GENETICALLY ENGINEERED PSEUDOMONAS STRAINS CAPABLE OF METABOLIZING ETHYLENE GLYCOL AND ITS METABOLIC INTERMEDIATES
20190024126 ยท 2019-01-24
Inventors
- Gregg Tyler Beckham (Golden, CO)
- Mary Ann Franden (Centennial, CO)
- Lahiru N. Jayakody (Wheat Ridge, CO)
- Nick Johannes Petrus Wierckx (Bemelen, NL)
- Janosch Alexander Klebensberger (Stuttgart, DE)
- Lars Mathias Blank (Dortmund, DE)
- Wing-Jin LI (Aachen, DE)
- Bernhard Hauer (Stuttgart, DE)
- Nicholas S. Cleveland (Golden, CO)
- William E. Michener (Golden, CO)
Cpc classification
C12Y202/01005
CHEMISTRY; METALLURGY
C12N2500/50
CHEMISTRY; METALLURGY
C12N9/1022
CHEMISTRY; METALLURGY
International classification
Abstract
Presented herein are genetically engineered Pseudomonas strains capable of metabolizing ethylene glycol and producing polyhydroxyalkanoates.
Claims
1. A genetically engineered Pseudomonas capable of growth on ethylene glycol as a sole carbon source.
2. The genetically engineered Pseudomonas of claim 1 comprising exogenous genes gcl, hyi, glxR, PP_4300, pykF, and glcDEF.
3. The genetically engineered Pseudomonas of claim 1 capable of expressing an exogenous gcl (glyoxylate carboligase) operon.
4. The genetically engineered Pseudomonas of claim 1 capable of expressing an exogenous glycolate oxidase.
5. The genetically engineered Pseudomonas of claim 1 capable of expressing an exogenous gcl operon and expressing an exogenous glycolate oxidase operon (glcDEF).
6. The genetically engineered Pseudomonas of claim 1 capable of expressing exogenous genes selected from the group consisting of gcl, hyi, glxR, PP_4300 and pykF.
7. The genetically engineered Pseudomonas of claim 1 capable of expressing exogenous genes selected from the group consisting of gcl, hyi, glxR, PP_4300, pykF, and glcDEF.
8. The genetically engineered Pseudomonas of claim 1 selected from the group consisting of MFL185, and MFL168.
9. The genetically engineered Pseudomonas of claim 1 that is capable of growth in media containing up to about 2 M ethylene glycol.
10. The genetically engineered Pseudomonas of claim 2 wherein said exogenous genes are inserted into the genome of the Pseudomonas.
11. The genetically engineered Pseudomonas of claim 2 wherein said exogenous genes are inserted into the genome of the Pseudomonas between fpyA and PP_4218.
12. The genetically engineered Pseudomonas of claim 10 wherein said exogenous genes are under the control of an exogenous promoter.
13. The genetically engineered Pseudomonas of claim 1 capable of consuming up to 0.16 g/L/h of ethylene glycol.
14. The genetically engineered Pseudomonas of claim 1 capable of consuming 500 mM ethylene glycol within 120 hours.
15. The genetically engineered Pseudomonas of claim 2 comprising exogenous copies of gcl, hyi, glxR, PP_4300, and pykF, having greater than 90% identity with gcl, hyi, glxR, PP_4300, and pykF in SEQ ID NO: 4.
16. The genetically engineered Pseudomonas of claim 2 comprising exogenous copies of glcDEF having greater than 90% sequence identity with glcDEF from SEQ ID NO: 1.
17. The genetically engineered Pseudomonas of claim 2 comprising exogenous copies of gcl, hyi, glxR, PP_4300, and pykF having greater than 90% identity with gcl, hyi, glxR, PP_4300, and pykF in SEQ ID NO: 4, and glcDEF having greater than 90% sequence identity with glcDEF from SEQ ID NO: 1.
18. A genetically engineered Pseudomonas capable of growth on ethylene glycol as a sole carbon source wherein the Pseudomonas comprises exogenous genes gcl, hyi, glxR, PP_4300, pykF, and glcDEF and is capable of making polyhydroxyalkanoates.
19. The genetically engineered Pseudomonas of claim 18 capable of producing polyhydroxyalkanoates at up to 0.06 grams per gram of dried cellular weight (DCW).
20. The genetically engineered Pseudomonas of claim 18 wherein said polyhydroxyalkanoates are derived from the metabolism of ethylene glycol.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
DETAILED DESCRIPTION
[0035] Wildtype P. putida KT2440 cannot grow on ethylene glycol as a sole carbon source. As disclosed herein, adaptive laboratory evolution experiments performed on wildtype strains of P. putida resulted in non-naturally occurring P. putida KT2440 mutants that can use ethylene glycol as their sole carbon source. The metabolism of ethylene glycol and its derivatives plays a pivotal role in the biotechnological utilization of plastic waste and lignin, and its oxidation products glycolic and glyoxylic acid are valued commodity chemicals. The characterization of the metabolic pathways in these mutants is useful for engineering Pseudomonas strains for the production of compounds of interest, and for using ethylene glycol as a redox energy yielding co-substrate. In an embodiment, the genetically engineered Pseudomonas strains disclosed herein can be used for the metabolism of glycoaldehyde.
[0036] A metabolic engineering approach to convert ethylene glycol into cellular biomass is disclosed herein. Although, P. putida KT2440 has all the genes necessary for growth in ethylene glycol, it is prevented from doing so, by its own regulation. By overexpressing the gcl operon, ethylene glycol can be used for cell growth. An exogenous gene or genes have been introduced into a genetically engineered organism and/or integrated into the genome of a genetically engineered organism resulting in a non-naturally occurring, genetically engineered organism. In an embodiment the engineered organisms disclosed herein express and/or overexpress glc operon and/or gcl operons that are exogenous.
[0037] In an embodiment, the genes introduced into the genetically engineered Putida organisms disclosed herein are exogenous. The exogenous genes may be additional copies of native genes in the genetically engineered organism. In an embodiment the genes introduced into engineered Putida strains disclosed herein are additional copies of native genes. In an embodiment, the genes introduced into engineered Putida strains disclosed herein are additional copies of native genes and are under the control of exogenous promoters.
[0038] As depicted herein, the quantitative physiological characterization of ethylene glycol co-metabolism by P. putida KT2440 provides valuable insights for the production of the latter value-added chemicals, and also identifies opportunities and bottlenecks for the use of ethylene glycol as a redox energy yielding co-substrate.
[0039] Experiments were performed to expand the ability of P. putida to both use and produce substrates of industrial interest by enhancing its metabolism of ethylene glycol via metabolic engineering through the overexpression of existing regulated pathways that include the glyoxylate carboligase (gcl) operon. Growth in concentrations of ethylene glycol above 50 mM was inhibited by the accumulation of toxic intermediates, glycolaldehyde and glyoxal. The additional overexpression of glycolate oxidase (glcDEF) operon removes the glycolate bottleneck and minimizes the production of these toxic intermediates, permitting the growth in up to 2 M (120 g/L) and consumption of greater than about 0.5 M (30 g/L) of ethylene glycol.
[0040] Ethylene glycol is used as a raw material in the production of polyethylene terephthalate, in antifreeze, as a gas hydrate inhibitor in pipelines, and for many other industrial applications. It is metabolized by aerobic microbial processes via the highly toxic intermediates glycolaldehyde and glycolate through C2 metabolic pathways. Pseudomonas putida KT2440, which has been engineered for environmental remediation applications given its high toxicity tolerance and broad substrate specificity, is not able to efficiently metabolize ethylene glycol, despite harboring putative genes for this purpose. To further expand the metabolic portfolio of P. putida, we elucidated the metabolic pathway to enable ethylene glycol via systematic overexpression of glyoxylate carboligase (gcl) in combination with other genes. Quantitative reverse transcription polymerase chain reaction demonstrated that all of the four genes in genomic proximity to gcl (hyi, glxR, ttuD, and pykF) are transcribed as an operon. Where the expression of only two genes (gcl and glxR) resulted in growth in ethylene glycol, improved growth and ethylene glycol utilization were observed when the entire gcl operon was expressed. Both glycolaldehyde and glyoxal inhibit growth in concentrations of ethylene glycol above 50 mM. To overcome this bottleneck, the additional overexpression of the glycolate oxidase (glcDEF) operon removes the glycolate bottleneck and minimizes the production of these toxic intermediates, permitting growth in up to 2 M (124 g/L) and complete consumption of 0.5 M (31 g/L) ethylene glycol in shake flask experiments. In addition, the engineered strain enables conversion of ethylene glycol to medium-chain-length polyhydroxyalkanoates (mcl-PHAs). Overall, the methods and non-naturally occurring genetically modified organisms disclosed herein result in P. putida KT2440 strains that are now useful for ethylene glycol consumption, and can serve as a biocatalyst for applications in the remediation of waste polyester plastics and biomass-derived wastewater streams.
[0041] Ethylene glycol is a large-volume industrial chemical used for myriad applications including for the production of polyester plastics such as polyethylene terephthalate (PET), as a coolant in antifreeze, as a deicing fluid for aircraft, and as an inhibitor of clathrate hydrate formation in natural gas pipelines. Because of its widespread use, it is a common pollutant in the environment, where it is broken down either chemically or biologically. Plastic wastes, including ethylene glycol and terephthalic acid, offer novel substrates for industrial biotechnology to convert into value-added products, especially given the worldwide concern over plastic accumulation in the biosphere.
[0042] Aerobic ethylene glycol metabolism also generates the highly toxic intermediate glycolaldehyde. Besides being a metabolic intermediate in ethylene glycol metabolism, this compound is also often a significant component of lignocellulose-derived streams, and can also be present in pyrolysis wastewater in concentrations as high as 50 g/kg. Currently, wastewater streams containing significant amounts of glycolaldehyde from biomass pyrolysis are sent to thermal wastewater treatment processes, but converting this carbon to a value-added co-product stream would improve biorefinery economics.
[0043] From an environmental perspective, disposal of ethylene glycol or its intermediate, glycolaldehyde, poses serious environmental problems. Soil bacteria, such as pseudomonads, are likely responsible for a substantial extent of ethylene glycol catabolism in the environment. The obligate aerobic organism P. putida KT2440 uses ethylene glycol only as a source for the production of reducing equivalents and energy, whereas ethylene glycol enables biomass formation in other P. putida strains, such as JM37. Through comparative proteomics of these two P. putida strains, the catabolism of ethylene glycol in P. putida KT2440 was proposed to proceed via two functionally redundant, periplasmic quinoproteins PedE and PedH and the subsequent activity of the two cytoplasmic aldehyde dehydrogenases PP_0545 and PedI, together with the membrane anchored oxidase GlcDEF, yielding glyoxylic acid (
[0044] In contrast to the productive use of ethylene glycol by other strains of P. putida, the lack of growth of P. putida KT2440 on ethylene glycol is puzzling, as the organism exhibits the genomic inventory to use ethylene glycol as a carbon source through the initial ligation of two glyoxylate molecules to tartronate semialdehyde by the glyoxylate carboligase (Gcl) enzyme. According to the Pseudomonas Genome Database predictions, the enzymes adjacent to gcl encode hydroxypyruvate isomerase (hyi), tartronate semialdehyde reductase (glxR), hydroxypyruvate reductase (ttuD), and pyruvate kinase (pykF), which could, together with glycerate kinase (garK) encoded on a different locus of the genome, allow conversion of glyoxylic acid into biomass. The lack of growth with ethylene glycol in native, naturally occurring P. putida KT2440 is caused by an unknown regulatory mechanism, which prevents the functional production of the aforementioned enzymes necessary to use ethylene glycol for growth. As disclosed herein, by using adaptive laboratory evolution techniques, it was discovered that the observed lack of growth with ethylene glycol is caused by an unknown regulatory mechanism wherein repression of gcl-operon genes is overcome by a mutation in a specific transcriptional regulator.
[0045] In the present disclosure, we demonstrate that efficient glyoxylate and ethylene glycol conversion into biomass involves the constitutive expression of gcl in addition to genes in proximity of gcl. Contrary to operon prediction software, transcriptomic analysis reveals that the operon consists of four other genes contiguous to gcl (hyi, glxR, ttuD, and pykF), permitting a different and more effective path from glyoxylate to glycerate, via hydroxypyruvate. An additional bottleneck was discovered at the metabolite glycolate as concentrations of substrate increased, resulting in the accumulation of a toxic intermediate (glycolaldehyde). The overproduction of the native glycolate oxidase operon (glcDEF) resolves this bottleneck, which leads to increased metabolic flux, and decreases the accumulation of toxic intermediates, transforming P. putida KT2440 into an efficient ethylene glycol-metabolizing strain. Also, disclosed herein are engineered strains that enable efficient conversion of ethylene glycol into medium-chain-length polyhydroxyalkanoates (mcl-PHAs), a high value chemical building block. Engineered P. putida strains disclosed herein can serve as a foundation for conversion of both ethylene glycol from plastic waste and glycolaldehyde in biomass-derived wastewater streams.
[0046] In an embodiment, disclosed herein are engineered P. putida strains that are capable of the expression of two exogenous genes (gcl and glxR) that confer the ability of engineered P. putida to grown on ethylene glycol. In an embodiment, engineered P. putida strains are disclosed that comprise a gcl operon that contains the genes gcl, hyi, glxR, ttuD, and pykF that allows for growth and/or improved growth in ethylene glycol. In another embodiment, P. putida strains are disclosed herein that are capable of overexpression of glycolate oxidase which removes a glycolate metabolic bottleneck. In an embodiment, disclosed herein are engineered P. putida KT2440 strains that consume up to about 31 g/L of ethylene glycol. In another embodiment, disclosed herein are engineered P. putida KT2440 strains capable of producing mcl-PHAs from ethylene glycol.
[0047] Plasmid Construction
[0048] Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and primers synthesized by Integrated DNA Technologies (IDT) were used in all PCR amplification. Plasmids were constructed using Gibson Assembly Master Mix (New England Biolabs) according to the manufacturer's instructions. Primers used for PCR amplification and Gibson assembly are listed in Table 1.
[0049] Table 1 contains primers used for creating plasmid and integration constructs. Underlined nucleotides denote homology to a target gene. Nucleotides in bold font are restriction sites.
TABLE-US-00001 TABLE1 TemplateUsed For Primer forPCR Construction ID PrimerSequence (region) of oMFL158 gagaGCGGCCGCGAATTCAAGCTT pBTL-2(NotI pMFL115 GATATCATTCAGGAC upstreamfrom soxRterm) oMFL159 gagaCCTGCAGGGAATTCTCTAGA pBTL-2(SbfI pMFL115 GTGTGAAATTGTTATCCG downstream fromlac promoter) oMFL160 gagaCCTGCAGGGGGCCTAGATAT KT2440 pMFL113, AGGAGGAATAACCATGAGCAAAA (upstream pMFL114, TGAGAGCAATCGATG targeting5 of pMFL116, gclwithSbfI pMFL117 siteandRBS) oMFL161 gagaTTAATTAAATTCGCGGCCGC KT2440 pMFL113, TCAGTCCAGCAGCGAGATGG (downstream pMFL116 targeting3 of gclwith NotIPacIsites) oMFL162 gagaGCGGCCGCGATTAGTCAGGT KT2440 pMFL115, AAGGAGCCTAATTATGACTGGAT (upstream pMFL117 ACGTTCAAGTCGGTG targeting5 of glcBwithNotI siteandRBS) oMFL163 gagaTTAATTAATTACAACCCGTTA KT2440 pMFL115, CGCGCCT (downstream pMFL117 targeting3 of glcBwithPacI sites) oMFL164 gagaTTAATTAAATTCGCGGCCGC KT2440 pMFL114, TCAGATCAAAGTCTCGATCCGCA (downstream pMFL117 G targeting3 of gcloperonwith PacIsite) oMFL165 gagaTTAATTAAGAATTCAAGCTTG pBTL-2(PacI pMFL113, ATATCATTCAGGAC upstreamfrom pMFL114, soxRterm) pMFL116, pMFL117 oMFL166 gagaCCTGCAGGGATTAGTCAGGT KT2440 pMFL115 AAGGAGCCTAATTATGACTGGAT (upstream ACGTTCAAGTCGGTG targeting5 of glcBwithSbfI siteandRBS) oMFL167 gagaGCGGCCGCTTACAACCCGTT KT2440 pMFL115 ACGCGCCT (downstream targeting3 of glcBwithNotI sites) oCJ288 CTAGCTTCACGCTGCCGCAAG pK18mobsacB pMFL161 aroundthe pMFL160 worldF oCJ289 CTAACTCACATTAATTGCGTTGCG pK18mobsacB pMFL161 CTCACTG aroundthe pMFL160 worldR oCJ301 AGTGAGCGCAACGCAATTAATGT Upstream pMFL161 GAGTTAGAAGCCGAATGTCGATG targeting3 of pMFL160 ATATCTACAACCTGAG fpvAFwith pK18mobsacB overlapin italics oCJ302X CCTCCTCTCTAGAGTGTGAAATTG Upstream pMFL161 TTATCCGCTCACAATTCCACACAT targeting3 of pMFL160 TATACGAGCCGATGATTAATTGTC fpvARwith AACAGCTCGAATTCAAAAAACCG native CACCTGGGTGCG terminator, Ptac,andXbaI oCJ306X ATTCAGACTAGTAGTCAAAAGCC Downstream pMFL161 X TCCGACCGGAGGCTTTTGACTCAT targeting3 of pMFL160 GGATGCCTGAAAGGCTCCCTTAC fpvAFwith tonBterminator andSpeIsite oCJ307 CCCTGAGTGCTTGCGGCAGCGTG Downstream pMFL161 AAGCTAGGCCCCTCTGGAGAATC targeting3 of pMFL160 GAACGATG fpvARwith pK18mobsacB overlapin italics oMFL276 CACACTCTAGAGAGGAGGACAGC Targeting5 of pMFL161 TATGAGCAAAATGAGAGCAATCG KT2440gcl pMFL160 AT operonF (underlined) withoverlapto PtacandRBS (oCJ302*)with XbaIsite oMFL279 ACTACTAGTTTATTTGTCGTCGCG Targeting3 of pMFL160 GATCGAGAAG KT2440glxRR (underlined) andSpeIsite oMFL280 ACTACTAGTTCAGATCAAAGTCT Targeting3 of pMFL161 CGATCCGC KT2440gcl operon(pykF)R (underlined) andSpeIsite oLJ100 GACATGATTACGAATTCGAGCTC Upstream pLJ030 GGTACCCTTCGCGGCGGTTCGACG targetingof C region5 of glcCwith overlapto pK18mobsacB (italics) oLJ101 GGTGCGGTTTTTTGCGCGGCTCAC Downstream pLJ030 TCGCAACGGTTTTTG targetingregion immediately5 ofglcDwith overlaptosoxR terminator (italics) oLJ102 GTTGCGAGTGAGCCGCGCAAAAA Upstream pLJ030 ACCGCACCCAGGTGCGGTTTTTTG targeting5 of AATTCGAGCTGTTGACAATTAATC glcDincluding ATCGGCTCGTATAATGTGTCAGAC soxRterminator TCAATAATAATAATAAGGAGGTA andtac TCGAATGAATATCCTGTACGACG promoterand AACGC RBSwith overlapto3 endofglcC (italics)and oLJ101 oLJ103 CGGCCAGTGCCAAGCTTGCATGC Downstream pLJ030 CTGCAGGAGGTGCACCTCGCGGG targetingregion CC immediately3 ofglcDwith overlapto pK18mobsacB (italics) oLJ110 GCGGATAACAATTTCACACTAAA Targeting5 of pJL032 GTTAATATTAAGGAGGTAAACAT KT2440gclF GAGCAAAATGAGAGCAATC (underlined) withoverlapto pMFL160 (italics)and RBS oLJ111 GTTAGTTGTCGTTTTGATATCAGT Targeting3 of pJL032 CCAGCAGCGAGATG KT2440gclR (underlined) withoverlapto 5 ofglxRwith RBS oLJ112 GCTGGACTGATATCAAAACGACA Targeting5 of pJL032 ACTAACTAAGGAGGTACACTATG KT2440glxR GCTAAAATCGGTTTCATC (underlined) withoverlapto 3 ofgclwith RBS oLJ113 CGGTCGGAGGCTTTTGACTATTAT Targeting3 of pJL032 TTGTCGTCGCGGATC KT2440gclR (underlined) withoverlapto pMFL161 (italics)
[0050] The plasmid, pBTL2 was used as the backbone of all plasmid-based overexpression constructs in engineered P. putida KT2440 strains whose dried cellular weight (DCW) and use of ethylene glycol is depicted in
TABLE-US-00002 TABLE 2 Plasmid Strain used for ID Integration Strain genotype Strain description MFL1 P. putida KT2440 Wild-type (WT) strain also (KT2440) designated as KT2440 MFL142 KT2440 pBTL-2 WT strain with control plasmid (pBTL2) MFL113 KT2440 pBTL2-gcl WT strain with plasmid expressing only gcl MFL114 KT2440 pBTL2-gcl operon WT strain with plasmid expressing gcl operon MFL115 KT2440 pBTL2-glcB WT strain with plasmid expressing only glcB MFL116 KT2440 pBTL2-gcl-glcB WT strain with plasmid expressing gcl and glcB MFL117 KT2440 pBTL2-gcl- WT strain with plasmid expressing operon-glcB gcl operon and glcB MFL168 pMFL161 KT2440 fpvA::P.sub.tac::gcl-hyi- Strain expressing gcl operon glxR-ttuD-pykF integrated between fpvA and PP 4218 MFL170 pMFL160 KT2440 fpvA::P.sub.tac::gcl-hyi- Strain expressing gcl-hyi-glxR glxR integrated between fpvA and PP_4218 mFL185 pMFL161 KT2440 fpvA::P.sub.tac::gcl-hyi- Strain expressing gcl operon and pLJ030 glxR-ttuD-pykF, integrated between fpvA and andP.sub.tac::glcDEF PP_4218 and with tac promoter integrated in front of glcDEF:PP 3748:PP3749 operon MFL186 pLJ030 KT2440 Ptac::glcDEF Strain with tad promoter integrated in front of glcDEF:PP_3748:PP3749 operon MFL188 pLJ032 KT2440 fpvA::P.sub.tac::gcl- Strain expressing gcl-glxR glxR integrated between fpvA and PP_4218
[0051] Plasmids for gene integration were constructed in plasmid pK18mobsacB from ATCC (American Type Culture Collection, Manassas, Va.), which is unable to replicate in P. putida KT2440, and contains the kanamycin-resistant marker to select for integration of the plasmid into the genome by homologous recombination and sacB to counterselect for a second recombination event to subsequently remove the plasmid backbone from the genome.
