MUTEINS OF TEAR LIPOCALIN AND METHODS FOR OBTAINING THE SAME
20190015477 ยท 2019-01-17
Inventors
- Kristian Jensen (Munich, DE)
- Martin HUELSMEYER (Wolfersdorf, DE)
- Steffen Schlehuber (Langenbach, DE)
- Andreas HOHLBAUM (Paunzhausen, DE)
- Arne Skerra (Freising, DE)
- Eric Boudreau (Research Triangle Park, NC, US)
- Richard Jones (Basel, CH)
- Ian Kimber (Cheshire, GB)
- Rebecca Dearman (Cheshire, GB)
Cpc classification
A61P29/00
HUMAN NECESSITIES
C07K14/705
CHEMISTRY; METALLURGY
A61P9/10
HUMAN NECESSITIES
C12N5/10
CHEMISTRY; METALLURGY
A61P43/00
HUMAN NECESSITIES
G01N33/57492
PHYSICS
A61K47/60
HUMAN NECESSITIES
International classification
C07K14/705
CHEMISTRY; METALLURGY
A61K47/60
HUMAN NECESSITIES
C12N5/10
CHEMISTRY; METALLURGY
Abstract
The present invention relates to novel muteins derived from human tear lipocalin. The invention also refers to a corresponding nucleic acid molecule encoding such mutein and to a method for its generation. The invention further refers to a method for producing such a mutein. Finally, the invention is directed to a pharmaceutical composition comprising such a lipocalin mutein as well as to various uses of the mutein.
Claims
1-147. (canceled)
148. A mutein of human tear lipocalin capable of binding a non-natural ligand of human tear lipocalin with a K.sub.D of about 200 nM or lower, wherein the mutein comprises a mutated amino acid residue at any one or both of the sequence positions 80 and 104 of the linear polypeptide sequence of mature human tear lipocalin (SEQ ID NO: 71), and wherein the mutein comprises at least 10 mutated amino acid residues at any of the sequence positions 26-34, 56-58, 83, 105-106, and 108 of the linear polypeptide sequence of mature human tear lipocalin (SEQ ID NO: 71).
149. A mutein of human tear lipocalin capable of binding a non-natural ligand of human tear lipocalin with a K.sub.D of about 200 nM or lower, wherein the mutein comprises 2 or 3 mutated amino acid residues at any of the sequence positions 61, 101, and 153 of the linear polypeptide sequence of mature human tear lipocalin (SEQ ID NO: 71), and wherein the mutein comprises at least 12 mutated amino acid residues at any of the sequence positions 26-34, 56-58, 80, 83, 104-106, and 108 of the linear polypeptide sequence of mature human tear lipocalin (SEQ ID NO: 71).
150. The mutein of claim 148, wherein the mutein comprises 1, 2, or 3 mutated amino acid residues at any of the sequence positions 61, 101, and 153 of the linear polypeptide sequence of mature human tear lipocalin (SEQ ID NO: 71).
151. The mutein of claim 148, wherein the mutein comprises at least one of the following mutated amino acid residues with respect to the linear polypeptide sequence of mature human tear lipocalin (SEQ ID NO: 71): Cys 61.fwdarw.Ala, Phe, Lys, Arg, Thr, Asn, Tyr, Met, Ser, Pro or Trp; Cys 153.fwdarw.Ser or Ala; and Cys 101.fwdarw.Ser.
152. The mutein of claim 148, wherein the mutein comprises at least 15 mutated amino acid residues at any of the sequence positions 26-34, 56-58, 80, 83, 104-106, and 108 of the linear polypeptide sequence of mature human tear lipocalin (SEQ ID NO: 71).
153. The mutein of claim 149, wherein the mutein comprises at least 15 mutated amino acid residues at any of the sequence positions 26-34, 56-58, 80, 83, 104-106, and 108 of the linear polypeptide sequence of mature human tear lipocalin (SEQ ID NO: 71).
154. The mutein claim 148, wherein the non-natural ligand is selected from the group consisting of a small molecule, a peptide, and a protein or protein domain.
