INCREASED TRIACYLGLYCEROL PRODUCTION IN MICROALGAE
20190017082 · 2019-01-17
Inventors
Cpc classification
C12P7/6463
CHEMISTRY; METALLURGY
C12Y114/13039
CHEMISTRY; METALLURGY
International classification
C12P7/64
CHEMISTRY; METALLURGY
Abstract
The application generally relates to bioproduction of molecules of interest in micro- organisms, more particularly in microalgae. In particular, the application relates to methods for increasing triacylglycerol production in micro-organisms, in particular in microalgae, using recombinant micro-organisms which have been genetically engineered to produce or overproduce nitric oxide (NO) and uses thereof.
Claims
1. A method for increasing the production of a molecule of interest in a micro-organism, said method comprising: culturing a recombinant micro-organism which has been genetically engineered to produce or overproduce nitric oxide (NO) under conditions suitable for the production or overproduction of NO by said micro-organism, so as to enhance the production of said molecule of interest and recovering said molecule of interest.
2. The method according to claim 1, wherein the molecules of interest are molecules of the lipid metabolic pathway or biomolecules derived from said molecules and wherein said lipid metabolic pathway is comprised between acetyl-CoA and lipids.
3. The method according to claim 1, wherein said micro-organism is a microalga.
4. The method according to claim 1, wherein said micro-organism has been transformed with a recombinant nucleic acid encoding a protein involved in an NO production pathway or wherein expression of an endogenous gene encoding a protein involved in an NO production pathway is modified.
5. The method according to claim 1, wherein said micro-organism has been transformed with a recombinant nucleic acid encoding a NOA protein.
6. The method according to claim 4, wherein said protein is the Phaeodactylum tricornutum NOA (PtNOA) protein or a homolog or functional variant thereof.
7. The method according to claim 4, wherein said protein has at least 80% sequence identity with SEQ ID NO:1.
8. The method according to claim 4, wherein said protein is the Nannochloropsis gaditana NOA (NgNOA) protein or a homolog or functional variant thereof.
9. The method according to claim 4, wherein said protein is a nitric oxide synthase (NOS).
10. The method according to claim 2, wherein the microalga is selected from the Chromalveolata.
11. The method according to claim 10, wherein the microalga is selected from the Bacillariophyceae or the Eustigmatophyceae.
12. The method according to claim 11, wherein the microalga is Phaeodactylum tricornutum.
13. The method according to claim 1, wherein the molecules of interest are triacylglycerols (TAGs).
14. The method according to claim 13, wherein the triacylglycerol content is increased in said recombinant micro-organism to at least 150%, preferably at least 200%, compared to a corresponding micro-organism wherein the NO production pathway was not modulated.
15. The method according to claim 1, wherein said culturing conditions are suitable for growth of the recombinant micro-organism, such that the production of the molecules of interest is concomitant with the growth of the recombinant micro-organism.
16. Use of a recombinant micro-organism which has been genetically engineered to produce or overproduce nitric oxide (NO) for the production of molecules of interest.
17. Use according to claim 16, wherein the molecules of interest are molecules of the lipid metabolic pathway or biomolecules derived from said molecules, and wherein said lipid metabolic pathway is a pathway comprised between acetyl-CoA and lipids.
18. Use according to claim 16 for the production of triacylglycerols, fatty acids, hydrocarbons or fatty alcohols.
19. Use according to claim 1 for biofuel production, in food industry, in pharmaceutical industry or for the production of cosmetics.
20. A recombinant microalga, which has been transformed with a recombinant nucleic acid encoding a PtNOA homolog.
21. The recombinant micro-organism according to claim 20, wherein said PtNOA homolog is from Nannochloropsis gaditana having SEQ ID NO:4.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0029] The teaching of the application is illustrated by the following Figures which are to be considered as illustrative only and do not in any way limit the scope of the claims.
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
DETAILED DESCRIPTION OF THE INVENTION
[0038] Unless otherwise defined, all terms used in disclosing the invention, including technical and scientific terms, have the meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. By means of further guidance, term definitions are included to better appreciate the teaching of the present invention.
[0039] As used herein, the singular forms a, an, and the include both singular and plural referents unless the context clearly dictates otherwise.
[0040] The terms comprising, comprises and comprised of as used herein are synonymous with including, includes or containing, contains, and are inclusive or open-ended and do not exclude additional, non-recited members, elements or method steps. Where reference is made to embodiments as comprising certain elements or steps, this encompasses also embodiments which consist essentially of the recited elements or steps.
[0041] The recitation of numerical ranges by endpoints includes all numbers and fractions subsumed within the respective ranges, as well as the recited endpoints.
[0042] The term about as used herein when referring to a measurable value such as a parameter, an amount, a temporal duration, and the like, is meant to encompass variations of +/10% or less, preferably +/5% or less, more preferably +/1% or less, and still more preferably +/0.1% or less of and from the specified value, insofar such variations are appropriate to perform in the disclosed invention. It is to be understood that the value to which the modifier about refers is itself also specifically, and preferably, disclosed.
[0043] All documents cited in the present specification are hereby incorporated by reference in their entirety.
[0044] As used herein, the terms microbial, microbial organism or micro-organism are intended to mean any organism that exists as a microscopic cell that is included within the domains of archaea, bacteria or eukaryotes. Therefore, the term is intended to encompass prokaryotic or eukaryotic cells or organisms having a microscopic size and includes bacteria, archaea and eubacteria such as cyanobacteria of all species as well as eukaryotic micro-organisms such as fungi, including yeasts, and algae. The term also includes cell cultures of any species.
[0045] The term microalga or microalgae (plural) as used herein refers to microscopic alga(e). Microalgae encompass, without limitation, organisms within (i) several eukaryotic phyla, including the Rhodophyta (red algae), Chlorophyta (green algae), Dinoflagellata, Haptophyta, (ii) several classes from the eukaryotic phylum Heterokontophyta which includes, without limitation, the classes Bacillariophycea (diatoms), Eustigmatophycea, Phaeophyceae (brown algae), Xanthophyceae (yellow-green algae) and Chrysophyceae (golden algae), and (iii) the prokaryotic phylum Cyanobacteria (blue-green algae). The term microalgae includes for example genera selected from: Achnanthes, Amphora, Anabaena, Anikstrodesmis, Arachnoidiscusm, Aster, Botryococcus, Chaetoceros, Chlamydomonas, Chlorella, Chlorococcum, Chorethron, Cocconeis, Coscinodiscus, Crypthecodinium, Cyclotella, Cylindrotheca, Desmodesmus, Dunaliella, Emiliana, Euglena, Fistulifera, Fragilariopsis, Gyrosigma, Hematococcus, Isochrysis, Lampriscus, Monochrysis, Monoraphidium, Nannochloris, Nannochloropsis, Navicula, Neochloris, Nephrochloris, Nephroselmis, Nitzschia, Nodularia, Nostoc, Odontella, Oochromonas, Oocystis, Oscillartoria, Pavlova, Phaeodactylum, Playtmonas, Pleurochrysis, Porhyra, Pseudoanabaena, Pyramimonas, Scenedesmus, Schyzochitrium, Stichococcus, Synechococcus, Synechocystis, Tetraselmis, Thalassiosira, and Trichodesmium.
[0046] The term transformation means introducing an exogenous nucleic acid into an organism so that the nucleic acid is replicable, either as an extrachromosomal element or by chromosomal integration.
[0047] The terms genetically engineered or genetically modified or recombinant as used herein with reference to a host cell, in particular a micro-organism such as a microalga, denote a non-naturally occurring host cell, as well as its recombinant progeny, that has at least one genetic alteration not found in a naturally occurring strain of the referenced species, including wild-type strains of the referenced species. Such genetic modification is typically achieved by technical means (i.e. non-naturally) through human intervention and may include, e.g., the introduction of an exogenous nucleic acid and/or the modification, over-expression, or deletion of an endogenous nucleic acid.
[0048] The term exogenous or foreign as used herein is intended to mean that the referenced molecule, in particular nucleic acid, is not naturally present in the host cell.
[0049] The term endogenous or native as used herein denotes that the referenced molecule, in particular nucleic acid, is present in the host cell.
[0050] By recombinant nucleic acid when referring to a nucleic acid in a recombinant host cell, in particular a recombinant micro-organism such as a recombinant microalga, is meant that at least part of said nucleic acid is not naturally present in the host cell in the same genomic location. For instance a recombinant nucleic acid can comprise a coding sequence naturally occurring in the host cell under control of an exogenous promotor, or it can be an additional copy of a gene naturally occurring in the host cell, or a recombinant nucleic acid can comprise an exogenous coding sequence under the control of an endogenous promoter.
