Genetic transformation of bifidobacteria

10184127 · 2019-01-22

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention concerns a method for genetically transforming a Bifidobacterium strain comprising a step of methylation of a shuttle vector in an E. coli or a Gram-positive bacterium strain by two type II DNA methyltransferases from a Bifidobacterium: a methyltransferase enzyme that methylates the adenine base at position 4 of the nucleotide sequence RTCAGG and a methyltransferase enzyme that methylates the cytosine base at position 4 of the nucleotide sequence GGWCC. The present invention also concerns genetic tools and culture media useful for carrying out said method.

Claims

1. A method for genetically transforming a Bifidobacterium strain, the method comprising: transforming an Escherichia coli strain or a Gram-positive bacterium strain either with a recombinant vector DNA comprising a gene encoding a methyltransferase enzyme from a Bifidobacterium that methylates the adenine base at position 4 of the nucleotide sequence RTCAGG (BanLI methyltransferase) and a recombinant vector DNA comprising a gene encoding a methyltransferase enzyme from a Bifidobacterium that methylates the cytosine base at position 4 of the nucleotide sequence GGWCC (BanLII methyltransferase), or with a recombinant vector DNA comprising both a gene encoding a BanLI methyltransferase from a Bifidobacterium and a gene encoding a BanLII methyltransferase from a Bifidobacterium, wherein said recombinant vectors DNA are capable of replicating in said E. coli or Gram-positive bacterium strain, ii) transforming the E. coli or Gram-positive bacterium strain obtained after step i) with a recombinant shuttle vector DNA comprising a DNA sequence of interest to introduce in a Bifidobacterium strain, wherein the said shuttle vector DNA is capable of replicating in the E. coli or the Gram-positive bacteria strain of step i) and in the Bifidobacterium strain to be targeted for genetic transformation, iii) cultivating the transformed E. coli or Gram-positive bacterium strain obtained in step ii), iv) extracting the shuttle vector DNA from the transformed E. coli or Gram-positive bacterium strain, v) transforming, preferably electrotransforming, a Bifidobacterium strain with the shuttle vector DNA obtained from step iv), vi)recovering the transformed Bifidobacterium strain of step v).

2. The method according to claim 1, wherein step i) is replaced by a step of providing an E. coli or Gram-positive bacterium strain transformed either with a recombinant vector DNA comprising a gene encoding a BanLI methyltransferase from a Bifidobacterium and a recombinant vector DNA comprising a gene encoding a BanLII methyltransferase strain from a Bifidobacterium, or with a recombinant vector DNA comprising both a gene encoding a BanLI methyltransferase from a Bifidobacterium and a gene encoding a BanLII methyltransferase from a Bifidobacterium.

3. The method according claim 1, wherein the amino acid sequence of the BanLI methyltransferase has at least 60% identity with the amino acid sequence SEQ ID NO: 1 and/or the amino acid sequence of the BanLII methyltransferase has at least 55% identity with the amino acid sequence SEQ ID NO:3.

4. The method according to claim 1, wherein the BanLI methyltransferase or the BanLII methyltransferase are from a Bifidobacterium strain of the same Bifidobacterium species as the Bifidobacterium strain to be targeted for genetic transformation in step ii).

5. The method according claim 1, wherein the Bifidobacterium strain is cultivated prior to transformation and/or resuspended after the transformation in an appropriate medium at a temperature between 36 C. and 46 C., preferably between 41 C. and 43 C., more preferably at 42 C.

6. The method according to claim 5, wherein the said appropriate medium is a Man, Rogosa and Sharpes medium supplemented with cysteine and a carbohydrate (DM-MRS).

7. The method according to claim 1, wherein each of the transformation steps is carried out by a method selected from the group consisting of electroporation, transduction, heat shock, and protoplast fusion.

8. The method according to claim 1, wherein the Bifidobacterium strain is selected from the group consisting of a strain of the species B. adolescentis, B. animalis, B. bifidum, B. breve, B. dentium, B. infantis, B. longum, B. pseudolongum and B. thermophilum, preferably a strain of the species B. animalis.

9. A transformed Escherichia coli or Gram-positive bacterium strain, comprising a recombinant vector, wherein the vector comprises a recombinant cassette comprising a polynucleotide sequence encoding a BanLI methyltransferase having at least 60% identity with the amino acid sequence SEQ ID NO: 1 and/or a polynucleotide sequence encoding a BanLII methyltransferase having at least 55% identity with the amino acid sequence SEQ ID NO: 3, under control of a promoter that is functional in the bacterium.

Description

(1) In addition to the preceding features, the invention further comprises other features which will emerge from the following description, which refers to examples illustrating the present invention, as well as to the appended figures.

(2) FIG. 1 represents the plasmid map of expression vector pWSK29-M.BanLI.

(3) FIG. 2 represents the plasmid map of expression vector pWSK29-M.BanLII.