155. The mutein of claim 148, wherein the non-natural ligand is selected from the group consisting of interleukin 4 receptor alpha chain (IL-4 receptor alpha), vascular endothelial growth factor (VEGF), and vascular endothelial growth factor receptor 2 (VEGF-R2).
156. The mutein of claim 148, wherein the mutein comprises one of the following sets of mutated amino acid residues at sequence positions corresponding to the linear wild type amino acid sequence of mature human tear lipocalin (SEQ ID NO: 71): (a) Arg 26.fwdarw.Ser, Glu 27.fwdarw.Arg, Phe 28.fwdarw.Cys, Glu 30.fwdarw.Arg; Met 31.fwdarw.Ala, Leu 33.fwdarw.Tyr, Leu 56.fwdarw.Gln, Ile 57.fwdarw.Arg, Asp 80.fwdarw.Ser, Lys 83.fwdarw.Arg, Glu 104.fwdarw.Leu, Leu 105.fwdarw.Cys, His 106.fwdarw.Pro, and Lys 108.fwdarw.Gln. (b) Glu 27.fwdarw.Gly, Phe 28.fwdarw.Ala, Pro 29.fwdarw.Leu, Glu 30.fwdarw.Arg, Met 31.fwdarw.Cys, Asn 32.fwdarw.Leu, Leu 33.fwdarw.Ala, Glu 34.fwdarw.Gly, Asp 80.fwdarw.Ile, Lys 83.fwdarw.Ile, Glu 104.fwdarw.Cys, and Lys 108.fwdarw.Val. (c) Arg 26.fwdarw.Ser, Glu 27.fwdarw.Ile, Glu 30.fwdarw.Ser, Met 31.fwdarw.Gly, Asn 32.fwdarw.Arg, Leu 33.fwdarw.Ile, Glu.fwdarw.34 Tyr, Ile 57.fwdarw.Phe, Ser 58.fwdarw.Arg, Lys 83.fwdarw.Glu, Glu 104.fwdarw.Leu, Leu 105.fwdarw.Ala, His 106.fwdarw.Val, and Lys 108.fwdarw.Thr.
157. The mutein of claim 148, wherein the mutein has at least 80% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 2-8, 26-33 and 44-47.
158. The mutein of claim 148, wherein the mutein is in a conjugated form or as a fusion protein.
159. The mutein of claim 148, wherein the mutein is, at its N-terminus or its C-terminus, conjugated with or fused to a molecule selected from the group consisting of a toxin, a signal sequence, an affinity tag, a peptide, a protein or a protein domain, an antibody, and a mutein of human lipocalin.
160. The mutein of claim 148, wherein the mutein is fused to a moiety that extends the serum half-life of the mutein.
161. The mutein of claim 160, wherein the moiety that extends the serum half-life is selected from the group consisting of an Fc part of an immunoglobulin, a CH3 domain of an immunoglobulin, a CH4 domain of an immunoglobulin, albumin or an albumin fragment, an albumin binding peptide, an albumin binding protein, and transferrin.
162. A nucleic acid molecule comprising a nucleotide sequence encoding a mutein of claim 148.
163. A method for the production of the mutein of claim 148, wherein the mutein is produced starting from the nucleic acid coding for the mutein.
164. A pharmaceutical composition comprising one or more mutein(s) of claim 148.
165. A nucleic acid molecule comprising a nucleotide sequence encoding a mutein of claim 149.
166. A method for the production of the mutein of claim 149, wherein the mutein is produced starting from the nucleic acid coding for the mutein.
167. A pharmaceutical composition comprising one or more mutein(s) of claim 149.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0179] The invention is further illustrated by the following non-limiting Examples and the attached drawings in which:
[0180]
[0181]
[0182]
[0183]
[0184]
[0185]
[0186]
[0187]
[0188]
[0189]
[0190]
[0191]
[0192]
[0193]
[0194]
[0195]
[0196]
[0197]
[0198]
[0199]
[0200]
[0201]
[0202]
[0203]
[0204]
[0205]
[0206]
[0207]
[0208]
[0209]
[0210]
[0211]
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236]
[0237]
[0238]
[0239]
[0240]
[0241]
[0242]
[0243]
[0244]
[0245]
[0246]
[0247]
[0248]
[0249]
[0250]
EXAMPLES
[0251] Unless otherwise indicated, established methods of recombinant gene technology were used, for example, as described in Sambrook et al. (supra).