[0051] By nucleic acid is meant oligomers and polymers of any length composed essentially of nucleotides, e.g., deoxyribonucleotides and/or ribonucleotides. Nucleic acids can comprise purine and/or pyrimidine bases and/or other natural (e.g., xanthine, inosine, hypoxanthine), chemically or biochemically modified (e.g., methylated), non-natural, or derivatised nucleotide bases. The backbone of nucleic acids can comprise sugars and phosphate groups, as can typically be found in RNA or DNA, and/or one or more modified or substituted sugars and/or one or more modified or substituted phosphate groups.
[0052] Modifications of phosphate groups or sugars may be introduced to improve stability, resistance to enzymatic degradation, or some other useful property. A nucleic acid can be for example double-stranded, partly double stranded, or single-stranded. Where single-stranded, the nucleic acid can be the sense strand or the antisense strand. The nucleic acid can be circular or linear. The term nucleic acid as used herein preferably encompasses DNA and RNA, specifically including genomic, hnRNA, pre-mRNA, mRNA, cDNA, recombinant or synthetic nucleic acids, including vectors.
[0053] By encoding is meant that a nucleic acid sequence or part(s) thereof corresponds, by virtue of the genetic code of an organism in question, to a particular amino acid sequence, e.g., the amino acid sequence of a desired polypeptide or protein. By means of example, nucleic acids encoding a particular polypeptide or protein, e.g. an enzyme, may encompass genomic, hnRNA, pre-mRNA, mRNA, cDNA, recombinant or synthetic nucleic acids.
[0054] Preferably, a nucleic acid encoding a particular polypeptide or protein may comprise an open reading frame (ORF) encoding said polypeptide or protein. An open reading frame or ORF refers to a succession of coding nucleotide triplets (codons) starting with a translation initiation codon and closing with a translation termination codon known per se, and not containing any internal in-frame translation termination codon, and potentially capable of encoding a polypeptide or protein. Hence, the term may be synonymous with coding sequence as used in the art.
[0055] The terms polypeptide and protein are used interchangeably herein and generally refer to a polymer of amino acid residues linked by peptide bonds, and are not limited to a minimum length of the product. Thus, peptides, oligopeptides, polypeptides, dimers (hetero- and homo-), multimers (hetero- and homo-), and the like, are included within the definition. Both full-length proteins and fragments thereof are encompassed by the definition. The terms also include post-expression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation, etc. Furthermore, for purposes of the present invention, the terms also refer to such when including modifications, such as deletions, additions and substitutions (e.g., conservative in nature), to the sequence of a native protein or polypeptide.
[0056] The term variant, when used in connection to a protein, such as an enzyme, for example as in a variant of protein X, refers to a protein, such as an enzyme, that is altered in its sequence compared to protein X, but that retains the activity of protein X, such as the enzymatic activity (i.e. a functional variant or homolog). More particularly a functional variant of protein X involved in the production of NO, such as a NOA protein, is capable of ensuring at least 60% of the activity of protein X in the production of NO. More particularly, the effect of a homolog or functional variant on NO production activity can be determined by measuring NO levels in a micro-organism. For example, NO levels can be measured using the fluorophore 4-amino-5-methylamino-2,7-difluororescein diacetate (DAF-FM), which allows detection of nitric oxide (ONOO.sup.) which is in equilibrium with NO (St Laurent et al. 2015 Methods Mol Biol. 1220:339-345). In particular embodiments, the functional variant is a non-natural variant. In alternative embodiments, the functional variant is a homolog. Preferably, such variant would show at least 80%, more preferably at least 85%, even more preferably at least 90%, and yet more preferably at least 95% such as at least 96%, at least 97%, at least 98% or at least 99% sequence identity to the reference protein, preferably calculated over the entire length of the sequence. The sequence changes may be naturally occurring, for example, due to the degeneracy of the genetic code, or may be introduced artificially, for example by targeted mutagenesis of the respective sequence. Such techniques are well known to the skilled person.
[0057] The term homolog as used herein in connection to a protein, such as an enzyme, for example as in a homolog of protein X refers to the fact that the protein differs from protein X in its sequence, but that retains the activity or protein X, such as the enzymatic activity as detailed above, and originates from another species, i.e. is a naturally occurring sequence. A homolog of protein X can be identified by the skilled person by pairwise search methods such as BLAST and checking of the corresponding activity.
[0058] As used herein, the terms identity and identical and the like are used interchangeably with the terms homology and homologues and the like herein and refer to the sequence similarity between two polymeric molecules, e.g., between two nucleic acid molecules or polypeptides. Methods for comparing sequences and determining sequence identity are well known in the art. By means of example, percentage of sequence identity refers to a percentage of identical nucleic acids or amino acids between two sequences after alignment of these sequences. Alignments and percentages of identity can be performed and calculated with various different programs and algorithms known in the art. Preferred alignment algorithms include BLAST (Altschul, 1990; available for instance at the NCBI website) and Clustal (reviewed in Chenna, 2003; available for instance at the EBI website). Preferably, BLAST is used to calculate the percentage of identity between two sequences, such as the Blast 2 sequences algorithm described by Tatusova and Madden 1999 (FEMS Microbiol Lett 174: 247-250), for example using the published default settings or other suitable settings (such as, e.g., for the BLASTN algorithm: cost to open a gap=5, cost to extend a gap=2, penalty for a mismatch=2, reward for a match=1, gap x_dropoff =50, expectation value=10.0, word size=28; or for the BLASTP algorithm: matrix=Blosum62, cost to open a gap=11, cost to extend a gap=1, expectation value=10.0, word size=3).
[0059] As used herein, the term molecules of interest refers to any molecule which can be produced by micro-organisms, including but not limited to molecules derived from the acetyl-CoA pool in a micro-organism. Such molecules of interest include, without limitation, hydrocarbons, fatty acids and lipids. Such molecules of interest can be recovered from the micro-organism or its culture medium, and then used in certain applications.
[0060] As used herein, the term lipid metabolic pathway refers to any pathway in a micro-organism comprised between acetyl-CoA and lipids (it being understood that acetyl-CoA is included in such lipid metabolic pathway). Said term hence encompasses without limitation fatty acid synthesis pathways, pathways ensuring the assembly of triacylglycerols (TAGs) or the conversion of any lipids to TAGs, and pathways degrading TAGs (beta-oxidation).
[0061] As used herein, triacylglycerols, also referred to as triacylglycerides or TAG are esters resulting from the esterification of the three hydroxyl groups of glycerol, with three fatty acids.
[0062] The present application generally relates to production of molecules of interest, in particular production of molecules of the lipid metabolic pathway, including production of triacylglycerol (TAG) and any intermediates in the lipid metabolic pathway, in micro-organisms, in particular in microalgae. The application is further directed to the production of biomolecules derived from said molecules of the lipid metabolic pathway.
[0063] More particularly, the application provides methods for increasing TAG production in micro-organisms, in particular microalgae, by genetically engineering the micro-organisms, in particular the microalgae, to produce or overproduce nitric oxide (NO). The application also encompasses the recombinant micro-organisms as well as their use, e.g. for fatty acid production.
[0064] It has been surprisingly found that exposure of microalgae such as Phaeodactylum tricornutum to nitric oxide (NO) triggers TAG accumulation in the microalgae. The present inventors have found that genetic engineering of microalgae to produce or overproduce
[0065] NO, in particular by transformation with a recombinant nucleic acid encoding a protein involved in NO production (such as the NOA protein of Phaeodactylum tricornutum), results in increased production of certain molecules of interest; in particular, it was discovered that such engineering in the NO production pathway results in increased TAG production in said recombinant microalgae.
[0066] Accordingly, in an aspect, the application provides a method for increasing the production of molecules of interest in a micro-organism, in particular a microalga, said method comprising culturing a recombinant micro-organism, in particular a recombinant microalga, which has been genetically engineered to produce or overproduce NO under conditions suitable to produce or overproduce NO in said recombinant micro-organism. In particular embodiments, the invention thus relates to a method for the production of molecules of interest, which encompasses the steps of (i) genetically engineering a micro-organism, in particular a microalga, to produce or overproduce NO; and (ii) culturing the recombinant micro-organism, in particular the recombinant microalga, obtained in step (b) so as to allow the production of said molecules of interest.
[0067] In particular embodiments, the molecules of interest are molecules of the lipid metabolic pathway or biomolecules derived from said molecules and the production of such molecules of interest is increased according to the invention. In further particular embodiments, the molecules of interest are lipids, in particular triacylglycerols (TAGs).
[0068] In particular embodiments, the recombinant micro-organism has been engineered to express or overexpress a protein involved in an NO production pathway.