(4) FIG. 3 represents the plasmid map of expression vector pWSK29-M.BanLI-M.BanLII.

(5) FIG. 4 represents the plasmid map of the replicative vector pDM1.

(6) FIG. 5 represents the plasmid map of the replicative vector pDM2.

(7) FIG. 6 represents the transformation efficiencies of B. animalis subsp. lactis CNCM 1-2494 with pDM1 isolated from E. coli (XL1Blue), XL1Blue harbouring pWSK29, or derivatives harbouring the individual methylase encoding genes singly or in combination. The final column represents the transformation efficiency of pDM1 isolated from B. animalis subsp. lactis CNCM I-2494 (DN 173-010).

(8) FIG. 7 represents the culture of B. animalis subsp. lactis CNCM 1-2494 in DM-MRS medium supplemented with 1% maltose and 0.05% cysteine. This medium allows reproductible growth of the strain over 5 consecutive subcultures.

(9) FIG. 8 represents the growth profiles of B. animalis subsp. lactis CNCM 1-2494 at temperatures ranging from 32 C. to 50 C. in DM-MRS medium supplemented with 1% maltose and 0.05% cysteine.

EXAMPLE 1

Genetic Transformation of Bifidobacterium Animalis Subsp. Lactis CNCM I-2494

(10) Materials and Methods

(11) Cloning of Genes Encoding Methyltransferases M.BanLI and M.BanLII

(12) For the construction of plasmids pWSK29-M.BanLI (see FIG. 1) and pWSK29-M.BanLII (see FIG. 2), DNA fragments encompassing the coding sequences of BanLI methyltransferase and BanLII methyltransferase were generated by PCR amplification from chromosomal DNA of B. animalis subsp. lactis CNCM 1-2494 using PFU Ultra DNA polymerase and primer combinations BanLIF and BanLIR or BanLIIF and BanLIIR (see Table 1 below).

(13) TABLE-US-00001 TABLE1 OligonucleotideprimersusedinthisExample SEQ ID Purpose Primer Sequence NO: Cloningofm. BanLIF cgtccgctgcagataagga 5 BanLIinpNZ44 ggcactcaccatggctacg cctctcaatcgag BanLIR gctctataagcttttactt 6 tccttgcgcttcttc Cloningofp44- BanLIF1 cgtccgagatctgttagtt 7 MBanLIinpWSK29 gaagaaggtttttatatta cag Constructionof BanLIIF cgtccgtctagaataagga 8 transcriptional ggcactcaccatgccgcgt fusionofBanLII gtgttcaattg toplaconpWSK29 BanLIIR gctctactgcagcaatgga 9 ggcgtgcaaatc Constructionof BanLIF2 tcagctgtcgacacaattg 10 pWSK29-M.BanLI- taacccatacaggag M.BanLII BanLIR2 gcgacggtcgactttactt 11 tccttgcgcttcttc Construction SpecF gtcctggagctcgcacacg 12 ofpDM1 aaaaacaagttaag SpecR ctggaagagctccaatgaat 13 aggtttacacttactttag Construction SpecF1 ctggaaaagcttcaatgaat 14 ofpDM2 aggtttacacttactttag SpecR1 gtcctggaattcgcacacga 15 aaaacaagttaag

(14) Each forward primer contained the sequence of a ribosome binding site to facilitate translation of each mRNA. For the BanLI-encoding fragment PstI and HindIII sites were incorporated into the forward and reverse primers, respectively to facilitate ligation to similarly digested pNZ44 (McGrath S. et al., 2001, Appl Environ Microbiol. 67:608-616). Ligations were electroporated into L. lactis NZ9000 (Kuipers O. P. et al., 1993, Eur J Biochem. 216:281-291; Kuipers O. P. et al., 1998, J Biotechnol. 64:15-21) and transformants selected based on chloramphenicol resistance. The presence and integrity of the cloned insert was confirmed by restriction analysis followed by sequencing of the BanLI insert. The BanLI-encoding sequence, together with the constitutive p44 lactococcal promoter, specified by pNZ44, were amplified by PCR from a representative pNZ44-BanLI plasmid using the primer pair BanLIF1 and BanLIR (see Table 1). The resultant fragment was restricted with BglII and HindIII and ligated to the compatible BamHI and HindIII sites on pWSK29 (Wang R. F. and Kushner S. R., 1991, Gene, 100:195-199). For the construction of pWSK29-M.BanLII (M.AvaII) the M.BanLII-encoding sequence was transcriptionally fused to the lac promoter on pWSK29. The amplified fragment was restricted with XbaI and PstI and ligated to similarly digested pWSK29. Each ligation was transformed into E. coli X11Blue. The plasmid content of a number of Amp.sup.r transformants was screened by restriction analysis and the integrity of positively identified clones was verified by sequencing. The resultant plasmids were designated pWSK29-M.BanLI and pWSK29-M.BanLII.

