METHODS FOR EXTENDING THE REPLICATIVE CAPACITY OF SOMATIC CELLS DURING AN EX VIVO CULTIVATION PROCESS

20190024079 ยท 2019-01-24

    Inventors

    Cpc classification

    International classification

    Abstract

    A product and process for extending the replicative capacity of metazoan somatic cells using targeted genetic amendments to abrogate inhibition of cell-cycle progression during replicative senescence and derive clonal cell lines for scalable applications and industrial production of metazoan cell biomass. An insertion or deletion mutation using guide RNAs targeting the first exon of the transcript encoding each protein is created using CRISPR/Cas9. Targeted amendments result in inactivation of p15 and p16 proteins which increases the proliferative capacity of the modified cell populations relative to their unaltered parental populations. Combining these amendments with ancillary telomerase activity from a genetic construct directing expression of a telomerase protein homolog from a TERT gene, increases the replicative capacity of the modified cell populations indefinitely. One application is to manufacture skeletal muscle for dietary consumption using cells from the poultry species Gallus gallus; another is from the livestock species Bos taurus.

    Claims

    1. A process for extending the replicative capacity of a metazoan somatic cell population comprising: decoupling retinoblastoma protein inhibition of cell division cycle advancement during replicative senescence by abrogating cyclin-dependent kinase inhibitor (CKI)-mediated stabilization of a retinoblastoma protein using genetic amendment; maintaining telomerase activity by transducing the metazoan somatic cell population with a genetic construct (SEQ ID NO 11) directing ectopic expression of functional telomere reverse transcriptase (TERT) protein; maintaining a bank of cells that is a master cell bank having the genetic amendment and ectopic expression of TERT protein; cultivating cells from the master cell bank in an ex vivo milieu that is a cultivated cell biomass; and harvesting the cultivated cell biomass for dietary consumption.

    2. The process of claim 1, wherein the genetic amendment comprises inactivating a p15 protein by genetic amendment of a CDKN2B gene (NCBI Gene ID: 395076) in the metazoan somatic cell population to abolish retinoblastoma protein inhibition of the cell cycle during replicative senescence.

    3. The process of claim 2, wherein the genetic amendment is a mutation of a conserved nucleotide sequence in exon one of the CDKN2B gene.

    4. The process of claim 3, wherein the genetic amendment is an insertion mutation made using guide RNAs, said guide RNAs selected from the group consisting of guide RNAs (SEQ ID Nos. 1, 2, 3, 4 and 5) targeting exon one of the CDKN2B gene and is created using clustered regularly-interspaced short palindromic repeats-Cas9 (CRISPR/Cas9).

    5. The process of claim 3, wherein the genetic amendment is a deletion mutation made using guide RNAs, said guide RNAs selected from the group consisting of guide RNAs (SEQ ID Nos. 1, 2, 3, 4 and 5) targeting exon one of the CDKN2B gene and is created using CRISPR/Cas9.

    6. The process of claim 2, wherein cultivating cells from the master cell bank further comprises: expanding selected cell populations from the master cell bank; cryopreserving and storing expanded cell populations in a master cell bank stock inventory; seeding and cultivating cells from the master cell bank stock inventory in an ex vivo milieu; and harvesting cultivated cell biomass for dietary consumption.

    7. The process of claim 2, wherein the metazoan somatic cell population species identity is Gallus gallus and the metazoan somatic cell population lineage is skeletal muscle.

    8. The process of claim 1, wherein the genetic amendment comprises inactivating a p16 protein by genetic amendment of a CDKN2A gene (NCBI Gene ID: 616369) in the metazoan somatic cell population to abolish retinoblastoma protein inhibition of the cell cycle during replicative senescence.

    9. The process of claim 8, wherein the genetic amendment is a mutation of a conserved nucleotide sequence in exon two of the CDKN2A gene.

    10. The process of claim 9, wherein the genetic amendment is an insertion mutation made using guide RNAs targeting exon two of the CDKN2A gene and is created using CRISPR/Cas9.

    11. The process of claim 9, wherein the genetic amendment is a deletion mutation made using guide RNAs said guide RNAs selected from the group consisting of guide RNAs (SEQ ID Nos. 8, 9 and 10) targeting exon two of the CDKN2A and is created using CRISPR/Cas9.

    12. The process of claim 8, wherein cultivating cells from the master cell bank further comprises: expanding selected cell populations from the master cell bank; cryopreserving and storing expanded cell populations in a master cell bank stock inventory; seeding and cultivating cells from the master cell bank stock inventory in an ex vivo milieu; and harvesting cultivated cell biomass for dietary consumption.

    13. The process of claim 8, wherein the metazoan somatic cell population species identity is Bos taurus and the metazoan somatic cell population lineage is skeletal muscle.

    14. The process of claim 1, wherein the genetic amendment further comprises modifying the cell population with a genetic construct (SEQ ID NO 12) that directs ectopic expression of a cyclin-dependent kinase 4 (CDK4) protein homolog, from a CDK4 gene (NCBI Gene ID: 510618).

    15. The process of claim 14, wherein cultivating cells from the master cell bank further comprises: expanding selected cell populations from the master cell bank; cryopreserving and storing expanded cell populations in a master cell bank stock inventory; seeding and cultivating cells from the master cell bank stock inventory in an ex vivo milieu; and harvesting cultivated cell biomass for dietary consumption.

    16. The process of claim 14, wherein the metazoan somatic cell population species identity is Gallus gallus and the metazoan somatic cell population lineage is skeletal muscle.

    17. The process of claim 14, wherein modifying the metazoan cell population is with a genetic construct (SEQ ID NO 12) directing expression of a CDK4 protein homolog from a Bos taurus CDK4 gene.

    18. A clonal cell line of a metazoan somatic cell population derived by a process comprising: decoupling retinoblastoma protein inhibition of cell division cycle advancement during replicative senescence by abrogating CM-mediated stabilization of a retinoblastoma protein using genetic amendment; maintaining telomerase activity by transducing the metazoan somatic cell population with a genetic construct (SEQ ID NO 11) directing ectopic expression of functional TERT protein; maintaining a bank of cells that is a master cell bank having the genetic amendment and ectopic expression of TERT protein; cultivating cells from the master cell bank in an ex vivo milieu that is a cultivated cell biomass; harvesting the cultivated cell biomass for dietary consumption; and wherein the clonal cell line has indefinite replicative capacity for scalable applications in the industrial production.

    19. The clonal cell line of claim 18, wherein the genetic amendment comprises inactivating a p15 protein by genetic amendment of a CDKN2B gene (NCBI Gene ID: 395076) in the metazoan somatic cell population to abolish retinoblastoma protein inhibition of the cell cycle during replicative senescence.

    20. The clonal cell line of claim 19, wherein the genetic amendment is a mutation of a conserved nucleotide sequence in exon one of the CDKN2B gene.

    21. The clonal cell line of claim 20, wherein the genetic amendment is an insertion mutation made using guide RNAs said guide RNAs selected from the group consisting of (SEQ ID Nos. 1, 2, 3, 4 and 5) targeting exon one of the CDKN2B gene and is created using CRISPR/Cas9.

