TOMATO PLANTS HAVING FRUIT WITH YELLOW AND RED SEGMENTS

20190021251 ยท 2019-01-24

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided are tomato plants having fruit with red and yellow segments that appear across the fruit from the internal seed area to the most external layer of the epidermis. The present invention discloses that this phenotype, designated Arlecchino, is linked to insertion mutation within the Phytoene synthase 1 (Psy1) gene.

Claims

1.-42. (canceled)

43. A tomato cultivar producing fruit having an Arlecchino phenotype of yellow-red segments spanning from the placenta and/or locules across the fruit pericarp to the epidermis, wherein the phenotype is linked to at least one allele of r.sup.arl, the r.sup.arl allele is Phytoene synthase 1 (Psy1) allele comprising an insertion within an intron of the allele, wherein the insertion results in a non-functional splice variant of Psy1.

44. The tomato cultivar of claim 43, wherein cells of the yellow segments are homozygous for the r.sup.arl allele.

45. The tomato cultivar of claim 43, wherein the insertion comprises a transposon flanked by a nucleic acid sequence selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2 at the transposon 3 end.

46. The tomato cultivar of claim 45, wherein the transposon comprises a nucleic acid sequence at least 90% homologous to the nucleic acid sequence set forth in SEQ ID NO:3.

47. The tomato cultivar of claim 43, wherein the insertion within the Psy1 allele comprises a nucleic acid sequence at least 90% homologous to the nucleic acid sequence set forth in SEQ ID NO:4.

48. The tomato cultivar of claim 46, wherein the r.sup.arl allele comprises the nucleic acid sequence set forth in SEQ ID NO:5.

49. The tomato cultivar of claim 43, wherein the tomato cultivar comprises at least one pericarp cell homozygous for the r.sup.arl allele and at least one pericarp cell comprising at least one wild type Psy1 allele or at least one Psy1 allele comprising transposon excision footprint.

50. The tomato cultivar of claim 49, wherein the transposon excision footprint comprises at least one nucleotide deletion within the nucleic acid sequence set forth in SEQ ID NO:7.

51. The tomato cultivar of claim 43, said cultivar produces small cherry fruit.

52. The tomato cultivar claim 43, said cultivar further comprises within its genome additional Psy1 mutant allele encoding for a yellow flesh phenotype.

53. The tomato cultivar of claim 52, wherein cells of the yellow segments comprise one r.sup.arl allele and one Psy1 mutant allele encoding for the yellow flesh phenotype and the red segments comprise wild type Psy1 allele, Psy1 allele comprising transposon excision footprint or a combination thereof.

54. A seed of the tomato cultivar of claim 43, wherein a plant grown from the seed produces fruit having a phenotype of yellow-red segments spanning from the placenta and/or locules across the fruit pericarp to the epidermis, wherein the phenotype is linked to at least one allele of r.sup.arl, the r.sup.arl allele is Phytoene synthase 1 (Psy1) allele comprising an insertion within an intron of the allele, wherein the insertion results in a non-functional splice variant of Psy1.

55. A plant part of the tomato cultivar of claim 43, the plant part is selected from the group consisting of leaves, embryos, roots, root tips, anthers, flowers, isolated cells, isolated tissues and any part thereof.

56. A tomato fruit having a phenotype of yellow-red segments spanning from the placenta and/or locules across the fruit pericarp to the epidermis, wherein the phenotype is linked to at least one allele of r.sup.arl in a cultivated tomato plant producing the fruit, the r.sup.arl allele is Phytoene synthase 1 (Psy1) allele comprising an insertion within an intron of the allele, wherein the insertion results in a non-functional splice variant of Psy1, and wherein cells of the yellow segments are homozygous for the r.sup.arl allele.

57. A method for producing a tomato cultivar producing fruit having an Arlecchino phenotype of yellow-red segments spanning from the placenta and/or locules across the fruit pericarp to the epidermis, the method comprising introducing into a tomato cultivar producing red fruit or a part thereof a genetic element comprising allele of Phytoene synthase 1, the r.sup.arl allele comprises an insertion within an intron of the allele, wherein the insertion results in a non-functional splice variant of Psy1.

58. The method of claim 57, wherein the genetic element is introduced by crossing the tomato cultivar producing red fruit with a donor tomato plant comprising the genetic element to provide offspring cultivated tomato plants.

59. The method of claim 58, said method further comprises the steps of: a. examining a nucleic acid sample obtained from each offspring cultivated tomato plant or par thereof for the presence of r.sup.arl allele; b. selecting offspring cultivated tomato plants comprising the r.sup.arl allele; and c. examining the fruit produced by the plants selected in step (b) and electing cultivated tomato plants producing fruit with Arlecchino phenotype.

60. The method of claim 57, wherein the genetic element is introduced by transforming a plurality of cells of the tomato cultivar producing red fruit with said genetic element.

61. The method of claim 60, said method further comprises: a. examining a nucleic acid sample obtained from each transformed cell for the presence of r.sup.arl allele; b. selecting a plurality of cells comprising the r.sup.arl allele; c. regenerating the plurality of transformed cells to obtain a plurality of transgenic plants comprising the r.sup.arl allele; and d. examining the fruit produced by the transgenic plant and selecting plant producing fruit having the Arlecchino phenotype.

62. The method of claim 59, wherein examining the nucleic acid sample for the presence of the r.sup.arl allele is performed by amplifying at least one of an r.sup.arl allele marker comprising the nucleic acid sequence set forth in SEQ ID NO:7; a transposon sequence having the nucleic acids sequence set forth in SEQ ID NO:3; the 3 genomic junction of a transposon insertion within the Psy1 allele; and the 5 genomic junction of a transposon insertion within the Psy1 allele.

63. A method for producing a tomato cultivar producing fruit having an Arlecchino phenotype of yellow-red segments spanning from the placenta and/or locules across the fruit pericarp to the epidermis, the method comprises mutating at least one allele of Phytoene synthase 1 by an insertion mutation.

64. The method of claim 63, wherein the insertion is within an intron resulting in a non-functional Psy1 allele.

65. The method of claim 64, wherein the insertion is of a transposon.

66. An isolated polynucleotide encoding a mutated Phytoene synthase 1 comprising the nucleic acids sequence as set forth in SEQ ID NO:5.