(15) For plasmid pWSK29-M.BanLI-M.BanLII (see FIG. 3), which expresses two of the identified B. animalis subsp. lactis CNCM 1-2494 methyltransferases, the DNA fragment encompassing p44-M.BanLI was amplified from pWSK29-M.BanLI by PCR using primer combinations BanLIF2 and BanLIR2 (see Table 1), both of which had SalI restriction sites incorporated at their 5 ends. The resulting amplicon was digested with SalI, and ligated into similarly digested pWSK29-M.BanLII. The resulting ligation mixture was introduced into E. coli X11Blue by electrotransformation and transformants selected based on ampicillin resistance. The plasmid content of a number of Amp.sup.r transformants was screened by restriction analysis and the integrity of positively identified clones was verified by sequencing.

(16) Construction of the Replicative Plasmids pDM1 (pAMS-spec) and pDM2 (pDG7-spec)

(17) The spectinomycin resistance gene together with its own promoter were amplified from pMG36 (van de Guchte M. et al., 1989, Appl Environ Microbiol. 55:224-8) carrying a spectinomycin resistant marker (pMG36S), using the primer combinations SpecF and SpecR (see Table 1) that harbor SacI sites at their 5 end or SpecF1 and SpecR1 (see Table 1) that contain EcoRI and HindIII sites, respectively. In each case the 1117 bp amplicon was digested with either SacI or a combination of EcoRI and HinDIII and ligated to similarly digested pAMS (Alvarez-Martin et al., 2007, cited above) or pDG7 (Argnani et al., 1996, cited above), respectively. The ligations were transformed into E. coli EC101 with selection on LB agar containing spectinomycin. A number of spectinomycin-resistant transformants were selected and screened for plasmid content by restriction analysis and DNA sequencing. In the resultant plasmid, pDM1, the tet.sup.r cassette of pAMS was replaced with the spectinomycin resistance cassette, while pDM2 is pDG7 harbouring the spectinomycin cassette cloned in the unique EcoRI and HinDIII sites.

(18) Transformation of B. animalis subsp. lactis CNCM I-2494

(19) 48 ml of DM-MRS (see Table 2 below) supplemented with 0.05% cysteine and 1% maltose was inoculated with 2 ml of an overnight culture of B. animalis subsp. lactis CNCM 1-2494 and incubated anaerobically at 42 C. (DM-MRS is autoclaved at 121 C. for 15 min. Prior to inoculation DM-MRS is supplemented with cysteine HCL 0.05% and maltose 1%.

(20) TABLE-US-00002 TABLE 2 Composition of DM-MRS broth g/L Difco Proteose Peptone No. 3 10 g Difco Beef Extract 10 g Difco Yeast Extract 5 g Polysorbate (Tween) 80 1 ml Tri-ammonium citrate 2 g MgSO.sub.47H.sub.20 0.575 g MnSO.sub.44H.sub.20 0.120 g K.sub.2HPO.sub.4 3 g KH.sub.2PO.sub.4 3 g Pyruvic acid 0.2 g Cysteine-HCl 0.3 g FeSO.sub.47H.sub.2O 0.034 g pH 6.8

(21) At an optical density (OD600 nm) of approximately 0.8, the bacterial cells were collected by centrifugation at 6,500 g for 10 min at 4 C., and the pellet washed twice with chilled sucrose citrate buffer (1 mM citrate [pH 5.8], 0.5 M sucrose). The cells were subsequently suspended in 300 l of chilled sucrose citrate buffer. Fifty microliters of the cell suspension was used for each electrotransformation, the cells and plasmid DNA were mixed and held on ice prior to the pulse at 25 F, 200 ohms and 2 kV. After transformation, the cells were suspended in 1 ml of DM-MRS supplemented with cysteine and maltose and incubated for 3 hours at 42 C. Serial dilutions were plated on RCA supplemented with maltose and containing the appropriate antibiotic and incubated at 42 C. for 24-36 h at which point transformant colonies were visible.

(22) Results

(23) The results (see FIG. 6) show that the transformation efficiency of B. animalis subsp lactis CNCM 1-2494 with pDM1 DNA isolated from genetically modified E. coli habouring BanLI and BanLII methyltransferase encoding genes increases by 10 fold as compared to un-methylated pDM1 DNA.

EXAMPLE 2

Development of a Growth Medium for Growing A Bifidobacterium Strain

(24) Following testing of various growth media, a modified MRS medium (named DM-MRS; see Table 2 above) was formulated. This medium allows B. animalis subsp. lactis CNCM I-2494 be reproducibly subcultured in the presence of 1% maltose and 0.05% cysteine over five consecutive subcultures (FIG. 7). This medium further allows growth that is entirely dependent on the supplementation of maltose as the sole carbon and energy source of the strain.

(25) Further, the temperature of 42 C. is an optimum temperature for growing B. animalis subsp. lactis CNCM 1-2494 in DM-MRS (see FIG. 8).