[0069] Preferably, the recombinant micro-organism has been transformed with a recombinant nucleic acid encoding a protein involved in an NO production pathway.
[0070] Accordingly, in embodiments, the method encompasses transforming the micro-organism with a recombinant nucleic acid encoding a protein involved in an NO production pathway, and culturing the recombinant micro-organism so obtained under conditions suitable to produce or overproduce NO in said recombinant micro-organism so as to allow production of the desired molecule or biomolecule by the micro-organism.
[0071] NO production differs from organism to organism. Some diatoms such as Pseudo-nitzschia multistriata contain a nitric oxide synthase (NOS) (Di Dato et al. 2015 Scientific Reports 5:12329). In the pennate diatom Phaeodactylum tricornutum, NO production depends on the activity of a protein called NOA (Vardi et al. 2008). Any protein or enzyme involved in NO production is envisaged herein for (over)expression in the recombinant micro-organisms described herein.
[0072] In particular embodiments, the protein involved in the NO production pathway is a NOA protein. In particular embodiments, the NOA protein is an NOA protein of microbial origin, such as from a microalga or diatom. In particular embodiments, the protein involved in NO production is the NOA protein of a Phaeodactylum more particularly of P. tricornutum, also referred to herein as PtNOA, or a variant or a homolog thereof. In particular embodiments, of the present invention, the homologue of PtNOA originates from a microalga. As used herein the term PtNOA refers to a protein having an amino acid sequence of SEQ ID NO:2. Preferably, the variants have a sequence substantially identical to SEQ ID NO:2, or a sequence having at least about 70%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:2.
[0073] Accordingly, in embodiments of the methods described herein, the recombinant micro-organism, in particular the recombinant microalga, has been transformed with a recombinant nucleic acid encoding a NOA protein. In particular embodiments, the recombinant nucleic acid encoding a NOA protein encodes a NOA protein from a Phaeodactylum species or a variant or a homolog thereof. In further embodiments, the recombinant micro-organism comprises a recombinant nucleic acid encoding a Phaeodactylum tricornutum NOA protein or a homolog or functional variant thereof. In particular embodiments, of the present invention, the homologue of PtNOA originates from a microalga. Most particularly, the recombinant micro-organism is transformed with a recombinant nucleic acid comprising the sequence of SEQ ID NO:1 or a sequence substantially identical to SEQ ID NO:1, or a sequence having at least about 70%, preferably at least about 80%, more preferably at least about 85%, 90% or 95%, even more preferably at least about 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:1.
[0074] The application also envisages the use of recombinant nucleic acids encoding homologs of the identified Phaeodactylum tricornutum NOA protein. For instance the present inventors have identified a genomic sequence in Nannochloropsis gaditana (SEQ ID NO:3) encoding a protein of SEQ ID NO:4 that is homologous to PtNOA (
[0075] In particular embodiments, the recombinant nucleic acid encoding the NOA protein has been codon-optimized for expression in one or more microalgae of interest. Accordingly, in particular embodiments, the invention provides recombinant microalgae, in particular microalgae of a Phaeodactylum species, which have been transformed with a recombinant nucleic acid comprising SEQ ID NO:5, which sequence encodes the same protein as the sequence of SEQ ID NO:3, but wherein the coding sequence was codon-optimized for expression in a Phaeodactylum species.
[0076] In particular embodiments, the protein involved in the NO production pathway is a nitric oxide synthase (NOS) and the recombinant micro-organism has been transformed with a recombinant nucleic acid encoding a NOS enzyme. Non-limiting examples of NOS enzymes suitable for use in the methods and recombinant microalgae envisaged herein include the NOS of Pseudo-nitzschia multistriata (PmNOS) as described in Di Dato et al. (2015), the NOS of Amphiprora sp., Thalassiosira rotula, Thalassiosira minuscule, Skeletonema menzelii, Skeletonema costatum, Skeletonema marinoi, Cylindrotheca closterium, Chaetoceros cf. neogracile as described in Di Dato et al. (2015).
[0077] Also envisaged herein are variants or homologs of the proteins and enzymes involved in an NO production pathway as described herein. It is understood that the variant proteins or enzymes described herein may have conservative or non-essential amino acid substitutions, which do not have a substantial effect on the protein function. Whether or not a particular substitution will be tolerated (i.e., will not adversely affect desired biological properties) can be determined as described in Bowie et al. (1990) (Science 247:1306 1310). A conservative amino acid substitution is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine), and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
[0078] Additional protein and enzyme variants are those in which additional amino acids are fused to the enzyme, such as restriction sites for cloning purposes.
[0079] The recombinant micro-organisms described herein may comprise an exogenous nucleic acid encoding a protein or an enzyme involved in an NO production pathway, and/or may over-express an endogenous nucleic acid encoding a protein or an enzyme involved in an NO production pathway.
[0080] Methods for increasing expression of an endogenous nucleic acid are known in the art and include but are not limited to introducing one or more copies of the endogenously present nucleic acid, optionally under control of stronger promoters, introducing transcription activators, capable of activating transcription of the endogenous gene etc.
[0081] The methods provided herein envisage genetically engineering micro-organisms, in particular microalgae, for producing an increased amount of certain molecules of interest. Accordingly, the herein described methods aim to increase the production of molecules of interest, in particular molecules of the lipid metabolic pathway, including lipids as well as intermediates of said lipid metabolic pathway such as fatty acids. In addition, the herein described methods may also increase the production of biomolecules derived from said molecules of the lipid metabolic pathway such as hydrocarbons, fatty alcohols, etc. In particular embodiments of the method, the production of lipids, more particularly TAGs, is increased.
[0082] In particular embodiments, the micro-organisms described herein have further been genetically modified to ensure production of molecules of interest, in particular molecules of the lipid metabolic pathway or biomolecules derived from said molecules. Further genetic modifications to further increase lipid production, in particular TAG production, as well as the production of any intermediate of the lipid metabolic pathway, are envisaged herein, but also further genetic modifications to ensure (increased) production of a biomolecule of interest derived from a molecule of the lipid metabolic pathway. For example, the recombinant micro-organisms described herein may be further genetically modified to further increase fatty acid biosynthesis and/or TAG assembly. In other examples, the recombinant micro-organisms may be further genetically modified to ensure production of e.g. hydrocarbons from fatty acids, or fatty alcohols from acetyl-CoA.
[0083] As metabolic pathways are well-established in micro-organisms, methods for modifying the lipid metabolic pathway and the production of biomolecules derived from molecules of said lipid metabolic pathway in a micro-organism as described herein can be easily determined by the skilled person, including in microalgae. Standard reference work setting forth the general principles of biochemistry includes Biochemical Pathways: An Atlas of Biochemistry and Molecular Biology, ed. Michal, G, John Wiley and Sons, Inc., New York, US, 1999. In the field of microalgae, standard reference work includes: Handbook of Microalgal Culture: Applied Phycology and Biotechnology, 2nd Edition, Amos Richmond and Qiang Hu, WileyBlackwell, 2013.
[0084] The methods provided herein envisage transforming micro-organisms, in particular microalgae, to stimulate the lipid metabolic pathway and/or to increase production of biomolecules derived from molecules of the lipid metabolic pathway. Accordingly, in particular embodiments, the methods encompass providing a microbial strain suitable for lipid production or wherein the lipid production is to be increased. Such a strain is preferably a microbial strain which produces lipids.
[0085] In preferred embodiments, the micro-organism is a microalga. Preferably, the microalga is selected from the Chromalveolata, more preferably the Heterokontophyta, even more preferably the Bacillariophyceae (diatoms), including the Naviculales such as Phaeodactylum tricornutum and the Pennales (pennate diatoms), and/or the Eustigmatophyceae, including Nannochloropsis species such as Nannochloropsis gaditana. In particular embodiments, the microalga is Phaeodactylum tricornutum, including the Pt1 strain.
[0086] In further particular embodiments, the recombinant microalga is Phaeodactylum tricornutum which has been modified to ensure an increased NO production. More particularly the recombinant Phaeodactylum tricornutum is transformed with one or more recombinant nucleic acids encoding one or more proteins involved in NO production such as one or more of PtNOA, NgNOA or a variant thereof.