67. The method of claim 61, wherein examining the nucleic acid sample for the presence of the r.sup.arl allele is performed by amplifying at least one of an r.sup.arl allele marker comprising the nucleic acid sequence set forth in SEQ ID NO:7; a transposon sequence having the nucleic acids sequence set forth in SEQ ID NO:3; the 3 genomic junction of a transposon insertion within the Psy1 allele; and the 5 genomic junction of a transposon insertion within the Psy1 allele.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0061] FIG. 1 shows the construction of the Solanum pimpinelltfolium (Sp) LA1589 backcross inbred line (BIL) population and the production of the Arlecchino mutation detected only in a single plant in the BIL#112 family in the year 2010.

[0062] FIG. 2 shows the Arlecchino mutation phenotype in different genetic background showing whole fruit (A) and transverse sections (B).

[0063] FIG. 3 demonstrates the segregation of fruit color traits in two independent F2 populations resulting from crosses of BIL#112 showing the Arlecchino phenotype and wild type red tomato lines.

[0064] FIG. 4 shows the carotenoid concentration (g/g Fresh Weight) in fruit samples of red (r) and yellow (y) sectors of Arlecchino compared with wild type (M82) and the yellow-flesh mutant r3756.

[0065] FIG. 5 demonstrates the nucleotide sequence differences in the transposon insertion/excision site within the Psy1 gene in red and yellow sections of Arlecchino fruit. Yellow sections were homozygous for the flanking repeats whereas red sections were heterozygous to this sequence because the transposon was excised from one allele.

[0066] FIG. 6 is a schematic demonstration of the amplified segments of Psy1 transcripts obtained from different color sections of Arlecchino fruit.

[0067] FIG. 7 is a schematic demonstration of the transposon and flanked nucleic acid insertion within the Psy1 gene (FIG. 7A) and of the amplified Arlecchino marker (FIG. 7B).

[0068] FIG. 8 shows the nucleic acids sequence of the r.sup.arl allele (SEQ ID NO:5). Upper case letters indicate sequences of tomato wild type Psy1 gene, with exons marked in bold letters. Small case letters indicate the Arlecchino intron sequence and the flanked nucleotide insertion is boxed.

DETAILED DESCRIPTION OF THE INVENTION

[0069] The present invention provides tomato cultivars producing fruit having the appealing appearance of red and yellow stripes or segments that span across all the edible part of the fruitfrom the inner seed area and up to the most external layer of the exocarp (fruit skin), through the mesocrap and endocarp. The present invention further discloses for the first time the genetic configuration which is linked to this appearance, designated herein Arlecchino.

Definitions

[0070] The term plant is used herein in its broadest sense. It also refers to a plurality of plant cells that are largely differentiated into a structure that is present at any stage of a plant's development. Such structures include, but are not limited to, a root, stem, shoot, leaf, flower, petal, fruit, etc. As used herein, the term plant part typically refers to a part of a tomato plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which tomato plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.

[0071] The term pericarp as is known in the art refers to the wall of a matured ovary. Specifically, tomato fruit pericarp refers to the fruit wall, which surrounds the seeds and placenta. The term pericarp includes the exocarp, mesocarp and endocarp as well as the radial pericarp.

[0072] The term gene, as used herein, refers to a hereditary unit consisting of a sequence of DNA that occupies a specific location on a chromosome and that contains the genetic instruction for a particular characteristics or trait in an organism. The term gene thus refers to a nucleic acid (e.g., DNA or RNA) sequence that comprises coding sequences necessary for the production of RNA or a polypeptide or its precursor. A functional polypeptide can be encoded by a full-length coding sequence or by any part thereof as long as the desired activity or functional properties (for example, enzymatic activity, ligand binding, signal transduction, etc.) of the polypeptide are retained. The term parts thereof when used in reference to a gene refers to fragments of that gene. The fragments may range in size from a few nucleotides to the entire gene sequence minus one nucleotide. Thus, a nucleic acid sequence comprising at least a part of a gene may comprise fragments of the gene or the entire gene. The term gene encompasses both cDNA and genomic forms of a gene.

[0073] The term gene also encompasses the coding regions of a structural gene and includes sequences located adjacent to the coding region on both the 5 and 3 ends for a distance of about 1 kb on either end such that the gene corresponds to the length of the full-length mRNA. The sequences which are located 5 of the coding region and which are present on the mRNA are referred to as 5 non-translated sequences. The sequences which are located 3 or downstream of the coding region and which are present on the mRNA are referred to as 3 non-translated sequences.

[0074] As sued herein, the term allele refers to alternative or a variant form of a gene or of any kind of identifiable genetic element, which are alternative in inheritance because they are situated at the same locus in homologous chromosomes. Such alternative or variant forms may be the result of single nucleotide polymorphisms, insertions, inversions, translocations or deletions, or the consequence of gene regulation caused by, for example, chemical or structural modification, transcription regulation or post-translational modification/regulation. In a diploid cell or organism, the two alleles of a given gene or genetic element typically occupy corresponding loci on a pair of homologous chromosomes.

[0075] As used herein, the terms r.sup.arl allele or r.sup.arl allele of Psy1 are used herein interchangeably and refer to a Phytoene synthase 1 allele comprising an insertion within intron of the allele, wherein the insertion results in a non-functional splice variant of Psy1. According to certain exemplary embodiments, the terms refer to the nucleic acid sequence set forth in SEQ ID NO:5.

[0076] The term genotype as used herein refers to the genetic constitution of a cell or organism. As is known in the art, a genotype can relate to a single locus or to multiple loci, whether the loci are related or unrelated and/or are linked or unlinked. In some embodiments, an individual's genotype relates to one or more genes that are related in that the one or more of the genes are involved in the expression of a phenotype of interest (e.g. color trait as defined herein). Thus, in some embodiments a genotype comprises a summary of one or more alleles present within an individual at one or more genetic loci.

[0077] The term phenotype as used herein refers to the appearance or other detectable characteristic of an individual, in particular individual plant. According to certain embodiments, the phenotype results from the plant genotype. According to additional embodiments, the phenotype results from the interaction of its genome, proteome and/or metabolome with the environment.

[0078] The terms segment, section and their plurality forms are used herein interchangeably and refer to area of the tomato fruit which is either yellow or red in color, forming the red-yellow phenotype of Arlecchino.

[0079] As used herein, the term breeding, and grammatical variants thereof, refer to any process that generates a progeny individual. Breeding can be sexual or asexual, or any combination thereof. Exemplary non-limiting types of breeding include crossings, selfing, doubled haploid derivative generation, and combinations thereof.

[0080] As used herein the term selfing refers to a controlled self-pollination of a plant, i.e. contacting pollen and ovule produced by the same plant. The term crossing refers to controlled cross-pollination, i.e. contacting pollen and ovule each produced by a different plant.