Example 1: Generation of a Library with 210.SUP.9 .Independent Tlc Muteins
[0252] A random library of tear lipocalin (Tlc) with high complexity was prepared by concerted mutagenesis of the 18 selected amino acid positions 26, 27, 28, 29, 30, 31, 32, 33, 34, 56, 57, 58, 80, 83, 104, 105, 106, and 108 of the mature wild type human tear lipocalin. To this end, a gene cassette wherein the corresponding codons were randomized in a targeted fashion was assembled via polymerase chain reaction (PCR) with degenerate primer oligodeoxynucleotides in two steps according to a strategy described before (Skerra, A. (2001) Anticalins: a new class of engineered-ligand-binding proteins with antibody-like properties. J. Biotechnol. 74, 257-275). In this library design the first 4 N-terminal amino acid residues (HHLA) as well as the two last C-terminal amino acid residues (SD) of the wild type sequence of tear lipocalin were deleted (for this reason, all tear lipocalin muteins shown in the attached Sequence Listing have Ala5 of the wild type sequence as N-terminal residue and Gly156 as C-terminal residue (the latter optionally fused to an affinity tag, for example)).
[0253] In the first step of the generation of the random library, a PCR fragment with randomized codons for the first and second exposed loop of Tlc was prepared using primers TL46 (SEQ ID NO:10) and TL47 (SEQ ID NO:11) while another PCR fragment with randomized codons for the third and fourth exposed loop of Tlc was prepared in parallel, using primers TL48 (SEQ ID NO:12) and TL49 (SEQ ID NO:13). In the second step these two PCR fragments were combined with a connecting oligodeoxynucleotide and used as templates in a PCR reaction with primers AN-14 (SEQ ID NO:14), TL50 bio (SEQ ID NO:15) and TL51 bio (SEQ ID NO:16) to yield the assembled randomized gene cassette.
[0254] The two PCR reactions (1a and 1b) for the first step were each performed in a volume of 100 l using 10 ng pTLPC10 plasmid DNA (
[0255] For the second PCR step a 1000 l mixture was prepared, wherein approximately 500 fmol of both fragments from PCR reactions 1a and 1b were used as templates in the presence of 500 pmol of each of the flanking primers TL50 bio (SEQ ID NO:15) and TL51 bio (SEQ ID NO:16) and 10 pmol of the mediating primer AN-14 (SEQ ID NO:14). Both flanking primers carried a biotin group at their 5-ends, thus allowing the separation of the PCR product after BstXI cleavage from incompletely digested product via streptavidin-coated paramagnetic beads. In addition, the reaction mix contained 100 l 10Taq buffer, 20 l dNTP-Mix (10 mM dATP, dCTP, dGTP, dTTP), 50 u Taq DNA polymerase (5 u/l, Promega) and water to bring it to the final volume of 1000 l. The mixture was divided into 100 l aliquots and PCR was performed with 20 cycles of 1 minute at 94 C., 1 minute at 57 C., 1.5 minutes at 72 C., followed by a final incubation for 5 minutes at 60 C. The PCR product was purified using the E.Z.N.A. Cycle-Pure Kit (PeqLab).
[0256] For subsequent cloning, this fragment representing the central part of the library of Tlc muteins in nucleic acid form was first cut with the restriction enzyme BstXI (Promega) according to the instructions of the manufacturer and then purified by preparative agarose gel electrophoresis as described above, resulting in a double-stranded DNA-fragment of 301 base pairs in size.