[0087] Most microalgae are photoautotrophs, i.e. their growth is strictly dependent on the generation of photosynthetically-derived energy. Their cultivation hence requires a relatively controlled environment with a large input of light energy. For certain industrial applications, it is advantageous to use heterotrophic microalgae, which can be grown in conventional fermenters. In particular embodiments the microalgae have been further metabolically engineered to grow heterotrophically (i.e. to utilize exogenous organic compounds (such as glucose, acetate, etc.) as an energy or carbon source). A method for metabolically engineering microalgae to grow heterotrophically has been described in U.S. Pat. No. 7,939,710, which is specifically incorporated by reference herein. In particular embodiments, the microalgae are further genetically engineered to comprise a recombinant nucleic acid encoding a glucose transporter, preferably a glucose transporter selected from the group consisting of Glut 1 (human erythrocyte glucose transporter 1) and Hup1 (Chlorella HUP1 Monosaccharide-H+ Symporter). The glucose transporters facilitate the uptake of glucose by the host cell, allowing the cells to metabolize exogenous organic carbon and to grow independent of light. This is particularly advantageous for obligate phototrophic microalgae. Lists of phototrophs may be found in a review by Droop (1974. Heterotrophy of Carbon. In Algal Physiology and Biochemistry, Botanical Monographs, 10:530-559, ed. Stewart, University of California Press, Berkeley), and include, for example but without limitation, organisms of the phyla Cyanophyta (Blue-green algae), including the species Spirulina and Anabaena; Chlorophyta (Green algae), including the species Dunaliella, Chlamydomonas, and Heamatococcus; Rhodophyta (Red algae), including the species Porphyridium, Porphyra, Euchema, and Graciliaria; Phaeophyta (Brown algae), including the species, Macrocystis, Laminaria, Undaria, and Fucus; Baccilariophyta (Diatoms), including the species Nitzschia, Navicula, Thalassiosira, and Phaeodactylum; Dinophyta (Dinoflagellates), including the species Gonyaulax; Chrysophyta (Golden algae), including the species lrsochrysis and Nannochloropsis; Cryptophyla, including the species Cryptomonas; and Euglenophyta, including the species Euglena.
[0088] In the methods envisaged herein, the recombinant micro-organisms are preferably cultured under conditions suitable for the production of NO by the recombinant micro-organisms so as to increase production of the molecules of interest. More particularly this implies conditions sufficient to allow expression of the recombinant nucleic acid (encoding a protein involved in an NO production pathway). Typically the culture conditions are also selected so as to favor production of molecules of interest, in particular molecules of the lipid metabolic pathway or biomolecules derived from said molecules.
[0089] Culture conditions can comprise many parameters, such as temperature ranges, levels of aeration, and media composition. Each of these conditions, individually and in combination, allows the micro-organism to grow. To determine if conditions are sufficient to allow (over)expression, a micro-organism can be cultured, for example, for about 4, 8, 12, 18, 24, 36, or 48 hours. During and/or after culturing, samples can be obtained and analyzed to determine if the conditions allow (over)expression. For example, the micro-organisms in the sample or the culture medium in which the micro-organisms were grown can be tested for the presence of a desired product, e.g. NO or a transcript of the recombinant nucleic acid. When testing for the presence a desired product, assays, such as, but not limited to, polymerase chain reaction (PCR), sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), TLC, HPLC, GC/FID, GC/MS, LC/MS, MS, can be used. In particular, when testing for the presence of NO, the fluorophore 4-amino-5-methylamino-2,7-difluororescein diacetate (DAF-FM) can be used as described elsewhere herein.
[0090] Exemplary culture media include broths or gels. The micro-organisms may be grown in a culture medium comprising a carbon source to be used for growth of the micro-organisms. Exemplary carbon sources include carbohydrates, such as glucose, fructose, cellulose, or the like, that can be directly metabolized by the host cell. In addition, enzymes can be added to the culture medium to facilitate the mobilization (e.g., the depolymerization of starch or cellulose to fermentable sugars) and subsequent metabolism of the carbon source. A culture medium may optionally contain further nutrients as required by the particular strain, including inorganic nitrogen or phosphorous sources, and the like, and minerals and the like. In particular embodiments, wherein phototrophic microalgae are used, the method for increasing the production of molecules of interest, in particular molecules of the lipid metabolic pathway or biomolecules derived from said molecules, may comprise providing recombinant microalgae genetically engineered to produce or overproduce NO as taught herein, and culturing said microalgae in photobioreactors or an open pond system using CO.sub.2 and sunlight as feedstock.
[0091] Other growth conditions, such as temperature, cell density, and the like are generally selected to provide an economical process. Temperatures during each of the growth phase and the production phase may range from above the freezing temperature of the medium to about 50 C.
[0092] The culturing step of the methods described herein can be conducted continuously, batch-wise, or some combination thereof.
[0093] In particular embodiments, the culturing conditions which are suitable for the production of NO by the recombinant micro-organisms are also suitable for growth of the recombinant micro-organism, such that the production of the molecules of interest is concomitant with the growth of the micro-organism. In other words, according to particular embodiments, the cell concentration is not substantially impacted by modulating the NO production pathway, in particular by NOA or NOS overexpression, in the genetically engineered strains, such that the production of the molecules of interest can occur during the growth phase of the micro-organism, which can increase improve overall productivity of the molecules of interest.
[0094] In particular embodiments, the methods for the increased production of molecules of interest, further comprise the step of recovering said molecules or biomolecules from the recombinant micro-organisms and/or from the cultivation medium. Accordingly, in particular embodiments the methods comprise recovering molecules of the lipid metabolic pathway, in particular lipids, more particularly TAGs, or biomolecules derived from said molecules as envisaged herein, from the recombinant micro-organism and/or from the cultivation medium.
[0095] Methods for the recovery of said molecules or biomolecules from microalgae are known in the art and typically involve cell disruption and extraction of the molecules of interest (Guldhe et al. 2014, Fuel 128:46-52). Alternatively or in addition, the recombinant micro-organisms described herein may be further genetically engineered to ensure secretion of the molecules of interest. A further example includes a hydrothermal processing (HTL) of microalgae to produce biocrude, from which the molecules of interest can be recovered or which can be further processed to e.g. biofuel.
[0096] As noted before, the present inventors have surprisingly found that culturing the recombinant micro-organisms described herein results in increased production of molecules of interest, in particular increased production of molecules of the lipid metabolic pathway, in particular increased lipid production, more particularly increased TAG production.
[0097] In particular embodiments, the recombinant micro-organisms, in particular the recombinant microalgae described herein ensure a rate of TAG production, which is sufficiently high to be industrially valuable. More particularly, the TAG content in said recombinant micro-organisms and microalgae may be to at least 110%, preferably at least 120%, more preferably at least 150% 160%, 170%, 180% or 190%, even more preferably at least 200% or more as compared to micro-organisms and microalgae wherein the NO production was not modulated such as a wild-type micro-organisms and microalgae or micro-organisms and microalgae that have been transformed with an empty vector. In other words, the present method causes an increase in the TAG content of the recombinant micro-organisms and microalga compared to a micro-organism or microalga wherein the NO production was not modulated by a factor of at least 1.1, preferably at least 1.2, more preferably at least 1.5, 1.6, 1.7, 1.8 or 1.9, even more preferably at least 2 or even beyond.
[0098] The lipid content, in particular the TAG content, of a micro-organism can be measured using a variety of methods well known in the art. Non-limiting examples include staining with the fluorophore Nile Red (excitation wavelength at 485 nm; emission at 525 nm) and measurement of Nile Red fluorescence, and mass spectrometry (MS).
[0099] In particular embodiments, the methods include optimizing said micro-organisms and/or the cultivation medium so as to ensure the production of the biomolecule of interest. This can encompass modifying the micro-organism so as to further the production and/or preventing the catabolism of the biomolecule, for instance by blocking other biosynthesis pathways. For instance, where production of TAG is envisaged, the methods of the present invention may additionally comprise modifying the micro-organism of interest by blocking of pathways that divert carbon to alternative metabolic routes and/or preventing TAG catabolism. Such methods have been described in the art, as noted in the background section herein. Additionally or alternatively the cultivation or production conditions can be adjusted to stimulate the production of the biomolecule of interest. In particular embodiments, the micro-organisms are modified to block non-desirable pathways, such as programmed cell death. In particular embodiments, the methods of the invention comprise maintaining the cell under conditions which ensure that cell viability is maintained or is at an acceptable level.
[0100] The recombinant micro-organisms and microalgae described herein may hence be particularly suitable for industrial applications such as biofuel production and the production of biomolecules e.g. for chemical applications, for use in food industry, for the production of cosmetics, etc. Hence, a further aspect relates to the use of the recombinant micro-organisms and microalgae described herein for biofuel production or production of biomolecules (e.g. fatty acids), e.g. for chemical industry, for food industry, for cosmetics, etc.