    22. The clonal cell line of claim 20, wherein the genetic amendment is a deletion mutation made using guide RNAs said guide RNAs selected from the group consisting of (SEQ ID Nos. 1, 2, 3, 4 and 5) targeting exon one of the CDKN2B gene and is created using CRISPR/Cas9.

    23. The clonal cell line of claim 18, wherein cultivating cells from the master cell bank further comprises: expanding selected cell populations from the master cell bank; cryopreserving and storing expanded cell populations in a master cell bank stock inventory; seeding and cultivating cells from the master cell bank stock inventory in an ex vivo milieu; and harvesting cultivated cell biomass for dietary consumption.

    24. The clonal cell line of claim 19, wherein the metazoan somatic cell population species identity is Gallus gallus and the metazoan somatic cell population lineage is skeletal muscle.

    25. The process of claim 18, wherein the genetic amendment comprises inactivating a p16 protein by genetic amendment of a CDKN2A gene (NCBI Gene ID: 616369) in the metazoan somatic cell population to abolish retinoblastoma protein inhibition of the cell cycle during replicative senescence.

    26. The clonal cell line of claim 25, wherein the genetic amendment is a mutation of a conserved nucleotide sequence in exon two of the CDKN2A.

    27. The clonal cell line of claim 26, wherein the genetic amendment is an insertion mutation made using guide RNAs said guide RNAs selected from the group consisting of (SEQ ID NO 8-10) targeting exon two of the CDKN2A and is created using CRISPR/Cas9.

    28. The clonal cell line of claim 26, wherein the genetic amendment is a deletion mutation made using guide RNAs said guide RNAs selected from the group consisting of (SEQ ID NO 8-10) targeting exon two of the CDKN2A and is created using CRISPR/Cas9.

    29. The clonal cell line of claim 25, wherein cultivating cells from the master cell bank further comprises: expanding selected cell populations from the master cell bank; cryopreserving and storing expanded cell populations in a master cell bank stock inventory; seeding and cultivating cells from the master cell bank stock inventory in an ex vivo milieu; and harvesting cultivated cell biomass for dietary consumption.

    30. The clonal cell line of claim 25, wherein the metazoan somatic cell population species identity is Bos taurus and the metazoan somatic cell population lineage is skeletal muscle.

    31. The clonal cell line of claim 18, wherein the genetic amendment further comprises modifying the cell population with a genetic construct that directs ectopic expression of a CDK4 protein homolog, from a CDK4 gene (NCBI Gene ID: 510618).

    32. The clonal cell line of claim 31, wherein cultivating cells from the master cell bank further comprises: expanding selected cell populations from the master cell bank; cryopreserving and storing expanded cell populations in a master cell bank stock inventory; seeding and cultivating cells from the master cell bank stock inventory in an ex vivo milieu; and harvesting cultivated cell biomass for dietary consumption.

    33. The clonal cell line of claim 31, wherein the metazoan somatic cell population species identity is Gallus gallus and the metazoan somatic cell population lineage is skeletal muscle.

    34. The clonal cell line of claim 31, wherein modifying the metazoan cell population is with a genetic construct (SEQ ID NO 12) directing expression of a CDK4 protein homolog from a Bos taurus CDK4 gene.

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS

    [0019] FIG. 1 shows insertion of a transgenic DNA sequence containing a gene (example shown: Serum Albumin), preceded by, and under the regulation of, an active regulatory region. (Example shown: Desmin Promoter).

    [0020] FIG. 2 shows insertion of a transgenic DNA sequence containing an active regulatory region (example shown: Desmin Promoter) for regulation of expression from a target gene (Example shown: Serum Albumin) endogenous to the genome.

    [0021] FIG. 3 shows genetic amendment of an endogenous regulatory region (example shown: Serum Albumin Promoter) DNA sequence by INDEL or point mutation, for the activation of a regulatory region (example shown: Serum Albumin Gene).

    [0022] FIG. 4 shows insertion of a transgenic DNA sequence representing a target gene (example shown: Serum Albumin Gene) for expression under the regulation of an endogenous, 5 regulatory region with tissue-specific activity (example shown: Myostatin Promoter), and parallel disruption of the regulatory region's activation of the endogenous gene 3 to the inserted DNA sequence (example shown: Myostatin Gene).

    [0023] FIG. 5 shows epigenetic or transcription program inductive amendment for targeted activation of gene expression from the promoter region of a targeted gene (example shown: Serum Albumin Promoter & Gene), alone or in combination with, activation of gene expression from an enhancer outside of the regulatory region by a genetic sequence-targeted activation tether. For exemplary purposes, modalities representing CRISPRa (i.e. CRISPR activation) are shown.

    [0024] FIG. 6 shows epigenetic- or transcription program-suppressive amendment for targeted repression of gene expression from the regulatory region of a target gene, or directly from the coding sequence of the target gene, by a DNA-sequence targeted repression tether (example shown: Serum Albumin Promoter and Gene). For exemplary purposes, modalities representing CRISPRi (i.e. CRISPR interference) are shown.

    [0025] FIG. 7 shows genetic amendment of an endogenous regulatory region (example shown: Myostatin Promoter) or the target gene coding sequence, such as the start codon, by an INDEL or point mutation, to silence or disrupt expression of the endogenous target gene (example shown: Myostatin Gene).

    [0026] FIG. 8 shows insertion of a transgenic DNA sequence containing an shRNA coding region (example shown: Myostatin shRNA), preceded by, and under the regulation of, an active regulatory region (example shown: Desmin promoter).

    [0027] FIG. 9 shows p16 and p15 amino acid alignments: a. Conservation among predicted amino acid sequence homology within representative mammalian murine (Mus musculus; SEQ ID NO 17), bovine (Bos taurus; SEQ ID NO 18), and porcine (Sus scrofa; SEQ ID NO 19) p16 orthologs (Panel A); b. Conservation among predicted amino acid sequence homology within representative metazoan gallinacean (Gallus gallus; SEQ ID NO 20), murine (Mus musculus; SEQ ID NO 21), bovine (Bos taurus; SEQ ID NO 23), porcine (Sus scrofa; SEQ ID NO 22), salmonid (Oncorhynchus mykiss; SEQ ID NO 24) and cichlid (Oreochromis niloticus; SEQ ID NO 25) p15 orthologs (Panel B).

    DETAILED DESCRIPTION

    [0028] The genetic amendments of this invention decouple retinoblastoma protein inhibition of cell division cycle advancement during replicative senescence. This is accomplished by abrogating CM-mediated stabilization of the retinoblastoma protein, as shown in exemplary embodiments. We disclose three exemplary embodiments: (I) Inactivation of the p15 protein by disruption of the CDKN2B gene through targeted mutation of the coding sequence; (II) Inactivation of the p16 protein by disruption of the CDKN2A gene through targeted mutation of the coding sequence; and (III) Abrogation of endogenous CKI-mediated stabilization of retinoblastoma protein inhibition of cell division cycle progression by overexpression of a cyclin-dependent kinase homolog. These amendments, alone, or in combination, with ancillary overexpression of telomerase directed by an ectopic genetic construct, extend the replicative capacity of the metazoan cells amended.