[0081] The term donor, as used herein, refers to the plant or plant line from which the trait, introgression or genomic segment originates, and which donor may have the trait, introgression or genomic segment either heterozygous or homozygous.

[0082] The term recipient, as used herein, refers to the plant or plant line receiving the trait, introgression or genomic segment from a donor, and which recipient may or may not have the trait, introgression or genomic segment itself either heterozygous or homozygous.

[0083] The term offspring as used herein refers to any plant resulting as progeny from a vegetative or sexual reproduction from one or more parent plants or descendants thereof. For instance an offspring plant can be obtained by cloning or selfing of a parent plant or by crossing two parent plants and include selfing as well as the F1 or F2 or still further generations. An F1 is a first-generation offspring produced from parents at least one of which is used for the first time as donor of a trait, while offspring of second generation (F2) or subsequent generations (F3, F4, and the like) are specimens produced from selfing of F1 s, F2s and the like. An F1 can thus be (and in some embodiments is) a hybrid resulting from a cross between two true breeding parents (true-breeding is homozygous for a trait), while an F2 can be (and in some embodiments is) an offspring resulting from self-pollination of the F1 hybrids.

[0084] As used herein, the term hybrid refers to any offspring of a cross between two genetically unlike individuals, including but not limited to the cross between two inbred lines.

[0085] As used herein, the term inbred means a substantially homozygous individual plant or plant line.

[0086] As used herein, the term backcross, and grammatical variants thereof, refers to a process in which a breeder crosses a hybrid progeny back to one of the parents, for example, a first generation hybrid F1 with one of the parental genotypes of the F1 hybrid. In some embodiments, a backcross is performed repeatedly, with a progeny individual of one backcross being itself backcrossed to the same parental genotype.

[0087] A cultivated tomato plant or tomato cultivar or tomato cultivar plant is understood within the scope of the invention to refer to a plant of the Solanaceae clade Lycopersicon that is no longer in the natural state but has been developed by human care and for human use and/or consumption. Cultivated tomato plants or tomato cultivars or tomato cultivar plants are further understood to exclude those wild species which comprise the trait being subject of this invention as a natural trait and/or part of their natural genetics. Examples of tomatoes include Solanum lycopersicum (formally Lycopersicon esculentum), Solanum cerasiforme, Solanum cheesmanii, Solanum chilense, Solanum chmielewskii, Solanum hirsuturn, Solanum parviflorum, Solanum pennellii, Solanum peruvianum, or Solanum lycopersicoides. According to certain embodiments, the tomato cultivar is Solanum lycopersicum (taxonomy according to Peralta I et al. 2005 Northern Peru Systematic Botany 30(2):424-434.

[0088] The term heterozygous is used herein to refer to unlike alleles at one or more corresponding loci on homologous chromosomes.

[0089] The term homozygous is used herein to refer to like alleles at one or more corresponding loci on homologous chromosomes.

[0090] New appearances of tomato fruit that would be appealing to the customer are always desired. The sophisticated customer also requires that the fruit are firm, tasty, and have reasonable shelf live. The tomato grower is looking for a plant that is resistant to biotic and abiotic stress and produces high yield. Understanding the genetic inheritance rules in plants and the fast development of molecular genetics tools during the past decades facilitates the production of superior agricultural crops in general and tomato plants in particular.

[0091] In the course of studying the phenotype-genotype relationship in a population of tomato backcross inbred lines (BILs) produced on a background of a population with artificially induced mutations the inventors have unexpectedly produced a tomato plant having fruit with alternate yellow and red segments. This phenotype has been designated as Arlecchino. In contrast to hitherto known fruit showing similar external fruit phenotype, the colored segments of Arlecchino were not restricted to the epidermis and/or outer layers of the fruit pericarp, but spanned from within the fruit (including the placenta and/or locules) across the pericarp and up to the most external epidermis layer (FIG. 2).

[0092] The color of the fruit as indicated herein refers to the color of ripening fruit at the breaker stage and up to a fully ripe or mature fruit. At the breaker stage there is a definite break of color from green to tannish-yellow, pink or red on the tomato fruit surface. The term mature as used herein means that the contents of two or more seed cavities have developed a jellylike consistency and the seeds are well developed. The Arlecchino phenotype is easily detected visually.

[0093] Tomato fruit is classified as a fleshy berry. As a true fruit, it develops from the ovary of the plant after fertilization. Tomato fruit can be either bilocular or multilocular. Most cultivated varieties except cherry tomatoes have two to five locules. The locules are surrounded by the pericarp. The pericarp includes the inner wall, columella; the radial wall, septa; and the outer wall (epidermis). The pericarp and the placenta comprise the fleshy tissue of the tomato. The seeds are located inside of the locular cavities and are enclosed in gelatinous membranes. There are vascular bundles throughout the outer wall of the pericarp and travelling from the stem to the center of the tomato and from there radiating to each seed.

[0094] The BILs population from which the Arlecchino mutated phenotype was isolated was constructed from a cross between the small red-fruited, self-compatible, wild accession of Solanum pimpinellifolium LA1589 and the S. lycopersicum processing-tomato, inbred variety, cv. E6203 (TA209). Without wishing to be bound by any specific theory or mechanism of action, the Arlecchino mutation may be the results of a genomic shock resulting from wide crosses.

[0095] One of the factors characterizing mutagens is that changes in the DNA are created via a variety of molecular mechanisms and thus the repertoire of the mutations obtained can vary dramatically among different mutagens (transitions, transversions, deletions or additions). Another known force that induces mutations results from the creation of interspecific populations by the crossing of evolutionary divergent types. Merging of divergent genomes can create a genomic shock, a process described by McClintock (1984. Science 226:792-801). Despite intensive research, the molecular mechanisms that affect a genomic shock are not well characterized. However, it has been reported that the introgression of alien genomic segment into a divergent background can trigger genetic changes and mutations. This phenomenon has been previously described, a detailed work executed in wheat being an example (Shaked et al., 2001. Plant Cell 13:1749-1759). Shaked et al. have shown that upon the synthesis of new wheat allotetraploids events such as gene loss, gene silencing and activation are rather common. In wheat, interspecific hybridization followed by chromosome doubling leads to rapid, genetic and epigenetic changes, where retrotransposons appear to be the principal actors when their activity is activated by the genomic shock (Shaked et al., 2001, ibid; Ozkan et al., 2001. Plant Cell 13:1735-1747; Kashkush et al., 2003. Nat. Genet. 33:102-106).

[0096] Further breeding of the isolated Arlecchino-phenotype plant provided for the tomato plants of the present invention, which are cultivar tomato plants suitable for commercial growth.