[0101] An aspect of the application is directed to methods for obtaining a recombinant micro-organism such as a recombinant microalga capable of (over)producing NO as described herein. Such methods may comprise ensuring (over)expression of a gene encoding a protein involved in NO production. In particular embodiments, the methods comprise transforming a micro-organism with a recombinant nucleic acid encoding a protein involved in an NO production pathway as taught herein. In particular, the method may comprise the steps of: a) transforming a micro-organism with a recombinant nucleic acid encoding a protein involved in an NO production pathway as described herein above; and b) selecting a micro-organism capable of (over)producing NO. As detailed above the recombinant nucleic acid may encode a protein which is endogenous or foreign to the micro-organism. Additionally or alternatively the methods may involve modifications which induce or increase endogenous expression of a gene encoding a protein involved in NO production as described above.
[0102] The methods for generating the recombinant micro-organisms described herein involve standard genetic modifications, for which well-established methods are available to the skilled person.
[0103] More particularly, genetic engineering of the micro-organisms containing a recombinant nucleic acid encoding a protein involved in an NO production pathway as described herein may be accomplished in one or more steps via the design and construction of appropriate vectors and transformation of the micro-organisms with those vectors.
[0104] Methods for transforming microalgae are well known to a skilled person. For example, electroporation and/or chemical (such as calcium chloride- or lithium acetate-based) transformation methods or Agrobacterium tumefaciens-mediated transformation methods as known in the art can be used.
[0105] Numerous vectors are known to practitioners skilled in the art and any such vector may be used. Selection of an appropriate vector is a matter of choice. Preferred vectors are vectors developed for microalgae such as the vectors called pH4-GUS, pCT2, and pCT2Ng.
[0106] Typically, a vector may comprise a recombinant nucleic acid encoding a protein involved in an NO production pathway as described herein. In particular, a vector may comprise the coding sequence of a protein involved in an NO production pathway as described herein and associated promoter and terminator sequences. The vector may further contain restriction sites of various types for linearization or fragmentation. The vector may further include an origin of replication that is required for maintenance and/or replication in a specific cell type. The vector also preferably contains one or more selection marker gene cassettes. A selectable marker gene cassette typically includes a promoter and transcription terminator sequence, operatively linked to a selectable marker gene. Suitable markers may be selected from markers that confer antibiotic resistance, herbicide resistance, visual markers, or markers that complement auxotrophic deficiencies of a host cell, in particular a microalga. For example, the selection marker may confer resistance to an antibiotic such as hygromycin B (such as the hph gene), zeocin/phleomycin (such as the ble gene), kanamycin or G418 (such as the nptII or aphVIII genes), spectinomycin (such as the aadA gene), neomycin (such as the aphVIII gene), blasticidin (such as the bsd gene), nourseothricin (such as the natR gene), puromycin (such as pac gene) and paromomycin (such as the aphVIII gene). In other examples, the selection marker may confer resistance to a herbicide such as glyphosate (such as GAT gene), oxyfluorfen (such as protox/PPO gene) and norflurazon (such as PDS gene). Visual markers may also be used and include for example beta-glucuronidase (GUS), luciferase and fluorescent proteins such as Green Fluorescent Protein (GFP), Yellow Fluorescent protein, etc. Two prominent examples of auxotrophic deficiencies are the amino acid leucine deficiency (e.g. LEU2 gene) or uracil deficiency (e.g. URA3 gene). Cells that are orotidine-5-phosphate decarboxylase negative (ura3) cannot grow on media lacking uracil. Thus a functional URA3 gene can be used as a selection marker on a host cell having a uracil deficiency, and successful transformants can be selected on a medium lacking uracil. Only cells transformed with the functional URA3 gene are able to synthesize uracil and grow on such medium. If the wild-type strain does not have a uracil deficiency, an auxotrophic mutant having the deficiency must be made in order to use URA3 as a selection marker for the strain. Methods for accomplishing this are well known in the art.
[0107] Successful transformants can be selected for in known manner, by taking advantage of the attributes contributed by the marker gene, or by other characteristics (such as the ability to produce NO) contributed by the inserted recombinant nucleic acid. Screening can also be performed by PCR or Southern analysis to confirm that the desired insertions have taken place, to confirm copy number and to identify the point of integration of coding sequences into the host genome. Activity (such as NO-producing activity) of the protein encoded by the inserted coding sequence can be confirmed using known assay methods. For example, NO levels can be measured using the fluorophore 4-amino-5-methylamino-2,7-difluororescein diacetate (DAF-FM), which allows detection of nitric oxide (ONOO.sup.) which is in equilibrium with NO (St Laurent et al. 2015 Methods Mol Biol. 1220:339-345).
[0108] Methods for modifying endogenous gene expression by the use of artificial transcription factors (ATFs) or activator domains have also been described (Sera T. 2009, Adv Drug Deliv Rev 61:513-526; Maeder et al. 2013, Nat Methods 10:243-245; Cheng et al. 2013, Cell Res 23:1163-1171).
[0109] A further aspect of the application relates to the recombinant micro-organisms, in particular the recombinant microalgae, described herein. These micro-organisms are characterized in that they are genetically engineered to (over)produce NO as described herein and may further be characterized by their increased lipid content. In particular, the TAG content of the recombinant micro-organisms or microalgae described herein is increased to at least 110%, preferably at least 120%, more preferably at least 150% 160%, 170%, 180% or 190%, even more preferably at least 200% as compared to micro-organisms or microalgae wherein the NO production was not modulated such as a wild-type micro-organisms or microalgae or a micro-organism or microalgae that has been transformed with an empty vector.
[0110] In particular embodiments, the micro-organisms are characterized by the presence of one or more genetic modifications in the genome which affect NO synthesis, as detailed above.
[0111] The present invention will now be further illustrated by means of the following non-limiting examples.
EXAMPLES
Example 1: Effect of Overexpression of the Endogenous NOA Gene on Triacylglycerol Production in Phaeodactylum tricornutum
Material and Methods
[0112] Phaeodactylum tricornutum (Pt1) Bohlin Strain 8.6 CCMP2561 (Culture Collection of Marine Phytoplankton, now known as NCMA: National Center for Marine Algae and Microbiota) was used in example 1.
Genetic Construct for PtNOA Overexpression
[0113] Genomic DNA was extracted from Phaeodactylum tricornutum Pt1 strain using the following procedure: 100.Math.10.sup.6 cells were harvested and frozen in liquid nitrogen. A volume of 20 l Edward-Buffer (Tris-HCl 200 mM, pH 7.5; NaCl 250 mM; EDTA 25 mM; SDS 0.5%, w/v) was added, then samples were homogenized and debris removed by centrifugation. The supernatant was transferred to the same volume of isopropanol to precipitate DNA. After an additional 15 minute centrifugation at 10,000g, the pellet was washed with ethanol 70%, dried and solubilized in TE buffer (10 mM Tris-HCL pH7, 1 mM EDTA). DNA concentration was measured using a Nanodrop 2000 spectrophotometer (Thermo Scientific). Using genomic DNA as matrix, a 2352-bp sequence was amplified by polymerase chain reaction (PCR) with the following oligonucleotides designed from Phatr2_56150 (Vardi et al. 2008), and carrying respectively XbaI and EcoRI restriction sites (underlined sequence): NOA-Fw XbaI 5-TTTATCTAGAATGGTCCCCACTGGTTGTATG-3 (SEQ ID NO:8), NOA-Rev EcoRI 5-TTTAGAATTCCTAATTACGCCCTACACCTTTTCTTC-3 (SEQ ID NO:9). PCR was performed using Phusion High Fidelity polymerase (Thermo Scientific) according to the manufacturer's instructions. PCR product was digested by EcoRI and XbaI, purified and cloned in the linearized expression vector. The expression vector used for overexpression corresponds to the pH4-GUS vector (De Riso et al. 2009 Nucleic Acids Res. doi: 10.1093/nar/gkp448). The vector contains a gene coding for resistance to zeocin (Shble), allowing selection of transformed cells. Expression of the NOA gene is controlled by the constitutive histone 4 promoter (H4pro). The vector sequence is provided in SEQ ID NO:6 (
Transformation of P. tricornutum with the Genetic Construct and Selection of Strains Overexpressing NOA
[0114] Wild-type P. tricornutum cells were transformed via particle-bombardment under aseptic conditions according to Russel Kikkert et al. (1993) (The Biolistic PDS-1000/He device, Plant Cell, Tissue and Organ Culture, Volume 33, Issue 3, pp 221-226). A modified diatom protocol (Falciatore et al. 1999. Mar Biotechnol (NY) 1:239-251) was used. Briefly, three to four days-old Pt1 cultures were concentrated to 4.Math.10.sup.7 cells.500 l.sup.1 and spread onto a 1% agar-plate containing artificial seawater (ESAW) medium (Table 1) with 50% reduced concentration of salt solution 1 and 2 (see Table 1 for the composition of salt solution 1 and 2). While vortexing, 2-3 g of non-linearized plasmid were added to 25 l ethanol-sterilized tungsten particles (SIGMA), together with 25 l of 2.5 M CaCl.sub.2 and 10 l of 0.1 M spermidine. The mix was vortexed for three minutes, pelleted and washed two times (full speed, 5 s, room temperature) with 700 l ethanol. Finally, DNA-coated tungsten particles were re-suspended in 25 l ethanol. 12 l of the mix were transferred onto a macrocarrier and the bombardment was carried out using 1,550 psi rupture disks (BioRad). After two to three days of incubation under continuous illumination, cells were transferred to the same kind of agar-plates containing 100 g.Math.ml.sup.1 zeocin (Promega) for the selection of resistant transformants (i.e. genetically modified strains). Colonies appearing 4 to 6 weeks afterwards were transferred to a new plate for one week, prior to the inoculation of 20 ml liquid cultures.