    [0029] Illustrated in FIG. 1-5 are five exemplary models of inductive amendment for targeted transcriptional activation of a gene and four exemplary models of suppressive amendment (FIG. 4, 6-8) for targeted suppression of gene products. In FIG. 1-8, G refers to the native genomic DNA sequence and T refers to the foreign transgenic DNA sequence. Note that FIG. 4 may represent an inductive amendment to the transgene introduced and a suppressive amendment to the endogenous gene separated from its native promoter. For the purpose of this example, the wild-type host cell tissue lineage is Myostatin.sup.+/Desmin.sup.+ skeletal muscle. For illustrative purposes, arrows indicate exemplary regions of genetic amendment within the DNA sequence of the promoter and/or gene by INDEL or point mutation. ROSA26 indicates an exemplary, transcriptionally active amendment locus. Amendments may include, for example, alterations to the endogenous or unmodified genetic, epigenetic or transcription program.

    [0030] Among species commonly accepted as classified as livestock, the predicted amino acid sequences of the protein p16 are largely conserved with 82% pairwise identity between Bos taurus (SEQ ID NO 18) and Sus scrofa (SEQ ID NO 19). Likewise, among species classified as livestock and seafood, the amino acid sequences of the protein p15 are conserved as follows: 92% pairwise identity between Bos taurus (SEQ ID NO 23) and Sus scrofa (SEQ ID NO 22), 60% between Oncorhynchus mykiss (SEQ ID NO 24) and Oreochromis niloticus (SEQ ID NO 25). Further, comparing all livestock, poultry and seafood at the p15 locus (shown in FIG. 9 panel B) the genomic alignment reveals that there is 58% pairwise identity (Gallus gallus, SEQ ID NO 20; Mus musculus, SEQ ID NO 21; Bos taurus, SEQ ID NO 23; Sus scrofa, SEQ ID NO 22; Oncorhynchus mykiss, SEQ ID NO 24; and Oreochromis niloticus, SEQ ID NO 25).

    [0031] FIG. 9 demonstrates p16 and p15 amino acid alignments: a. Conservation among amino acid sequence homology within representative mammalian murine (Mus musculus; SEQ ID NO 17), bovine (Bos taurus; SEQ ID NO 18), and porcine (Sus scrofa; SEQ ID NO 19) p16 orthologs (Panel A); b. Conservation among amino acid sequence homology within representative metazoan gallinacean (Gallus gallus; SEQ ID NO 20), murine (Mus musculus; SEQ ID NO 21), bovine (Bos taurus; SEQ ID NO 23), porcine (Sus scrofa; SEQ ID NO 22), salmonid (Oncorhynchus mykiss; SEQ ID NO 24) and cichlid (Oreochromis niloticus; SEQ ID NO 25) p15 orthologs (Panel B). Darkened areas indicate degree of conservation (i.e., identity and similarity): black shading indicates 100% similarity, grey indicates 60-80% similarity and white represents less than 60% similarity based on the Blosum 62 score matrix (images and scoring produced in Geneious R10 (http://www.geneious.com, Kearse et al., 2012).

    [0032] Together, these orthologs demonstrate conserved amino acid sequence homology of p15 and p16 orthologs targeted by embodiments of this invention among species classified as livestock, poultry and seafood. Note that annotated fish and avian genomes lack a p16 ortholog. Therefore, it is predicted that the integrity of p15-mediated function across avian, mammalian and fish species is conserved and the integrity of p16-mediated function across mammalian species is conserved as a platform for targeted application in this invention.

    First Exemplary Embodiment: Delayed Replicative Senescence Through Genetic Amendment of the CDKN2B Locus and Ectopic Expression of TERT

    (A) Delayed Replicative Senescence Through Genetic Amendment of the CDKN2B Locus

    [0033] In sum, this first exemplary embodiment disrupts the CDKN2B locus encoding the p15 protein within primary myoblast cell populations isolated from Gallus gallus skeletal muscle using CRISPR/Cas9 to generate an INDEL targeted to exon #1 of CDKN2B (NCBI Accession Number: NM_204433.1) using guide RNAs (gRNAs) (SEQ ID NO 1-5). Although disrupting the CDKN2B locus alone provides benefits, when done in combination with ancillary telomerase activity from a genetic construct (SEQ ID NO 6) directing expression of a telomerase protein homolog from a TERT gene (NCBI Accession Number: NM_001031007.1; NCBI Gene ID: 420972), the replicative capacity of modified cell populations increases indefinitely. Targeted inactivation of CDKN2B is a novel approach.

    [0034] In general terms, the first embodiment extends the native replication capacity of metazoan somatic cells by ex vivo cultivation in a five step process: (1) decoupling retinoblastoma protein inhibition of cell division cycle advancement in replicative senescence by inactivating a p15 protein to abolish retinoblastoma protein inhibition of the cell cycle during proliferation, but not during differentiation; (2) maintaining telomerase activity by transducing the metazoan somatic cells with a genetic construct directing expression of a telomerase protein homolog from a functional TERT gene (ectopic expression of TERT) to lessen replicative senescence characteristic of normal, unmodified metazoan somatic cells; (3) maintaining a bank of cells having the CDKN2B gene mutation and ectopic expression of TERT (i.e., the master cell bank); (4) cultivating cells from the master cell bank in an ex vivo milieu; and (5) harvesting the cultivated cell biomass for dietary consumption.

    [0035] More specifically and in one embodiment, the first exon of the CDKN2B gene (NCBI Accession Number: NM_204433.1) encoding the p15 protein is targeted for genetic amendment using gRNA-targeted CRISPR/Cas9 (gRNA SEQ ID NO 1-5) to insert a mutation within the first exon of the CDKN2B gene within the genome of a Gallus gallus cell population. For a more detailed discussion of the methods used for these examples see below in the Materials and Methods sections A, B, D, E, and F.

    [0036] Exemplary embodiment I employs the model illustrated in FIG. 7 for disrupting the function of the endogenous p15 protein. Specifically, the model shown in FIG. 7 may be adapted for use in this invention where endogenous gene expression is disrupted by mutation of the start codon or a regulatory region sequence enabling transcriptional activation. Alternatively, endogenous gene function may be disrupted by introducing a frameshift mutation after the start codon. For instance, as applied to this invention, the model shown in FIG. 7 may represent the repression of p15 function by an INDEL mutation introduced into the 5-prime (5) coding sequence of the CDKN2B gene using CRISPR/Cas9-targeted nuclease activity.

    (B) Expression of an Ectopic TERT Gene

    [0037] Cells modified as described in Embodiment I-A may also be modified with a genetic construct directing expression of a telomerase protein homolog from a TERT gene (NCBI Accession Number: NM_001031007.1; NCBI Gene ID: 420972). This is followed by selection of cells from this population transduced with a genetic construct (SEQ ID NO 6) directing expression of a telomerase protein homolog from a TERT gene for cells featuring genetic amendment by the genetic construct directing expression of a telomerase protein homolog.

