STRAIN WITH IMPROVED AROMATIC AMINO ACID PRODUCTION CAPACITY BY ANSB GENE INACTIVATION

Abstract

Disclosed is a mutant strain having improved aromatic amino acid production capability as a result of the inactivation or weakening of activity of asparaginase which is expressed by ansB gene.

Claims

1. A mutant strain having improved aromatic amino acid production capability due to inactivation or weakening of activity of asparaginase which is expressed by asparaginase B (ansB) gene.

2. The mutant strain of claim 1, wherein the ansB gene consists of the nucleotide sequence of SEQ ID NO: 1.

3. The mutant strain of claim 1, wherein the aromatic amino acid is at least one of L-tryptophan and L-phenylalanine.

4. The mutant strain of claim 1, which the inactivation or weakening of activity of asparaginase is achieved by insertion, substitution or deletion of one or more nucleotides in the nucleotide sequence of the ansB gene.

5. The mutant strain of claim 1, which is derived from a strain of the genus Escherichia.

6. The mutant strain of claim 5, wherein the strain of the genus Escherichia is Escherichia coli.

7. A method for producing an aromatic amino acid, comprising steps of: culturing the mutant strain of claim 1 in a medium; and recovering an aromatic amino acid from the cultured mutant strain and the medium.

8. The method of claim 7, wherein the aromatic amino acid is at least one of L-tryptophan and L-phenylalanine.

Description

EXAMPLE 1

Construction of ansB Gene-Deleted Mutant Strains

[0027] ansB gene-inactivated mutant strains were constructed from parent strains (accession numbers: KFCC11660P and KCCM10016) by a one-step inactivation method (One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products, Datsenko K A, Wanner B L., Proc Natl Acad Sci U.S.A. 2000 Jun. 6; 97 (12): 6640-5).

[0028] The KFCC11660P strain and the KCCM10016 strain are Escherichia coli strains. For homologous recombination of the fourth fragment, pKD46 (GenBank accession number: AY048746), a Red recombinase plasmid, was introduced into each of the strains, and pKD46 was removed before introduction of pCP20.

[0029] The ansB gene was deleted by homologous recombination between the ansB gene and a DNA fragment containing an antibiotic resistance gene, and then the ansB gene was inactivated by removing the antibiotic resistance gene from the recombined DNA fragment. The specific process is as follows.

(1) Construction of First Fragment

[0030] PCR reaction (total volume: 50 μl) was performed using a pKD13 plasmid (Genbank accession number: AY048744) and a primer pair of ansB_PF and ansB_PR having a portion of the ansB gene sequence shown in Table 1 below and a portion of the pKD13 plasmid sequence under the following conditions, thus obtaining a first amplified fragment of about 1.4 kb in length: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 2 min at 72° C., followed by 5 min at 72° C. and 10 min at 12° C. The first fragment contained the kanamycin resistance gene derived from the pKD13 plasmid.