Culture of P. tricornutum at Different Scales, Different Media, Different CO.SUB.2 .Supplies and Different Illumination Regimes
[0115] For batch cultures, 20 ml or 50 ml cultures were grown in 250 ml Erlenmeyer flasks at 20 C. in ESAW medium. Cells were grown on a 12:12 light (30 E m.sup.2.Math.sec.sup.1) / dark cycle.
[0116] For experiments in small photobioreactors, cells were pre-cultured in 250 ml Erlenmeyer flasks until they reached a density of 2-4.Math.10.sup.6 cells/ml. Cells were then centrifuged at 3,500 g for 5 minutes and re-suspended in either 10 ESAW medium (containing ten times more N and P; Table 1), medium E (Anandarajah et al. 2012 Applied Energy 96: 371-377;
[0117] Table 2) or medium F (Benvenuti et al. J Appl Phycol 27:1425-1431; Table 3) to a final concentration of 2.Math.10.sup.6 cells/ml. These two additional media were chosen from the published literature because of their very different macronutrients and microelements composition, thus testing TAG accumulation in NOA overexpressor(s) across culture conditions. Cells were grown under a constant light regime at 20 C. in small scale bioreactors (Multi-Cultivator MC 1000, Photon Systems Instruments, Czech Republic), where temperature and light are tightly controlled. Culture mixing throughout cultivation time was provided by gas sparging as in air-lift photobioreactors; in order to test precise CO.sub.2 supplies to bioreactor tubes, the Gas Mixing System GMS 150 (Photon Systems Instruments, Czech Republic) was used following manufacturer's instructions.
TABLE-US-00001 TABLE 1 Composition of ESAW 1 culture medium. Salt Solution 1 is autoclaved separately and added aseptically to the final medium. NaNO.sub.3 and NaH.sub.3PO.sub.4 are added in 10 concentration or left absent. 10 Stock Final medium Concentration concentration Salt Solution 1 NaCl 211.94 g/L 100 ml per 1 L 21.194 g/L Na.sub.2SO.sub.4 35.50 g/L final medium 3.550 g/L KCl 5.99 g/L 0.599 g/L NaHCO.sub.3 1.74 g/L 0.174 g/L KBr 0.863 g/L 0.0863 g/L H.sub.3BO.sub.3 0.230 g/L 0.0230 g/L NaF 0.028 g/L 0.0028 g/L Salt Solution 2 MgCl.sub.26H.sub.2O 95.92 g/L 100 ml per 1 L 9.592 g/L CaCl.sub.22H.sub.2O 13.44 g/L final medium 1.344 g/L SrCl.sub.26H.sub.2O 0.218 g/L 0.0218 g/L Major Nutrients NaNO.sub.3 46.67 g/L 1 ml per 1 L final 46.67 mg/L medium (or 10 ml/L 10 ESAW) NaH.sub.2PO.sub.4 3.094 g/L 1 ml per 1 L final 3.094 mg/L medium (or 10 ml/L 10 ESAW) For 50 ml Trace Metal TRACE METALS stock solution Na.sub.2EDTA2H.sub.2O 3.09 g/100 mL 5 ml 1 ml Trace Metal 3.09 mg/L ZnSO.sub.47H.sub.2O 0.73 g/100 ml 0.5 ml solution per 1 L 7 g/L CoCl.sub.26H.sub.2O 0.16 g/100 ml 0.5 ml final medium 16 g/L MnCl.sub.24H.sub.2O 0.54 g/100 mL 5 ml 540 g/l Na.sub.2MoO.sub.42H.sub.2O 0.148 g/100 ml 50 l 1.48 g/l Na.sub.2SeO.sub.3 0.017 g/100 mL 50 l 0.173 g/l NiCl.sub.26H.sub.2O 0.149 g/100 mL 50 l 1.49 g/l CuSO.sub.45H.sub.2O 0.98 g/100 mL 50 l 9.8 g/l Stock Other Concentration EDTA-Iron 3 g/L 1 ml per 1 L final 3 mg/L medium Vitamin stock 1 ml per 1 L final 1 mg/L medium Vitamin H 1 mg/L Vitamin B12 0.2 g/L Vitamin B1 Final Medium ESAW Prep: For 1 L For 1 L solid: ESAW1X 0.5 Ingredient Added Volume Ingredient Added Volume Volume before autoclave before autoclave Salt Solution 2 100 ml H.sub.2O 800 ml 800 ml NaH.sub.2PO.sub.4 1 ml (or 10 ml/L Agar 1% (w/v) 10 g 10 g 10 ESAW) Trace metals 1 ml Ingredient Added Volume Volume stock after autoclave EDTA-Iron 1 ml Sea Salt1 100 ml/L 50 ml/L Water up to 0.9 L Sea Salt2 100 ml/L 50 ml/L Ingredient Added Volume NaNO.sub.3 1 ml/l 1 ml/l after autoclave Salt Solution 1 100 ml NaH.sub.2PO.sub.4 1 ml/l 1 ml/l NaNO.sub.3 1 ml (or 10 ml/L Trace metals 1 ml/l 1 ml/l 10 ESAW) stock Vitamins 1 ml EDTA-Iron 1 ml/l 1 ml/l Vitamins 1 ml/l 1 ml/l
TABLE-US-00002 TABLE 2 Composition of medium E Final Final Stock ml stock for Conc. MW Conc. Conc. 1 L Medium Medium E mM g/mol g/L g/L ml Tris pH 8 40 121.14 4.8456 NaCl 363 58.44 21.19 Salt 100 Na.sub.2SO.sub.4 25 142.04 3.55 solution 1 KCl 8.035 74.55 0.599 (10X) NaHCO.sub.3 2.071 84 0.174 256.5 g/L KBr 0.725 119 0.0863 H.sub.3BO.sub.3 0.372 61.8 0.023 NaF 0.667 41.99 0.028 MgCl.sub.2 .Math. 6H.sub.2O 47.172 203.3 9.59 Salt 100 CaCl.sub.2 .Math. 2H.sub.2O 9.142 147.01 1.344 solution 2 SrCl.sub.2 .Math. 6H.sub.2O 0.082 266.6 0.0218 (10X) 109.6 g/L NaNO.sub.3 8.825 84.99 0.75 75 10 NaH.sub.2PO.sub.4 0.217 119.98 0.026 5 5.36 Na.sub.2 EDTA .Math. 2H.sub.2O 0.012 372.24 0.00436 1 mL Trace FeCl.sub.3 .Math. 6H.sub.2O 0.012 270.3 0.00315 metals stock CuSO.sub.4 .Math. 5H.sub.2O 0.00016 249.7 4.00E solution + 05 1 ml Primary Zn SO.sub.4 .Math. 7H.sub.2O 0.00031 287.5 8.80E trace metal 05 solution E CoCl.sub.2 .Math. 6H.sub.2O 0.00017 237.9 4.00E 05 MnCl.sub.2 .Math. 2H.sub.2O 0.00445 161.9 7.20E 04 Na.sub.2MoO.sub.4 0.00012 205.9 2.52E 05 biotin (vit. H) 4.1E06 244.31 1.00E Solution 1 06 Vitamines Cobalamin (Vit. B12) 7.4E07 1355.37 1.00E 06 thiamine vit. B1 0.00066 300.81 2.00E 04
TABLE-US-00003 TABLE 3 Composition of medium F Final Final Stock ml stock for Conc. MW Conc. Conc. 1 L medium Medium F mM g/mol g/L g/L ml HEPES pH 7.5 100 238.3 23.83 NaCl 420 58.44 24.5448 MgSO.sub.47H.sub.2O 5 246.5 1.2325 Na.sub.2SO.sub.4 3.5 142.04 0.49714 CaCl.sub.22H.sub.2O 2.5 147 0.3675 NaNO.sub.3 70 84.99 5.9493 KH.sub.2PO.sub.4 0.88 136.09 0.1197592 K.sub.2HPO.sub.4 2.3 174.2 0.40066 NaHCO.sub.3 10 84 0.84 EDTA 0.11 367.1 0.040381 Fe(III)Na- salts Na.sub.2 0.18 372.24 0.0670032 EDTA2H.sub.2O ZnSO.sub.47H.sub.2O 0.004 287.5 1.15E03 22 0.05227273 CoCl.sub.26H.sub.2O 0.0012 237.9 2.85E04 10 0.028548 MnCl.sub.22H.sub.2O 0.0155 161.9 2.51E03 180 0.01394139 CuSO.sub.45H.sub.2O 0.0013 249.7 3.25E04 10 0.032461 biotin (vit. H) 0.0001 244.31 2.44E05 0.1 0.24431 Cobalamin 0.0001 1355.37 1.36E04 0.1 1.35537 (Vit. B12) thiamine (vit. 0.0037 300.81 1.11E03 0.5 2.225994 B1)
Measurement of NOA Gene Expression
[0118] To quantify the NOA mRNA level in the genetically modified strains, quantitative polymerase chain reaction (qPCR) was performed after reverse transcription (RT) of extracted RNA. RNA was extracted from 10.sup.7 cells that were previously pelleted, frozen in liquid nitrogen and stored at 80 C. until processing. A volume of 1 ml TriReagent (SIGMA) was added to the frozen pellet and transferred to a new Eppendorf tube. After vortexing for 30 seconds, samples were incubated for 5 min at room temperature. 200 l chloroform were added and tubes inverted and incubated for 15 min at room temperature. Phase separation was achieved by centrifugation (30 min, full speed, 4 C.). The upper phase was transferred to a new tube and RNA precipitated using 1 volume isopropanol (30 min, full speed, 4 C.), washed with 75% ice cold ethanol (5 min, full speed, 4 C.) and the pellet was dried in a Speed Vac system (Eppendorf Concentrator 5301) prior to resuspension in 30 l DECP water (SIGMA) at 65 C. for 10 min. RNA was purified following a second ethanol precipitation using 1 volume of 5 M NH.sub.4.sup.