    [0038] Exemplary embodiment I makes use of the model illustrated in FIG. 1 for expression of an ectopic TERT gene. Specifically, the model shown in FIG. 1 may be adapted for use in this invention where ectopic genes are expressed under the regulation of a foreign promoter. For instance, as applied to this invention, the model shown in FIG. 1 may represent expression of an ectopic TERT gene from an introduced CAG promoter.

    [0039] The model shown in FIG. 2 may be adapted for use in this invention where endogenous genes are expressed under the regulation of a foreign promoter. For instance, as applied to this innovation, the model shown in FIG. 2 may also represent the expression of an endogenous TERT gene from an introduced CAG promoter.

    [0040] The model shown in FIG. 3 may be adapted for use in this invention where gene expression is altered by targeted mutation of its regulatory sequence. For instance, as applied to this invention, the model shown in FIG. 3 may represent the expression of an endogenous TERT gene from an endogenous TERT promoter wherein repressor binding sites within the TERT promoter have been disrupted by mutation.

    [0041] The model shown in FIG. 4 may be adapted for use in this invention where the expression of a foreign gene is expressed under the regulation of an endogenous promoter inserted at the 3-prime (3) end of the gene. For instance, as applied to this invention, the model shown in FIG. 4 may represent the expression of a foreign TERT gene from and endogenous (3-actin promoter.

    [0042] The model shown in FIG. 5 may be adapted for use in this invention where the expression of an endogenous gene is transcriptionally activated from the promoter by a genetic sequence-targeted activation tethering. For instance, as applied to this invention, the model shown in FIG. 5 may represent the induction of an endogenous TERT gene by CRISPRa targeted to the TERT promoter. Exemplary CRISPRa modalities include, but are not limited to, activation mediated by a nuclease-deficient Cas9 protein targeted to the regulatory region of a target gene by a single gRNA. Outside of the scope of CRISPRa, modalities for this inductive amendment mechanism encompass genetic sequence-targeted activation tethering including, but not limited to, nuclease-deficient Zinc Finger Nucleases (ZFNs) and nuclease-deficient Transcription Activator-Like Effector Nucleases (TALENs).

    [0043] The model shown in FIG. 6 may be adapted for use in this invention where the expression of an endogenous gene is transcriptionally repressed from the promoter by genetic sequence-targeted repression tethering. For instance, as applied to this invention, the model shown in FIG. 6 may represent the repression of the endogenous CDKN2B gene by CRISPRi targeted to the CDKN2B promoter. Exemplary CRISPRi repression modalities include, but are not limited to, repression mediated by nuclease-deficient Cas9 protein targeted to a regulatory region or gene by a single gRNA. Outside of the scope of CRISPRi, modalities for this suppressive amendment mechanism encompass DNA sequence-targeted repression tethering including, but not limited to, nuclease-deficient ZFNs and nuclease-deficient TALENs.

    [0044] For a more detailed discussion of the methods used in these examples see the Materials and Methods below in paragraphs C, G, H and I; noting the manufacturing process can be accomplished in this exemplary embodiment using the same manufacturing process described above in section I-B.

    (C) Manufacturing Biomass for Dietary Consumption

    [0045] In one embodiment, manufacturing biomass for dietary consumption comprises four steps: (1) Expanding selected cell populations harboring genetic amendment to the CDKN2B locus and/or ectopic expression of TERT; (2) Cryopreserving and storing expanded cell populations in a master cell bank stock inventory; (3) Seeding and cultivating cells from master cell bank stock inventory in an ex vivo milieu; and (4) Harvesting cultivated cell biomass for dietary consumption.

    [0046] Step 1 is expanding selected cell populations harboring genetic amendment to the CDKN2B locus. Selected cell populations harboring the genetic amendment are seeded onto a substrate consisting of gelatin-coated tissue-culture treated plastic, in a standard growth medium containing 10% animal serum, such as, but not limited to, bovine serum plus basal medium at a density of 7.510.sup.3 cells/cm.sup.2 and cultured at 37 C. under 5% carbon dioxide, 5% oxygen atmospheric conditions. As cultures approach 80% confluence, cells are enzymatically dissociated and the expanded quantity of cells is seeded at 7.510.sup.3 cells/cm.sup.2. This process is repeated until the total number of cells harvested following dissociation exceeds 1.010.sup.8 cells.

    [0047] Step 2 is cryopreserving and storing the expanded cell populations in a master cell bank stock inventory. Cells are harvested in quantities equal to or exceeding 1.010.sup.8. Following expansion, selected cells are pelleted by centrifugation for 5 minutes at 300g. The cell pellet is suspended in a standard cryopreservation medium at 2.510.sup.6 cells/mL and aliquoted at 1.0 mL per cryovial. Cryovials are cooled to 80 C. at 1 C./minute using a controlled cooling container and transferred to a dewar containing liquid nitrogen for long-term storage. As cells stocks are depleted from this bank, remaining vials of cells are expanded as described in Embodiment I-B-1 and cryopreserved as described in Embodiment I-B-2 to replenish and expand the master cell bank inventory.

    [0048] Step 3 is seeding and cultivating cells from a master cell bank in an ex vivo milieu: In accordance with the cultivation scale desired, one or more vials from the master cell bank is rapidly thawed to room temperature. The cryopreservation medium is removed from the cells by a 5 minute, 300g centrifugation step. Cells are suspended in standard growth medium and seeded onto a gelatin-coated cultivation substrate in standard growth medium and cultivated as outlined in embodiment I-B-1, except that, on the final passage prior to harvest, the cells are permitted to proliferate to equal to, or greater than, 100% confluence on the cell culture substrate. The cultivation scale for biomass harvest is outlined according to Table 1, where the estimated average cell mass is 2.010 grams, and the estimated average cell doubling time is 24 hours (h).

    TABLE-US-00001 TABLE 1 # hours 1 vial 2 vials 3 vials 4 vials 5 vials 6 vials 7 vials 8 vials 9 vials 10 vials 0 h 0.005 0.01 0.015 0.02 0.025 0.03 0.035 0.04 0.045 0.05 24 h 0.01 0.02 0.03 0.04 0.05 0.06 0.07 0.08 0.09 0.1 48 h 0.02 0.04 0.06 0.08 0.1 0.12 0.14 0.16 0.18 0.2 72 h 0.04 0.08 0.12 0.16 0.2 0.24 0.28 0.32 0.36 0.4 96 h 0.08 0.16 0.24 0.32 0.4 0.48 0.56 0.64 0.72 0.8 120 h 0.16 0.32 0.48 0.64 0.8 0.96 1.12 1.28 1.44 1.6 144 h 0.32 0.64 0.96 1.28 1.6 1.92 2.24 2.56 2.88 3.2 168 h 0.64 1.28 1.92 2.56 3.2 3.84 4.48 5.12 5.76 6.4 192 h 1.28 2.56 3.84 5.12 6.4 7.68 8.96 10.24 11.52 12.8 216 h 2.56 5.12 7.68 10.24 12.8 15.36 17.92 20.48 23.04 25.6 240 h 5.12 10.24 15.36 20.48 25.6 30.72 35.84 40.96 46.08 51.2 264 h 10.24 20.48 30.72 40.96 51.2 61.44 71.68 81.92 92.16 102.4 288 h 20.48 40.96 61.44 81.92 102.4 122.88 143.36 163.84 184.32 204.8 312 h 40.96 81.92 122.88 163.84 204.8 245.76 286.72 327.68 368.64 409.6 336 h 81.92 163.84 245.76 327.68 409.6 491.52 573.44 655.36 737.28 819.2

    [0049] Table 1 shows Biomass Production Scale Cultivation Yield Estimates. Masses are shown in grams. 1 vial is equivalent to 2.510.sup.6 cells.