[0097] The present invention further discloses the linkage between the Arlecchino phenotype and the presence of transposon insertion in at least one allele of the Phytoene synthase 1 (Psy1) gene. It is to be explicitly understood that the presence of the r.sup.arl allele is obligatory for the Arlecchino phenotype, but may not be the only factor responsible for its appearance.

[0098] Sequencing the area of the initially observed insertion of the 9 base pairs (SEQ ID NO:1) within the Psy1 gene pointed to the presence of a direct repeat of the nucleic acid sequence TCTGGATA (SEQ ID NO:2). Insertion of transposons into a plant genome is typically characterized by the formation of sequence duplication in direct orientation at the place of insertion. As exemplified hereinbelow, the inventors of the present invention have discovered that the Arlecchino phenotype is indeed a result of transposon insertion in cells forming the fruit yellow sections. The insertion is within intron 8 of the Psy1 gene (according to the Psy1 sequence shown in FIG. 8) resulting in splice variants missing the last exon (exon 9) of Psy1 such that translation of a functional protein is impaired. The red sections cells comprise either wild type Psy1 alleles and/or cells in which the transposon has been excised without negatively affecting the gene transcription, enabling the translation of functional Phytoene synthase 1.

[0099] The present invention thus provides a tomato cultivar which produces fruit having an Arlecchino phenotype of yellow-red segments spanning from the placenta and/or locules across the fruit pericarp to the epidermis, wherein the phenotype is linked to at least one allele of r.sup.arl, the r.sup.arl allele is Phytoene synthase 1 (Psy1) allele comprising an insertion within an intron of the allele, wherein the insertion results in a non-functional splice variant of Psy1.

[0100] According to certain embodiments, cells of the yellow segments of the Arlecchino fruit are homozygous for the r.sup.arl allele.

[0101] According to certain embodiments, the insertion comprises a transposon flanked by the nucleic acid sequence TCTGGATA (SEQ ID NO:2) at the transposon 3 end. According to additional embodiments, the insertion comprises a transposon flanked by the nucleic acid sequence ATCTGGATA (SEQ ID NO:1) at the transposon 3 end.

[0102] According to certain embodiments, the transposon belongs to the hAT family. According to some embodiments, the transposon comprises a nucleic acid sequence at least According to these embodiments, the transposon comprises a nucleic acids sequence at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% homologous to SEQ ID NO:3. Each possibility represents a separate embodiment of the present invention.

[0103] According to additional exemplary embodiments, the transposon consists of the nucleic acid sequence set forth in SEQ ID NO:3.

[0104] According to certain exemplary embodiments, the insertion within the Psy1 gene comprises a nucleic acid sequence at least 95%, at least 96%, at least 97%, at least 98%, at least 98% or at least 99% homologous to the nucleic acid sequence set forth in SEQ ID NO:4. According to certain exemplary embodiments, the insertion within the Psy1 gene comprises the nucleic acid sequence set forth in SEQ ID NO:4.

[0105] According to certain embodiments, the r.sup.arl allele of Psy1 comprises the nucleic acid sequence set forth in SEQ ID NO:5.

[0106] The present invention further provides methods for producing tomato cultivars having the Arlecchino phenotype, plants so produced and parts thereof.

[0107] According to a certain aspect, the present invention provides a method for producing a tomato cultivar producing fruit having an Arlecchino phenotype of yellow-red segments spanning from the placenta and/or locules across the fruit pericarp to the epidermis, the method comprising introducing into a tomato cultivar producing red fruit or a part thereof a genetic element comprising r.sup.arl allele of Phytoene synthase 1, the r.sup.arl allele comprises an insertion within an intron of the allele, wherein the insertion results in a non-functional splice variant of Psy1.

[0108] Introduction of the genetic element into the genome of a selected tomato cultivar can be performed using any method as is known in the art.

[0109] Plant breeders and in particular seed companies use elite breeding lines, generally referred to as elite lines to provide a constant quality product. The elite lines are the result of intensive inbreeding and combine multiple superior characteristics such as high yield, fruit quality, resistance to pests and diseases, and tolerance to abiotic stress. The average yield of these elite lines is generally much higher than the original wild accessions from which many of the modern tomato varieties are descendants. The elite lines can be used directly as crop plant, but are typically used to produce so-called F1 or single-cross hybrids, produced by a cross between two (homozygous or inbred) elite lines. The F1 hybrids thus combine the genetic properties of the two parents into a single plant. An additional benefit of hybrids is that they express hybrid vigor or heterosis, the phenomenon that hybrid plants grow better than either (inbred) parent and show higher yields.

[0110] Backcross or pedigree selection is one method by which breeders add desirable agronomic traits to their elite breeding lines. The method involves crossing the breeding line with a line that expresses the desirable trait followed by backcrossing offspring plants expressing the trait to the recurrent parent. As a result, the selection of an individual as a parent in a breeding program is based on the performance of its forebears. Such methods are most effective in breeding for qualitatively-inherited traits, i.e. traits which are present or absent.

[0111] Recurrent selection is an alternative breeding method for improving breeding lines and involves systematic testing and selection of desirable progeny followed by recombination of the selected individuals to form a new population. Recurrent selection has proven effective for improving quantitative traits in crop plants. Recurrent selection, however, decreases the rate of broadening genetic basis underlying the various traits in a breeding program, and its potential is therefore limited.

[0112] As disclosed herein, tomato plants producing yellow-red bicolor fruit can be produced by introducing a genetic element comprising r.sup.arl allele of Phytoene synthase 1, into an elite breeding line.

[0113] Introducing the r.sup.arl allele can be performed by plant breeding, i.e. by crossing a donor plant comprising the r.sup.arl allele with a recipient plant, preferably an elite cultivar tomato plant not comprising the r.sup.arl allele.

[0114] Alternatively, a nucleic acid, preferably DNA, comprising the r.sup.arl allele may be isolated by any method known in the art and introduced into the genome of a tomato plant producing red fruit.

[0115] Transforming plants with isolated nucleic acid sequence generally involves the construction of an expression vector that will function in plant cells. According to the teachings of the present invention, such a vector comprises a nucleic acid sequence that comprises the r.sup.arl allele. Typically, the vector comprises the r.sup.arl allele under control of or operatively linked to a regulatory element. According to certain embodiments, the regulatory element is selected from the group consisting of a promoter, an enhancer and a translation termination sequence. The expression vector may contain one or more such operably linked gene/alleles/regulatory element combinations, provided that at least one of the alleles contained in the combinations comprises the r.sup.arl allele. The vector(s) may be in the form of a plasmid, and can be used, alone or in combination with other plasmids, in a method for producing transgenic plants that produce fruit with the Arlecchino phenotype, using transformation methods known in the art to be suitable for transforming nucleic acid sequences into tomato (dicotyledonous) plants.