[0052] The plasmids, pMFL160 and pMFL161, used for of integration of operons containing the gene gcl in strains MFL168, MFL170, MFL185, and MFL188 were constructed based on the integration vector pK18mobsacB. They contain the 1 kb homology region on either side of the intergenic region immediately after the fpvA (outer membrane ferripyoverdine receptor) terminator and PP_4218 (lipase/esterase) of P. putida KT2440 (see Table 1 for primers used for construction).
[0053] Features include the tac promoter to drive gene expression and a tonB terminator situated behind the fragments cloned into the plasmid backbone, which are depicted in
[0054] Strain Construction
[0055] P. putida KT2440 (ATCC 47054) was used as the strain for engineering and gene replacements that were made using the antibiotic/sacB system of selection and counter-selection. To prepare electrocompetent cells of different P. putida KT2440 strains, we used a modified protocol. Briefly, cultures were grown overnight in LB broth and incubated at 30 C., shaking at 225 rpm. The next day, cells were centrifuged 21,130g in an Eppendorf centrifuge for 1 minute at room temperature, washed three times in 0.3 M sucrose in half the original volume. Finally, the cells were resuspended in 1/50.sup.th of the culture's original volume in 0.3 M sucrose. Cells were immediately used for electroporation by introducing 5 L (200 ng-2 g) of plasmid DNA to 50 L of the electrocompetent cells, transferred to a chilled 0.1 cm electroporation cuvette, and electroporated at 1.6 kV, 25 F, 200. Subsequently, 950 L SOC (NEB) was added and the cells were incubated shaking at 225 rpm, 30 C., for 2 h. The entire transformation was plated on an LB agar plate containing appropriate antibiotics and incubated at 30 C. overnight. Initial colonies from the transformation plates were re-streaked on selective LB agar plates and grown at 30 C. overnight to obtain clonal transformants. For sucrose counter-selection, clonal transformants were streaked on YT plates containing 25% (YT+25%; w/v) sucrose (10 g/L yeast extract, 20 g/L tryptone, 250 g/L sucrose, 18 g/L agar), and incubated at 30 C. overnight. P. putida KT2440 containing the sacB gene can grow on YT+25% sucrose media. Therefore, single colonies presumed to have lost the sacB gene via homologous recombination, indicated by larger colonies, were picked and re-streaked on fresh YT+25% sucrose plates and incubated at 30 C. overnight to finally obtain clonal sucrose resistant and antibiotic sensitive strains. All strains were analyzed for the correct gene replacement by performing a colony PCR at the site of integration. Table 2 lists the specific strains produced in this work and the plasmids used for the integration.
[0056] Culture Growth and Metabolite Analysis
[0057] Shake flask experiments were performed using M9 minimal media (Sigma-Aldrich) containing 6.78 g/L disodium phosphate, 3 g/L monopotassium phosphate, 0.5 g/L NaCl, 1 g/L NH.sub.4Cl, 2 mM MgSO.sub.4, 100 M CaCl.sub.2, and 40 M FeSO.sub.4.7H.sub.2O supplemented with 20 mM glucose (Fisher Scientific), ethylene glycol, or sodium acetate (Sigma-Aldrich). For analysis of mcl-PHA production, nitrogen-limiting M9 medium was prepared by substituting 1 g/L of NH.sub.4Cl with 0.132 g/L of (NH.sub.4).sub.2SO.sub.4 (Sigma-Aldrich). For growth experiments with ethylene glycol, glyoxylate, or glycolaldehyde, overnight cultures were harvested, washed in M9 minimal media without a carbon source, and used for inoculation of fresh medium to an OD.sub.600 of 0.1 and at OD.sub.600 of 0.5 for cultures grown in 2 M9 salts. Cultures were grown with a volume of 25 mL in 125 mL baffled shake flasks, incubated at 30 C. with shaking at 225 rpm. Growth of the cultures was followed by periodic measurement of the optical density at 600 nm (OD.sub.600) using a Beckman DU640 spectrophotometer (Beckman Coulter, Brea Calif.). The dry cell weight of samples (DCW) was calculated by using the conversion factor y=0.5746x, where y is DCW in g/L and x=OD.sub.600, supported by experimental data that included OD.sub.600 measurement values<3.3. Except for experiments conducted with plasmid-bearing strains, all shake flask cultures were performed in duplicate. Concentrations of glucose, ethylene glycol, glycolaldehyde, glyoxal, glycolate, glyoxylate, and oxalate in sterile-filtered culture supernatants were measured with high performance liquid chromatography (HPLC) on an Agilent1100 series system (Agilent USA, Santa Clara, Calif.) utilizing a Phenomenex Rezex RFQ-Fast Fruit H+ column (Phenomenex, Torrance, Calif.) and cation H+ guard cartridge (Bio-Rad Laboratories, Hercules, Calif.) at 85 C. A mobile phase of 0.1 N sulfuric acid was used at a flow rate of 1.0 mL/min and a diode array detector was utilized for compound detection. Products were identified by comparing the retention times and spectral profiles with pure compounds and were calculated based on a calibration curve generated for each compound. To quantify yield and composition of mcl-PHAs as a percent of the dry cell weight in cultures growth in media containing ethylene glycol or acetate, shake-flask experiments were performed in 250-mL Erlenmeyer flask filled with 50 mL of nitrogen-limiting M9 medium-containing 100 mM of ethylene glycol. The detailed descriptions of microscopic observations and analytical quantification of mcl-PHA are described below.
[0058] mcl-PHA Observation, Quantification, and Characterization
[0059] Medium chain length PHA formation in P. putida KT2440 was observed by using an epifluorescence Nikon Eclipse 80i microscope. One mL samples were taken from ethylene glycol-containing shake flask cultures. Cells were pelleted by centrifugation at 13,000 rpm for 1 min, washed twice with 1 phosphate buffer saline (PBS), resuspended in 1 mL PBS-containing 10 g/mL Nile Red (Molecular probes, Invitrogen Cooperation, USA), and incubated at room temperature in the dark for 30 min. Cells were pelleted again, washed twice with 1 PBS, and resuspended in 1 mL PBS. 5 L of resuspended cells were mixed with 5 L of 1% (w/v) low-melting-temperature agarose to immobilize the cells and placed on a microscopic slide with coverslip. Nile Red fluorescence was observed with band-pass filtering between 560-590 nm.
[0060] Fluorescence-activated cell sorting (FACS) analysis of mcl-PHAs: Time course of mcl-PHA production of P. putida was monitored using a BD FACSAria (BD Biosciences, USA) instrument equipped with BD FACSDiva data acquisition and analytical software. After cells were stained with Nile Red as previously described, cell pellets were washed twice with PBS solution and resuspended in BD FACSFlow sheath fluid (BD Biosciences, USA) for analysis. Samples were loaded into FACS, mcl-PHA content of cells were monitored using the 488 nm (exited) laser coupled with B610-20A (610 nm) detection channels, and 20,000 events were recorded to generate the histograms for obtaining mean fluorescents.
[0061] Analysis of mcl-PHA quantity and composition: Extraction and quantification of mcl-PHAs in P. putida was performed. Samples were prepared for derivatization by adding about 30 mg of biomass to a gas chromatography glass (GC) vial. To track derivatization, 25 L of benzoic acid (Sigma Aldrich) dissolved in dichloromethane (8 mg/mL) was added as an internal surrogate. Samples were derivatized by adding about 1 mL of 20% BF.sub.3/MeOH to the GC vial, which was sealed, vortexed, and placed in a heating block at 80 C. for about 16 hrs. Vials were then removed from the heating block and allowed to cool to room temperature. Vial contents were pipetted into a 10 mL volumetric flask and the vial residual was rinsed twice with dichloromethane (DCM) (Sigma Aldrich) before filling the flask to 10 mL total with additional DCM. The 10 mL solution was transferred to a (polytetrafluoroethylene) PTFE capped vial and about 3 mL of water was added to form a bi-phase and vortexed to wash out residual BF3 to the aqueous layer. The DCM layer (2 mL) was then transferred into another gram vial containing Na.sub.2SO.sub.4 and Na.sub.2CO.sub.3 to dry and neutralize any remaining BF.sub.3. The dried and neutralized solutions were syringe filtered (0.2 m PTFE) into fresh GC vials for analysis. To track recovery of PHAs during sample derivatization and analysis, triplicate biomass samples of P. putida KT2440 grown at NREL were processed in parallel. Recovery yields during sample workup were calculated based on a cell dry weight PHA content of 24% determined by bulk sample solvent extraction. Hydroxyacid methyl esters were identified and the distribution quantified by gas chromatography mass spectroscopy (GC-MS) using an Agilent 6890N GC equipped with a 5973 MSD (Agilent Technologies). Agilent MSD Productivity Chemstation G1701 software was used to collect and quantitate analytes. 8-Hydroxyoctanoic acid methyl ester, 10-hydroxydecanoic acid methyl ester, 12-hydroxydodecanoic acid methyl ester, and 14-hydroxytetradecanoic acid methyl ester were obtained from Matreya (98+ percent purity, Matreya, State College, Pa., USA), and used to determine the GC-MS instrument response. Samples were injected at a volume of 1 L onto a Stabilwax-DA (Restek, Bellefonte, Pa.) column (30 m0.25-mm id, 0.25-m film) in splitless mode, with helium at 1 mL/min constant flow used as the carrier gas. The GC/MS method consisted of a front inlet temperature of 250 C., and an auxiliary transfer line temperature of 260 C. The separation used had a starting temperature of 35 C. and this was held for 5 min, then ramped at 15 C./min to a temperature of 225 C. and held for 2.0 minutes, then ramped at 15 C./min to a temperature of 250 C. and held for 5.67 minutes with a solvent delay time of 6 minutes, for a total run time of 27 min. Sample total ion counts were collected on the mass spectrometer at scan range from 30 to 450 m/z. Calibration curves where made by using target ions and diluting the derivatized standards between a concentration of 10-1000 g/L. A minimum of seven calibration levels was used resulting in an r.sup.2 coefficient of 0.995 or better for each analyte and a check calibration standard (CCS) was analyzed every ten samples to insure the integrity of the initial calibration. An internal standard of 1,2-diphenylbenzene (99.9+ percent purity, AccuStandard, New Haven, Conn.) was added to all standards and samples at a concentration of 20 ug/L to adjust for any detector response changes.
[0062] Toxicity Tests and Competitive Inhibition Assays
[0063] Toxicity tests and competitive inhibition assays were performed using Bioscreen C MBR analyzers (Growth Curves US, Piscataway, N.J.). For toxicity tests, overnight cultures of P. putida KT2440 were grown in M9 medium containing 20 mM glucose starting at an OD.sub.600 of 0.05-0.1 at 30 C. with shaking at 225 rpm in baffled shake flasks until the OD.sub.600 reached about 1.0-1.5. Cells were subsequently concentrated by centrifugation and inoculated into wells of Bioscreen C microplates at an initial OD.sub.600=0.05. Each well contained a total volume of 300 L M9 medium, 20 mM glucose, and inhibitors at various concentrations. Incubations were performed at 30 C. with maximum shaking. Absorbance readings were taken every 15 min. For competitive inhibition assays, individual wells of the plate were filled with 200 L of M9 medium containing 20 mM glucose and a respective concentration of glycolaldehyde and glyoxal according to full-factorial test run results of which are presented in Table 3 and depicted in graphical form in
TABLE-US-00003 TABLE 3 Inhibitory effects of glycolaldehyde and glyoxal on P. putida KT2440 growth Test Glycolaldehyde Glyoxal Growth (Run#) (mM) (mM) Rate(1/h) SEM 1 0 1.0 0.297 0.001 2 0 1.5 0.280 0.006 3 0 2.0 0.246 0.002 4 1.0 1.0 0.187 0.001 5 1.0 1.5 0.145 0.001 6 1.0 2.0 0.102 0.000 7 1.5 1.0 0.181 0.002 8 1.5 1.5 0.094 0.001 9 1.5 2.0 0.003 0.000 10 2.0 1.0 0.010 0.001 11 2.0 1.5 0.001 0.000 12 2.0 2.0 0.001 0.001 13 1.0 0 0.281 0.001 14 1.5 0 0.221 0.001 15 2 0 0.218 0.002 16 0 0 0.337 0.002
[0064] RNA Extraction, cDNA Synthesis and Quantitative Reverse Transcription Polymerase Chain Reaction (qRT-PCR)
[0065] To prepare P. putida cultures for RNA extraction, cells were grown overnight in M9 minimal medium containing 20 mM glucose in baffled shake flasks at 30 C., 225 rpm. Cells were then diluted and used to inoculate fresh cultures containing 20 mM ethylene glycol and 40 mM sodium acetate to an initial OD.sub.600 of 0.1. After incubation at 30 C. with shaking at 225 rpm to mid-exponential growth phase (OD.sub.600 0.8-1), 2 volume of Qiagen RNAprotect Bacteria Reagent was added to the cultures and allowed to mix for 5 minutes. Subsequently, cells were harvested by centrifugation at 5,000g for 15 min at 4 C. Supernatant was removed and cells were frozen and stored at 80 C. until further analysis. Supernatants of cultures prior to addition of RNAprotect reagent was analyzed for acetate and ethylene glycol by HPLC that showed that substrate was still available. RNA was extracted from cells using Qiagen's RNeasy mini kit following manufacturer's instructions including a DNAse (Qiagen RNase-Free DNase) in column digestion for one hour at room temperature following manufacturer's instructions. After one round of RNA isolation, a DNase digestion was performed (TURBO DNase; Ambion, Austin, Tex., USA). After two hours incubation at 37 C., the DNase was removed from the RNA sample with an additional purification step using the Qiagen's RNeasy mini kit. cDNA was prepared from the purified RNA using an iScript Reverse Transcription supermix kit for RT-qPCR (Bio-Rad). The expression levels of seven genes were analyzed using primers designed by the Realtime PCR tool for RT-qPCR (http://www.idtdna.com/scitools/Applications/RealTimePCR/) and is listed in Table 4.
TABLE-US-00004 TABLE4 ForwardandreverseprimersusedforqRT- PCR. Primer Gene ID PrimerSequence Target oMFL299 (Fw)AGGCATTCGTGAAGTCATGG rpoD oMFL300 (Rw)ATGTAACCGCTGAGAACGTC rpoD oMFL301 (Fw)CTCGCCACTGGATCAACTG gcl oMFL302 (Rw)GAACTGGAAGTCGTAGTCACC gcl oMFL303 (Fw)TGCAGATCATGGAAGGTGAC hyi oMFL304 (Rw)CAGGAAGCGGTAGTTGATCTC hyi oMFL305 (Fw)AAAGAGGTTGCCCAGGAAG glxR oMFL306 (Rw)CGAGCTCATGTCGATCACC glxR oMFL307 (Fw)CCATCCTCAAACGCTACAAC ttuD oMFL308 (Rw)TGGCGATCAACTGGAAGTG ttuD oMFL309 (Fw)ACATCTTCCGCCTCAACTTC pykF oMFL310 (Rw)TTGCAGGTCCATGAGGATG pykF oMFL325 (Fw)AACTGAAGCTGATCCTGGTG PP_0762 oMFL326 (Rw)AGGGTATGCTGGGCTACA PP_0762
[0066] Quantitative RT-PCR was performed using iQ SYBR Green Supermix (Bio-Rad) on a Bio-Rad CFX96 Touch Real-Time PCR Detection System (Bio-Rad Lab, Hercules, Calif., USA). The reaction conditions were 10 min at 95 C., 39(15 s at 95 C., 45 s at 55 C., followed by melting curve analysis: 1 min at 95 C., 81(30 s starting at 55 C., increasing 0.5 C. per cycle, ending at 95 C.). Experiments were performed in triplicate with biological duplicates. The gene expression levels were assessed by comparing the Ct value of the house keeping gene rpoD to the Ct value of the target gene using the following formula:
Gene expression level=2.sup.Ct(rpoD)Ct(target)
[0067] Ct values represent the first cycle at which the instrument can distinguish the fluorescence of nucleic acid amplification generated as being above the background signal. Final expression levels were averaged for each target gene and normalized to the expression level of the control (P. putida KT2440) strain.
[0068] Cell Preparation, Extraction, and NAD(P)H Oxidizing Activity Assays
[0069] For extracting whole lysate protein for enzyme assays, strains were grown in LB medium and harvested by centrifugation at 3,828g for 5 min at 4 C. during exponential growth phase. After washing with water twice, cells were finally re-suspended in B-PER (Thermo Fisher Scientific, Waltham, Mass., USA) solution supplemented with protease inhibitor cocktail (Thermo Fisher Scientific). Whole cell lysates were obtained by following the manufacturer recommended protocol (Thermo Fisher Scientific). The protein concentration of samples was assessed using a NanoDrop 2000/c Spectrophotometer (Thermo Fisher Scientific) by following the manufacturer protocol. Hydroxypyruvate reduction activity of samples was measured by monitoring oxidation of NAD(P)H at 340 nm with FLUOstar Omega micro plate reader (BMG Labtech, Ortenberg, Germany). For this, two hundred L of a reaction mixture-containing 150 L of 50 mM potassium phosphate buffer (pH 7), 20 L of 0.5 M lithium (3-hydroxypyruvate hydrate (Sigma-Aldrich, St. Louis, Mo., USA), 20 L of 0.7 mM NAD(P)H, and 10 L of the cell extracts were used for the enzyme activity assay. One unit (1 U) of enzyme was defined by the conversion of 1 M of NAD(P)H into NAD(P).sup.+ per minute. The units were normalized to the total protein content of the corresponding sample (mg).
[0070] Statistical Analysis
[0071] All experiments, except the initial plasmid-bearing strains, were performed in duplicate or triplicates as mentioned in figure legends. The results are expressed in mean values and standard errors of the means (SEM). A one-way analysis of variance (ANOVA) followed by Tukey's post hoc honest significance difference test was adopted for multiple comparisons. Data analysis was performed using KaleidaGraph statistical program (Synergy Software, PA, USA). For a pair-wise comparison of the differences between the sample averages of two groups, a one-tailed Student's t-test without known deviations was employed.