    [0050] Step 4 is harvesting cultivated cell biomass for dietary consumption. After the cells have proliferated to confluence, the culture medium is removed and the adherent cell cultures are rinsed with phosphate buffered saline. Next, the confluent biomass of adherent cells is mechanically dissociated from the substrate by means of a scraping device. The dissociated biomass is collected into centrifuge tubes, pelleted at 400g for 5 minutes to remove excess liquid and processed for food product formulation.

    Second Exemplary Embodiment: Delayed Replicative Senescence Through Genetic Amendment of the CDKN2A Locus and Ectopic Expression of TERT

    [0051] In sum, the second exemplary embodiment disrupts the CDKN2A locus encoding the p16 protein within a metazoan somatic cell population that is a primary myoblast cell population isolated from Bos taurus skeletal muscle using CRISPR/Cas9 to create an INDEL mutation targeted to the first exon of the CDKN2A sequence encoding p16, using gRNAs (SEQ ID NO 8-10). The Bos taurus gene CDKN2A has two predicted splice variants (NCBI Accession Numbers: XM_010807759.2, XM_010807758.1) wherein the first exon encoding p16 is exon #2 of CDKN2A. Although disrupting the CDKN2A locus alone provides replicative benefits, when used in combination with ancillary telomerase activity from a synthetic genetic construct (SEQ ID NO 11) directing expression of a telomerase protein homolog from a TERT gene in the same cell population (NCBI Accession Number: NM_001046242.1; NCBI Gene ID 518884), the synergistic action of both amendments can increase the replicative capacity of the modified cell population further than either amendment alone. The Bos taurus species genome features a CDKN2A gene with a predicted transcript encoding p16 (NCBI Accession Number: XM_010807759.2). In other words, the genetic amendment is a mutation of a conserved nucleotide sequences in exon two of the CDKN2A gene (i.e., exon one of the gene sequence encoding p16) and guide RNAs targeting exon two of the CDKN2A gene (i.e., exon one of the gene sequence encoding p16) and is created using CRISPR/Cas9. Disrupting the CDKN2A locus within the predicted p16 coding sequence is a novel method in this application. For a more detailed discussion of the methods used for these examples see Materials and Methods sections A, B, C, D, E, F, G, H and I.

    [0052] In all other regards the second exemplary embodiment follows the method outlined in the first exemplary embodiment to manufacture biomass for dietary consumption in an ex vivo cultivation process, which comprises: (1) decoupling retinoblastoma protein inhibition of cell division cycle advancement in replicative senescence by inactivating a p15 protein to abolish retinoblastoma protein inhibition of the cell cycle during proliferation, but not during differentiation; (2) maintaining telomerase activity by transducing the metazoan somatic cells with a genetic construct directing expression of a telomerase protein homolog from a functional TERT gene (ectopic expression of TERT) to lessen replicative senescence characteristic of normal, unmodified metazoan somatic cells; (3) maintaining a bank of cells having the CDKN2A locus mutation and ectopic expression of TERT (master cell bank); (4) cultivating cells from the master cell bank in an ex vivo milieu; and (5) harvesting the cultivated cell biomass for dietary consumption.

    [0053] Exemplary Embodiment II employs the model illustrated in FIG. 7 for disrupting the function of the endogenous p16 protein; and Exemplary Embodiment II employs the model illustrated in FIG. 1 for expression of an ectopic TERT gene.

    Third Exemplary Embodiment: Delayed Replicative Senescence Through Expression of Ectopic Cyclin-Dependent Kinase and Ectopic TERT

    [0054] In general terms, the third exemplary embodiment abrogates cyclin-dependent kinase inhibitor-mediated stabilization of retinoblastoma protein inhibition of the cell division cycle during replicative senescence by ectopic overexpression of cyclin-dependent kinase homologs; specifically, modification of cells with a genetic construct directing ectopic expression of a CDK4 protein homolog, from a CDK4 gene (NCBI Gene ID: 510618). Additional benefit can be achieved by adding ancillary telomerase activity from a genetic construct directing overexpression of a telomerase protein homolog from a TERT gene (NCBI Gene ID: 518884). Overexpression of telomerase protein homolog increases the replicative capacity of modified cell populations relative to the unmodified parental populations.

    [0055] More specifically and in one embodiment, Gallus gallus was chosen to model modification of poultry skeletal muscle cells using a genetic construct directing ectopic expression of a cyclin-dependent kinase protein homolog from a cyclin-dependent kinase gene; maintaining a master cell bank stock inventory of cells harboring the genetic construct directing ectopic expression of a cyclin-dependent kinase protein homolog from a cyclin-dependent kinase gene. Transduction of said metazoan cell population is with a genetic construct (SEQ ID NO 12) directing expression of a CDK4 protein homolog from a Bos taurus CDK4 gene (NCBI Accession Number: NM_001037594.2; NCBI Gene ID: 510618). For a more detailed discussion of the methods used for these examples see the Materials and Methods sections C, G, H, and I.

    [0056] Manufacturing biomass for dietary consumption and modification of cells from the metazoan cell population with a genetic construct (SEQ ID NO 11) directing expression of a telomerase protein homolog from a TERT gene follows the method described above in the first exemplary embodiment.

    [0057] Exemplary embodiment III employs the model illustrated in FIG. 1 for expression of an ectopic CDK4 gene. Exemplary Embodiment III employs the model illustrated in FIG. 1 for expression of an ectopic TERT gene.

    <Materials and Methods>

    (A) Target Locus Sequencing

    [0058] Genomic DNA is extracted from primary cell isolates with the E.Z.N.A. Tissue DNA Extraction kit (Omega Bio-tek) for each species. Genomic DNA is PCR amplified using primers designed to amplify endogenous CDKN2B from Gallus gallus and endogenous CDKN2A from Bos Taurus.

    [0059] In Gallus gallus, the putative promoter region and CDKN2B are PCR amplified using primers SEQ ID NO 26-31; see Table 2 below providing details on primer targets. In Bos taurus, the putative promoter region and CDKN2A are PCR amplified using primers SEQ ID NO 32-43; see Table 2 below for details on primer targets.