[0116] Expression vectors can include at least one marker (reporter) gene, operably linked to a regulatory element (such as a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (by inhibiting the growth of cells that do not contain the selectable marker gene), or by positive selection (by screening for the product encoded by the markers gene). Many commonly used selectable marker genes for plant transformation are known in the art, and include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or a herbicide, or genes that encode an altered target which is insensitive to the inhibitor. Several positive selection methods are known in the art, such as mannose selection. Alternatively, marker-less transformation can be used to obtain plants without mentioned marker genes, the techniques for which are known in the art.

[0117] Methods for transforming a plant cell with nucleic acids sequences according to the present invention are known in the art. As used herein the term transformation or transforming describes a process by which a foreign nucleic acid sequence, such as a vector, enters and changes a recipient cell into a transformed, genetically modified or transgenic cell. Transformation may be stable, wherein the nucleic acid sequence is integrated into the plant genome and as such represents a stable and inherited trait, or transient, wherein the nucleic acid sequence is expressed by the cell transformed but is not integrated into the genome, and as such represents a transient trait. According to typical embodiments the nucleic acid sequence of the present invention is stably transformed into a plant cell.

[0118] There are various methods of introducing foreign genes into both monocotyledonous and dicotyledonous plants (for example, Potrykus I. 1991. Annu Rev Plant Physiol Plant Mol Biol 42:205-225; Shimamoto K et al., 1989. Nature 338:274-276).

[0119] The principal methods of the stable integration of exogenous DNA into plant genomic DNA includes two main approaches:

[0120] Agrobacterium-mediated gene transfer: The Agrobacterium-mediated system includes the use of plasmid vectors that contain defined DNA segments which integrate into the plant genomic DNA. Methods of inoculation of the plant tissue vary depending upon the plant species and the Agrobacterium delivery system. A widely used approach is the leaf-disc procedure, which can be performed with any tissue explant that provides a good source for initiation of whole-plant differentiation (Horsch et al., 1988. Plant Molecular Biology Manual A5, 1-9, Kluwer Academic Publishers, Dordrecht). A supplementary approach employs the Agrobacterium delivery system in combination with vacuum infiltration. Agrobacterium mediated transformation protocols for tomato plants are known to a person skilled in the art.

[0121] Direct nucleic acid transfer: There are various methods of direct nucleic acid transfer into plant cells. In electroporation, protoplasts are briefly exposed to a strong electric field, opening up mini-pores to allow DNA to enter. In microinjection, the nucleic acid is mechanically injected directly into the cells using micropipettes. In microparticle bombardment, the nucleic acid is adsorbed on microprojectiles such as magnesium sulfate crystals or tungsten particles, and the microprojectiles are physically accelerated into cells or plant tissues. Another method for introducing nucleic acids to plants is via the sonication of target cells. Alternatively, liposome or spheroplast fusion has been used to introduce expression vectors into plants.

[0122] Following transformation of tomato target tissues, expression of the above described selectable marker genes allows for preferential selection of transformed cells, tissues and/or plants, using regeneration and selection methods now well known in the art.

[0123] According to certain embodiments, the present invention provides a method for producing tomato plants with Arlecchino phenotype, comprising the steps of: [0124] (a) introducing a genetic element comprising the r.sup.arl allele from a donor tomato plant comprising the genetic element into a recipient tomato cultivar, preferably an elite cultivar to provide offspring cultivated tomato plants; [0125] (b) examining a nucleic acid sample obtained from each offspring cultivated tomato plants for the presence of r.sup.arl allele; and [0126] (c) selecting cultivated tomato plants comprising said r.sup.arl allele.

[0127] This method can be defined as marker assisted selection as the selection of the desired Arlecchino phenotype is performed using nucleic acid markers specific for the Arlecchino genotype. Since the Arlecchino phenotype can only be properly identified phenotypically when the plant has produced fruit, it is of particular advantage that the establishment of proper introgression of the genetic element in offspring plants may be monitored by using the gene specific markers.

[0128] Introducing the genetic element comprising the r.sup.arl allele of Psy1 into a recipient plant can be performed by any method as described hereinabove and is known in the art.

[0129] Any method for obtaining a genetic material from the offspring tomato cultivar and any suitable molecular marker as are known in the art can be used for selecting Arlecchino genotype according to the teachings of the present invention.

[0130] As used herein, the terms molecular marker or molecular markers refer to a molecular indicator that is used in methods for visualizing differences in characteristics of nucleic acid sequences. Examples of such indicators are diversity array technology (DArT) markers, restriction fragment length polymorphism (RFLP) markers, amplified fragment length polymorphism (AFLP) markers, single nucleotide polymorphisms (SNPs), sequence-characterized amplified regions (SCARs), cleaved amplified polymorphic sequence (CAPS) markers, sequence-characterized hybridization markers; or any combination thereof. According to certain exemplary embodiments, the step of examining a nucleic acid sample obtained from each offspring cultivated tomato plants for the presence of r.sup.arl allele comprise the use of a set of bi-directional primers. Bi-directional means that the orientation of the primers is such that one functions as the forward and one as the reverse primer in an amplification reaction of nucleic acid. The bi-directional primers are typically used in an amplification reaction on genomic DNA that amplifies a unique nucleic acid sequence of the r.sup.arl allele of Psy1 or a marker thereof but that does not amplify the wild type Psy1 allele. According to certain embodiments, the pair of primers is designed to amplify an r.sup.arl allele marker comprising the nucleic acid sequence set forth in SEQ ID NO:7 (TCTGGATAATCTGGATA).

[0131] According to certain exemplary embodiments, the r.sup.arl allele marker is amplified by a pair of primer comprising the nucleic acid sequence set forth in SEQ ID NO:10 (CAGTGCCAGAAGAGGAAGA) and SEQ ID NO:11 (TTGCGGTACAAGACCAAAGA).

[0132] According to additional embodiments, the pair of primers is designed to amplify the full length transposon insertion. According to certain exemplary embodiments, the transposon is amplified by a pair of primer comprising the nucleic acid sequence set forth in SEQ ID NO:12 (GTGGATCCTGAAATGGCTTG) and SEQ ID NO:13 (AGTACTAATAAAATGGTTTTGCC).