TABLE-US-00001 TABLE 1 SEQ ID NO Sequence ansB 1 atggagtttttcaaaaagacggcacttgccgcactggttatgggtittagtggtgcagcattggcattac ccaatatcaccattttagcaaccggcgggaccattgccggtggtggtgactccgcaaccaaatctaact acacagtgggtaaagttggcgtagaaaatctggttaatgcggtgccgcaactaaaagacattgcgaa rgttaaaggcgagcaggtagtgaatatcggctcccaggacatgaacgataatgtctggctgacartg gcgaaaaaaattaacaccgactgcgataagaccgacggcttcgtcattacccacggtaccgacacgat ggaagaaactgcttacttcctcgacctgacggtgaaatgcgacaaaccggtggtgatggtcggcgca atgcgtccgtccacgtctatgagcgcagacggtccattcaacctgtataacgcggtagtgaccgcagct gataaagcctccgccaaccgtggcgtgctggtagtgatgaatgacaccgtgcttgatggccgtgacgt caccaanaccaacaccaccgacgtagcgaccttcaagtctgttaactacggtcctctgggttacattcac aacggtaagattgactaccagcgtaccccggcacgtaagcataccagcgacacgccattcgatgtctct aagctgaatgaactgccgaaagtcggcattgtttataactacgctaacgcatccgatcttccggctaaa gcactggtagatgcgggctatgatggcatcgttagcgctggtgtgggtaacggcaacctgtataaatc tgtgttcgacacgctggcgaccgccgcgaaaaccggtactgcagtcgtgcgttcttccogcgtaccga cgggcgctaccactcaggatgccgaagtggatgatgcgaaatacggcttcgtcgcctctggcacgct gaacccgcaaaaagcgcgcgttctgctgcaactggctctgacgcaaaccaaagatccgcagcagatcc agcagatcttcaatcagtactaa ansB_HF1 2 cgaaggccag caattagtga ansB_HR1 3 gaggcaggta acaaaacgaa ansB_PF 4 ttcgttttgt tacctgcctc gtgtaggctg gagctgcttc ansB_PR 5 atcatccact tcggcatcct ctgtcaaaca tgagaattaa ansB_HF2 6 aggatgccga agtggatgat ansB_HR2 7 agcagtgccg tgccaacaat ansB_CF 8 ttcaggagat gggcgaaagc ansB_CR 9 ggcctgatta cccttagcat

(2) Construction of Second Fragment

[0031] To obtain an upstream fragment of the ansB gene, PCR reaction (total volume: 50 μl) was performed using the genomic DNA of E. coli MG1655 as a template and the primers ansB_HF1 and ansB_HR1 shown in Table 1 above under the following conditions, thus obtaining a second amplified fragment of about 0.3 kb in length: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 30 sec at 72° C., followed by 5 min at 72° C. and 10 min at 12° C.

(3) Construction of Third Fragment

[0032] To obtain a downstream fragment of the ansB gene, PCR reaction (total volume: 50 μl) was performed using the genomic DNA of E. coli MG1655 as a template and the primers ansB_HF2 and ansB_HR2 shown in Table 1 above under the following conditions, thus obtaining a third amplified fragment of about 0.3 kb in length: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 30 sec at 72° C., followed by min at 72° C. and 10 min at 12° C.

(4) Construction of Fourth Fragment

[0033] The first fragment, second fragment and third fragment amplified in the above experiment could be ligated into a single fragment due to the complementary sequences of the primers during amplification. These fragments were subjected to PCR (total volume: 50 μl) without primers under the following conditions, thus obtaining a fourth amplified single fragment having a size of about 2 kb: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 58° C., and 2 min and 30 sec at 72° C., followed by 5 min at 72° C. and 10 min at 12° C. The fourth fragment contained a portion of the ansB gene and the kanamycin antibiotic resistance gene. Specifically, it consisted of a portion of the 5′ fragment of the ansB gene, the kanamycin antibiotic resistance gene, and a portion of the 3′ fragment of the ansB gene.

(5) Introduction of Fourth Fragment and Deletion of ansB

[0034] The obtained fourth fragment was introduced by electroporation into each of the KFCC11660P and KCCM10016 strains, which are Escherichia coli strains containing the Red recombinase plasmid pKD46 (GenBank accession number: AY048746). The fourth fragment was replaced with ansB by homologous recombination using the Lambda Red recombination system, whereby ansB was deleted.

[0035] Thereafter, PCR reaction was performed on the cell line showing kanamycin resistance to confirm whether the ansB gene was deleted. The PCR reaction (total volume: 20 μl) was performed using the ansB_CF and ansB_CR primers shown in Table 1 above under the following conditions: one cycle of 5 min at 95° C., and then 30 cycles, each consisting of 30 sec at 95° C., 30 sec at 55° C., and 3 min at 72° C., followed by 5 min at 72° C. and 10 min at 12° C. It was confirmed that, when the original ansB gene was present, about 1.9 kb (before deletion) was produced, whereas when the fragment was inserted into the chromosome, about 2.3 kb (containing the antibiotic resistance gene) which is an increased length was produced.