+, acetate (2.5 M final concentration) and 1 volume isopropanol. Samples were incubated for 10 min on ice and centrifuged, washed, dried and re-suspended as described above. Concentration was determined using a NanoDrop device (Life Inc.). 1000 ng RNA were used for reverse transcription after DNAse treatment (QIAGEN) following manufacturer's instructions so as to yield 1000 ng cDNA, which were diluted to 10 ng.Math.l.sup.1. For quantitative real time PCR, the housekeeping gene oligonucleotides described by Siaut et al. (2007 Gene 406(1-2):23-35), namely 30S Ribosomal Protein Subunit (RPS) (5-CGAAGTCAACCAGGAAACCAA-3 (SEQ ID NO:10) and 5-GTGCAAGAGACCGGACATACC-3 (SEQ ID NO:11)) and tubulin A (TubA) (5-CTGGGAGCTTTACTGCTTGGA-3 (SEQ ID NO:12) and 5-ATGGCTCGAGATCGACGTAAA-3 (SEQ ID NO:13)), were used as internal controls. NOA-binding oligonucleotides were 5-CCTGAAAAGTTCGCTACGCA-3 (SEQ ID NO:14) and 5-CGGATCCTTTTTGCCCTGAG-3 (SEQ ID NO:15). The total qPCR reaction volume was 10 l (120 nM per oligonucleotide, 20 ng cDNA, 5 l 2 SYBR Green Sso Advanced (BioRad). A two-step thermo-profile in 40 cycles was applied after 3 min at 95 C. initial denaturation (95 C. 10 sec, 58 C. 30 sec) and a melt curve was detected (from 65 Cto 95 C. with a 0.5 C. increment) (BioRad CFX Connect Real-Time System).
[0119] Evaluation of gene expression in 3 biological replicates each in technical triplicates were carried out using the CFX Connect Real-Time System software using TubA and RPS as internal controls.
Measurement of Nitric Oxide using a Fluorescent Reporter
[0120] NO production was monitored using the fluorophore 4-amino-5-methylamino-2,7-difluororescein diacetate (DAF-FM), which allows the sensitive detection of low levels of nitric peroxide (ONOO) ,which is in equilibrium with NO and thus indicates NO levels (St Laurent et al. 2015. Methods Mol Biol. 1220:339-45) and was previously used to detect NO levels in P. tricornutum cells (Vardi et al., 2008). 10 ml culture were diluted to 10.sup.6 cells/ml and cells were incubated with 20 l 5 mM DAF-FM (1.5 h, room temperature, darkness, shaking). Cells were washed and re-suspended in 10 ml 10ESAW media and aliquoted to 500 l cultures on a 48 well culture plate. For the examination of DAF-FM-dependent detection of nitric peroxide, 150 l of the culture were transferred into a 96 well plate and fluorescence was measured with a TECAN infinite M1000Pro plate reader (excitation wavelength at 488 nm, emission at 529 nm).
Measurement of TAG Accumulation by Nile Red Staining
[0121] A first method to measure the accumulation of TAG droplets consisted in their detection by Nile Red (Sigma Aldrich) fluorescent staining (Excitation wavelength at 485 nm; emission at 525 nm) as previously described (Abida et al., 2015). In brief, cells were diluted and adjusted to a cell density that was linearly correlated with Nile Red fluorescence. Nile Red solution (40 l of 2.5 g/mL stock concentration, in 100% DMSO) was added to 160 l cell suspension. Oil bodies stained with Nile Red were then visualized using a Zeiss AxioScope.A1 microscope (FITC filter; Excitation wavelength at 488 nm; emission at 519 nm). The productivity, corresponding to the accumulation of TAG per volume and per time unit was calculated based on the staining by Nile Red, and expressed in relative fluorescence unit (Rfu) of Nile Red per mL and per day of incubation. Alternatively, Nile red fluorescence values were normalized to the cell concentration.
Measurement of TAG Accumulation by Mass Spectrometry
[0122] Glycerolipids were extracted from freeze-dried P. tricornutum cells grown in 50 mL of medium. About 50 to 100.Math.10.sup.6 cells are required for a triplicate analysis of TAGs. First, cells were harvested by centrifugation, then immediately frozen in liquid nitrogen. Once freeze-dried, the pellet was suspended in 4 mL of boiling ethanol for 5 minutes to prevent lipid degradation, and lipids were extracted as described by Simionato et al., (2013 Eukaryot Cell. 201, 12(5):665-76) by addition of 2 mL methanol and 8 mL chloroform at room temperature. The mixture was then saturated with argon and stirred for 1 hour at room temperature. After filtration through glass wool, cell debris was rinsed with 3 mL chloroform/methanol 2:1, v/v, and 5 mL of NaCl 1% were then added to the filtrate to initiate biphase formation. The chloroform phase was dried under argon before solubilizing the lipid extract in 1 ml of chloroform. Total glycerolipids were quantified from their fatty acids, in a 10 l aliquot fraction a known quantity of 15:0 was added and the fatty acids present were transformed as methyl esters (FAME) by a 1 hour incubation in 3 mL 2.5% H.sub.250.sub.4 in pure methanol at 100 C. (Jouhet et al. 2003 FEBS Lett. 544(1-3):63-8). The reaction was stopped by addition of 3 mL water, and 3 mL hexane were added for phase separation. After 20 min of incubation, the hexane phase was transferred to a new tube. FAMEs were extracted a second time via the addition, incubation and extraction of another 3 ml hexane. The combined 6 ml were argon-dried and re-suspended in 30 l hexane for gas chromatography-flame ionization detector (GC-FID) (Perkin Elmer) analysis on a BPX70 (SGE) column. FAME were identified by comparison of their retention times with those of standards (Sigma) and quantified by the surface peak method using 15:0 for calibration. Extraction and quantification were performed with at least three biological replicates. TAGs were analyzed and quantified by HPLC-MS/MS. For a technical triplicate analysis, an aliquot of the lipid extract containing 25 nmol of total fatty acid was dried under argon and dissolved in 100 l of a methanol/chloroform solution (1:2) containing 125 pmol of 18:0/18:0/18:0 TAG as internal standard. For each replicate, 20 l were injected in the HPLC-MS/MS system. The analytic device comprised a LC system with binary pumps (Agilent 1260 Infinity) coupled to a QQQ MS (Agilent 6460) equipped with a JetStream electrospray vane of injection. TAGs were separated by HPLC from other lipids using a diol column (Macherey-Nagel, EC 150/2 Nucleosil 100-5 OH) maintained at 40 C. The chromatography conditions were as follows: solvent A: isopropanol/water/ammonium acetate 1 M pH 5.3 (850/125/1); solvent B: Hexane/isopropanol/water/ammonium acetate 1 M pH 5.3 (625/350/24/1); gradient: 0 to 5 min 100% B, 5 to 30 min linear increase of A to 100%, 30 to 45 min 100% A, 45 to 50 min:linear increase of B to 100%, 50 to 70 min 100% B. Under these conditions, TAGs were eluted after 4-5 min of run. The various TAG species were detected from their m/z ratio by MS/MS using the Multiple Reaction Monitoring (MRM) mode. The various transition reactions used to identify the different TAG species are those previously established with Phaeodactylum tricornutum (Abida et al. 2015). Quantification was made using the Agilent Mass Hunter software furnished by the MS supplier.