[0257] DNA fragments not or incompletely digested were removed via their 5-biotin tags using streptavidin-coated paramagnetic beads (Merck). To this end, 150 l of the commercially available suspension of the streptavidin-coated paramagnetic particles (at a concentration of 10 mg/ml) was washed three times with 100 l TE buffer (10 mM Tris/HCl pH 8.0, 1 mM EDTA). The particles were then drained with the help of a magnet and mixed with 70 pmol of the digested DNA fragment in 100 l TE buffer for 15 minutes at room temperature. The paramagnetic particles were then collected at the wall of the Eppendorf vessel with the aid of a magnet and the supernatant containing the purified, fully digested DNA fragment was recovered for use in the following ligation reaction.
[0258] The vector pTLPC27 (
[0259] For the ligation reaction, 40 pmol of the PCR fragment and 40 pmol of the vector fragment (pTLPC27) were incubated in the presence of 1074 Weiss Units of T4 DNA ligase (Promega) in a total volume of 10.76 ml (50 mM Tris/HCl pH 7.8, 10 mM MgCl.sub.2, 10 mM DTT, 1 mM ATP, 50 g/ml BSA) for 48 h at 16 C. The DNA in the ligation mixture was then precipitated 1.5 h by adding 267 l yeast tRNA (10 mg/ml solution in H.sub.2O (Roche)), 10.76 ml 5 M ammonium acetate, and 42.7 ml ethanol. After precipitation, the DNA pellet was washed with 70% EtOH and then dried. At the end the DNA was dissolved to a final concentration of 200 g/ml in a total volume of 538 l of water.
[0260] The preparation of electrocompetent bacterial cells of E. coli strainXL1-Blue (Bullock et al., supra) was carried out according to the methods described by Tung and Chow (Trends Genet. 11 (1995), 128-129) and by Hengen (Trends Biochem. Sci. 21 (1996), 75-76). 11 LB medium (10 g/L Bacto Tryptone, 5 g/L Bacto Yeast Extract, 5 g/L NaCl, pH 7.5) was adjusted to an optical density at 600 nm of OD.sub.600=0.08 by addition of an overnight culture of XL1-Blue and was incubated at 140 rpm and 26 C. in a 21 Erlenmeyer flask. After reaching an OD.sub.600=0.6, the culture was cooled for 30 minutes on ice and subsequently centrifuged for 15 minutes at 4000 g and 4 C. The cells were washed twice with 500 ml ice-cold 10% w/v glycerol and finally re-suspended in 2 ml of ice-cold GYT-medium (10% w/v glycerol, 0.125% w/v yeast extract, 0.25% w/v tryptone). The cells were then aliquoted (200 l), shock-frozen in liquid nitrogen and stored at 80 C.
[0261] Electroporation was performed with a Micro Pulser system (BioRad) in conjunction with cuvettes from the same vendor (electrode distance 2 mm) at 4 C. Aliquots of 10 l of the ligated DNA solution (containing 1 g DNA) was mixed with 100 l of the cell suspension, first incubated for 1 minute on ice, and then transferred to the pre-chilled cuvette. Electroporation was performed using parameters of 5 ms and 12.5 kV/cm field strength and the suspension was immediately afterwards diluted in 2 ml ice-cold SOC medium (20 g/L Bacto Tryptone, 5 g/L Bacto Yeast Extract, 10 mM NaCl, 2.5 mM KCl, pH 7.5, autoclaved, before electroporation 10 ml/L 1 M MgCl.sub.2 and 1 M MgSO.sub.4 with 20 ml/L 20% Glucose were added), followed by incubation for 60 min at 37 C. and 140 rpm. After that, the culture was diluted in 2 L 2YT medium (16 g/L Bacto Tryptone, 10 g/L Bacto Yeast Extract, 5 g/L NaCl, pH 7.5) containing 100 g/ml chloramphenicol (2 YT/Cam), resulting in an OD.sub.550 of 0.26. The culture was incubated at 37 C. until the OD.sub.550 had risen again by 0.6 units.
[0262] By employing a total of 107.6 g ligated DNA in 54 electroporation runs, a total of about 2.010.sup.9 transformants were obtained. The transformants were further used for the preparation of phagemids coding for the library of the Tlc muteins as fusion proteins.