[0072] Growth of P. Putida KT2440 Plasmid-Bearing Strains in Ethylene Glycol
[0073] Given that the gene cluster containing gcl, hyi, glxR, ttuD, and pykF together with glcB are needed for glyoxylic acid catabolism in P. putida KT2440, experiments were performed to identify the minimal enzymatic setup which would allow growth of the organism. As such, various combinations of gcl or the gcl cluster and glcB were cloned into the plasmid pBTL2 under the control of a lac promoter and transformed into P. putida KT2440. Based on the Database of Prokaryotic Operons (DOOR), the gene glcB is predicted to represent a single transcriptional unit (
[0074] Strains constitutively expressing gcl (MFL113), glcB (MFL115), or both (MFL116), do not exhibit any growth in a minimal medium supplemented with 20 mM ethylene glycol (
[0075] Construction of Genomically Engineered P. Putida KT2440
[0076] To ascertain which genes are critical for ethylene glycol metabolism and to provide a base strain for further improvements, different combinations of genes from the gcl cluster were overexpressed in an intergenic region between fpvA and PP_4218 (
[0077] Expression Analysis of Gel Gene Cluster by qRT-PCR
[0078] As mentioned, the genes engineered into MFL168 were predicted to be transcribed in three different transcriptional units, namely gcl-hyi, glxR, and ttuD-pykF. To resolve the question of whether genes located together in this gene cluster are co-expressed, we conducted quantitative real-time PCR experiments to measure transcript levels of gcl, hyi, glxR, ttuD, and pykF. We employed the housekeeping gene, rpoD, to quantify transcript levels between each of our samples using the 2.sup.Ct method.
[0079] As shown below, Ct values obtained for each sample and gene are provided in Table 5 and summarized as fold expression to transcript levels obtained from the control (P. putida KT2440) after normalizing gene expression to rpoD (
TABLE-US-00005 TABLE 5 Ct.sub.Control Biological Sample KT2440-A KT2440-B Technical Replicate 1 2 3 1 2 3 Avg rpoD 19.75 19.89 19.82 20.65 20.29 20.29 20.12 gcl 29.2 29.32 29.11 29.18 29.22 29.23 29.21 hyi 24.75 24.82 24.86 25.43 25.37 25.26 25.08 glxR 27.67 27.46 27.43 27.95 28.09 28 27.77 PP_4300 28.54 28.59 28.55 29.16 29.32 29.05 28.87 pykF 27.45 27.48 27.52 26.82 27.56 28.02 27.48 PP_0762 30.12 30.06 30.13 35.43 37.16 32.58 rpoD (neg)* 35.22 34.45 35.25 33.68 34.76 35.12 34.75 Ct.sub.Control Biological Sample KT2440-A KT2440-B Technical Replicate 1 2 3 1 2 3 Avg rpoD 0 0 0 0 0 0 0.00 gcl 9.45 9.43 9.29 8.53 8.93 8.94 9.10 hyi 5 4.93 5.04 4.78 5.08 4.97 4.97 glxR 7.92 7.57 7.61 7.3 7.8 7.71 7.65 PP_4300 8.79 8.7 8.73 8.51 9.03 8.76 8.75 pykF 7.7 7.59 7.7 6.17 7.27 7.73 7.36 PP_0762 10.37 10.17 10.31 15.14 16.87 12.57 rpoD (neg)* 15.47 14.56 15.43 13.03 14.47 14.83 14.63 2.sup.-Ct.sub.Control Biological Sample KT2440-A KT2440-B Technical Replicate 1 2 3 1 2 3 Avg rpoD 1.00 1.00 1.00 1.00 1.00 1.00 1.00 gcl 0.00 0.00 0.00 0.00 0.00 0.00 0.00 hyi 0.03 0.03 0.03 0.04 0.03 0.03 0.03 glxR 0.00 0.01 0.01 0.01 0.00 0.00 0.01 PP_4300 0.00 0.00 0.00 0.00 0.00 0.00 0.00 pykF 0.00 0.01 0.00 0.01 0.01 0.00 0.01 PP_0762 0.00 0.00 0.00 0.00 0.00 0.00 rpoD (neg)* 0.00 0.00 0.00 0.00 0.00 0.00 0.00 2.sup.-Ct.sub.Control Biological Sample KT2440-A KT2440-B Technical Replicate 1 2 3 1 2 3 Avg rpoD gcl 0.78 0.79 0.87 1.48 1.12 1.11 1.03 hyi 0.98 1.03 0.95 1.14 0.92 1.00 1.00 glxR 0.83 1.06 1.03 1.28 0.90 0.96 1.01 PP_4300 0.97 1.04 1.02 1.18 0.83 1.00 1.01 pykF 0.79 0.85 0.79 2.28 1.06 0.77 1.09 PP_0762 4.60 5.29 4.80 0.17 0.05 2.98 Ct.sub.MFL168 Biological Sample MFL168-A MFL168-B Technical Replicate 1 2 3 1 2 3 rpoD 20.63 20.79 20.68 21.03 21.03 21.09 gcl 19 19.1 18.81 19.23 19.22 19.20 hyi 17.37 17.4 17.3 17.69 17.65 17.69 glxR 19.85 20.04 19.88 20.72 20.37 20.25 PP_4300 22.16 22.13 22.66 22.7 22.43 22.36 pykF 20.12 20.1 19.99 20.06 19.93 19.91 PP_0762 30.04 30.44 29.59 29.56 29.56 29.57 rpoD (neg)* 35.44 35.86 36.66 40 40 35.12 Ct.sub.MFL168 Biological Sample MFL168-A MFL168-B Technical Replicate 1 2 3 1 2 3 rpoD 0 0 0 0 0 0 gcl 1.63 1.69 1.87 1.8 1.81 1.89 hyi 3.26 3.39 3.38 3.34 3.38 3.4 glxR 0.78 0.75 0.8 0.31 0.66 0.84 PP_4300 1.53 1.34 1.98 1.67 1.4 1.27 pykF 0.51 0.69 0.69 0.97 1.1 1.18 PP_0762 9.41 9.65 8.91 8.53 8.53 8.48 rpoD (neg)* 14.81 15.07 15.98 18.97 18.97 14.03 2.sup.-Ct.sub.MFL168 Biological Sample MFL168-A MFL168-B Technical Replicate 1 2 3 1 2 3 rpoD 1.00 1.00 1.00 1.00 1.00 1.00 gcl 3.10 3.23 3.66 3.48 3.51 3.71 hyi 9.58 10.48 10.41 10.13 10.41 10.56 glxR 1.72 1.68 1.74 1.24 1.58 1.79 PP_4300 0.35 0.40 0.25 0.31 0.38 0.41 pykF 1.42 1.61 1.61 1.96 2.14 2.27 PP_0762 0.00 0.00 0.00 0.00 0.00 rpoD (neg)* 0.00 0.00 0.00 0.00 0.00 0.00 2.sup.-Ct.sub.MFL168 Biological Sample MFL168-A MFL168-B Technical Replicate 1 2 3 1 2 3 Avg rpoD gcl 1693 1764 1999 1904 1917 2027 1884 hyi 300 328 326 317 326 330 321 glxR 345 338 350 249 318 360 327 PP_4300 149 170 109 136 164 179 151 pykF 234 265 265 322 352 372 302 PP_0762 9 8 13 16 16 17 13 Ct.sub.MFL170 Biological Sample MFL170-A MFL170-B Technical Replicate 1 2 3 1 2 3 rpoD 20.27 20.24 20.32 22.62 22.6 22.76 gcl 17.64 17.85 17.7 20.21 20.27 20.24 hyi 15.93 15.74 15.53 18.15 18.21 18.45 glxR 18.94 18.86 19.04 21.26 21.15 21.62 PP_4300 28.84 28.98 28.84 30.75 30.8 31.2 pykF 27.58 27.69 27.32 29.85 29.66 30.05 PP_0762 29.34 29.98 29.99 31.31 30.99 31.2 rpoD (neg)* 34.21 34.46 34.4 33.5 33.64 32.06 Ct.sub.MFL170 Biological Sample MFL170-A MFL170-B Technical Replicate 1 2 3 1 2 3 rpoD 0 0 0 0 0 0 gcl 2.63 2.39 2.62 2.41 2.33 2.52 hyi 4.34 4.5 4.79 4.47 4.39 4.31 glxR 1.33 1.38 1.28 1.36 1.45 1.14 PP_4300 8.57 8.74 8.52 8.13 8.2 8.44 pykF 7.31 7.45 7 7.23 7.06 7.29 PP_0762 9.07 9.74 9.67 8.69 8.39 8.44 rpoD (neg)* 13.94 14.22 14.08 10.88 11.04 9.3 2.sup.-Ct.sub.MFL170 Biological Sample MFL170-A MFL170-B Technical Replicate 1 2 3 1 2 3 rpoD 1.00 1.00 1.00 1.00 1.00 1.00 gcl 6.19 5.24 6.15 5.31 5.03 5.74 hyi 20.25 22.63 27.67 22.16 20.97 19.84 glxR 2.51 2.60 2.43 2.57 2.73 2.20 PP_4300 0.00 0.00 0.00 0.00 0.00 0.00 pykF 0.01 0.01 0.01 0.01 0.01 0.01 PP_0762 0.00 0.00 0.00 0.00 0.00 rpoD (neg)* 0.00 0.00 0.00 0.00 0.00 0.00 2.sup.-Ct.sub.MFL170 Biological Sample MFL170-A MFL170-B Technical Replicate 1 2 3 1 2 3 Avg rpoD gcl 3385 2866 3362 2906 2750 3137 3068 hyi 633 708 865 693 656 620 696 glxR 506 523 488 516 549 443 504 PP_4300 1 1 1 2 1 1 1 pykF 1 1 1 1 1 1 1 PP_0762 11 7 7 15 18 18 12 Ct.sub.MFL188 Biological Sample MFL188-A MFL188-B Technical Replicate 1 2 3 1 2 3 rpoD 21.11 21.32 21.3 20.98 21.01 21 gcl 19.38 19.16 19.3 18.4 18.48 18.7 hyi 26.59 26.25 26.39 26.12 26.21 26.37 glxR 20.57 20.63 20.62 20.1 20.16 20.11 PP_4300 30.15 29.78 29.73 29.79 29.67 29.88 pykF 28.55 28.33 28.43 28.21 28.2 28.42 PP_0762 29.92 30.26 30.15 30.23 30.21 30.36 rpoD (neg)* 34.87 36.3 36.12 32.86 32.3 32.26 Ct.sub.MFL188 Biological Sample MFL188-A MFL188-B Technical Replicate 1 2 3 1 2 3 rpoD 0 0 0 0 0 0 gcl 1.73 2.16 2 2.58 2.53 2.3 hyi 5.48 4.93 5.09 5.14 5.2 5.37 glxR 0.54 0.69 0.68 0.88 0.85 0.89 PP_4300 9.04 8.46 8.43 8.81 8.66 8.88 pykF 7.44 7.01 7.13 7.23 7.19 7.42 PP_0762 8.81 8.94 8.85 9.25 9.2 9.36 rpoD (neg)* 13.76 14.98 14.82 11.88 11.29 11.26 2.sup.-Ct.sub.MFL188 Biological Sample MFL188-A MFL188-B Technical Replicate 1 2 3 1 2 3 rpoD 1.00 1.00 1.00 1.00 1.00 1.00 gcl 3.32 4.47 4.00 5.98 5.78 4.92 hyi 0.02 0.03 0.03 0.03 0.03 0.02 glxR 1.45 1.61 1.60 1.84 1.80 1.85 PP_4300 0.00 0.00 0.00 0.00 0.00 0.00 pykF 0.01 0.01 0.01 0.01 0.01 0.01 PP_0762 0.00 0.00 0.00 0.00 0.00 rpoD (neg)* 0.00 0.00 0.00 0.00 0.00 0.00 2.sup.-Ct.sub.MFL188 Biological Sample MFL188-A MFL188-B Technical Replicate 1 2 3 1 2 3 Avg rpoD gcl 1814 2444 2187 3270 3158 2693 2594 hyi 1 1 1 1 1 1 1 glxR 292 324 322 370 362 373 341 PP_4300 1 1 1 1 1 1 1 pykF 1 1 1 1 1 1 1 PP_0762 14 12 13 10 10 9 12 *Negative control - no reverse transcriptase
[0080] Transcript levels of all gcl cluster genes in the wild type were very low. Values of 2-Ct of gcl, hyi, glxR, ttuD and pykF are 31-532 fold lower than for the control, rpoD (Table 5), confirming that this strain fails to induce this pathway on ethylene glycol. Transcript levels for gcl were approximately 2,000-fold higher in the engineered strains compared to the wild type, since it is driven by the strong tac promoter. For MFL168, transcript levels of the following genes in the cluster (hyi, glxR, ttuD, and pykF) are approximately the same, but 6-12 fold lower than gcl.
[0081] This was unexpected since a 27-base pair region (CCCTGTGGGAGCGGGCTCGCCCGCGAA) which is present downstream from hyi is repeated as inverse complement further downstream, forming a 91 bp inverted repeat. Interestingly, a similar repeat region is present in the vicinity of gcl, downstream from PP_4296 (hypothetical protein) that differs by 1 nucleotide from the repeat downstream of hyi and forms an 81 bp inverted repeat. The presence of the inverted repeat did obviously not diminish the expression of downstream genes, since transcript levels for gcl, hyi, and glxR in MFL170 and MFL188 are similar to those in MFL168, for genes that were overexpressed. These results indicate that under the conditions tested, the putative terminators in the gcl gene cluster do not affect transcription of downstream genes, and that all of the genes in the cluster are transcribed as a single transcriptional unit and will thus be referred to as an operon.
[0082] Hydroxypyruvate Reductase Activity Assays
[0083] If a secondary pathway from tartronate semialdehyde to glycerate exists as shown in
[0084] Characterization of Engineered P. Putida KT2440
[0085] To characterize the relative contribution of single genes of the gcl operon, the engineered strains were compared in minimal medium containing 20 and 50 mM ethylene glycol (
[0086] Therefore, an investigation of the intermediate metabolites (glycolaldehyde, glyoxylate, glycolate, oxalate, and glyoxal) and the substrate, ethylene glycol, was conducted to understand their impact on ethylene glycol metabolism.
[0087] Substrate, Metabolite, and Toxicity Assays
[0088] The toxicity of ethylene glycol, glyoxylate, glycolaldehyde, glyoxal, and oxalate to P. putida KT2440 were examined by monitoring growth in the Bioscreen C instrument (a microplate reader that monitors turbidity over time) in the presence of M9 minimal medium containing 20 mM glucose and the potential inhibitor. The average of at least five wells is shown in
[0089] Characterization of a Glycolate Oxidase Overexpressing Strain
[0090] We observed that all three engineered strains transiently accumulated large amounts of glycolate in 20 mM ethylene glycol cultures (
[0091] Growth rates, maximum dry cell weights, and consumed substrate are shown in Table 6 for cultures grown in the presence of 50 mM ethylene glycol which demonstrates a trend in ethylene glycol metabolic efficiencies for the engineered strains (MFL185>>MFL168>MFL170>MFL188).
TABLE-US-00006 TABLE 6 Comparison of metabolism of engineered strains grown in 50 mM ethylene glycol Maximum DCW Growth Rate Ethylene glycol Strain (g/L) (1/h) consumed (g/L/h) KT2440 0.04 0.00 0.00 0.00 0.01 0.00 MFL168 0.67 0.17 0.12 0.01 0.05 0.00 MFL170 0.48 0.02 0.08 0.02 0.03 0.00 MFL185 1.02 0.04 0.19 0.02 0.16 0.00 MFL186 0.10 0.00 0.04 0.00 0.01 0.00
[0092] We also compared growth on ethylene glycol at concentrations much higher than 50 mM, first in the Bioscreen C and then for MFL185 in shake flasks (
[0093] Production of mcl-PHAs from Ethylene Glycol
[0094] As a proof-of-concept for converting ethylene glycol to value-added products, we evaluated the ability of MFL185 to convert ethylene glycol into native carbon storage products, mcl-PHAs. Given that P. putida induces mcl-PHA production under nitrogen-limiting conditions, we grew cells in nitrogen-limiting M9 medium supplemented with 100 mM of ethylene glycol as the sole carbon source (
[0095] Although P. putida KT2440 has the genes necessary to convert ethylene glycol into cellular biomass, previous studies demonstrated that the organism is not capable of growing with ethylene glycol as the sole source of carbon and energy. We initially hypothesized that growth on ethylene glycol should depend on the functional expression of the gcl operon with glyoxylate carboligase (gcl) and tartronate semialdehyde reductase (glxR) as key enzymes. A prediction of the exact composition of a gcl operon from the genomic context was however, not straightforward. From a functional perspective, the co-transcription of gcl, hyi (hydroxypyruvate isomerase), glxR, ttuD, and pykF (pyruvate kinase) would make sense since those enzymes would allow two different routes for the conversion of glyoxylate to glycerate (
[0096] Without being limited by theory, the minimal requirement for glyoxylate metabolism from the gcl operon (
[0097] At elevated levels of ethylene glycol (>50 mM), glycolate and more importantly, glycolaldehyde and glyoxal levels increased to inhibitory levels, except in strain MFL185. The biomass yield for MFL168 in 20 mM ethylene glycol is high at 0.54 g DCW/g of ethylene glycol consumed and dropped to 0.16-0.27 g DCW per g of ethylene glycol consumed, when the substrate concentration was raised to 50 mM. The loss in biomass yield could be the result of the accumulation of intermediates, such as glycolaldehyde and glyoxal, which was not observed in 20 mM ethylene glycol (
[0098] To improve the ethylene glycol conversion at higher substrate concentrations, we used the overexpression of glycolate oxidase to increase its conversion and thus to minimize the accumulation of the toxic intermediates glycolaldehyde and glyoxal. By combining glycolate oxidase with the gcl operon overexpression we generated a strain (MFL185) that can efficiently consume 0.5 M ethylene glycol (32 g/L) under shake flask conditions. Furthermore, we show that MFL185 can tolerate growth in up to 2 M (124 g/L) ethylene glycol. Moreover, with the addition of twice the M9 medium salt composition, we observed further consumption of ethylene glycol in the presence of 1 M (62 g/L) ethylene glycol (up to 37 g/L). Thus, with proper bioreactor control and the addition of limiting nutrients (i.e. nitrogen, iron) even higher substrate utilization might be possible.
[0099] Dynamic branching of intracellular metabolites is crucial for eliminating imbalance of cellular metabolism in microorganisms. For instance, in trehalose cycling, a side-pathway pushes glycolysis toward the trehalose metabolism for establishing steady state of the upper and lower pathway of glycolysis, thus eliminating the accumulation of intermediate metabolites. The failure to do so results in metabolic malfunctioning and growth arrest in high glucose containing medium. Similarly, Hyi siphons the ethylene glycol metabolite intermediate tartronate semialdehyde into hydroxypyruvate. Overexpression of hyi may facilitate a synthetic steady-state of ethylene glycol metabolism and relieve the bottleneck at tartronate semialdehyde, allowing for more efficient utilization of ethylene glycol. Otherwise cells exhibit metabolic and growth arrest. This might explain why the strains MFL168 and MFL170 perform better than strain MFL188. In addition, as described in the push-and-pull concept, the amplification of upstream, metabolite-forming pathways combined with a similar increase in the flux of downstream, metabolite utilization pathways could overcome feedback inhibition, and steer P. putida to achieve large flux of ethylene glycol at high rate.
[0100] Beyond the superior growth characteristics of MFL185 in ethylene glycol, we demonstrated that ethylene glycol could be converted to high-value products such as mcl-PHAs. Together with the conversion of terephthalate, this now enables the complete biotransformation of depolymerized PET into mcl-PHAs with P. putida. mcl-PHAs can be upgraded into chemical precursors and fuels via straightforward catalytic process. Several metabolic engineering strategies have been developed to enhance mcl-PHAs production in P. putida, and these approaches could be used to increased mcl-PHA production in the MFL185 strain. As disclosed herein, metabolic modeling coupled with techno-economic analysis are useful tools for identifying ideal product(s) from ethylene glycol. The source of ethylene glycol should be considered for tailoring MFL185 as a biocatalyst to valorize ethylene glycol containing streams. For instance, in PET-degraded streams, ethylene glycol could be used for growth, energy, and/or PHA production.
[0101] Thus, presented herein is an engineered strain (MFL185) for ethylene glycol consumption, and a foundation strain for further development as a biocatalyst for the conversion of ethylene glycol in waste plastics streams, and for the conversion of glycolaldehyde in thermochemical wastewater streams, and generally for additional environmental bioremediation applications.