(6) Antibiotic Resistance Gene Removal and Selection

[0036] To remove the antibiotic resistance marker gene from the strain in which deletion of the ansB gene was confirmed, FLP recombination was induced by introducing a pCP20 plasmid into the strain. Thereafter, the ansB-deleted strain was cultured in LB plate medium with or without antibiotics to confirm that the antibiotic resistance marker gene was removed.

EXAMPLE 2

Evaluation of Aromatic Amino Acid Production of ansB-Deleted Strain

[0037] Each of the E. coli strain KFCC11660PΔansB obtained by the method of Example 1 and KFCC11660P was cultured in the tryptophan-producing medium shown in Table 2 below.

[0038] In addition, each of the E. coli strain KCCM10016ΔansB obtained by the method of Example 1 and KCCM10016 was cultured in the phenylalanine-producing medium shown in Table 2 below.

[0039] For culture, 1 vol % of each of the KFCC11660PΔansB, KFCC11660P, KCCM10016ΔansB, and KCCM10016 strains was inoculated into a flask containing 10 mL of the tryptophan-producing medium or phenylalanine-producing medium having the composition shown in Table 2 below, and cultured with shaking at 200 rpm at 37° C. for 70 hours. Then, the concentrations of L-amino acids obtained from the strains were compared.

TABLE-US-00002 TABLE 2 Tryptophan-producing medium Phenylalanine-producing medium Component Content Component Content Glucose 80.0 g/L Glucose 80.0 g/L (NH.sub.4) .sub.2SO.sub.4 20.0 g/L (NH.sub.4).sub.2SO.sub.4 20.0 g/L K.sub.2HPO.sub.4 0.8 g/L K.sub.2HPO.sub.4 1.0 g/L K.sub.2SO.sub.4 0.4 g/L KH.sub.2PO.sub.4 1.0 g/L MgCl 0.8 g/L K.sub.2SO.sub.4 0.4 g/L Fumaric acid 1.0 g/L MgCl.sub.2 1.0 g/L Yeast extract 1.0 g/L Fumaric acid 0.5 g/L (NH.sub.4) .sub.6MO.sub.7O.sub.24 0.12 ppm Yeast extract 1.0 g/L H.sub.3BO.sub.3 0.01 ppm Glutamic acid 0.5 g/L CuSO.sub.4 0.01 ppm CaCl.sub.2 5.00 ppm MnCl.sub.2 2.00 ppm MnCl.sub.2 2.00 ppm ZnSO.sub.4 0.01 ppm ZnSO.sub.4 1.00 ppm CoCl.sub.2 0.10 ppm CoCl.sub.2 0.10 ppm FeCl.sub.2 10.00 ppm FeCl.sub.2 10.00 ppm Thiamine_HCl 20.00 ppm Thiamine_HCl 20.00 ppm L-Tyrosine 200.00 ppm L-Tyrosine 200.00 ppm L-phenylalanine 300.00 ppm CaCO.sub.3 3% CaCO.sub.3 3% — —

[0040] As a result of the above experiment, as shown in Tables 3 and 4 below, it was confirmed that, in the case of the strains in which the ansB gene was inactivated, the production of tryptophan and phenylalanine increased and the production of aspartate significantly decreased.

[0041] Referring to Tables 3 and 4 below, it was confirmed that, when the ansB gene in the KFCC11660P strain was inactivated, the production of L-tryptophan increased by 10% or more, and when the ansB gene in the KCCM10016 strain was inactivated, the production of L-phenylalanine increased by 5% or more.

TABLE-US-00003 TABLE 3 L- tryptophan L-aspartate Strain production (g/L) (relative amount) KFCC11660P 4.21 62.41 KFCC11660PΔansB 4.71 18.5

TABLE-US-00004 TABLE 4 L-phenylalanine L-aspartate Strain production (g/L) (relative amount) KCCM10016 3.47 80.12 KCCM10016ΔansB 3.68 35.74