    TABLE-US-00002 TABLE2 SEQIDNO DNASequence Details 1 TCACCCGCAGCAGATCGCCG gRNAtargetingG.gallusCDKN2B CGG exon1 2 CGGGTGAAGG gRNAtargetingG.gallusCDKN2B AGCTACTGGACGG exon1 3 GCACCACGCCTGCTGCTCCG gRNAtargetingG.gallusCDKN2B GGG exon1 4 GCTGGGCTCCCCTCGCGGGT gRNAtargetingG.gallusCDKN2B CGG exon1 5 CCTCGTGTCTGTGGGCAGCG gRNAtargetingG.gallusCDKN2B GGG exon1 8 GGCGGCCAAC gRNAtargetingbovineCDKN2Aexon AAGTCGGCCGAGG 2 9 GCCAACGCGCCGAACCGTTA gRNAtargetingbovineCDKN2Aexon CGG 2 10 CCTCGGGTGCAAAGACTCCG gRNAtargetingbovineCDKN2Aexon CGG 2 26 CTCTCCGTCCTCCCTACCTG PrimerforG.gallusCDKN2Bexon1 27 GTACCAACTG PrimerforG.gallusCDKN2Bexon1 CGGGGAGAAA 28 GGACGCCGGTCAATGAATCA PrimerforG.gallusCDKN2Bexon2 29 CAGGTGATGATGCTGGGCAG PrimerforG.gallusCDKN2Bexon2 30 TTTCTCCCCGCAGTTGGTAC PrimerforG.gallusCDKN2Bpromoter 31 CTGCAAGACCCAAGACGTCT PrimerforG.gallusCDKN2Bpromoter 32 GCCTAGTCCCACACCCTTTC PrimerforbovineCDKN2Apromoter 33 CATTTAAGCCTGGCCCCTGA PrimerforbovineCDKN2Apromoter 34 TGTCCGACTCTTTGCCATCC PrimerforbovineCDKN2Aexon4 35 GACCCTGGATAAGGCGTCAG PrimerforbovineCDKN2Aexon4 36 AGTGAATGCTCTGGGAAGCG PrimerforbovineCDKN2Aexon3 37 GATTGTCAGCGCATCTGCAG PrimerforbovineCDKN2Aexon3 38 TAGAGATCTGAACCCCACGC PrimerforbovineCDKN2Aexon2 39 CTCTGATGGG PrimerforbovineCDKN2Aexon2 AGTGGGGAGA 40 AGGCCTTTCCTACCTGGTCT PrimerforbovineCDKN2Aexon1 41 TAATTCCGCTGGTTTCCCAA PrimerforbovineCDKN2Aexon1 42 AAACTGCTGCGACATCTGGA PrimerforbovineCDKN2Apromoter 43 ACGGTCCCTCTTCTCTCTCC PrimerforbovineCDKN2Apromoter

    [0060] Table 2 shows details of gRNA and primer sequences.

    [0061] PCR products were compared to the in silico predicted sequence size using gel electrophoresis (1% agarose run at 10 W/cm). To determine the genomic sequence of CDKN2A and CDKN2B, the respective PCR products are purified using a commercial magnetic bead kit and Sanger sequenced. Sequencing primers are the same as those used to amplify the initial PCR product. All PCR primers are designed using a modified version of Primer3 2.3.7 (Untergasser et al., 2012), available in Geneious R10 (http://www.geneious.com, Kearse et al., 2012), using the reference sequence for Gallus gallus CDKN2B (NCBI Accession Number NM_204433.1) and Bos taurus CDKN2A (NCBI Accession Number: XM_010807759.2). The reference chromosome assembly for each species (NCBI Accession Number: AC_000165 for Bos taurus, NCBI Accession Number: NC_006127 for Gallus gallus) is used to design primers which amplify the putative promoter region for each gene

    (B) gRNA Design

    [0062] CRISPR/Cas9 is used to disrupt p16 of CDKN2A in the Bos taurus genome and p15 of CDKN2B in Gallus gallus genome. Suitable gRNAs for CRISPR/Cas9 are designed using the Find CRISPR Sites function in Geneious R10 (http://www.geneious.com, Kearse et al., 2012). Off-target effects are screened using the latest reference genome on NCBI for each species: Gallus gallus-5.0 (NCBI RefSeq Assembly Accession Number:GCF_000002315.4.) and Bos taurus v3.1.1 (NCBI RefSeq Assembly Accession Number: GCF_000003055.6). Only gRNAs with off target scores>90% are considered for synthesis. Guide RNA sequences selected for synthesis include but are not limited to SEQ ID NO 1-5 for Gallus gallus and SEQ ID NO 8-10 for Bos taurus. Separate pGS-gRNA vectors are constructed, amplified and purified for each selected gRNA by a third-party vendor. The pSpCas9 PX165 vector to be co-transfected with each gRNA plasmid is also sourced from a third-party vendor.

    (C) Synthetic Construct Design

    [0063] The Cytomegalovirus, Chicken Beta-Actin, Rabbit Beta-Globulin (CAG) regulatory element (Alexopoulou, Couchman, and Whiteford 2008) is used to promote robust expression of all introduced synthetic constructs. The Gallus gallus TERT reference sequence (NCBI Accession Number: NM_001031007.1) was retrieved from NCBI. For each transcript variant (NM_001031007.1 and XM_015282334.1), the coding DNA sequence (CDS) regions are extracted and joined into a concatenated sequence. The CAG regulatory element is then joined to the 5 end of the CDS for each transcript variant in Geneious R10 (http://www.geneious.com, Kearse et al., 2012). The full synthetic constructs SEQ ID NO 6 and SEQ ID NO 7 are assembled and cloned into a mammalian expression vector by a commercial vendor. The strategy described here is also used to create a bovine version of the synthetic TERT construct. The Bos taurus TERT construct (SEQ ID NO 11) is designed using the reference sequence (NCBI Accession Number: NM_001046242.1).

    [0064] To drive strong expression of CDK4 in bovine cells another set of synthetic constructs was created using the method described above. The Bos taurus CDK4 reference sequence (NCBI Accession Number: NM_001037594.2) was retrieved from NCBI. For both the wild type and mutant sequences the CDS regions were extracted and joined into a concatenated sequence. The synthetic constructs SEQ ID NO 12 were assembled and cloned into a mammalian expression vector by a third-party vendor.

    (D) CRISPR/Cas9 Cell Transfection for INDEL Mutagenesis of Gallus gallus CDKN2B or Bos Taurus CDKN2A

    [0065] To perform targeted INDEL mutagenesis, gRNA sequences recognized by CRISPR/Cas9 proteins encoded by plasmids are synthesized, amplified, and purified for transfection. The plasmid DNA contains a standard vector backbone containing the necessary regulatory elements for amplification in prokaryotic systems. Each plasmid also contains the regulatory and coding regions necessary to express the gRNA or Cas9 protein transiently within each target cell population to incite INDEL mutation formation within the 5 regulatory region, coding region, or both.