TABLE-US-00007 TABLE 7 Primers, genes, vectors, and restriction enzymes targeted/used for construction. Vector or Construct# Primer 1 Primer 2 Gene Target RE Digests Plasmid ID 1 oMFL165 oMFL159 pBTL2 SbfI/PacI pMFL113 oMFL160 oMFL161 gcl SbfI/NotI oMFL162 oMFL163 glcB NotI/PacI 2 oMFL165 oMFL159 pBTL2 SbfI/PacI pMFL114 oMFL160 oMFL164 gcl operon SbfI/NotI oMFL162 oMFL163 glcB NotI/PacI 3 oMFL158 oMFL159 pBTL2 Sbfl/NotI pMFL115 oMFL166 oMFL167 glcB SbfI/NotI 4 oMFL165 oMFL159 pBTL2 SbfI/PacI pMFL116 oMFL160 oMFL161 gcl SbfI/NotI oMFL162 oMFL163 glcB NotI/PacI 5 oMFL165 oMFL159 pBTL2 SbfI/PacI pMFL117 oMFL160 oMFL164 gcl operon SbfI/NotI oMFL162 oMFL163 glcB NotI/PacI
[0102] Plasmid Construction of pMFL113-pMFL117
[0103] The plasmid, pBTL2 was amplified with primers as designated above to introduce Notl and SbfI sites or PacI and SbfI sites to the plasmid. PCR products obtained from amplification from KT2440 genomic DNA using primers above and the vector were purified and digested with restriction enzymes noted above, purified again and ligated together, then transformed into NEB 5-alpha FIq E. coli. After confirmation of sequence, DNA was transformed into P. putida KT2440 and the strains designated as MFL113 to MFL117.
[0104] Plasmid construction details of pMFL160, pMFL161, pLJ030, pLJ031 and pLJ032 (Integration constructs for MFL168, MFL170, MFL185, MFL186 and MFL188) are depicted in Table 8.
TABLE-US-00008 TABLE 8 Assembly Primer 1 Primer 2 Vector or Gene Target Plasmid ID #1 oCJ288 oCJ289 pK18mobsacB pMFL160 (XbaI/SpeI) oCJ301 oCJ302X Upstream fpvA pMFL161 oCJ306XX oCJ307 Downstream fpvA XbaI/SpeI oMFL276 oMFL279 gcl-glxR pMFL160 XbaI/SpeI oMFL276 oMFL280 gcl operon pMFL161 #2 oLJ110 oLJ113 pMFL160 pLJ032 oLJ110 oLJ111 gcl oLJ112 oLJ113 glxR #3 oLJ100 oLJ103 pK18mobsacb pLJ1030 oLJ100 oLJ101 glcC (upstream glcD) oLJ102 oLJ103 glcD
[0105] In order to construct the integration plasmids, pMFL160 and MFL161, 3 PCR fragments for assembly #1 (Table 8) were assembled using NEBuilder HiFi DNA Assembly Master Mix following manufacturer's instructions. The fragment was digested with XbaI and SpeI along with PCR fragments generated from oMFL276 and oMFL279 (gcl-hyi-glxR) or oMFL276 with oMFL280 (gcl operon), which were also cut with XbaI, and SpeI. Fragments were PCR purified, ligated and transformed into E. coli as described above to generate either pMFL160 (integration overexpression construct for MFL170 (gcl-hyi-glxR)) or to generate pMFL161 (integration construct for MFL168 and MFL185 expressing the entire gcl operon), both of which are contain the pK18mobsacb backbone. The integration plasmid, pMFL160 was used as a template for the construction of pJL032 for integration of gcl-glxR. Briefly, three fragments were assembled as shown in the table above, then assembled (assembly #2) and transformed into NEB 5-alpha FIq E. coli. For assembly of the integration construction to insert the tac promoter in front of the glcDEF operon, three PCR fragments were generated (assembly #3 above), assembled and transformed into NEB 5-alpha FIq E. coli. All plasmids were confirmed by sequencing prior to integration into P. putida KT2440.
[0106] Redox Equivalent Homeostasis in the Utilization of Ethylene Glycol as Co-Substrate
[0107] An analysis of the P. putida genome reveals that it possesses open reading frames that putatively encode enzymes that if expressed might be useful in metabolic pathways that could potentially enable ethylene glycol metabolism. In one such ethylene glycol metabolic pathway, referred to herein as the energy yielding pathway, the diol (ethylene glycol) is converted into glyoxylate in a series of oxidation reactions catalyzed by a set of redundant dehydrogenases, PQQ-dependent PedI, PedE and PedH (see
[0108] The complete conversion of ethylene glycol to glyoxylate yields three reducing equivalents, either in the form of NADH, PQQH.sub.2, or a direct coupling to the electron transport chain. Glyoxylate can be further metabolized by the AceA or GlcB enzymes involved in the glyoxylate shunt. Although this shunt is usually a carbon conservation pathway for growth on C2 substrates that enter primary metabolism at the level of acetyl-CoA, the overall stoichiometry of glyoxylate metabolism via either of the reactions catalyzed by the AceA or GlcB enzymes can only yield 2 CO.sub.2 and 2 reducing equivalents (see
[0109] To investigate the applicability of ethylene glycol as a co-substrate, P. putida KT2440 was cultured in carbon-limited chemostat cultivations with acetate as carbon source, and either ethylene glycol or glyoxylate as an energy source. Acetate was chosen because it induces the glyoxylate shunt enzymes. Compared to the control with only acetate, a co-feed of ethylene glycol or glyoxylate significantly increased the biomass yield on acetate by 29.61.1% or 22.28.2%, respectively. This increase can likely be attributed to the additional reducing equivalents generated through the co-substrate metabolism, enabling a more efficient carbon metabolism of the primary substrate. However, the fed ethylene glycol was only partly metabolized, and several intermediate oxidation products were secreted. A limitation in the upstream oxidation reactions can be excluded, since glyoxylate was also not completely metabolized under these conditions.
[0110] Energy and redox equivalent homeostasis is essential for efficient growth of a bacterial cell. As such, the observed inefficiency in metabolism of ethylene glycol could result from a potential imbalance in the pool of redox equivalents. Assuming that all glyoxylate is metabolized through the glyoxylate shunt, 27.32.6 mmol (g CDW).sup.1 h.sup.1 of reducing equivalents were generated through the co-metabolism of ethylene glycol. In contrast, under similar conditions reached the maximal achievable biomass yield on glucose already with 7.60.9 mmol (g CDW).sup.1 h.sup.1 using a co-feed of formate. Thus, under these conditions, the generated flux of reducing equivalents from an ethylene glycol co-feed likely constitute a strong surplus in energy. This is further supported by the fact that a glyoxylate co-feed, yielding only 14.40.5 mmol (g CDW).sup.1 h.sup.1 of reducing equivalents, enabled almost the same biomass yield increase as the ethylene glycol co-feed. This surplus of reducing equivalents leads to an imbalance of redox cofactors, inhibiting the further conversion of ethylene glycol under these conditions.
[0111] Isolation of Mutants Able to Utilize Ethylene Glycol as Sole Carbon Source
[0112] In an alternative to the energy yielding pathway, the genome of P. putida KT2440 contains open reading frames (PP_4297-PP_4301) that if expressed might encode for enzymes useful in a pathway to metabolize glyoxylate through a glyoxylate carboligase which converts two glyoxylate into tartronate semialdehyde and CO.sub.2. In this pathway, glyoxylate is converted to glycerate, either directly or via hydroxypyruvate, and subsequently to 2-phosphoglycerate (see
[0113] Adaptive laboratory evolution (ALE) techniques were applied to P. putida KT2440 and lead to the emergence of adaptive mutations allowing for growth on ethylene glycol as a sole carbon source. Two independent ALE experiments were performed in two different laboratory P. putida KT2440 wildtype strains using different minimal media recipes supplemented with ethylene glycol as a sole carbon source. As depicted in
[0114] Three isolates were obtained from independently evolved cultures directly after this initial growth. The best growing clones from each culture were selected from nine individual clones and subcultured three times on LB-agar plates to obtain strains E1.1, E1.2 and E1.3.
[0115] A series of three parallel ALE cultivations was performed where batches were sequentially re-inoculated into fresh medium with ethylene glycol after growth became apparent by visual inspection, see
[0116] All five resulting strains (E1.1, E1.2, E1.3, E6.1, and E6.2) demonstrated a stable ethylene glycol-growing phenotype. No major differences could be observed within the E1 and E6 groups. When grown in minimal medium with 26.70.4 mM ethylene glycol as a sole carbon source, both groups grew at approximately the same initial rate (0.190.02 h.sup.1). However, the maximum biomass concentration of the E6 cultures (0.630.02 g.sub.cdw L.sup.1) was significantly higher than that of the E1 cultures (0.490.07 g.sub.cdw L.sup.1) (
[0117] Genomic and Metabolic Context of Adaptive Mutations
[0118] Whole genome resequencing was performed on the E1 and E6 strains in order to discover the mutations responsible for the stable phenotypic switch in the E1 and E6 ALE strains. In comparison to publicly available sequence of P. putida KT2440 (AE015451.2) (see
[0119] The mutations identified in strains E1 and E6 were very similar to each other, even though they were derived from different wildtype P. putida KT2440 strains. After subtracting parental, silent, and intergenic mutations, two additional mutated regions were identified in the E1 and E6 strains. One region (coordinates 4866804 to 4902814, of P. putida KT2440) was mutated in all the evolved strains (E1.1, E1.2, E1.3, E6.1, and E6.2), while the other region (coordinates 2325342 to 2334253) was only mutated in the E6 group (E6.1, and E6.2), see
[0120] In the first region, E1.1, E1.2, E1.3, and E6.1 contained mutations in the gene with locus tag PP_4283 encoding a putative GntR-type transcriptional regulator gclR. Using RegPrecise, GclR is predicted to be a regulator of xanthine metabolism, with two predicted binding sites upstream of the gcl gene. The mutations in the first region included one nonsense mutation in E6.1 giving rise to a stop codon in the 4th triplet, indicating that the gene function is disrupted. Strain E6.2 did not contain a mutation in gclR, instead it has a SNP 12.5 kb downstream in the promotor region of the gcl gene, which is the first gene in the PP_4297-PP_4301 cluster that encodes the enzymes of the gcl pathway.
[0121] Transcript levels of all five genes (PP_4297-PP_4301) in this cluster are very low in the wildtype P. putida KT2440 strain. In contrast, all five genes (PP_4297-PP_4301) in the cluster were strongly upregulated in strains E1.1, E6.1 and E6.2 having 2Ct values between 71 and 842 vs. wildtype, see
[0122] In P. putida, ethylene glycol and/or glyoxylate are not the effectors which bind GclR to relieve repression of the PP_4297-PP_4301 gene cluster. The genomic context of the gclR gene in P. putida KT2440 which, similarly to other organisms such as E. coli, Streptomyces coelicolor, and Bacillus subtilis, encode multiple genes known or predicted to be involved in the metabolism of purines via allantoin and glyoxylate, see
[0123] Both wildtype P. putida KT2440 and strain E6.1 are able to grow on allantoin as a sole carbon and nitrogen source (see
[0124] E6.2 was not able to utilize allantoin as sole nitrogen source, although it retained the ability to utilize it as a carbon source, either with or without the addition of ethylene glycol. This indicates that there is regulatory cross-talk between allantoin and ethylene glycol metabolism, possibly involving the PP_4296 gene whose expression is likely affected by its mutation in E6.2. The product of the PP_4296 gene shows sequence similarity to the E. coli GlcG protein which is implicated in glycolate metabolism.
[0125] In addition to the mutations involving gclR, an additional mutation was found in both of the strains E6.1 and E6.2. Both strains contained the same missense mutation (E34G) in the gene with locus tag PP_2046, a LysR-type transcriptional regulator. This regulator controls the adjacent operon which encodes a beta-oxidation pathway including a CoA-transferase, an acyl-CoA thioase, and several (enoyl-CoA-) dehydrogenases, see
[0126] Reversed Engineering of Ethylene Glycol Metabolism
[0127] Mutations in the gclR and PP_2046 genes contribute to the efficient growth of P. putida KT2440 on ethylene glycol as a sole carbon source. To determine how these mutations assert their effect, we replicated the phenotype of the mutant strains through reverse engineering.
[0128] Growth on ethylene glycol was assessed in gclR knockouts of the wildtype, E6.1, and E6.2 strains, see
[0129] Strain E6.2 gclR grows slower than its parental strain. This, together with the fact that E6.2 can't use allantoin as sole nitrogen source, is indicative of a more complex regulatory mechanism, perhaps one analogous to that of E. coli's AllR, which can bind both allantoin and glyoxylate leading to either the repression or the activation of genes. To verify that it is only the activation of the gcl pathway, excluding any polar regulatory effects, the gcl and glxR genes were expressed episomally in wildtype P. putida KT2440 under the control of the LacIq-Ptrc promoter on plasmid pSEVA234 (SEQ ID NO: 5). Indeed, the resulting strain KT2440 pSEVA234_gcl-glxR grows on ethylene glycol. Although qRT-PCR experiments determined that in the ALE strains, the five genes were upregulated, two of these are redundant, and P. putida KT2440 contains another gene encoding a glycerate kinase (PP_3178). In an embodiment, only gcl and glxR need to be expressed to enable growth on ethylene glycol. A significant contribution of the redundant pathway via hydroxypyruvate is indicated by strain KT2440 pSEVA234_gcl-glxR growing slower than KT2440 gclR or the ALE strains.
[0130] In contrast to the ALE mutations in gclR, the E6 strains both contained the same SNP in the PP_2046 gene leading to an E34G substitution. It is unclear whether this mutation simply disrupts activity, or whether it changes the functionality of the encoded regulator. To distinguish between these effects, PP_2046 was knocked out and the mutant variant of the gene was episomally re-introduced into this knockout under the control of the NagR-PnagAa promoter on plasmid pBNTmcs. These modifications were made in P. putida KT2440 gclR, because modification of PP_2046 alone didn't enable growth on ethylene glycol. Both strains P. putida KT2440 gclRPP_2046 pBNT_PP_2046E34G and the empty vector control KT2440 gclRPP_2046 pBNTmcs still grow on ethylene glycol, but the latter much slower than the former.
[0131] Engineering P. Putida KT2440 for Efficient Ethylene Glycol Utilization
[0132] To further expand the ability of P. putida for substrates of industrial interest, the metabolism of ethylene glycol was enhanced via metabolic engineering through the overexpression of existing regulated pathways that include the glyoxylate carboligase operon. Growth in concentrations of ethylene glycol above 50 mM was inhibited by the accumulation of toxic intermediates, glycolaldehyde and glyoxal. The additional overexpression of glycolate oxidase (glcDEF) operon removed the glycolate bottleneck and minimized the production of these toxic intermediates, permitting the growth in up to 2M (120 g/L) and consumption of greater than about 0.5M (30 g/L) of ethylene glycol.
[0133] Construction and Characterization of Integrated Engineered P. Putida KT2440
[0134] In order to ascertain which genes were important for ethylene glycol metabolism and to provide a base strain for further improvements, genes of interest were integrated into an intergenic region between fpvA and PP_4218. This region was chosen because we have successfully integrated other genes in this location, in addition to having native terminators present in both directions. The tac promoter was used for driving expression of the operon and the RBS in front of gcl modified for optimal ribosome binding, see
[0135] Cultures were compared for growth in the presence of 20 mM ethylene glycol in minimal medium, see
[0136] Integrated strains were tested for growth in 50 mM ethylene glycol and it was discovered that strains had more difficulty in consuming the higher concentration of ethylene glycol, see
[0137] Substrate, Metabolite, and Competitive Inhibition Toxicity Assays
[0138] The toxicity effects of ethylene glycol, glyoxylate, glycolaldehyde, glyoxal and oxalate on P. putida KT2440 were examined by monitoring growth in the Bioscreen C instrument (a microplate reader which monitors turbidity over time) in the presence of M9 minimal medium containing 20 mM glucose and the inhibitor, see
[0139] Glycolaldehyde and glyoxal have a synergistic inhibitory effect where, the growth rates in the presence of 2 mM glycolaldehyde is 0.2910.001 h.sup.1, 2 mM glyoxal is 0.2970.001 h.sup.1, and 1 mM glycolaldehyde+1 mM glyoxal is 0.1970.001 h.sup.1.
[0140] Characterization of an Overexpressing Glycolate Oxidase Strain
[0141] In 20 mM ethylene glycol cultures, all three engineered strains accumulated large amounts of glycolate (see
[0142] Growth at concentrations higher than 50 mM was compared between Bioscreen C and in shake flasks, see
[0143] A shake flask study in M9 minimal medium containing only ethylene glycol from 25 mM to 3 M was conducted to determine whether MFL185 can utilize this much extra ethylene glycol, see
[0144] qRT-PCR
[0145] The genes engineered into MFL168 were predicted to be transcribed in three different transcriptional units, namely gcl-hyi, glxR, and PP_4300-pykF. There is a strong inverted repeat located in the intergenic region between hyi and glxR, which indicates that glxR would be on a different transcript, however, no potential promoters were predicted to be present upstream of glxR using an online software prediction program, BPROM, on www.softberry.com. Quantitative real-time PCR experiments were conducted to measure transcript levels of gcl, hyi, glxR, PP_4300 and pykF in addition to PP_0762 to determine whether genes located together on this operon are expressed. PP_0762 was annotated to function as a hydroxypyruvate reductase and could be involved in converting hydroxypyruvate to glycerate in ethylene glycol metabolism. A housekeeping gene, rpoD, was used to quantify transcript levels between each of our samples using the 2-.sup.Ct method. Cultures were grown up in M9 minimal medium with 40 mM sodium acetate and 20 mM ethylene glycol. For ethylene glycol consuming cultures, acetate was utilized first, followed by ethylene glycol. All cultures were harvested at about an OD.sub.600 of 1 at which point, the substrates acetate and ethylene glycol were still available for growth.
[0146] Ct values were obtained for each sample and gene and are summarized as fold expression to transcript levels obtained from the control (P. putida KT2440) after normalizing gene expression to rpoD, see
[0147] Activity Assays
[0148] Experiments were performed to determine which enzyme is responsible for converting hydroxypyruvate to glycerate. PP_4300 and hprA (PP_0762) are not required for ethylene glycol assimilation, so assays were conducted to test cell extracts for activity on the substrate hydroxypyruvate by monitoring NADH and NADPH oxidation, see
[0149] A prediction of the exact composition of a gcl operon from the genomic context is not straightforward. From a functional perspective the co-transcription of gcl, hyi (hydroxypyruvate isomerase), glxR (tartronate semialdehyde reductase) and PP_4300 (hydroxypyruvate reductase) and pykF would make functional sense since they would allow two different routes for the conversion of glyoxylate to glycerate, see
[0150] The two additional enzymes, PP_4300 (TtuD) and PykF, expressed in MFL168, compared to MFL170, showed improved performance under our conditions, but not to a lesser extent than the addition of Hyi. PP_4300 was predicted to function as a hydroxypyruvate reductase (BioCYC Database collection), but PP_4300 was identified as a glycerate kinase in the KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway database, see
[0151] At elevated levels of ethylene glycol (>50 mM), glycolate, glycolaldehyde and glyoxal levels increased. The accumulation of glycolate caused the concentration of glycolaldehyde to increase to inhibitory levels and is likely responsible for inhibition of GlxR activity. A strain (MFL185) was engineered to overexpress glycolate oxidase. MFL185 can metabolize 500 mM ethylene glycol (30 g/L) under shake flask conditions. MFL185 will tolerate growth in up to 1.5 M (90 g/L) ethylene glycol. Increased substrate utilization with proper fermentation control and the addition of limiting nutrients (i.e. nitrogen, iron) may be possible.
[0152] The deregulation of the gcl operon allows for growth of P. putida KT2440 in ethylene glycol. Furthermore, growth of engineered strains in higher concentrations of ethylene glycol can be inhibited by the accumulation of the toxic intermediates, glycolaldehyde and glyoxal. The addition of glycolate oxidase removes the glycolate bottleneck and minimizes the production of these toxic intermediates, allowing for the growth in up to 2 M (120 g/L) and consumption of 0.5M (30 g/L) or more of ethylene glycol under the shake flask growth conditions.