[0133] According to yet additional embodiments, the pair of primers is designed to amplify the 3 genomic junction of the transposon insertion within the Psy1 allele. According to certain exemplary embodiments, the 3 transposon insertion junction is amplified by a pair of primer comprising the nucleic acid sequence set forth in SEQ ID NO:14 (GGGCTAGTCGGTGTATCAT) and SEQ ID NO:11 (TTGCGGTACAAGACCAAAGA).

[0134] According to yet further embodiments, the pair of primers is designed to amplify the 5 genomic junction of the transposon insertion within the Psy1 allele. According to certain exemplary embodiments, the 5 transposon insertion junction is amplified by a pair of primer comprising the nucleic acid sequence set forth in SEQ ID NO:15 (CTGGAAGGGTGACCGATAAA) and SEQ ID NO:16 (ATGATACACCGACTAGCCC).

[0135] Additionally or alternatively, the markers are sequence specific probes that specifically hybridize under stringent conditions to the r.sup.arl allele of Psy1 but not to its wild type allele, and that can be detected thereafter by various methods as are well to a person skilled in the art.

[0136] Nevertheless, it is to be explicitly understood that the method aspects of the invention are not limited to the use of the markers identified herein, and that methods of the present invention may also make use of markers not explicitly disclosed herein or even yet to be identified, as identifying and using such markers is well within the skills of a person with knowledge in the Art.

[0137] In an additional or alternative method, the offspring cultivated tomato plants are phenotypically examined for the Arlecchino appearance as exemplifies hereinbelow. According to these embodiments, the offspring plants are grown to produce fruit and the fruit are examined for the presence of red and yellow sections throughout the fruit (the Arlecchino phenotype).

[0138] According to certain embodiments, the cultivar tomato plant having fruit with Arlecchino phenotype is an inbred plant. According to other embodiments, the cultivar tomato plant having fruit with Arlecchino phenotype is a hybrid plant. The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.

Examples

Example 1: Whole Genome Backcross Inbred Lines (BILs)

[0139] The Solanum pimpinellifolium BILs were constructed from a cross between a small red-fruited self-compatible accession of the wild species Solanum pimpinellifolium (designated LA1589) and the processing-tomato, inbred variety, cv. E6203 (TA209) (S. lycopersicum) (Grandillo S and Tanksley S D. 1996. Theor. Appl. Genet. 92: 935-951). During the construction of BIL from both species, early generations were evaluated for yield associated traits, as a part of the advanced backcross (AB) QTL studies (reviewed by Grandillo S et al., 2007. Theor. Appl. Genet. 92: 935-951) and also for various morphological traits and biochemical properties. The S. pimpinellifolium BILs are composed from 178 lines and the genetic map of this resource was constructed from 4008, genome anchored, SNP markers that were found to be polymorphic between the wild species S. pimpinellifolium and the recurrent parent cv. E6203. The markers were divided into 873 bins with an average length of 0.87 Mbp/bin and composed an average of 4.59 SNPs/bin. Each of the bins showed a unique pattern of segregation, enabling the calculation of map distance in cM between pairs of neighboring bins. The calculated map is 1174.1 cM long and covers 100% of the wild species genome where the longest linkage group represents chromosome 3 (129.5 cM) and the shortest represents chromosome 6 (60.2 cM).

Example 2: The Arlecchino Mutation

[0140] The creation of the interspecific BIL population from Solanum pimpinellifolium and Solanum lycopersicum resulted in de novo formation of mutations within the BIL population. A single plant having an unstable fruit color phenotype was identified in BIL#112. The plant was produced during the year of 2010 (within the BC2self10 generation, FIG. 1 and the observed phenotype has not been detected previously in the various variety collections.

[0141] This unique mutant was characterized by parallel color bands of yellow and red, which paint the fruit longitudinally on the external epidermis (FIG. 2A) but importantly extends into the flesh (pericarp), seeds jelly and placenta (FIG. 2B). Hitherto, many mutations resulting in yellow tomato fruit have been identified; however, none of the mutations show yellow-red stripes or segments throughout the fruit cross, disclosed herein for the first time. Another characteristic of this mutant is that there is no observable phenotypic effect on fruit epidermis color in the immature green stage and only upon maturity the phenotype is revealed. The mutation phenotype has been assigned the name Arlecchino. The first Arlecchino phenotype discovered in 2010 was unstable along the plant and the inflorescence, particularly in that complete red fruit were observed together with Arlecchino fruit on the same plant.

[0142] The mode of inheritance of the Arlecchino phenotype was examined by crossing the plant identified in the BIL #112 with its parent cv. E6203 (TA209) and other wild type Solanum lycopersicum cultivars as compared to self-cross. The F1 hybrid plants had only normal red fruit while the BIL #112 self-progeny showed the characteristic Arlecchino phenotype. These results indicate that the new mutation is recessive. In the F2 population derived from selfing the F1 hybrid, the following progeny was observed: 29 plants with red fruits; 9 plants with the Arlecchino phenotype; and 2 plants with completely yellow fruit (Total 40). Additional F2 population derived from an independent F1 hybrid produced 90 plants with complete red fruit; 22 with Arlecchino fruit; and 5 with complete yellow fruit (total of 117 plants) (FIG. 3). The number of Arlecchino+yellow out of the total population fits the 1:3 ratio suggesting a single Mendelian gene with variable penetrance and expressivity.

[0143] To further examine the mode of the trait segregation, F3 progeny was examined. The F3 progeny was formed from selfing 31 F2 plants having red (21 plants), Arlecchino (8 plants) and yellow (2 plants) fruit phenotype. About 40 plants of the F3 generation of each F2 cross (3140) were examined. The plants were phenotyped for fruit color and the genotype of the F2 plant was derived based on the progeny tested. The results indicate that 13 plants out of 21 red F2 plants segregated for the fruit phenotype at a ratio of 25% Arlecchino and 75% red (Table 1). The other eight red fruit F2 plants did not segregate in their F3 progeny meaning that all the F3 plants were red (the F3 of Plant 4853-26 showed only a single Arlecchino phenotype and thus it was assumed to be a contaminant and therefore this line was scored as homozygous; Table 1). The two yellow-phenotype F2 plants did not segregate and all the F3 progeny plants had completely yellow fruits. The 8 Arlecchino F2 plant did not show any consistent segregation ratio. All F3 progeny of line No. 4853-27 showed the Arlecchino phenotype, indicating this line as a stable Arlecchino parent.