    [0066] Delivery of the plasmid DNA constructs is mediated by a non-liposomal DNA complex-forming transfection reagent (Fugene HD, Promega) delivered directly to the primary cell isolations in suspension and during adhesion. gRNAs targeting the 5 region of the Gallus gallus CDKN2B gene encoding the p15 or the 5 region of the Bos taurus CDKN2A gene encoding p16 are designed for expression from the transfected plasmid. Transfection is performed by using modification of the Grunwald and Speer (2007) protocol for targeted alteration of primary human skeletal muscle myoblasts (Biochemica March 2007, pages 26-27). The prepared plasmid DNA is diluted to a working concentration of 1 g/L in sterile, deionized water. Each plasmid DNA stock is aliquoted in a 2:1 ratio of Cas9 plasmid DNA:gRNA plasmid for a total DNA amount of 2 g and mixed well via trituration. The total DNA is diluted to a concentration of 1 g/50 L in sterile deionized water. Fugene HD is added to the DNA mixture at a ratio of 6:2, (Fugene HD reagent (in L): total DNA (in g)) and mixed well.

    [0067] The mixture is incubated at room temperature for fifteen minutes to promote complexation with DNA. The incubated DNA mixture is diluted by adding an equal volume of sterile, deionized water. This entire reaction mixture is then added dropwise to cells in suspension. The cells and DNA reaction mixture is incubated at 37 C. under 5% CO.sub.2, 5% O.sub.2 atmospheric conditions for 16 hours.

    [0068] Target cell populations are maintained in proliferation medium on tissue culture-treated plastic (6-well plates). The cells are maintained at a density of 410.sup.5 cells/ml of culture medium. Prior to transfection, the cell medium is removed aseptically, the cells washed in 1PBS, and then exposed to 1 dissociation reagent (TrypLE-Gibco) at 37 C. for 3 minutes. The reaction is terminated with the addition of an equal volume of proliferation medium, followed by gentle trituration. The cells are then transferred to a 0.1% gelatin-coated well. At this point, the DNA transfection reaction complex is added, and the cells are incubated for 48 hours at 37 C. under 5% CO.sub.2, 5% O.sub.2 for 48 hours prior to further processing and evaluation.

    (E) Limiting Dilution of Transfected Cells Targeting CDKN2B or CDKN2A

    [0069] Cell populations previously transfected using a CRISPR/Cas9 gRNA are selected by first isolating individual clonal populations of cells from the parental pool of cells subjected to one transfection cycle. Cells are selected using a limiting dilution method. Transfected cells are enzymatically-dissociated into a single cell suspension. A working stock of 210.sup.4 cells/mL proliferation medium is produced to a total volume of 500 L. Each well in a tissue-culture treated 96 well plate is coated in 0.1% gelatin. With the exception of well A1, each well is pre-filled with 100 L of proliferation medium. 410.sup.3 cells (200 uL) are transferred aseptically to the 0.1% gelatin-coated A1 well of a tissue-culture treated 96-well plate. One half of the volume (100 L) of well A1 is immediately transferred to well B1 and mixed well. This dilution series (1:2) is repeated from well C1 through HE Upon receiving cells, 100 L is removed and discarded from well HE 100 L of cell-free proliferation medium is added to each well from A1-H1 and mixed well. Next, one half of the volume in well A1 is transferred to well A2 and mixed well. This process is repeated from A2 through A12. The dilution series is repeated again starting from well B1 and continued through B12. This entire process is repeated for rows C through H until the entire plate (all 96 wells) have received a dilution volume of cells. To complete the dilution series, each well in column 12 has one half (100 L) removed and discarded. Each well in columns 2 through 12 have 100 L of cell-free proliferation medium added to each to bring the final volume of each well on the plate to 200 L. The entire plate is incubated at 37 C. under hypoxia until individual cell colonies emerge (greater than or equal to 10 cell doublings or 1,024 cells). Wells that appear to harbor cells originating from one single isolated cell are dissociated into single cells and passaged 1:1 into one well of a 0.1% gelatin coated 24 well plate and incubated at 37 C. under 5% CO.sub.2, 5% O.sub.2 atmospheric conditions. Once 90% confluent, cells are expanded to a 12-well then 6-well plate.

    [0070] Cells isolated by limiting dilution and expanded to 90% confluence in a 6 well plate are then passaged 1:4 into a 6-well plate. 90% confluent wells are then processed for further evaluation. One well is dissociated into single cells, washed, and pelleted at 300g for five minutes. Total cellular genomic DNA is isolated and quantified. Total genomic DNA is then subjected to PCR amplification of the CDKN2B or CDKN2A locus and run on a 1% agarose gel at 10 W/cm until resolved. These PCR products are then extracted from the agarose gel and submitted for Sanger sequencing. Sequence tracings are compared to the previously validated, wild-type, untreated parental cell population CDKN2B or CDKN2A genetic sequences.

    (F) Cell Proliferation and Senescence Assay (EdU Method)

    [0071] Cell populations demonstrating INDEL mutation formation in the 5 region of the Gallus gallus CDKN2B gene targeting p15 function, or the Bos taurus CDKN2A gene targeting p16 function, are then evaluated for functional and phenotypic characteristics via a standard EdU assay. Cell populations determined to harbor a correctly INDEL-disrupted gene and that are clonally pure are seeded at equal densities alongside wild-type cells that have received no previous CRISPR/Cas9 targeting and are of the same cell population doubling number as the INDEL-amended cells. Each cell type is allowed to incubate at 37 C. under 5% CO.sub.2, 5% O.sub.2 atmospheric conditions for 24 hours. Following this, a standard thymidine analog reagent (EdU) is added to the culture medium (Click-It Alexa 488 EdU kit, Thermo-Fisher) and the cells are incubated at 37 C. under 5% CO.sub.2, 5% O.sub.2 atmospheric conditions for 4 hours. Following incubation, the cells are washed, fixed, permeabilized, and probed using and anti-EdU Alexa 488-conjugated azide. Nuclear counter-staining is achieved using a standard DAPI nuclear stain. The cells are then visualized following excitation under standard 488 nm wavelength light. The ratios of Alexa Flour 488/DAPI in wild-type and CDKN2B/A gene-amended cell populations are quantified and compared to assess the proliferative population ratio within each cell group. Positive Alexa Fluor 488 signal in both total cell number per population treatment and measured over cell passage number indicates DNA replication has occurred and is a direct measure of cells actively proliferating. To quantify and track relative maintenance of proliferative capacity during serial passage, this procedure is repeated during successive population doublings until at least one of the cell populations ceases to proliferate and has become senescent.

    (G) Ectopic Plasmid DNA Transfection Method

    [0072] To express ectopically, a plasmid DNA construct containing either the TERT or CDK4 regulatory and coding sequences species-specific to the metazoan under study (i.e., the gene of interest) is generated using commercial plasmid production services as well as a unique eukaryotic antibiotic resistance gene (i.e. unique to other resident drug-selectable markers). For the intended use described here, plasmid DNA contains a standard vector backbone containing the necessary regulatory elements for amplification in prokaryotic systems.