[0153] Plasmid Construction
[0154] Q5 Hot Start High-Fidelity 2X Master Mix (New England Biolabs) and primers synthesized by Integrated DNA Technologies (IDT) were used in all PCR amplification for plasmid construction. Plasmids were constructed using Gibson Assembly Master Mix (New England Biolabs) according to the manufacturer's instructions. Plasmids for gene integration were constructed in pK18mobsacB from ATCC (American Type Culture Collection, Manassas, Va.), which is unable to replicate in P. putida KT2440, and contains the kanamycin resistant marker to select for integration of the plasmid into the genome by homologous recombination and sacB to counter select for recombination of the plasmid out of the genome. The plasmid, CJOXX, used for of integration of operons containing the gene gcl (MFL168, MFL170, MFL185, and MFL188) contains the 1 kb homology region on either side of the intergenic region immediately after the fpvA (outer membrane ferripyoverdine receptor) terminator and PP_4218 (lipase/esterase) of P. putida KT2440. Features include the tac promoter to drive operon expression and a tonB terminator situated behind the operon (
[0155] Plasmids were transformed into competent NEB 5-alpha FIq E. coli (New England Biolabs) according to the manufacturer's instructions. Transformants were selected on LB (Lennox) plates containing 10 g/L tryptone, 5 g/L yeast extract, 5 g/L NaCl, and 15 g/L agar, supplemented with either 10 g/mL tetracycline or 50 g/mL kanamycin grown at 37 C. The sequences of all plasmid inserts were confirmed using Sanger sequencing (GENEWIZ, Inc.). Specific plasmid construction details can be found in the supplementary materials and methods.
[0156] Strain Construction
[0157] P. putida KT2440 (ATCC 47054) was used as the basis of strain engineering and gene replacements were made using the antibiotic/sacB system of selection and counter-selection. To prepare cells of P. putida KT2440 and strains derived from it for transformation by electroporation, cultures were grown up overnight in LB broth and incubated at 30 C., shaking at 225 rpm. The next day, cells were centrifuged 15,000 rpm in an Eppendorf centrifuge for 1 minute at room temperature, washed three times in 0.3M sucrose in half the original volume, centrifuged again then resuspended then resuspended in 1/50th of the culture's original volume in 0.3M sucrose. Cells were immediately used for electroporation by introducing 5 L (200 ng-2 g) of plasmid DNA to 50 L of the electrocompetent cells, transferred to a chilled 0.1 cm electroporation cuvette, and electroporated at 1.6 kV, 25 F, 200 ohms. 950 L SOC outgrowth medium (NEB) was added to the cells immediately after electroporation and the resuspended cells were incubated shaking at 225 rpm, 30 C., for two hours. The entire transformation was plated on an LB agar plate containing appropriate antibiotics (50 g/mL kanamycin for pBTL2 and pK18mobsacB-based plasmids) and incubated at 30 C. overnight. Transformants were restreaked for single colonies on LB agar and incubated at 30 C. overnight to reduce the possibility of untransformed cells being transferred. For sucrose counter-selection, restreaked transformants were streaked for single colonies on YT+25% sucrose plates (10 g/L yeast extract, 20 g/L tryptone, 250 g/L sucrose, 18 g/L agar), and incubated at 30 C. overnight. P. putida KT2440 containing the sacB gene can grow, although very slowly, on YT+25% sucrose media. Therefore, colonies presumed to have recombined the sacB gene out of the genomethose colonies that were larger than most were restreaked on YT+25% sucrose plates and incubated at 30 C. overnight to reduce the possibility that cells that had not recombined would be carried along with sucrose resistant isolates. Colonies from the second YT+25% sucrose plates were subjected to colony PCR to check for gene replacement at both junctions. These isolates were also plated on LB plates containing appropriate antibiotics to ensure that they had lost antibiotic resistance and, thus, represented pure gene replacements.
[0158] Toxicity Tests in Bioscreen C
[0159] Growth curves were obtained from Bioscreen C analyzers (Growth Curves US, Piscataway, N.J.). Overnight cultures of P. putida KT2440 were grown in M9 medium containing 20 mM glucose starting at an OD.sub.600 of 0.05-0.1, 30 C., 225 rpm (baffled shake flask) until the OD.sub.600 reached 1.0-1.5. Cells were concentrated by centrifugation and inoculated into wells of Bioscreen C microplates containing various inhibitors and concentrations in the presence of 20 mM glucose at and additional OD.sub.600=0.05 in a total volume of 300 L. Incubations were performed at 30 C. and absorbance readings were taken every 15 min. Operation of the Bioscreen C and collection of turbidity measurements (OD.sub.420-580) were computer automated with EZ Experiment. Data was collected and exported to Microsoft Excel spreadsheets for analysis.
[0160] Culture Growth and Metabolite Analysis
[0161] Shake flask experiments were performed using M9 minimal media (Sigma-Aldrich) containing 6.78 g/L disodium phosphate, 3 g/L monopotassium phosphate, 0.5 g/L NaCl, 1 g/L NH.sub.4Cl, 2 mM MgSO.sub.4, 100 M CaCl.sub.2, and 40 M FeSO4.7H.sub.2O supplemented with 20 mM glucose (Fisher Scientific), ethylene glycol, or sodium acetate (Sigma-Aldrich). Cultures were grown in 225 mL baffled shake flasks, incubated at 30 C., 225 rpm. Culture growth was followed by periodic measurement of the optical density at 600 nm (OD.sub.600) using a Beckman DU640 spectrophotometer (Beckman Coulter, Brea Calif.). When testing for growth on ethylene glycol, glyxoylate or glycolaldehyde, overnight cultures were spun down, washed in M9 minimal media lacking substrates and resuspended in same media prior to inoculating into shake flasks at OD.sub.600=0.1. Growth was conducted in shake flasks under the same conditions described above. Except for experiments conducted with plasmid-bearing strains, all cultures were performed in duplicate. Concentrations of glucose, ethylene glycol, glycolaldehyde, glyoxal, glycolate, glyxoylate, and oxalate in filtered culture supernatant samples were measured by high performance liquid chromatography (HPLC) on an Agilent1100 series system (Agilent USA, Santa Clara, Calif.) utilizing a Phenomenex Rezex RFQ-Fast Fruit H.sup.+ column (Phenomenex, Torrance, Calif.) and cation H+ guard cartridge (Bio-Rad Laboratories, Hercules, Calif.) at 85 C. A mobile phase of 0.1 N sulfuric acid was used at a flow rate of 1.0 mL/min and a diode array detector was utilized for compound detection. Products were identified by comparing the retention times and spectral profiles with pure compounds.
[0162] RNA Extraction, cDNA Synthesis and Quantitative Real-Time PCR
[0163] To prepare P. putida cultures for RNA extraction, cells were grown up overnight in M9 minimal medium containing 20 mM glucose in baffled shake flasks at 30 C., 225 rpm. Cells were then diluted and transferred to fresh cultures containing 20 mM ethylene glycol and 40 mM sodium acetate @ OD.sub.600=0.1, 30 C., 225 rpm. Cells were harvested at mid-exponential growth phase when OD600 reached 0.8-1 by adding cells to 2 volume of Qiagen RNAprotect Bacteria Reagent, mixing well and resting for 5 minutes prior to centrifugation at 5,000g for 15 min at 4 C. Supernatant was removed and cells were frozen and stored at 80 C. until use. RNA was extracted from cells using Qiagen's RNeasy mini kit following manufacturer's instructions including a DNAse (Qiagen RNase-Free DNase) in column digestion for 1 hour at room temperature following manufacturer's instructions. After isolation, and additional DNase digestion was performed with Ambion's TURBO DNase (Ambion, Austin, Tex., USA) for 2 hours at 37 C. that was followed by an additional RNA purification to remove DNase using the same kit. cDNA was prepared from RNA using an iScript Reverse Transcription supermix kit for RT-qPCR (Bio-Rad). The expression levels of seven genes were analyzed using primers designed by the Realtime PCR tool for RT-qPCR and is listed in Table 4 (http://www.idtdna.com/scitools/Applications/RealTimePCR/). Quantitive real-time PCR was performed using iQ SYBR Green Supermix (Bio-Rad) on a Bio-Rad CFX96 Touch Real-Time PCR Detection System (Bio-Rad Lab, Hercules, Calif., USA). The reaction conditions were 10 min at 95 C., 39(15 s at 95 C., 45 s at 55 C., followed by melting curve analysis: 1 min at 95 C., 81 (30 s starting at 55 C., increasing 0.5 C. per cycle, ending at 95 C.). Experiments were performed in triplicate with biological duplicates. The gene expression levels were assessed by the following formula:
Gene expression level=2.sup.C(rpoD)Ct(target)
[0164] Ct values represent the first cycle at which the instrument can distinguish the fluorescence of nucleic acid amplification generated as being above the background signal. This method compares the Ct value of the house keeping gene rpoD to the Ct value of the target gene. Final expression levels were averaged for each target gene and normalized to the expression level of the control (P. putida KT2440) strain. NAD(P)H oxidizing activity assays used for measuring hydroxypyruvate substrate conversion
[0165] For extracting whole lysate protein for enzyme assays, strains were grown in LB medium and harvested during exponential growth phase. The cells were collected by centrifugation at 4,800 rpm for 5 min, washed with water twice, and re-suspended in B-PER solution supplemented with protease inhibitor cocktail (Thermo Fisher Scientific, Waltham, Mass., USA). Whole lysate proteins were obtained by following manufacture recommended protocol (Thermo Fisher Scientific, Waltham, Mass., USA). The protein concentration of samples was assessed using a NanoDrop 2000/c Spectrophotometers (Thermo Fisher Scientific, Waltham, Mass., USA) by following manufacturer protocol. Hydroxypyruvate reduction activity of samples was measured by monitoring oxidation of NAD(P)H at 340 nm with FLUOstar Omega micro plate reader (BMG Labtech, Ortenberg, Germany). Two hundred microliters of a reaction mixture-containing 150 L of 50 mM potassium phosphate buffer (pH 7), 20 L of 0.5 M lithium -hydroxypyruvate hydrate (Sigma-Aldrich, St. Louis, Mo., USA), 20 L of 0.7 mM NAD(P)H, and 10 L of the cell extracts were used for the enzyme activity assay. One unit (1 U) of enzyme was defined by the conversion of 1 M of NAD(P)H into NAD(P).sup.+ per minute. The units were normalized to the total protein (mg).
TABLE-US-00009 Sequences: (SEQIDNO:1) pLJ030(P.sub.tac::glcDEF)5-3 sequence(SEQIDNO:1) ttcgcggcggttcgacgcgagagggccgatacaaggccgcttcacccccagccatccatacgcatggtcgccctgaccaggcgctgctcttcctgctcgatctccc gcaaactgtcgcgtatgccgttgatatgctcacgcgccgcccgctgcgcctgctcgggcagttgttccatgactgcgcggtacaaccgcgcatgctgccgatcaatct ggcgtttctgcgctggccggcagtacaagttgttgaccgacgcaaacaccgtgctcaacgtcaggtcactgagcgattgcagggtatgcaccagcactgggttatgc gacgcctactgatggcccggtgaaaggcatggtcacggcgggcatgctcacgggcatcgagcgcctgcgcagcctcgtgcgcagccagcatttcttcgtagcgcc ggcggattagcaggcggtcgacgtcggtagcccgcaacgccgccagccgcgccgactcagcctccagcaacgcccggacctccagcaggtcgaacagagtgc gcggttgcgaacgaacaggtgcatcaaaggcgtagcacccgcctgcccggtgagatcggcgacgaacgaaccccgcccctgttcggtgtcgatgatgccgcgcc cacgcagaacgcgcaggccctcgcgcaaggccgaacgtgaacagccaagcttttccaccagccgccgctccgacggcagtgcctggcccaccttgagcacgcc ttcgacgataagccgctcaacccgttcggccacctggtcggcgaccttggccttgccttcagtacccactgcgcacactcctgctggtaggaccactttgacttatatc gccaatctagccagacagaaccgtgaatagacagtactgcccgaagaaactggtaggaccagtcaacatctcactcgaccccaaacactagcacgcgcacgctgc atcggtgaccgcttcgccaacacaacaaaaaccgttgcgagtgagccgcgcaaaaaaccgcacccaggtgcggttttttgaattcgagctgttgacaattaatcatcg gctcgtataatgtgtcagactcaataataataataaggaggtatcgaatgaatatcctgtacgacgaacgcgtcgatggcgcgctgcccaacgtggacctggccgccc tgttgcaggcgctgcgcgatgccctgccggatcttgaaatcctgcaccgcgatgaagacctcaaaccgtacgaatgcgacggcctgtcggcctaccgcaccgtgcc actgctggtggcgctgcccgagcgcctggcaggtgcagacgctgttgaagctttgccaccagcgcggcgtaccggtggttgcgcgtggcgccggtaccggcctgt ctggtggtgccctgccgctggccaagggcatcctgctggtgatggcgcgcttcaaccgtatcctcgaggtcaacccgcaggggcgttacgcccgcgtgcaaccgg gcgtacgcaacctggccatctcccaggccgccgcaccccatggtatgtactacgcacccgacccttcctcgcaaattgcctgctcgatcggtggcaacgtcgccga aaacgccggtggcgtgcactgcctcaagtacggcctgaccgtacacaatgtgctcaaggtggacatccttacggtcgagggcgaacgcctgagcctgggcagcga tgccctggacagccccggcttcgacctgctggcattgttcacggctccgaaggcatgctcggtatcgtcaccgaagtcaccgtcaagctgctgcccaagccccaggt ggcgcgggtgatactggccagtttcgacagcgtcgaggacgccggccgggcagtcgccgacatcatcgctgccggcatcattcccggcggcctggagatgatgg acaacctggcgatccgcgccgctgaagacttcatccatgccggctacccggtggacgcggcggcgatcctgctgtgcgaactggatggcgtggaagccgatgttta cgacgactgcgagcgcgtcgccgccgtgctgacgcaagccggggcccgcgaggtgcacctactagtagtcaaaagcctccgaccggaggcttttgactcatggat gcctgaaaggctcccttacagatgctgctgcagtgcctcgaccaccatcgccaggccttcatcggcctcctcgatgatcgaacccatacgcatgaagtcatgggtcac tcccgggatcaccgcaagctgcaccgccaccccggcttgctccaagtgccgtgcataagcgacaccctggtcatgcagcgggtcgcactcggcaatcagcatcag tgcaggtgcactgttgctggcgacgctgcccagcaacggtgaaaaacgcggatcgtgacggtctgccggcaccgtggcgtattgctggtagaaccactccagggt ctgcgcttcaagcaggtaaccgctgccatagcgctgcaccgaaggccgccggcaactggcatcggtcaccgggtagatcattacctgcaggcgcggtgccggca gctcgcgctgcgcagccaactggttggccagaatggtagccaggctaccaccgacactgtcgcccaccaccgccagtcgctgcgcatcgatgcccagcgcctcg gcctgctcgaccaaccagcgccaggcatccagggcatcgtcactggctgtcgggaaacgccactgcggcgccagccggtagcccacggcaatcaccggcaccc cggcatcctgcgccaggttccagcacagcgtgtcatgcgaatcgaggctgcccaccacgtagccgccgccatgcaggtacagcagcgccgcgccggccagtgc agggtcggcctgcggcgggcggtacaagcgcaccggcaaggtatggccatcgcgggtggtcaacgaaaggtcgctgatgcagtccggctcgtcggccttgccc gcaatcagcgccgaggactcttcgaactggcggcgcgcctcgtccgccgccagggcatgcatgggcagcaccttgccggcgctgcgtccggcctccaccagttg caggtaggccgccaggtcagggttcagggacatcgttcgattctccagaggggcctagcttcacgctgccgaagcactcagggcgcaagggctgctaaaggaag cggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagc aggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaa gccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaac aagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctg tcagcgcaggggcgcccggttcttffigtcaagaccgacctgtccggtgccctgaatgaactccaagacgaggcagcgcggctatcgtggctggccacgacgggc gttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgcc gagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgta ctcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcggatgcccgac ggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggac cgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagc gcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgctagaggatcgatcctttttaacccatcacatatacctgccgttcactattatttagt gaaatgagatattatgatattttctgaattgtgattaaaaaggcaactttatgcccatgcaacagaaactataaaaaatacagagaatgaaaagaaacagatagattlitta gttctttaggcccgtagtctgcaaatccttttatgattttctatcaaacaaaagaggaaaatagaccagttgcaatccaaacgagagtctaatagaatgaggtcgaaaagt aaatcgcgcgggtttgttactgataaagcaggcaagacctaaaatgtgtaaagggcaaagtgtatactttggcgtcaccccttacatattttaggtctttttttattgtgcgt aactaacttgccatcttcaaacaggagggctggaagaagcagaccgctaacacagtacataaaaaaggagacatgaacgatgaacatcaaaaagtttgcaaaacaa gcaacagtattaacctttactaccgcactgctggcaggaggcgcaactcaagcgtttgcgaaagaaacgaaccaaaagccatataaggaaacatacggcatttccca tattacacgccatgatatgctgcaaatccctgaacagcaaaaaaatgaaaaatatcaagtttctgaatttgattcgtccacaattaaaaatatctcttctgcaaaaggcctg gacgtttgggacagctggccattacaaaacgctgacggcactgtcgcaaactatcacggctaccacatcgtctttgcattagccggagatcctaaaaatgcggatgac acatcgatttacatgttctatcaaaaagtcggcgaaacttctattgacagctggaaaaacgctggccgcgtctttaaagacagcgacaaattcgatgcaaatgattctatc ctaaaagaccaaacacaagaatggtcaggttcagccacatttacatctgacggaaaaatccgtttattctacactgatttctccggtaaacattacggcaaacaaacact gacaactgcacaagttaacgtatcagcatcagacagctctttgaacatcaacggtgtagaggattataaatcaatctttgacggtgacggaaaaacgtatcaaaatgta cagcagttcatcgatgaaggcaactacagctcaggcgacaaccatacgctgagagatcctcactacgtagaagataaaggccacaaatacttagtatttgaagcaaa