Results
[0123] Results shown in
Example 2: Overexpression of a PtNOA Homolog from Nannochloropsis gaditana (NgNOA) in P. tricornutum and N. gaditana
[0124] A PtNOA homolog (
[0125] For the heterologous expression of NgNOA in Phaeodactylum tricornutum and the overexpression in Nannochloropsis gaditana, the coding sequence was optimized to match the codon optimization of both Chromalveolata species. Restriction sites for BamHI and Xbal were added at the 5-end, and EcoRI and NdeI at the 3-end of the codon optimized CDS to allow expression in the pH4 vector for expression in P. tricornutum, and in the PCT2Ng vector (SEQ ID NO:7) for the expression in N. gaditana, respectively. The codon optimized NgNOA coding sequence is designated as NgNOAoptCDS and has the following sequence:
TABLE-US-00004 (SEQIDNO:5) GGATCCTCTAGAATGGCTCCCCACCTCTCCGGCCTCAACTTCCACTCCCT CGTCAAGCGCTCCTCCGCTGCTGCTCTCCTCTTCTCCCTCTTCATCATGA AGCTCCCCTGCGTCGGCGCTTTCCAGGGCGTCGTCCGCGTCTGGTCCTCC GCTGTCGCTCCCTCCCGCGCTGCTGTCCTCACCTCCTTCATGTCCCCCAA GCGCCACGTCCTCAAGCGCATGCCCATCTCCGCTCTCTGCCGCCGCTCCA CCATCATGGCTTCCCGCAAGGCTGGCGCTGGCCAGGGCGAGCACGAGGCT GAGGGCGAGGGCATCTCCCCCGAGTCCATCTCCTCCACCGGCTCCAACGC TGGCGGCAAGGGCATCGGCCGCGGCCCCCGCAACCGCCGCAAGATCGCTG TCTCCGCTGAGGAGGAGGAGTTCTCCGCTCTCTCCGACTCCCGCACCTCC GTCTCCGAGGAGAAGGACTCCATCCGCCGCCCCCGCGTCATCTCCCGCCC CCCCTCCCGCCCCGTCAAGCGCACCATGACCATCAACCCCAACTGGCGCG CTCACGGCGGCCCCGAGAACTCCATCAAGGGCCCCGAGGAGGCTGCTTCC TCCTCCTCCGGCACCGCTGGCTCCGGCAAGGCTCGCGTCGGCAAGAACGG CCCCCGCGGCGCTTCCCCCCTCGGCGCTGAGGTCCCCCGCTACGTCGAGG ACGAGGACGAGGACGGCATCACCTTCCCCAAGGACATGGTCATCCGCGGC CTCGACTCCCAGTCCTACGAGGAGGCTCGCCGCCAGGCTGTCCTCTCCGA CGACGAGGGCGAGGAGGAGGAGTGGGCTGACGAGGGCGTCATGGTCGAGG AGGAGGAGGGCGAGGACTTCGACGAGGAGGAGGAGGAGGAGGACTTCGAC GAGGAGGAGGAGGAGGAGGACTTCGACGAGGGCGACGAGGAGGAGGAGGA CGGCGCTCACCTCCCCCCCGTCCGCCCCGTCTCCATGGAGGAGCGCCTCC GCCTCGCTGAGTCCGGCAACATCTTCAACCCCTACGTCGCTCGCATGCAC ACCCGCGCTGGCACCGGCGAGGGCCCCTCCGGCGAGGCTGAGGACCCCGG CCCCATGGACGGCGGCGGCCTCCGCTTCCTCGAGGAGGACGTCTCCCCCG GCGAGAAGCGCGAGGAGGCTCGCCGCGCTCAGGCTCCCTCCCTCCCCGTC AAGTTCCAGTACAAGGTCGTCGTCGGCGCTGGCACCTGCCCCGGCTGCGG CAACGCTTTCCAGACCAAGAACGAGTCCTCCCCCGGCTTCCTCCCCCCCG ACGTCTACGAGCGCCTCCAGGCTCAGATGACCGCTCTCCGCCCCGGCGCT CCCCGCAAGCCCCGCCCCGACGCTCCCCCCCTCTCCAAGTCCGCTGCTGG CGCTCTCCGCAAGAAGACCGAGACCCGCGGCGAGGAGGGCGACCTCTTCC AGGGCCTCTCCGCTGAGGAGGAGGTCGAGATGCTCCTCTCCGGCAAGTCC CGCGAGGAGTTCGAGATCGAGCGCGCTGCTGGCCGCGGCCGCGAGGCTCA GGGCGGCGAGGTCGACCTCGACCTCGACGAGGAGGGCAAGGAGGAGAAGG AGGGCGAGGGCCGCGAGGGCGAGGAGGGCGGCGAGGGCGAGGAGGAGGAG GAGGAGTTCCGCGCTGTCATCTGCCAGCGCTGCCACAAGCTCAAGCACTA CGGCGACGTCGAGGACGCTCTCCGCCCCGGCTGGTCCGCTAACGAGCTCC TCACCCCCGAGCGCTTCCGCGAGCTCGTCTCCGTCGTCCGCCGCAAGCGC TGCGCTGTCGTCTGCCTCGTCGACATCTTCGACTTCCACGGCTCCCTCCT CTACAACCTCCCCCGCATCGTCGGCTCCAACCCCGTCCTCGTCGCTGTCA ACAAGGCTGACCTCCTCCCCGCTGACTTCTCCCAGGACCGCGTCCGCATC TGGGTCAAGCAGGAGCTCGAGAAGGTCGGCATGACCGACGTCTCCACCCG CGACATCCACCTCATCTCCTGCAAGACCGGCAACAACGTCCGCCCCCTCC TCCGCTCCATGAAGCAGATGGCTCGCCAGCGCCGCCGCGACCTCTACGTC ATCGGCGCTGCTAACGTCGGCAAGTCCACCTTCATCAACCGCCTCATCGA GCTCGGCCGCTCCGGCGGCGACGCTCAGCGCAAGAAGAAGAAGAAGCAGG GCGAGCAGTCCAAGGGCGGCTCCCTCGTCACCACCTCCGCTCTCCCCGGC ACCACCCTCGACTTCATCGAGGTCGACCTCGGCGACAAGGTCTCCCTCTA CGACACCCCCGGCCTCATCCTCCCCCACCAGATCACCACCCTCCTCAACA CCGAGGAGCTCAAGGCTGTCATCCCCCAGAAGCGCATCAACCACGTCACC CTCCGCCTCAAGGAGGGCAAGTCCGTCCTCCTCGGCGGCCTCGTCCGCCT CGACATGCTCGAGGGCCGCCCCTTCCTCTTCACCTTCTACGTCTCCAACG AGGTCAAGCTCCACCAGACCGCTACCGACCGCGCTGGCGAGTTCCTCGAC TCCCACCTCGGCGAGCTCATCTCCCCCCCCTTCACCCAGGAGCGCCGCGC TGCTATGGGCCCCTGGGTCCCCCGCGACTTCGAGATCGAGGGCACCGGCT GGAAGACCTCCGCTGTCGACATCGTCATCTCCGGCCTCGGCTGGATCTCC GTCACCGGCGCTCTCGACTGCAAGGTCCGCGTCATGGCTCCCGAGGCTGT CGGCGTCCGCCTCCGCTCCCCCCTCATGCCCTACGAGACCTGGGCTACCA CCGCTAAGTGGACCGGCCTCCGCGCTGTCAAGTCCGACAAGCAGAAGGGC TCCTCCCGCTAAGAATTCCATATG.