TABLE-US-00001 TABLE 1 Summary of F3 Progeny Tests F2 Phenotype F3 Phenotype (Fruit Color) (Fruit Estimated Line Color) Red Arlecchino Yellow Total genotype 4583-1 Red 33 7 0 40 Heterozygous 4583-2 Arlecchino 14 16 0 30 4583-3 Red 15 0 0 15 Homozygous 4583-4 Red 40 0 0 40 Homozygous 4583-5 Arlecchino 22 7 0 29 45836 Red 28 8 0 36 Heterozygous 4583-7 Red 37 0 0 37 Homozygous 4583-8 Red 26 6 0 32 Heterozygous 4583-9 Red 22 0 0 22 Homozygous 4583-10 Red 30 9 0 39 Heterozygous 4583-11 Red 40 0 0 40 Homozygous 4583-12 Red 32 8 0 40 Heterozygous 4583-13 Red 14 7 0 21 Heterozygous 4583-14 Red 34 6 0 40 Heterozygous 4583-15 Yellow 0 0 40 40 4583-16 Red 30 10 0 40 Heterozygous 4583-17 Arlecchino 19 13 0 32 4583-18 Red 40 0 0 40 Homozygous 4583-19 Red 36 4 0 40 Heterozygous 4583-20 Red 22 8 0 30 Heterozygous 4583-21 Red 25 0 0 25 Homozygous 4583-22 Arlecchino 14 21 0 35 4583-23 Red 4583-24 Red 12 4 0 16 Heterozygous 4583-25 Yellow 0 0 35 35 4583-26 Red 32 1* 0 32 Homozygous 4583-27 Arlecchino 0 16 0 16 4583-28 Arlecchino 5 26 0 31 4583-29 Red 19 6 0 25 Heterozygous 4583-30 Red 4583-31 Red 24 11 0 35 Heterozygous 4583-32 Red 4583-33 Red 4583-34 Arlecchino 21 9 0 30 4583-35 Arlecchino 32 8 0 40 4583-36 Red 4583-37 Red 4583-38 Red 4583-39 Arlecchino 4583-40 Red

Example 3: Allelic Configuration of the Arlecchino Phenotype

[0144] The results described above indicated that the Arlecchino phenotype is recessively inherited as fruit of F1 plants derived from the cross of BIL#112 and TA209 and other wild type (WT) cultivars were found to be completely red. Phenotypic complementation was also found in F1 plants derived from crosses of BIL#112 to the tangerine mutation e3406m2 and the zeta mutation e2083m1. Only in crosses of plant having the Arlecchino phenotype two independent mutations having the phenotype yellow flesh (r/r; defective in the Phytoene synthase 1 gene (Psy1) showed lack of complementation and the fruit showed a mild stripped phenotype (Table 2). These results suggest that Arlecchino is possibly allelic to yellow flesh.

TABLE-US-00002 TABLE 2 Allelism tests of the Arlecchino phenotype E6203 e2083m1 (TA209) M82 e3756m2 LA2997 e3406m2 (zeta/ Line (R/R) (R/R) (r/r) (r/r) (t/t) zeta) BIL 112 Red Red Weak Weak Red Red Arlecchino Arlecchino Arlecchino

Example 4: Analysis of Carotenoid Content in Arlecchino-Phenotype Fruit

[0145] The carotenoid content within the red and yellow sections of ripe fruit having Arlecchino phenotype was examined and compared to the carotenoid content within red fruit of wild type tomato (M82) and yellow fruit of the yellow flesh variety e3756m2 (r/r; M82 EMS derivative). The carotenoids were extracted from the different section as described in Kachanovsky et al. (Kachanovsky D E et al., 2012. Proc. Natl. Acad. Sci. 109:19021-19026) and separated using high performance liquid chromatography (HPLC) using Waters 996 photodiode array detector (Ronen G et. al., 1999. Plant J 17:341-351). Red sections within the Arlecchino fruit have about 5 times higher total carotenoid content with a profile similar to wild type fruit while the yellow sections carotenoid content is significantly lower with a profile similar to the yellow flesh (e3756m2) mutant fruit (FIG. 4, Table 3).

TABLE-US-00003 TABLE 3 Carotenoid composition in red and yellow sections of ripe Arlecchino fruit (g/g fresh weight) Arlecchino Arlecchino Red section Yellow sections Phytoene 6.57 2.42 0.19 0.04 phytofluene 4.13 1.96 0.14 0.05 trans-Lycopene 7.96 7.18 1.46 0.88 -Carotene 2.79 1.06 0.29 0.99 Lutein 1.13 0.30 0.76 0.15 tri-cis--carotene 0.40 0.20 di-cis--carotene 0.42 0.20 Others 1.53 1.07 1.14 0.24 Total carotenoids 26.7 4.42 5.24 2.38

Example 5: Sequence Analysis of the Arlecchino-Phenotype Mutation

[0146] Carotenoids are 40-carbon isoprenoid pigments synthesized by all plants, algae and cyanobacteria as well as by several non-photosynthetic bacteria and fungi. The polyene chain of carotenoids may extend from 3 to 15 conjugated double bonds, which are responsible for the carotenoid characteristic absorption spectra and confer specific photochemical properties. The first committed step in the carotenoid pathway is the head to head condensation of two geranylgeranyl pyrophosphate (GGPP) molecules to produce phytoene, the first C40 carotenoid, catalyzed by the enzyme phytoene synthase (PSY). Initial DNA sequencing of Phytoene synthase 1 in the original BIL#112 Arlecchino phenotype plant revealed a 9 bp insertion in intron 8 (ATCTGGATA, SEQ ID NO:1) that was inserted after nucleotide 3338.

Initial Sequence Analysis of the Eight's Intron in Yellow and Red Sections of Arlecchino Fruit

[0147] The eight's intron of Psy1 was amplified by PCR from DNA samples obtained from red and yellow sections of fruit of Arlecchino phenotype and cloned into pGEM plasmid vector. Genomic DNA was extracted using a Genomic Plant DNA Purification Kit (Thermo). The intron was amplified using the primers listed in Table 4 below. E. coli cells were tranfected with pGEM plasmids carrying PCR products from yellow sectors or from red sectors. Seven E. coli colonies with pGEm clones from yellow tissue and 21 colonies with pGEM clones from the red tissues were tested. All DNA clones from yellow tissue showed the same sequence pattern of a duplication of the direct repeats of TCTGGATA (SEQ ID NO:2) separated by Adenine (A) nucleotide (SEQ ID NO:7) designated herein as the Arlecchino marker. The clones from the red tissues showed sequence variability amongst the colonies, with majority of the colonies containing transposon excision footprints while the rest of the colonies showing the same pattern as observed in the yellow colonies (FIG. 5). These results indicated a possibility of an excision of a transposon from one copy or by contamination of yellow cells in the red section.