cactggaactgaagatggctaccaaggcgaagaatctttatttaacaaagcatactatggcaaaagcacatcattcttccgtcaagaaagtcaaaaacttctgcaaagc gataaaaaacgcacggctgagttagcaaacggcgctctcggtatgattgagctaaacgatgattacacactgaaaaaagtgatgaaaccgctgattgcatctaacaca gtaacagatgaaattgaacgcgcgaacgtctttaaaatgaacggcaaatggtacctgttcactgactcccgcggatcaaaaatgacgattgacggcattacgtctaac gatatttacatgcttggttatgtttctaattctttaactggcccatacaagccgctgaacaaaactggccttgtgttaaaaatggatcttgatcctaacgatgtaacctttactt actcacacttcgctgtacctcaagcgaaaggaaacaatgtcgtgattacaagctatatgacaaacagaggattctacgcagacaaacaatcaacgtttgcgccgagct tcctgctgaacatcaaaggcaagaaaacatctgttgtcaaagacagcatccttgaacaaggacaattaacagttaacaaataaaaacgcaaaagaaaatgccgatgg gtaccgagcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcggaatcgttttccggga cgccctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagcaggtaggccgacaggctcatgccggccgccgccgccttttc ctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctcatctgttacgccggcg gtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcac ctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaaaatcg ctataatgaccccgaagcagggttatgcagcggaaaagcgctgcttccctgctgttttgtggaatatctaccgactggaaacaggcaaatgcaggaaattactgaact gaggggacaggcgagagacgatgccaaagagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctctt acgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatt tattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagctcctgaaaatctcgata actcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccgg tatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtat gatggtgtttttgaggtgctccagtggcttctgtttctatcagggctggatgatcctccagcgcggggatccatgctggagttcttcgcccaccccaaaaggatctaggt gaagatcattttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaagatcaaaggatcttcttgagatccffittttct gcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagctaccaactcffittccgaaggtaactggcttcagcaga gcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggct gctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagccc agcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaag cggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatattatagtcctgtcgggtttcgccacctctgacttgagcgtcgattttt gtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctattacggttcctggccttttgctggcatttgctcacatgttctttcctgcgttatc ccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaaga gcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaatt aatgtgagttagaagccgaatgtcgatgatatctacaacctgagcgagcacgtcgagcaggaaggggcgtacgtcaccacccgcctgaacatcgccgacccgctg aaggtcatcctgggtgcacgcctggactggtacgacaacaagtcggtgtacagcgaaatcaacgacggctactacaccaacagcgattacaaggtcacccgcaac gtcacccgctacgccggagtgatctacgacctggacgaccaccactcggtctacgccagctacaccgatatcttcatgccgcaatcggaactggcgcgtgaccgct ccatcatccgcccaatcgaaggcaagaactacgagatcggcatcaagggcgagtacttcgacggcgcactcaacgccagcgcggcgatcttccagatcgaccag gaaaaccgcgccgcagaagcttctaaccaggaaggttgcgtcgacatcacctgctacgaagcctcgggcaaggtacgcacccacggtatcgacctggagttgatg ggcgcactgacccccaactggcaagtcggcgcaggctacacctactcgcaaaccaagtaccgcaaggatgccgacaagaacaaggaaggcaccaagttcgaca ccgacctgccagaacacctgttcaagctgagcaccacctacaccttgccgggcgagctgaaccagtggcgcgtgggcggtaacgtgtatggccagagcagcatct tcaacaaaggcagcaacagcttcggcaactaccacatcgatcaaggtgcatacgcggtagtgggcctgatggtcggctacaaggtcaacaagaacctcgacactc gcctgaacctcaacaacgtattcgacaagaagtactaccagggcattgccagcaacaactcctggagcccgtacgacgtgtatggtgacccacgcaacttcaccatc accgccaatacagcttctgatcgcctgacgttgaacgcaaaaaaccgcacccaggtgcggttttttgaattcgagctgttgacaattaatcatcggctcgtataatgtgtg gaattgtgagcggataacaatttcacactctaga SEQIDNO:2 pLJ032(fpvA::Ptac::gcl-glxR)5-3 sequence(SEQIDNO:2) tagtcaaaagcctccgaccggaggcttttgactcatggatgcctgaaaggctcccttacagatgctgctgcagtgcctcgaccaccatcgccaggccttcatcggcc tcctcgatgatcgaacccatacgcatgaagtcatgggtcactcccgggatcaccgcaagctgcaccgccaccccggcttgctccaagtgccgtgcataagcgaca ccctggtcatgcagcgggtcgcactcggcaatcagcatcagtgcaggtgcactgttgctggcgacgctgcccagcaacggtgaaaaacgcggatcgtgacggtct gccggcaccgtggcgtattgctggtagaaccactccagggtctgcgcttcaagcaggtaaccgctgccatagcgctgcaccgaaggccgccggcaactggcatcg gtcaccgggtagatcattacctgcaggcgcggtgccggcagctcgcgctgcgcagccaactggttggccagaatggtagccaggctaccaccgacactgtcgccc accaccgccagtcgctgcgcatcgatgcccagcgcctcggcctgctcgaccaaccagcgccaggcatccagggcatcgtcactggctgtcgggaaacgccactgc ggcgccagccggtagcccacggcaatcaccggcaccccggcatcctgcgccaggttccagcacagcgtgtcatgcgaatcgaggctgcccaccacgtagccgcc gccatgcaggtacagcagcgccgcgccggccagtgcagggtcggcctgcggcgggcggtacaagcgcaccggcaaggtatggccatcgcgggtggtcaacgaa aggtcgctgatgcagtccggctcgtcggccttgcccgcaatcagcgccgaggactcttcgaactggcggcgcgcctcgtccgccgccagggcatgcatgggcagc accttgccggcgctgcgtccggcctccaccagttgcaggtaggccgccaggtcagggttcagggacatcgttcgattctccagaggggcctagcttcacgctgccg caagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatc tggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccgg aattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctg atcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcac aacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactccaa gacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaa gtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgccc attcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgc cagccgaactgttcgccaggctcaaggcgcggatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggcc gcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggct gaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgctagagg atcgatcctttttaacccatcacatatacctgccgttcactattatttagtgaaatgagatattatgatattttctgaattgtgattaaaaaggcaactttatgcccatg caacagaaactataaaaaatacagagaatgaaaagaaacagatagattttttagttctttaggcccgtagtctgcaaatccttttatgattttctatcaaacaaaa gaggaaaatagaccagttgcaatccaaacgagagtctaatagaatgaggtcgaaaagtaaatcgcgcgggtttgttactgataaagcaggcaagacctaaaat gtgtaaagggcaaagtgtatactttggcgtcaccccttacatattttaggtctttttttattgtgcgtaactaacttgccatcttcaaacaggagggctggaagaagc agaccgctaacacagtacataaaaaaggagacatgaacgatgaacatcaaaaagtttgcaaaacaagcaacagtattaacctttactaccgcactgctggcag gaggcgcaactcaagcgtttgcgaaagaaacgaaccaaaagccatataaggaaacatacggcatttcccatattacacgccatgatatgctgcaaatccctgaa cagcaaaaaaatgaaaaatatcaagtttctgaatttgattcgtccacaattaaaaatatctcttctgcaaaaggcctggacgtttgggacagctggccattacaaa acgctgacggcactgtcgcaaactatcacggctaccacatcgtctttgcattagccggagatcctaaaaatgcggatgacacatcgatttacatgttctatcaaaa agtcggcgaaacttctattgacagctggaaaaacgctggccgcgtctttaaagacagcgacaaattcgatgcaaatgattctatcctaaaagaccaaacacaag aatggtcaggttcagccacatttacatctgacggaaaaatccgtttattctacactgatttctccggtaaacattacggcaaacaaacactgacaactgcacaagtt aacgtatcagcatcagacagctctttgaacatcaacggtgtagaggattataaatcaatctttgacggtgacggaaaaacgtatcaaaatgtacagcagttcatc gatgaaggcaactacagctcaggcgacaaccatacgctgagagatcctcactacgtagaagataaaggccacaaatacttagtatttgaagcaaacactggaac tgaagatggctaccaaggcgaagaatctttatttaacaaagcatactatggcaaaagcacatcattcttccgtcaagaaagtcaaaaacttctgcaaagcgataa aaaacgcacggctgagttagcaaacggcgctctcggtatgattgagctaaacgatgattacacactgaaaaaagtgatgaaaccgctgattgcatctaacacagt aacagatgaaattgaacgcgcgaacgtctttaaaatgaacggcaaatggtacctgttcactgactcccgcggatcaaaaatgacgattgacggcattacgtctaa cgatatttacatgcttggttatgtttctaattctttaactggcccatacaagccgctgaacaaaactggccttgtgttaaaaatggatcttgatcctaacgatgtaacc tttacttactcacacttcgctgtacctcaagcgaaaggaaacaatgtcgtgattacaagctatatgacaaacagaggattctacgcagacaaacaatcaacgtttg cgccgagcttcctgctgaacatcaaaggcaagaaaacatctgttgtcaaagacagcatccttgaacaaggacaattaacagttaacaaataaaaacgcaaaag aaaatgccgatgggtaccgagcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcgg aatcgttttccgggacgccctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagcaggtaggccgacaggctcatgccggc cgccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccct catctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgc gggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggat ggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaagcgctgcttccctgctgttttgtggaatatctaccgactggaaacaggc aaatgcaggaaattactgaactgaggggacaggcgagagacgatgccaaagagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttattt cattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttatt ctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtgg cttctgtttctatcagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgt ctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaa gtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagggctggatgatcctccagcgcgggga tctcatgctggagttcttcgcccaccccaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtca gaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccg gatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaa ctctgtagcaccgcctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttacc ggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatga gaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgc ctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcgg cctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgc tcgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaa tgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagaagccgaatgtcgatgatatctacaacctgagcga gcacgtcgagcaggaaggggcgtacgtcaccacccgcctgaacatcgccgacccgctgaaggtcatcctgggtgcacgcctggactggtacgacaacaagtcgg tgtacagcgaaatcaacgacggctactacaccaacagcgattacaaggtcacccgcaacgtcacccgctacgccggagtgatctacgacctggacgaccaccac tcggtctacgccagctacaccgatatcttcatgccgcaatcggaactggcgcgtgaccgctccatcatccgcccaatcgaaggcaagaactacgagatcggcatc aagggcgagtacttcgacggcgcactcaacgccagcgcggcgatcttccagatcgaccaggaaaaccgcgccgcagaagcttctaaccaggaaggttgcgtcg acatcacctgctacgaagcctcgggcaaggtacgcacccacggtatcgacctggagttgatgggcgcactgacccccaactggcaagtcggcgcaggctacacc tactcgcaaaccaagtaccgcaaggatgccgacaagaacaaggaaggcaccaagttcgacaccgacctgccagaacacctgttcaagctgagcaccacctaca ccttgccgggcgagctgaaccagtggcgcgtgggcggtaacgtgtatggccagagcagcatcttcaacaaaggcagcaacagcttcggcaactaccacatcgat caaggtgcatacgcggtagtgggcctgatggtcggctacaaggtcaacaagaacctcgacactcgcctgaacctcaacaacgtattcgacaagaagtactacca gggcattgccagcaacaactcctggagcccgtacgacgtgtatggtgacccacgcaacttcaccatcaccgccaagtacagcttctgatcgcctgacgttgaacgc aaaaaaccgcacccaggtgcggttttttgaattcgagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttcacactaaagt taatattaaggaggtaaacatgagcaaaatgagagcaatcgatgcagccgttctggtcatgcgccgtgaaggtgtagataccgcgttcggcatcccgggggctgc catcaacccgttgtattcggccctgaaaaaagtcggtggcatcgatcacgtcctcgctcgtcacgtcgaaggtgcctcgcacatggccgagggctacacccgcgcc aacccgggcaacatcggtgtgtgcatcggcacttccggccctgccggcaccgacatggtcaccggcctgtacagtgcctcggccgactccatcccgattctgtgca tcactggccaggcgccacgtgcccgtctgcacaaggaagacttccaggctgtcgacatcaccaacatcgtcaagccagtgaccaagtgggcgaccaccgttctgg agccaggccaggtgccttacgccttccagaaggccttctatgaaatgcgtaccggccgcccaggcccggtgctgatcgacctgccgttcgacgtgcagatggccg aaatcgaattcgacatcgacgcctacgaaccgctgcccgtgcacaaaccgtccgccacacgcgtacaggccgaaaaagccctggccctgctcaatgacgccgag cgcccactgctggtagccggtggcggcatcatcaacgccgacgccagtgacaagctggtcgaattcgccgaactgaccggcgtacccgtgatcccgaccctgatg ggctggggcaccatcccggacgaccacgcacagatggtcggcatggtcggcctgcagacctcgcaccgctatggcaacgcaaccctgctgaaatccgacctggt gttcggtatcggtaaccgctgggccaaccgccacaccggttccgtcgatgtctacaccgaaggccgcaagttcgtgcacgtcgacatcgaaccgacccagatcgg ccgcgtgttcaccccggacctgggcatcgtttccgatgctggtaaggcactggacgtgttcctggaagtggcccgcgagtggaaagccgccggcaagctcaaatg ccgcaaggcctggctggaagagtgccaggagcgcaagtcgagcctgcagcgcaagacccacttcgacaacgtgccggtcaagccgcagcgcgtctacgaagaa atgaaccaagtgttcggcaaggacacctgctacgtcagcaccatcggcctgtcgcagattgccggcgcgcagttcctgcatgtgtacaagcctcgccactggatca actgcggccaggccggcccgctgggctggaccatccctgctgcgctgggcgtggtcaaagccgatccgaagcgcaaggttgtggcgctgtcgggtgactacgact tccagttcatgatcgaagaactggcggtaggcgcccagttcaacctgccgtacgtccacgtactggtgaacaacgcctacctgggcctgatccgccaggcgcagc gtggcttcgacatggattactgtgtacaactggcgttcgagaacatcaactcgaccgacgctgccacctacggtgtcgaccacgtcgctgtggtcgaaggcctggg ttgcaaggccatccgtgtgttcgagccagcagaaatcgcccctgccctgatcaaggcacagaagatggccgaagagttccgcgtgccggtggtggttgaagtgat tctcgagcgtgtgaccaacatttccatgggcaccgagatcaacgcggtcaacgaattcgaagacctggccctggtcggcaacgacgcgccaaccgccatctcgct gctggactgatatcaaaacgacaactaactaaggaggtacactatggctaaaatcggtttcatcggcaccggcatcatgggcaagcccatggctcagaacctgca aaaggcaggtcacagcctgttcatttccacccaccacgacgccgcgccagccgacctgatcgctgccggtgccgtggccctggccaacccgaaagaggttgccca ggaagccgaattcatcatcgtcatggtccccgacaccccgcaggtcgaaagcgtcctgttcggtgaaaacggcgtggccgagggcgttggcccgaacaaggtgg tgatcgacatgagctcgatctcgccaaccgccaccaaagccttcgccgagaagatcaaggctaccggtgccgcctacctggacgccccggtgtccggtggtgaag tcggcgccaaggcggcgaccctgagcatcatggttggtggctgcccgaacgccttcgagcgcaccctgccgctgttcgaagccatgggcaagaacatcacccgcg tcggtggcaacggtgacggccagaccgccaaggtcgccaaccagatcattgtcgccctgaacatccaggccgtggccgaagccctgctgttcgccgccaagaac ggcgccgaccctgccaaggtgcgcgaagcactgatgggcggctttgcttcgtcgaaaatcctcgaagtgcacgccgagcgcatgatcaagggcaccttcgaccca ggcttccgcatcaacctgcaccagaaggacctgaacctggccctgcaaggcgccaaggaactgggcatcaacctgcccaacacctccaatgcccagcaagtgtt caacacctgccaggccctgggcggcggcaactgggaccactcggcgctgatcaaaggcctggagcacatggccaacttctcgatccgcgacgacaaataactag t SEQIDNO:3 pMFL160(fpvA::Ptac::gcl-hyi-glxR)5-3 sequence(SEQIDNO:3) agtcaaaagcctccgaccggaggcttttgactcatggatgcctgaaaggctcccttacagatgctgctgcagtgcctcgaccaccatcgccaggccttcatcggcct cctcgatgatcgaacccatacgcatgaagtcatgggtcactcccgggatcaccgcaagctgcaccgccaccccggcttgctccaagtgccgtgcataagcgacac cctggtcatgcagcgggtcgcactcggcaatcagcatcagtgcaggtgcactgttgctggcgacgctgcccagcaacggtgaaaaacgcggatcgtgacggtctg ccggcaccgtggcgtattgctggtagaaccactccagggtctgcgcttcaagcaggtaaccgctgccatagcgctgcaccgaaggccgccggcaactggcatcgg tcaccgggtagatcattacctgcaggcgcggtgccggcagctcgcgctgcgcagccaactggttggccagaatggtagccaggctaccaccgacactgtcgccca ccaccgccagtcgctgcgcatcgatgcccagcgcctcggcctgctcgaccaaccagcgccaggcatccagggcatcgtcactggctgtcgggaaacgccactgcg gcgccagccggtagcccacggcaatcaccggcaccccggcatcctgcgccaggttccagcacagcgtgtcatgcgaatcgaggctgcccaccacgtagccgccg ccatgcaggtacagcagcgccgcgccggccagtgcagggtcggcctgcggcgggcggtacaagcgcaccggcaaggtatggccatcgcgggtggtcaacgaaa ggtcgctgatgcagtccggctcgtcggccttgcccgcaatcagcgccgaggactcttcgaactggcggcgcgcctcgtccgccgccagggcatgcatgggcagca ccttgccggcgctgcgtccggcctccaccagttgcaggtaggccgccaggtcagggttcagggacatcgttcgattctccagaggggcctagcttcacgctgccgc aagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatct ggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccgg aattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctg atcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcac aacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactccaa gacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaa gtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgccc attcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgc cagccgaactgttcgccaggctcaaggcgcggatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggcc gcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggct gaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgctagagg atcgatcctttttaacccatcacatatacctgccgttcactattatttagtgaaatgagatattatgatattttctgaattgtgattaaaaaggcaactttatgcccatg caacagaaactataaaaaatacagagaatgaaaagaaacagatagattttttagttctttaggcccgtagtctgcaaatccttttatgattttctatcaaacaaaa gaggaaaatagaccagttgcaatccaaacgagagtctaatagaatgaggtcgaaaagtaaatcgcgcgggtttgttactgataaagcaggcaagacctaaaat gtgtaaagggcaaagtgtatactttggcgtcaccccttacatattttaggtctttttttattgtgcgtaactaacttgccatcttcaaacaggagggctggaagaagc agaccgctaacacagtacataaaaaaggagacatgaacgatgaacatcaaaaagtttgcaaaacaagcaacagtattaacctttactaccgcactgctggcag gaggcgcaactcaagcgtttgcgaaagaaacgaaccaaaagccatataaggaaacatacggcatttcccatattacacgccatgatatgctgcaaatccctgaa cagcaaaaaaatgaaaaatatcaagtttctgaatttgattcgtccacaattaaaaatatctcttctgcaaaaggcctggacgtttgggacagctggccattacaaa acgctgacggcactgtcgcaaactatcacggctaccacatcgtctttgcattagccggagatcctaaaaatgcggatgacacatcgatttacatgttctatcaaaa agtcggcgaaacttctattgacagctggaaaaacgctggccgcgtctttaaagacagcgacaaattcgatgcaaatgattctatcctaaaagaccaaacacaag aatggtcaggttcagccacatttacatctgacggaaaaatccgtttattctacactgatttctccggtaaacattacggcaaacaaacactgacaactgcacaagtt aacgtatcagcatcagacagctcttgaacatcaacggtgtagaggattataaatcaatctttgacggtgacggaaaaacgtatcaaaatgtacagcagttcatcg atgaaggcaactacagctcaggcgacaaccatacgctgagagatcctcactacgtagaagataaaggccacaaatacttagtatttgaagcaaacactggaact gaagatggctaccaaggcgaagaatctttatttaacaaagcatactatggcaaaagcacatcattcttccgtcaagaaagtcaaaaacttctgcaaagcgataaa