    [0073] Each plasmid contains the regulatory and coding regions necessary to express either the TERT or CDK4 protein constitutively within each target cell population. Delivery of the plasmid DNA constructs is mediated by a non-liposomal DNA complex-forming transfection reagent (Fugene HD, Promega) delivered directly the primary cell isolations in suspension and during adhesion. The plasmid contains the regulatory sequences necessary to promote expression of both the gene of interest and the gene encoding the eukaryotic antibiotic resistance. Transfection is performed by using modification of the Grunwald and Speer (2007) protocol for targeted alteration of primary human skeletal muscle myoblasts (Reference Biochemica March 2007, pages 26-27). The prepared plasmid DNA is restriction enzyme digested upstream of the 5 regulatory components using a unique restriction site. To isolate the cut plasmid from uncut or mis-cut plasmid, a 0.8% agarose gel is run at 10 W/cm until resolved. If all plasmid DNA sampled is linearized appropriately, the cut plasmid is then diluted to a working concentration of 1 g/L in sterile, deionized water. 2 g of total DNA is diluted to a concentration of 1 g/50 L in sterile deionized water. Fugene HD is added to the DNA mixture at a ratio of 6:2, (Fugene HD reagent (in L): total DNA(in g)) and mixed well. The mixture is incubated at room temperature for fifteen minutes to promote complexation with DNA. The incubated DNA mixture is diluted by adding an equal volume of sterile, deionized water. This entire reaction mixture is then added dropwise to cells in suspension (see below). The cells and DNA reaction mixture is incubated at 37 C. under 5% CO.sub.2, 5% O.sub.2 atmospheric conditions for 48 hours.

    (H) Clonal Selection of Cells Transfected with Ectopic DNA

    [0074] Cell populations are selected via antibiotic drug selection and survival: Cells incubated in the Fugene HD: linearized TERT or CDK4 plasmid DNA sequence have their media removed, are washed in 1PBS, and fresh proliferation medium is applied. A lethal dosage of antibiotic is then applied to the culture medium to initiate cellular clone selection. The cells are incubated under lethal antibiotic drug exposure at 37 C. under 5% O.sub.2, 5% CO.sub.2 for 14 days. Cells culture medium is monitored and replaced at regular intervals to remove cellular detritus and debris due to drug-induced mortality. Non-morbid, proliferating cell colonies emerging from single cells harboring the antibiotic resistance gene carried on the transfected plasmid are picked using a sterile p200 pipette tip and transferred to a 0.1% gelatin coated well of a 96 well plate. 200 L of proliferation medium containing the lethal antibiotic concentration are then reapplied as before to maintain constant selection pressure. The cells are incubated at 37 C. under 5% O.sub.2, 5% CO.sub.2 atmospheric conditions until colonies have emerged. Established and proliferating colonies are then dissociated into single cells and expanded into larger-surface area gelatin-coated wells until confluent within 6 wells of a 6 well plate. One confluent well of each 6 well plate of each surviving, expanded cell population targeted by the gene of interest-containing plasmid is then subjected to total genomic DNA isolation. Total cellular genomic DNA is isolated and quantified. Total genomic DNA is then subjected to PCR amplification of the gene of interest's coding sequence and run on a 0.8% agarose gel at 10 W/cm until resolved. These PCR products are then extracted from the agarose gel and submitted for Sanger sequencing. Sequence tracings are compared to wild-type, untreated parental cell populations as well as in silico design of the species-specific gene of interest sequence. Cell populations demonstrating gene of interest genomic sequences that match the in silico prediction are then evaluated for functional and phenotypic characteristics.

    (I) Telomerase Function Validation Assay Using TRAP

    [0075] Functional evaluation of the TERT expression product is achieved using a standard TRAP assay. TRAP, Telomerase Repeated Amplification Protocol, is performed in the following manner Clonally isolated cell populations determined to possess the TERT construct are plated at equal concentrations alongside cells not containing the TERT construct (untreated cell comparator) and incubated until 80% confluence at 37 C. under 5% CO.sub.2, 5% O.sub.2 atmospheric conditions. Cells are then washed, collected, pelleted, and lysed to collect intracellular protein fraction as well as the genomic DNA. Using a commercially available TRAP assay kit (TRAPeze Telomerase Detection Kit, EMD Millipore) containing the necessary reagents and buffers, PCR amplification is performed on the genomic DNA. The result is run on a non-denaturing acrylamide gel to resolve banding patterns indicative of the presence of an active telomerase (i.e., the pattern of ladder banding that positively correlates with increased active telomerase or its absence).

    CONCLUSION

    [0076] The invention is not limited by the specific techniques used to decouple of retinoblastoma protein suppression of cell division cycle advancement during replicative senescence. In addition to these specific techniques named herein, this suppression can be achieved by other techniques. Examples of such techniques include, but are not limited to the following: (1) Silencing of RNA translation by short-hairpin RNA (FIG. 8); (2) Modulation of endogenous gene expression by guide RNA-targeted nuclease-deficient Cas9 (FIGS. 5 & 6); (3) Lentivirus vector, retrovirus vector, transfected DNA or homologous recombination-directed genetic engineering; (4) Direct targeting inhibition of pRB function or gene expression by methods modeled in FIGS. 4, 6, 7, and 8 to disrupt gene expression from the RB1 locus; (5) Ectopic overexpression of wild-type cyclin-dependent kinase homologs such as CDK6 and CDK2, as well as mutant CDK homologs refractory to CM inhibition, such as CDK4R24C (Wlfel et. al., 1995; Science Vol. 269 pp 1281-1284); (6) Simultaneous disruption of both p15 and p16 function in cells whose species identity features both transcripts; and (7) Disruption of retinoblastoma family protein function using a virus protein targeting retinoblastoma family proteins containing a motif homologous to a pentapeptide motif containing Leucine-X-Cysteine-X-Glutamic Acid.

    [0077] Though one embodiment of this process results in cultivation of animal biomass for dietary consumption, other applications include bioprocesses for production of textiles such as leather; and medical uses such as therapeutic tissues and vaccines. In addition, given the rapidly increasing global demands for meat, the resource requirements and ecological impacts of meat consumption, clonal, fully myogenic and immortalized livestock cell lines could provide valuable resource in understanding the mechanisms of skeletal muscle development in livestock, improving livestock weight gain, veterinary and other veterinary applications. It should also be understood that the uses described within the scope of this invention encompass, do not exclude, and are not restricted from: (1) applications for cell lines whose genetic identity does not originate from animal species prevalent in agriculture; and (2) the production of animal biomass from ontological cell lineages of tissues other than skeletal muscle.

    [0078] The taxonomic scope of the present invention and process encompasses species accepted as poultry, including, but not limited to, Gallus gallus, Meleagris gallopavo and Anas platyrhynchos, species accepted as livestock, including, but not limited to, Bos taurus, Sus scrofa and Ovis aries, and species accepted as seafood, including, but not limited to, Salmo salar, Thunnus thynnus, Gadus morhua, Homarus americanus and Litopenaeus setiferus.