TABLE-US-00004 TABLE4 PrimerpairfordetectingtheArlecchinomarker SEQ ID Primerdesignation Sequence NO. PrimerARL4forward 5-CAGTGCCAGAAGAGGAAGA-3 10 PrimerARL4reveres 5-TTGCGGTACAAGACCAAAGA-3 11
Determining the Complete Sequence of the r.sup.arl Allele

[0148] Initial PCR analysis confirmed the presence of the Arlecchino marker. PCR was conducted using READYMIX kit (Syntezza), 50-100 ng of genomic DNA, 0.4 M of the Forward and Reverse primers listed in Table 4 hereinabove. PCR was initiated using a denaturation step at 95 C. for 2 min, followed by 38 cycles of 45 s denaturation at 96 C., 30 s annealing at 58-60 C., and 90 s extension at 72 C., and finally 10 m extension at 72 C.

[0149] To sequence the full length of Psy1 transcript from Arlecchino red and yellow fruits sections, 3RACE was executed. RNA was extracted from yellow and red sectors of Arlecchino fruits by Thermo scientific GeneJET plant RNA purification Mini Kit #K0801. RNA was treated with Dnase I (New England BioLabs #M0303L) and then reverse transcribed by M-Mulv Reverse Transctiptase (New Englands BioLabs #M0253L) using an Oligo-dT-adaptor primer.

[0150] To amplify the Psy1 transcripts a PCR reaction was performed using a specific primer for Psy1 and an adaptor primer (Table 5).

TABLE-US-00005 TABLE5 Primersusedin3RACEassay SEQ ID Primerdescription Sequence NO. Oligo-dT-adaptor ctgtgaatgctgcgactacgatT 17 primer (X20) Adaptorprimer ctgtgaatgctgcgactacgat 18 Psy1specificprimer AACTTGTTGATGGCCCAAAC 19

[0151] Amplified Psy1 transcripts were cloned into pJET library (Thermo Scientific CloneJET PCR Cloning Kit).

[0152] Three spliced variants were detected in colonies obtained from Arlecchino fruit yellow sections, while in colonies obtained from red sections wild type transcript of Psy1 was detected in addition to the mutated transcripts. Two of the transcripts were found to be fused to a short part from the last intron and the third transcript was found to be fused to 400 bp sequence of a known hAT super-family transposon. In all three variants, the last exon (exon 9) was missing (FIG. 6).

[0153] Based on the above analysis, several primer pairs were designed (Table 6). Genomic DNA was extracted from young leaves or yellow fruit sections of plants having the Arlecchino phenotype using a Genomic Plant DNA Purification Kit (Thermo). PCR was conducted using a 50 ng-100 ng of genomic DNA, PCR buffer, 2.5 mM dNTPs, 0.2 M-0.3 M of the Forward and Reverse primers, and 0.5 units of PrimeSTAR GXL DNA Polymerase (Takara Bio). PCR was initiated using a denaturation step at 98 C. for 3 min, followed by 38 cycles of 10 seconds denaturation at 96 C., 15 seconds annealing at 55-60 C., and 180 seconds extension at 68 C., and finally 90 seconds extension at 68 C. These reactions enabled the amplification of the full length transposon as well of the area of the Psy1 adjacent to the intron, as described in FIG. 8.

TABLE-US-00006 TABLE6 Primerpairsfordetectingther.sup.arlallele SEQ Primer ID designation Sequence NO. Purpose PrimerARL1 5-GTGGATCCTGA 12 Amplificationof Forward AATGGCTTG-3 fulllengthof PrimerARL1 5-AGTACTAATAA 13 transposon Reverse AATGGTTTTGCC-3 PrimerARL2 5-GGGCTAGTCGG 14 Amplificationof Forward TGTATCAT-3 3genomic PrimerARL2 5-TTGCGGTACAA 11 junctionsof Reverse GACCAAAGA-3 thetransposon PrimerARL3 5-CTGGAAGGGTG 15 Amplificationof Forward ACCGATAAA-3 3genomic PrimerARL3 5-ATGATACACCG 16 junctionsof Reverse ACTAGCCC-3 thetransposon

Example 6: Sequence Analysis of Psy1 Transcript in Leaves and Fruit Yellow and Red Sections of Arlecchino Plants

[0154] Psy1 transcript was amplified from RNA extracted from Arlecchino red and yellow fruit sections and Arlecchino leaf tissue using three pairs of primers. Reaction I, aimed at amplifying a segment stretching from exon 7 to exon 8 was successful in all three RNA samples examined Reaction II and III, aimed at amplifying of a segment stretching from exon 7 to exon 8 and from exon 8 to exon 9, respectively, were successful only in samples containing RNA extracted from Arlecchino fruit red sections (Table 7). These results indicate that exon 9 is impaired in yellow and leaf tissue.

TABLE-US-00007 TABLE7 AmplificationofPsy1transcriptusingthree differentprimerpairs Area Forwardprimers: Reverseprimers: amplified Reaction Psy1_f2 Psy1-4rev Exon7- I AGCCATTCAGAGATAT ATCGGATAGACCTGCC Exon8 GATTGA TGTG (SEQIDNO:20) (SEQIDNO:21) Reaction psy1_f2 Psy1_r2 Exon7- II AGCCATTCAGAGATAT TTATCITTGAAGAGAG Exon9 GATTGA GCAGT (SEQIDNO:20) (SEQIDNO:22) Reaction ARL3 Psy1_r3 Exon8- III CTGGAAGGGTGACCGA GATAAAGTGAAGATAC Exon9 TAAA AACAAC (SEQIDNO:15) (SEQIDNO:23)

Example 7: The Arlecchino Transposon

[0155] Arlecchino transposon sequence was completed using the GXL polymerase and primers:

TABLE-US-00008 (SEQIDNO:12) ARL1Forward:GTGGATCCTGAAATGGCTTG; (SEQIDNO:13) ARL1Reveres:AGTACTAATAAAATGGTTTTGCC; and (SEQIDNO:16) ARL3Reveres:ATGATACACCGACTAGCCC.

[0156] The transposon comprises 3903 nucleic acids (SEQ ID NO:3) and with inverted repeats at the 5 and 3 ends providing for its insertion into Psy1 (FIG. 7).

[0157] Sequencing of the Arlecchino transposon showed that it contains an open reading frame similar to known transposases (such as in Tam3 from Antirrhinum majus) which contains a dimerization domain and a Zinc finger-DNA binding domain and thus is potentially an autonomous element (SEQ ID NO:24). The nucleic acids sequence of the Arlecchino Psy1 gene (SEQ ID NO:5) is presented in FIG. 8.

[0158] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.