aaacgcacggctgagttagcaaacggcgctctcggtatgattgagctaaacgatgattacacactgaaaaaagtgatgaaaccgctgattgcatctaacacagta acagatgaaattgaacgcgcgaacgtctttaaaatgaacggcaaatggtacctgttcactgactcccgcggatcaaaaatgacgattgacggcattacgtctaac gatatttacatgcttggttatgtttctaattctttaactggcccatacaagccgctgaacaaaactggccttgtgttaaaaatggatcttgatcctaacgatgtaacct ttacttactcacacttcgctgtacctcaagcgaaaggaaacaatgtcgtgattacaagctatatgacaaacagaggattctacgcagacaaacaatcaacgtttgc gccgagcttcctgctgaacatcaaaggcaagaaaacatctgttgtcaaagacagcatccttgaacaaggacaattaacagttaacaaataaaaacgcaaaaga aaatgccgatgggtaccgagcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgccttctatgaaaggttgggcttcgga atcgttttccgggacgccctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagcaggtaggccgacaggctcatgccggcc gccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctc atctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcg ggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatg gatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaagcgctgcttccctgctgttttgtggaatatctaccgactggaaacaggca aatgcaggaaattactgaactgaggggacaggcgagagacgatgccaaagagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttc attatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattc tgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggc ttctgtttctatcagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtc tcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaag tgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagggctggatgatcctccagcgcggggat ctcatgctggagttcttcgcccaccccaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtca gaccccgtagaaaagatcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccg gatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaa ctctgtagcaccgcctacatacctcgctctgctaatcctgttacagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccg gataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgag aaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcc tggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggc ctttttacggttcctggccttttgctggccttttgctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgct cgccgcagccgaacgaccgagcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaat gcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagaagccgaatgtcgatgatatctacaacctgagcgag cacgtcgagcaggaaggggcgtacgtcaccacccgcctgaacatcgccgacccgctgaaggtcatcctgggtgcacgcctggactggtacgacaacaagtcggt gtacagcgaaatcaacgacggctactacaccaacagcgattacaaggtcacccgcaacgtcacccgctacgccggagtgatctacgacctggacgaccaccact cggtctacgccagctacaccgatatcttcatgccgcaatcggaactggcgcgtgaccgctccatcatccgcccaatcgaaggcaagaactacgagatcggcatca agggcgagtacttcgacggcgcactcaacgccagcgcggcgatcttccagatcgaccaggaaaaccgcgccgcagaagcttctaaccaggaaggttgcgtcgac atcacctgctacgaagcctcgggcaaggtacgcacccacggtatcgacctggagttgatgggcgcactgacccccaactggcaagtcggcgcaggctacaccta ctcgcaaaccaagtaccgcaaggatgccgacaagaacaaggaaggcaccaagttcgacaccgacctgccagaacacctgttcaagctgagcaccacctacacc ttgccgggcgagctgaaccagtggcgcgtgggcggtaacgtgtatggccagagcagcatcttcaacaaaggcagcaacagcttcggcaactaccacatcgatca aggtgcatacgcggtagtgggcctgatggtcggctacaaggtcaacaagaacctcgacactcgcctgaacctcaacaacgtattcgacaagaagtactaccagg gcattgccagcaacaactcctggagcccgtacgacgtgtatggtgacccacgcaacttcaccatcaccgccaagtacagcttctgatcgcctgacgttgaacgcaa aaaaccgcacccaggtgcggttttttgaattcgagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttcacactctagaga ggaggacagctatgagcaaaatgagagcaatcgatgcagccgttctggtcatgcgccgtgaaggtgtagataccgcgttcggcatcccgggggctgccatcaac ccgttgtattcggccctgaaaaaagtcggtggcatcgatcacgtcctcgctcgtcacgtcgaaggtgcctcgcacatggccgagggctacacccgcgccaacccgg gcaacatcggtgtgtgcatcggcacttccggccctgccggcaccgacatggtcaccggcctgtacagtgcctcggccgactccatcccgattctgtgcatcactggc caggcgccacgtgcccgtctgcacaaggaagacttccaggctgtcgacatcaccaacatcgtcaagccagtgaccaagtgggcgaccaccgttctggagccagg ccaggtgccttacgccttccagaaggccttctatgaaatgcgtaccggccgcccaggcccggtgctgatcgacctgccgttcgacgtgcagatggccgaaatcgaa ttcgacatcgacgcctacgaaccgctgcccgtgcacaaaccgtccgccacacgcgtacaggccgaaaaagccctggccctgctcaatgacgccgagcgcccact gctggtagccggtggcggcatcatcaacgccgacgccagtgacaagctggtcgaattcgccgaactgaccggcgtacccgtgatcccgaccctgatgggctgggg caccatcccggacgaccacgcacagatggtcggcatggtcggcctgcagacctcgcaccgctatggcaacgcaaccctgctgaaatccgacctggtgttcggtat cggtaaccgctgggccaaccgccacaccggttccgtcgatgtctacaccgaaggccgcaagttcgtgcacgtcgacatcgaaccgacccagatcggccgcgtgtt caccccggacctgggcatcgtttccgatgctggtaaggcactggacgtgttcctggaagtggcccgcgagtggaaagccgccggcaagctcaaatgccgcaagg cctggctggaagagtgccaggagcgcaagtcgagcctgcagcgcaagacccacttcgacaacgtgccggtcaagccgcagcgcgtctacgaagaaatgaacca agtgttcggcaaggacacctgctacgtcagcaccatcggcctgtcgcagattgccggcgcgcagttcctgcatgtgtacaagcctcgccactggatcaactgcggc caggccggcccgctgggctggaccatccctgctgcgctgggcgtggtcaaagccgatccgaagcgcaaggttgtggcgctgtcgggtgactacgacttccagttc atgatcgaagaactggcggtaggcgcccagttcaacctgccgtacgtccacgtactggtgaacaacgcctacctgggcctgatccgccaggcgcagcgtggcttc gacatggattactgtgtacaactggcgttcgagaacatcaactcgaccgacgctgccacctacggtgtcgaccacgtcgctgtggtcgaaggcctgggttgcaagg ccatccgtgtgttcgagccagcagaaatcgcccctgccctgatcaaggcacagaagatggccgaagagttccgcgtgccggtggtggttgaagtgattctcgagc gtgtgaccaacatttccatgggcaccgagatcaacgcggtcaacgaattcgaagacctggccctggtcggcaacgacgcgccaaccgccatctcgctgctggact gatcgcctgacgcccccaggcacgccctgggggccttcatcgcaaggagacaactcatgcctcgcttcgctgccaacctgtccatgctgttcaccgaacaggactt cctggcccgcttcaaggctgccgccgatgctggtttcagcggcgtcgaatacctgttcccgtacgacttcagcgctgccgacatcaagcagcagctggaggccaac ggcctgacccaggtgctgttcaacctgccggccggcgactgggccaaaggtgagcgcggtatcacctgccaccccgaccgcatcgaagagttccgtgccggtgtc gacaaggccatcgagtacgccaaggtgctgggcaatactcaggtcaacgccctggccggcatccgcccacaaggcccggactgcgccaccgtgcgtaagacctt cgtcgagaacctgcgctacgccgctgacaagctcaagggcgccgggatccgcctggtcatggaaatgatcaacacccgcgacatccccggcttctacctgaacac cacccagcaggccctggaaatccaggccgaagtgggcagcgacaacctgttcctgcaatacgacatctaccacatgcagatcatggaaggtgacctggctcgca ccatggaagccaacctgaagctgatcaaccacatccagctggccgacaacccaggccgcaatgaaccaggcaccggcgagatcaactaccgcttcctgttcgaa cacctggaccgcattggctaccagggctgggtgggcgcggagtacaagccgctgaccaccaccggcgggcctgggctggctgaaaacccacaacgcaatctga ggaacaactcgggaccctgtgggagcgggctcgcccgcgaacaccggcaaagccggtgccatccaccgagttgtctgcttcgcgggcgagcccgctcccacagg gggccaaagcttgcttgagatatcacaattacaaagaggtaatttctcatggctaaaatcggtttcatcggcaccggcatcatgggcaagcccatggctcagaacc tgcaaaaggcaggtcacagcctgttcatttccacccaccacgacgccgcgccagccgacctgatcgctgccggtgccgtggccctggccaacccgaaagaggttg cccaggaagccgaattcatcatcgtcatggtccccgacaccccgcaggtcgaaagcgtcctgttcggtgaaaacggcgtggccgagggcgttggcccgaacaag gtggtgatcgacatgagctcgatctcgccaaccgccaccaaagccttcgccgagaagatcaaggctaccggtgccgcctacctggacgccccggtgtccggtggt gaagtcggcgccaaggcggcgaccctgagcatcatggttggtggctgcccgaacgccttcgagcgcaccctgccgctgttcgaagccatgggcaagaacatcac ccgcgtcggtggcaacggtgacggccagaccgccaaggtcgccaaccagatcattgtcgccctgaacatccaggccgtggccgaagccctgctgttcgccgccaa gaacggcgccgaccctgccaaggtgcgcgaagcactgatgggcggctttgcttcgtcgaaaatcctcgaagtgcacgccgagcgcatgatcaagggcaccttcg acccaggcttccgcatcaacctgcaccagaaggacctgaacctggccctgcaaggcgccaaggaactgggcatcaacctgcccaacacctccaatgcccagcaa gtgttcaacacctgccaggccctgggcggcggcaactgggaccactcggcgctgatcaaaggcctggagcacatggccaacttctcgatccgcgacgacaaata aactagt SEQIDNO:4 pMFL161(fpvA::P.sub.tac::gcl-hyi-glxR-ttuD-pykF)5-3 sequence(SEQIDNO:4) agtcaaaagcctccgaccggaggcttttgactcatggatgcctgaaaggctcccttacagatgctgctgcagtgcctcgaccaccatcgccaggccttcatcggcctc ctcgatgatcgaacccatacgcatgaagtcatgggtcactcccgggatcaccgcaagctgcaccgccaccccggcttgctccaagtgccgtgcataagcgacaccc tggtcatgcagcgggtcgcactcggcaatcagcatcagtgcaggtgcactgttgctggcgacgctgcccagcaacggtgaaaaacgcggatcgtgacggtctgcc ggcaccgtggcgtattgctggtagaaccactccagggtctgcgcttcaagcaggtaaccgctgccatagcgctgcaccgaaggccgccggcaactggcatcggtc accgggtagatcattacctgcaggcgcggtgccggcagctcgcgctgcgcagccaactggttggccagaatggtagccaggctaccaccgacactgtcgcccac caccgccagtcgctgcgcatcgatgcccagcgcctcggcctgctcgaccaaccagcgccaggcatccagggcatcgtcactggctgtcgggaaacgccactgcg gcgccagccggtagcccacggcaatcaccggcaccccggcatcctgcgccaggttccagcacagcgtgtcatgcgaatcgaggctgcccaccacgtagccgcc gccatgcaggtacagcagcgccgcgccggccagtgcagggtcggcctgcggcgggcggtacaagcgcaccggcaaggtatggccatcgcgggtggtcaacg aaaggtcgctgatgcagtccggctcgtcggccttgcccgcaatcagcgccgaggactcttcgaactggcggcgcgcctcgtccgccgccagggcatgcatgggc agcaccttgccggcgctgcgtccggcctccaccagttgcaggtaggccgccaggtcagggttcagggacatcgttcgattctccagaggggcctagcttcacgctg ccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggct atctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaacc ggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatct gatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcaca acagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactccaaga cgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagt gccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattc gaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagc cgaactgttcgccaggctcaaggcgcggatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgctttt ctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgc ttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgagcgggactctggggttcgctagaggatcgatcct ttttaacccatcacatatacctgccgttcactattatttagtgaaatgagatattatgatattttctgaattgtgattaaaaaggcaactttatgcccatgcaacagaaactataa aaaatacagagaatgaaaagaaacagatagattttttagttctttaggcccgtagtctgcaaatccttttatgattttctatcaaacaaaagaggaaaatagaccagttgca atccaaacgagagtctaatagaatgaggtcgaaaagtaaatcgcgcgggtttgttactgataaagcaggcaagacctaaaatgtgtaaagggcaaagtgtatactttg gcgtcaccccttacatattttaggtcffittttattgtgcgtaactaacttgccatcttcaaacaggagggctggaagaagcagaccgctaacacagtacataaaaaagga gacatgaacgatgaacatcaaaaagtttgcaaaacaagcaacagtattaacattactaccgcactgctggcaggaggcgcaactcaagcgtttgcgaaagaaacga accaaaagccatataaggaaacatacggcatttcccatattacacgccatgatatgctgcaaatccctgaacagcaaaaaaatgaaaaatatcaagtttctgaatttgatt cgtccacaattaaaaatatctcttctgcaaaaggcctggacgtttgggacagctggccattacaaaacgctgacggcactgtcgcaaactatcacggctaccacatcgt ctttgcattagccggagatcctaaaaatgcggatgacacatcgatttacatgttctatcaaaaagtcggcgaaacttctattgacagctggaaaaacgctggccgcgtct ttaaagacagcgacaaattcgatgcaaatgattctatcctaaaagaccaaacacaagaatggtcaggttcagccacatttacatctgacggaaaaatccgtttattctac actgatttctccggtaaacattacggcaaacaaacactgacaactgcacaagttaacgtatcagcatcagacagctctttgaacatcaacggtgtagaggattataaatc aatctttgacggtgacggaaaaacgtatcaaaatgtacagcagttcatcgatgaaggcaactacagctcaggcgacaaccatacgctgagagatcctcactacgtag aagataaaggccacaaatacttagtatttgaagcaaacactggaactgaagatggctaccaaggcgaagaatctttatttaacaaagcatactatggcaaaagcacatc attcttccgtcaagaaagtcaaaaacttctgcaaagcgataaaaaacgcacggctgagttagcaaacggcgctctcggtatgattgagctaaacgatgattacacactg aaaaaagtgatgaaaccgctgattgcatctaacacagtaacagatgaaattgaacgcgcgaacgtctttaaaatgaacggcaaatggtacctgttcactgactcccgc ggatcaaaaatgacgattgacggcattacgtctaacgatatttacatgcttggttatgtttctaattctttaactggcccatacaagccgctgaacaaaactggccttgtgtt aaaaatggatcttgatcctaacgatgtaacctttacttactcacacttcgctgtacctcaagcgaaaggaaacaatgtcgtgattacaagctatatgacaaacagaggatt ctacgcagacaaacaatcaacgtttgcgccgagcttcctgctgaacatcaaaggcaagaaaacatctgttgtcaaagacagcatccttgaacaaggacaattaacagt taacaaataaaaacgcaaaagaaaatgccgatgggtaccgagcgaaatgaccgaccaagcgacgcccaacctgccatcacgagatttcgattccaccgccgcctt ctatgaaaggttgggcttcggaatcgttttccgggacgccctcgcggacgtgctcatagtccacgacgcccgtgattttgtagccctggccgacggccagcaggtag gccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacaccttgataggtgggctgcccttcctggttggcttggtttc atcagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcagagcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaa gaaggaacacccgctcgcgggtgggcctacttcacctatcctgcccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtat atcgtgcgaaaaaggatggatataccgaaaaaatcgctataatgaccccgaagcagggttatgcagcggaaaagcgctgcttccctgctgttttgtggaatatctacc gactggaaacaggcaaatgcaggaaattactgaactgaggggacaggcgagagacgatgccaaagagctcctgaaaatctcgataactcaaaaaatacgcccggt agtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacgtctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccagg atttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtgcgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctcc agtggcttctgtttctatcagctcctgaaaatctcgataactcaaaaaatacgcccggtagtgatcttatttcattatggtgaaagttggaacctcttacgtgccgatcaacg tctcattttcgccaaaagttggcccagggcttcccggtatcaacagggacaccaggatttatttattctgcgaagtgatcttccgtcacaggtatttattcggcgcaaagtg cgtcgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtttctatcagggctggatgatcctccagcgcggggatctcat gctggagttcttcgcccaccccaaaaggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgt agaaaagatcaaaggatcttcttgagatcctttlIttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccggatcaagagct accaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgttcttctagtgtagccgtagttaggccaccacttcaagaactctgtagcaccgc ctacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgtgtcttaccgggttggactcaagacgatagttaccggataaggcgcagcg gtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttc ccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcc tgtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctUttacggttcctggcc ttttgctggccttttgctcacatgttcificctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccga gcgcagcgagtcagtgagcgaggaagcggaagagcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttc ccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagaagccgaatgtcgatgatatctacaacctgagcgagcacgtcgagcaggaaggggcg tacgtcaccacccgcctgaacatcgccgacccgctgaaggtcatcctgggtgcacgcctggactggtacgacaacaagtcggtgtacagcgaaatcaacgacggc tactacaccaacagcgattacaaggtcacccgcaacgtcacccgctacgccggagtgatctacgacctggacgaccaccactcggtctacgccagctacaccgata tcttcatgccgcaatcggaactggcgcgtgaccgctccatcatccgcccaatcgaaggcaagaactacgagatcggcatcaagggcgagtacttcgacggcgcact caacgccagcgcggcgatcttccagatcgaccaggaaaaccgcgccgcagaagcttctaaccaggaaggttgcgtcgacatcacctgctacgaagcctcgggca aggtacgcacccacggtatcgacctggagttgatgggcgcactgacccccaactggcaagtcggcgcaggctacacctactcgcaaaccaagtaccgcaaggat gccgacaagaacaaggaaggcaccaagttcgacaccgacctgccagaacacctgttcaagctgagcaccacctacaccttgccgggcgagctgaaccagtggcg cgtgggcggtaacgtgtatggccagagcagcatcttcaacaaaggcagcaacagcttcggcaactaccacatcgatcaaggtgcatacgcggtagtgggcctgatg gtcggctacaaggtcaacaagaacctcgacactcgcctgaacctcaacaacgtattcgacaagaagtactaccagggcattgccagcaacaactcctggagcccgt acgacgtgtatggtgacccacgcaacttcaccatcaccgccaagtacagcttctgatcgcctgacgttgaacgcaaaaaaccgcacccaggtgcggttttttgaattc gagctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttcacactctagagaggaggacagctatgagcaaaatgagagcaatcga tgcagccgttctggtcatgcgccgtgaaggtgtagataccgcgttcggcatcccgggggctgccatcaacccgttgtattcggccctgaaaaaagtcggtggcatcg atcacgtcctcgctcgtcacgtcgaaggtgcctcgcacatggccgagggctacacccgcgccaacccgggcaacatcggtgtgtgcatcggcacttccggccctg ccggcaccgacatggtcaccggcctgtacagtgcctcggccgactccatcccgattctgtgcatcactggccaggcgccacgtgcccgtctgcacaaggaagactt ccaggctgtcgacatcaccaacatcgtcaagccagtgaccaagtgggcgaccaccgttctggagccaggccaggtgccttacgccttccagaaggccttctatgaa atgcgtaccggccgcccaggcccggtgctgatcgacctgccgttcgacgtgcagatggccgaaatcgaattcgacatcgacgcctacgaaccgctgcccgtgcac aaaccgtccgccacacgcgtacaggccgaaaaagccctggccctgctcaatgacgccgagcgcccactgctggtagccggtggcggcatcatcaacgccgacg ccagtgacaagctggtcgaattcgccgaactgaccggcgtacccgtgatcccgaccctgatgggctggggcaccatcccggacgaccacgcacagatggtcggc atggtcggcctgcagacctcgcaccgctatggcaacgcaaccctgctgaaatccgacctggtgttcggtatcggtaaccgctgggccaaccgccacaccggttccg tcgatgtctacaccgaaggccgcaagttcgtgcacgtcgacatcgaaccgacccagatcggccgcgtgttcaccccggacctgggcatcgtttccgatgctggtaag gcactggacgtgttcctggaagtggcccgcgagtggaaagccgccggcaagctcaaatgccgcaaggcctggctggaagagtgccaggagcgcaagtcgagcc tgcagcgcaagacccacttcgacaacgtgccggtcaagccgcagcgcgtctacgaagaaatgaaccaagtgttcggcaaggacacctgctacgtcagcaccatcg gcctgtcgcagattgccggcgcgcagttcctgcatgtgtacaagcctcgccactggatcaactgcggccaggccggcccgctgggctggaccatccctgctgcgct gggcgtggtcaaagccgatccgaagcgcaaggttgtggcgctgtcgggtgactacgacttccagttcatgatcgaagaactggcggtaggcgcccagttcaacctg ccgtacgtccacgtactggtgaacaacgcctacctgggcctgatccgccaggcgcagcgtggcttcgacatggattactgtgtacaactggcgttcgagaacatcaa ctcgaccgacgctgccacctacggtgtcgaccacgtcgctgtggtcgaaggcctgggttgcaaggccatccgtgtgttcgagccagcagaaatcgcccctgccctg atcaaggcacagaagatggccgaagagttccgcgtgccggtggtggttgaagtgattctcgagcgtgtgaccaacatttccatgggcaccgagatcaacgcggtca acgaattcgaagacctggccctggtcggcaacgacgcgccaaccgccatctcgctgctggactgatcgcctgacgcccccaggcacgccctgggggccttcatcg caaggagacaactcatgcctcgcttcgctgccaacctgtccatgctgttcaccgaacaggacttcctggcccgcttcaaggctgccgccgatgctggtttcagcggcg tcgaatacctgttcccgtacgacttcagcgctgccgacatcaagcagcagctggaggccaacggcctgacccaggtgctgttcaacctgccggccggcgactggg ccaaaggtgagcgcggtatcacctgccaccccgaccgcatcgaagagttccgtgccggtgtcgacaaggccatcgagtacgccaaggtgctgggcaatactcag gtcaacgccctggccggcatccgcccacaaggcccggactgcgccaccgtgcgtaagaccttcgtcgagaacctgcgctacgccgctgacaagctcaagggcgc cgggatccgcctggtcatggaaatgatcaacacccgcgacatccccggcttctacctgaacaccacccagcaggccctggaaatccaggccgaagtgggcagcg acaacctgttcctgcaatacgacatctaccacatgcagatcatggaaggtgacctggctcgcaccatggaagccaacctgaagctgatcaaccacatccagctggcc gacaacccaggccgcaatgaaccaggcaccggcgagatcaactaccgcttcctgttcgaacacctggaccgcattggctaccagggctgggtgggcgcggagta caagccgctgaccaccaccgaagcgggcctgggctggctgaaaacccacaacgcaatctgaggaacaactcgggaccctgtgggagcgggctcgcccgcgaa caccggcaaagccggtgccatccaccgagttgtctgcttcgcgggcgagcccgctcccacagggggccaaagcttgcttgagatatcacaattacaaagaggtaat ttctcatggctaaaatcggtttcatcggcaccggcatcatgggcaagcccatggctcagaacctgcaaaaggcaggtcacagcctgttcatttccacccaccacgacg ccgcgccagccgacctgatcgctgccggtgccgtggccctggccaacccgaaagaggttgcccaggaagccgaattcatcatcgtcatggtccccgacaccccg caggtcgaaagcgtcctgttcggtgaaaacggcgtggccgagggcgttggcccgaacaaggtggtgatcgacatgagctcgatctcgccaaccgccaccaaagc cttcgccgagaagatcaaggctaccggtgccgcctacctggacgccccggtgtccggtggtgaagtcggcgccaaggcggcgaccctgagcatcatggttggtg gctgcccgaacgccttcgagcgcaccctgccgctgttcgaagccatgggcaagaacatcacccgcgtcggtggcaacggtgacggccagaccgccaaggtcgc caaccagatcattgtcgccctgaacatccaggccgtggccgaagccctgctgttcgccgccaagaacggcgccgaccctgccaaggtgcgcgaagcactgatgg gcggctttgcttcgtcgaaaatcctcgaagtgcacgccgagcgcatgatcaagggcaccttcgacccaggcttccgcatcaacctgcaccagaaggacctgaacct ggccctgcaaggcgccaaggaactgggcatcaacctgcccaacacctccaatgcccagcaagtgttcaacacctgccaggccctgggcggcggcaactgggac cactcggcgctgatcaaaggcctggagcacatggccaacttctcgatccgcgacgacaaataaatcgtttttagcctcactggcctcttcgcgggtaaacccgctcct accaaagaccgcacaatcgctcagagctgtgcatgtaggagcgggcttgcccgcgaagaagccaacgccgttgaacctgcgaccacaggcccaatggtggcatc gagcaacacccgcccctggttcggcctgcacggaggcagttccaggggcgtttttgattctgcagaacaacaataattgggagcctgccatgtcggtcgatccgcaa aaacttctccgcgaactgttcgacacagccatcgccgccgcccacccccgtcaagtcctcgaaccctacctgcccgccgatcgcagcggccgggttatcgtcatcg gcgccggcaaggccgcagctgccatggccgaagtggtcgagaaaagctggcagggtgaagtctccggcctggtcgtgacccgttacggccacggcgccaactg ccagaagatcgaggtggtcgaagccgcccacccggtcccggacgctgccggcctggctgtggccaagcgcgtgctggaactggtcagcaacctcaacgaagaa gaccgcgtcatcttcctgctgtctggcggtggctcggcgttgctggccctgcctgccgaaggcctgaccctggccgacaagcagcagatcaacaaggcgctgctga aatccggcgccaccatcggcgagatgaactgcgtgcgcaagcacctctcggcgatcaagggcgggcgcctggccaaggcctgctggccggccacggtctacac ctatgccatttccgatgtaccgggcgacctcgccacggtaatcgcctccggccccaccgtggccgacccgagcacctcggccgacgccctggccatcctcaaacg ctacaacatcgaagcgcccaaagcggtcatcgactggctgaacaacccggcctcggaaaccgtcaaggccgatgacccggccctggcccgcagccacttccagt tgatcgccaaaccccagcagtcgctggaggctgccgcggtcaaagcccgtcaggccggtttcagcccgctgattctcggcgacctggaaggtgaatcgcgcgaag tggccaaggtgcatgccggtatcgcccggcaaatcgttcaacacggccagccgctcaaagcgccctgcgtgatcctgtcgggtggcgaaaccaccgtgaccgtgc gcggcaatggccgtggcgggcgtaacgccgagttcctgctcagcctcaccgaaagcctgaaaggcctgccgggcgtgtacgccctggccggtgacaccgacgg catcgatggctcggaagaaaacgccggtgccttcatgaccccggccagctacgccagcgccgaagccttgggcctgtcggccagcgacgagctggacaacaac aacggctacggctacttcgccgcgctggatgcgctgatcgtcaccgaaccgacccgcaccaacgtcaacgacttccgcgccatcctgatccttgagactgcccaatc atgacgcctgataaaaaagttaagatccttgccacccttggccctgcgatcaacggcatcgacgatatccgccagctggtcgaagccggggtgaacatcttccgcct caacttcagccacggcgaacatgccgaccacgccctgcgctaccagtggatccgcgaagtcgagcaacagctgaactacccgctgggcatcctcatggacctgca agggccgaagctgcgcgttggccgcttcgccgaaggcaaggtgcagttgcaacgcgggcaggccctgcgcctggatctggacaagaccccgggcgacagccg ccgggtcaacctgccgcaccccgaaatcatcgccgccctcgaacccggcatggacctgctgctggacgacggcaagctgcgcctgcgcgtgaccgccaagcac agcgacgccatcgacaccgaggtgctgaatggtggcgagctttccgaccgcaagggcgtcaacgtaccgcaagcggtgctcgacctctccccgctcaccgaaaa agaccgccgcgacctggcctttggcctggagctgggtgtggactgggtcgccctgtcgttcgtgcagcgccctgaggacatcgtcgaagcgcgccagctgattgg cgaccgcgcctacctgatggccaaaatcgagaaaccatcggcagtcgagcaactgcaagccatcgccgagctggcagacgcgatcatggtggcccgtggtgacc tgggcgtggaagtaccggccgagagcgtgccgcagatccagaagcgcatcatcggcacctgccgccagctaggcaaacccgtggtggtggccacgcagatgct cgagtcgatgcgtttctcgccagcgccaacccgcgccgaagtcacggacgtggccaacgcggtggccgaaggtgccgatgcagtgatgctgtcggccgaaaccg cctcgggtgattacccgctggaagccgtgcagatgatgagcaagatcatccgccaggttgagaacggcccggactaccaggcccagctcgacgtcggccggcca aaggccgaagccaccgtgtcggatgccatcagctgcgccatccgccgcatcagcggcatcctgccagtggcggtgctggtcaactacagcgagtcgggtgcctcg accctgcgcgcggcacgtgaacggccacgggcaccgatcctcaacctgacgccgaacctgaacaccgcgcgccgcctgagcgtggcttggggtgtgcattcggt ggtcaacgaccgcctgcgtcaggtcgacgaggtggtttccaccgccctggagattgcccaggcgcaaggcatggccagccgtggcgacacgctgctgatcaccg ctggcgtgcctttcggcaagccgggtacgactaacacgctgcggatcgagactttgatctgaactagt SEQIDNO:5 pSEVA234_gcl_glx(SEQIDNO:5) 1 ttaattaattgacaccatcgaatggtgcaaaacctttcgcggtatggcatgatagcgccc 61 ggaagagagtcaattcagggtggtgaatgtgaaaccagtaacgttatacgatgtcgcaga 121 gtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttc 181 tgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccg 241 cgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtct 301 ggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactggg 361 tgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggt 421 gcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgacca 481 ggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctc 541 tgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgt 601 ggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttc 661 tgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattca 721 gccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgca 781 aatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgct 841 gggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagt 901 gggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaaca 961 ggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggcca 1021 ggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggc 1081 gcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacg 1141 acaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagcgcg 1201 aattgatctggtttgacagcttatcatcgactgcacggtgcaccaatgcttctggcgtca 1261 ggcagccatcggaagctgtggtatggctgtgcaggtcgtaaatcactgcataattcgtgt 1321 cgctcaaggcgcactcccgttctggataatgttttttgcgccgacatcataacggttctg 1381 gcaaatattctgaaatgagctgttgacaattaatcatccggctcgtataatgtgtggaat 1441 tgtgagcggataacaatttcacaccctaggccgcggccgcgcgaattcgagctcgctagg 1501 aggtcaaaccatgagcaaaatgagagcaatcgatgcagccgttctggtcatgcgccgtga 1561 aggtgtagataccgcgttcggcatcccgggggctgccatcaacccgttgtattcggccct 1621 gaaaaaagtcggtggcatcgatcacgtcctcgctcgtcacgtcgaaggtgcctcgcacat 1681 ggccgagggctacacccgcgccaacccgggcaacatcggtgtgtgcatcggcacttccgg 1741 ccctgccggcaccgacatggtcaccggcctgtacagtgcctcggccgactccatcccgat 1801 tctgtgcatcactggccaggcgccacgtgcccgtctgcacaaggaagacttccaggctgt 1861 cgacatcaccaacatcgtcaagccagtgaccaagtgggcgaccaccgttctggagccagg 1921 ccaggtgccttacgccttccagaaggccttctatgaaatgcgtaccggccgcccaggccc 1981 ggtgctgatcgacctgccgttcgacgtgcagatggccgaaatcgaattcgacatcgacgc 2041 ctacgaaccgctgcccgtgcacaaaccgtccgccacacgcgtacaggccgaaaaagccct 2101 ggccctgctcaatgacgccgagcgcccactgctggtagccggtggcggcatcatcaacgc 2161 cgacgccagtgacaagctggtcgaattcgccgaactgaccggcgtacccgtgatcccgac 2221 cctgatgggctggggcaccatcccggacgaccacgcacagatggtcggcatggtcggcct 2281 gcagacctcgcaccgctatggcaacgcaaccctgctgaaatccgacctggtgttcggtat 2341 cggtaaccgctgggccaaccgccacaccggttccgtcgatgtctacaccgaaggccgcaa 2401 gttcgtgcacgtcgacatcgaaccgacccagatcggccgcgtgttcaccccggacctggg 2461 catcgtttccgatgctggtaaggcactggacgtgttcctggaagtggcccgcgagtggaa 2521 agccgccggcaagctcaaatgccgcaaggcctggctggaagagtgccaggagcgcaagtc 2581 gagcctgcagcgcaagacccacttcgacaacgtgccggtcaagccgcagcgcgtctacga 2641 agaaatgaaccaagtgttcggcaaggacacctgctacgtcagcaccatcggcctgtcgca 2701 gattgccggcgcgcagttcctgcatgtgtacaagcctcgccactggatcaactgcggcca 2761 ggccggcccgctgggctggaccatccctgctgcgctgggcgtggtcaaagccgatccgaa 2821 gcgcaaggttgtggcgctgtcgggtgactacgacttccagttcatgatcgaagaactggc 2881 ggtaggcgcccagttcaacctgccgtacgtccacgtactggtgaacaacgcctacctggg 2941 cctgatccgccaggcgcagcgtggcttcgacatggattactgtgtacaactggcgttcga 3001 gaacatcaactcgaccgacgctgccacctacggtgtcgaccacgtcgctgtggtcgaagg 3061 cctgggttgcaaggccatccgtgtgttcgagccagcagaaatcgcccctgccctgatcaa 3121 ggcacagaagatggccgaagagttccgcgtgccggtggtggttgaagtgattctcgagcg 3181 tgtgaccaacatttccatgggcaccgagatcaacgcggtcaacgaattcgaagacctggc 3241 cctggtcggcaacgacgcgccaaccgccatctcgctgctggactgatcgcctgacgtcta 3301 gaataggaggtcaccagctatggctaaaatcggtttcatcggcaccggcatcatgggcaa 3361 gcccatggctcagaacctgcaaaaggcaggtcacagcctgttcatttccacccaccacga 3421 cgccgcgccagccgacctgatcgctgccggtgccgtggccctggccaacccgaaagaggt 3481 tgcccaggaagccgaattcatcatcgtcatggtccccgacaccccgcaggtcgaaagcgt 3541 cctgttcggtgaaaacggcgtggccgagggcgttggcccgaacaaggtggtgatcgacat 3601 gagctcgatctcgccaaccgccaccaaagccttcgccgagaagatcaaggctaccggtgc 3661 cgcctacctggacgccccggtgtccggtggtgaagtcggcgccaaggcggcgaccctgag 3721 catcatggttggtggctgcccgaacgccttcgagcgcaccctgccgctgttcgaagccat 3781 gggcaagaacatcacccgcgtcggtggcaacggtgacggccagaccgccaaggtcgccaa 3841 ccagatcattgtcgccctgaacatccaggccgtggccgaagccctgctgttcgccgccaa 3901 gaacggcgccgaccctgccaaggtgcgcgaagcactgatgggcggctttgcttcgtcgaa 3961 aatcctcgaagtgcacgccgagcgcatgatcaagggcaccttcgacccaggcttccgcat 4021 caacctgcaccagaaggacctgaacctggccctgcaaggcgccaaggaactgggcatcaa 4081 cctgcccaacacctccaatgcccagcaagtgttcaacacctgccaggccctgggcggcgg 4141 caactgggaccactcggcgctgatcaaaggcctggagcacatggccaacttctcgatccg 4201 cgacgacaaataagcatgcaagcttgcggccgcgtcgtgactgggaaaaccctggcgact 4261 agtcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttc 4321 agaacgctcggttgccgccgggcgttttttattggtgagaatccaggggtccccaataat 4381 tacgatttaaatttgtgtctcaaaatctctgatgttacattgcacaagataaaaatatat 4441 catcatgaacaataaaactgtctgcttacataaacagtaatacaaggggtgttatgagcc 4501 atattcagcgtgaaacgagctgtagccgtccgcgtctgaacagcaacatggatgcggatc 4561 tgtatggctataaatgggcgcgtgataacgtgggtcagagcggcgcgaccatttatcgtc 4621 tgtatggcaaaccggatgcgccggaactgtttctgaaacatggcaaaggcagcgtggcga 4681 acgatgtgaccgatgaaatggtgcgtctgaactggctgaccgaatttatgccgctgccga 4741 ccattaaacattttattcgcaccccggatgatgcgtggctgctgaccaccgcgattccgg 4801 gcaaaaccgcgtttcaggtgctggaagaatatccggatagcggcgaaaacattgtggatg 4861 cgctggccgtgtttctgcgtcgtctgcatagcattccggtgtgcaactgcccgtttaaca 4921 gcgatcgtgtgtttcgtctggcccaggcgcagagccgtatgaacaacggcctggtggatg 4981 cgagcgattttgatgatgaacgtaacggctggccggtggaacaggtgtggaaagaaatgc 5041 ataaactgctgccgtttagcccggatagcgtggtgacccacggcgattttagcctggata 5101 acctgattttcgatgaaggcaaactgattggctgcattgatgtgggccgtgtgggcattg 5161 cggatcgttatcaggatctggccattctgtggaactgcctgggcgaatttagcccgagcc 5221 tgcaaaaacgtctgtttcagaaatatggcattgataatccggatatgaacaaactgcaat 5281 ttcatctgatgctggatgaatttttctaataattaattggaccgcggtccgcgcgttgtc 5341 cttttccgctgcataaccctgcttcggggtcattatagcgattttttcggtatatccatc 5401 ctttttcgcacgatatacaggattttgccaaagggttcgtgtagactttccttggtgtat 5461 ccaacggcgtcagccgggcaggataggtgaagtaggcccacccgcgagcgggtgttcctt 5521 cttcactgtcccttattcgcacctggcggtgctcaacgggaatcctgctctgcgaggctg 5581 gccgtaggccggccctaccggcgcggcagcgttacccgtgtcggcggctccaacggctcg 5641 ccatcgtccagaaaacacggctcatcgggcatcggcaggcgctgctgcccgcgccgttcc 5701 cattcctccgtttcggtcaaggctggcaggtctggttccatgcccggaatgccgggctgg 5761 ctgggcggctcctcgccggggccggtcggtagttgctgctcgcccggatacagggtcggg 5821 atgcggcgcaggtcgccatgccccaacagcgattcgtcctggtcgtcgtgatcaaccacc 5881 acggcggcactgaacaccgacaggcgcaactggtcgcggggctggccccacgccacgcgg 5941 tcattgaccacgtaggccgacacggtgccggggccgttgagcttcacgacggagatccag 6001 cgctcggccaccaagtccttgactgcgtattggaccgtccgcaaagaacgtccgatgagc 6061 ttggaaagtgtcttctggctgaccaccacggcgttctggtggcccatctgcgccacgagg 6121 tgatgcagcagcattgccgccgtgggtttcctcgcaataagcccggcccacgcctcatgc 6181 gctttgcgttccgtttgcacccagtgaccgggcttgttcttggcttgaatgccgatttct 6241 ctggactgcgtggccatgcttatctccatgcggtaggggtgccgcacggttgcggcacca 6301 tgcgcaatcagctgcaacttttcggcagcgcgacaacaattatgcgttgcgtaaaagtgg 6361 cagtcaattacagattttctttaacctacgcaatgagctattgcggggggtgccgcaatg 6421 agctgttgcgtaccccccttttttaagttgttgatttttaagtctttcgcatttcgccct 6481 atatctagttctttggtgcccaaagaagggcacccctgcggggttcccccacgccttcgg 6541 cgcggctccccctccggcaaaaagtggcccctccggggcttgttgatcgactgcgcggcc 6601 ttcggccttgcccaaggtggcgctgcccccttggaacccccgcactcgccgccgtgaggc 6661 tcggggggcaggcgggcgggcttcgcccttcgactgcccccactcgcataggcttgggtc 6721 gttccaggcgcgtcaaggccaagccgctgcgcggtcgctgcgcgagccttgacccgcctt 6781 ccacttggtgtccaaccggcaagcgaagcgcgcaggccgcaggccggaggcttttcccca 6841 gagaaaattaaaaaaattgatggggcaaggccgcaggccgcgcagttggagccggtgggt 6901 atgtggtcgaaggctgggtagccggtgggcaatccctgtggtcaagctcgtgggcaggcg 6961 cagcctgtccatcagcttgtccagcagggttgtccacgggccgagcgaagcgagccagcc 7021 ggtggccgctcgcggccatcgtccacatatccacgggctggcaagggagcgcagcgaccg 7081 cgcagggcgaagcccggagagcaagcccgtagggggggcgcgcccagctgtctagggcgg 7141 cggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggccca 7201 tttcgactgagcctttcgttttatttgatgcct
[0166] Where nucleotides 1511 to 3286 of SEQ ID NO: 5 are gcl that encodes for glyoxylate carboligase PP4297.
[0167] Glyoxylate carboligase PP4297 has an amino acid sequence of SEQ ID NO: 6 as follows: M S K M R A I D A A V L V M R R E G V D T A F G I P G A A I N P L Y S A L K K V G G I D H V L A R H V E G A S H M A E G Y T R A N P G N I G V C I G T S G P A G T D M V T G L Y S A S A D S I P I L C I T G Q A P R A R L H K E D F Q A V D I T N I V K P V T K W A T T V L E P G Q V P Y A F Q K A F Y E M R T G R P G P V L I D L P F D V Q M A E I E F D I D A Y E P L P V H K P S A T R V Q A E K A L A L L N D A E R P L L V A G G G I I N A D A S D K L V E F A E L T G V P V I P T L M G W G T I P D D H A Q M V G M V G L Q T S H R Y G N A T L L K S D L V F G I G N R W A N R H T G S V D V Y T E G R K F V H V D I E P T Q I G R V F T P D L G I V S D A G K A L D V F L E V A R E W K A A G K L K C R K A W L E E C Q E R K S S L Q R K T H F D N V P V K P Q R V Y E E M N Q V F G K D T C Y V S T I G L S Q I A G A Q F L H V Y K P R H W I N C G Q A G P L G W T I P A A L G V V K A D P K R K V V A L S G D Y D F Q F M I E E L A V G A Q F N L P Y V H V L V N N A Y L G L I R Q A Q R G F D M D Y C V Q L A F E N I N S T D A A T Y G V D H V A V V E G L G C K A I R V F E P A E I A P A L I K A Q K M A E E F R V P V V V E V I L E R V T N I S M G T E I N A V N E F E D L A L V G N D A P T A I S L L D
[0168] Where nucleotides 3320 to 4213 of SEQ ID NO: 5 are glxR that encode for 2-Hydroxy-3oxopropionate-reductase PP4299.
[0169] Hydroxy-3-oxopropionate-reductase PP4299 has an amino acid sequence of SEQ ID NO: 7 as follows: M A K I G F I G T G I M G K P M A Q N L Q K A G H S L F I S T H H D A A P A D L I A A G A V A L A N P K E V A Q E A E F I I V M V P D T P Q V E S V L F G E N G V A E G V G P N K V V I D M S S I S P T A T K A F A E K I K A T G A A Y L D A P V S G G E V G A K A A T L S I M V G G C P N A F E R T L P L F E A M G K N I T R V G G N G D G Q T A K V A N Q I I V A L N I Q A V A E A L L F A A K N G A D P A K V R E A L M G G F A S S K I L E V H A E R M I K G T F D P G F R I N L H Q K D L N L A L Q G A K E L G I N L P N T S N A Q Q V F N T C Q A L G G G N W D H S A L I K G L E H M A N F S I R D D K
[0170] In an embodiment, and as used herein, homologous nucleic acid sequences are about 60%, 65%, 68%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.95% or even higher identical to nucleic acids disclosed herein. In an embodiment, and as used herein, homologous amino acid sequences are about 60%, 65%, 68%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.95% or even higher identical to amino acids and proteins disclosed herein.
[0171] The foregoing disclosure has been set forth merely to illustrate the invention and is not intended to be limiting. Since modifications of the disclosed embodiments incorporating the spirit and substance of the invention may occur to persons skilled in the art, the invention should be construed to include everything within the scope of the appended claims and equivalents thereof.