[0263] For preparation of the phagemid library, 41 of the culture from above were infected with 1.310.sup.12 pfu VCS-M13 helper phage (Stratagene). After agitation at 37 C. for 45 min the incubation temperature was lowered to 26 C. After 10 min of temperature equilibration 25 g/l anhydrotetracycline was added in order to induce gene expression for the fusion protein between the Tlc muteins and the phage coat protein. Phagemid production was allowed for 11 h at 26 C. After removal of the bacteria by centrifugation the phagemids were precipitated from the culture supernatant twice with 20% (w/v) polyethylene glycol 8000 (Fluka), 15% (w/v) NaCl and finally dissolved in PBS (4 mM KH.sub.2PO.sub.4, 16 mM Na.sub.2HPO.sub.4, 115 mM NaCl).
Example 2: Phagemid Presentation and Selection of Tlc Muteins with Affinity for IL-4 Receptor Alpha
[0264] Phagemid display and selection was performed employing the phagemids obtained from Example 1 essentially as described in WO 2006/56464 Example 2 with the following modifications: The target protein (IL-4 receptor alpha, Peprotech) was employed at a concentration of 200 nM and was presented to the library as biotinylated protein with subsequent capture of the phage-target complex using streptavidin beads (Dynal). Alternatively, the target protein was employed as Fc-fusion protein (IL-4 receptor alpha-Fc, R&D Systems) at a concentration of 200 nM and subsequent capture of the phage-target complex using protein G beads (Dynal) and by immobilization of Fc-fusion protein on anti-human Fc capture antibody (Jackson Immuno Research) coated immunosticks (Nunc) according to the instructions of the manufacturer. Three or four rounds of selection were performed.
Example 3: Identification of IL-4 Receptor Alpha-Specific Muteins Using High-Throughput ELISA Screening
[0265] Screening of the muteins selected according to Example 2 was performed essentially as described in Example 3 of WO 2006/56464 with the following modifications: Expression vector was pTLPC10 (
[0266] Screening 5632 clones, selected as described in Example 2, lead to the identification of 2294 primary hits indicating that successful isolation of muteins from the library had taken place. Using this approach the clone S148.3 J14 (SEQ ID NO:2) was identified. The sequence of S148.3 J14 is also depicted in
Example 4: Affinity Maturation of the Mutein S148.3 J14 Using Error-Prone PCR
[0267] Generation of a library of variants based on the mutein S148.3 J14 (SEQ ID NO:2) was performed essentially as described in Example 5 of WO 2006/56464 using the oligonucleotides TL50 bio (SEQ ID NO:15) and TL51 bio (SEQ ID NO:16) resulting in a library with 3 substitutions per structural gene on average.
[0268] Phagemid selection was carried out as described in Example 2 but employing limited target concentration (2 nM, 0.5 nM and 0.1 nM of IL-4 receptor alpha, Peprotech Ltd), extended washing times together with an antagonistic monoclonal antibody against IL-4 receptor alpha (MAB230, R&D Systems; 1 hour washing time and 2 hours washing time) or short incubation times (30 seconds, 1 minute and 5 minutes). Three or four rounds of selection were performed.
Example 5: Affinity Maturation of the Mutein S148.3 J14 Using a Site-Directed Random Approach
[0269] A library of variants based on the mutein S148.3 J14 (SEQ ID NO:2) was designed by randomization of the positions 34, 53, 55, 58, 61, 64 and 66 to allow for all 20 amino acids on these positions. The library was constructed essentially as described in Example 1 with the modification that the deoxynucleotides TL70 (SEQ ID NO:17), TL71 (SEQ ID NO:18) and TL72 (SEQ ID NO:19) were used instead of TL46, TL47, and AN-14, respectively.
[0270] Phagemid selection was carried out as described in Example 2 using limited target concentration (0.5 nM and 0.1 nM of IL-4 receptor alpha, Peprotech) combined with extended washing times together with a competitive monoclonal antibody against IL-4 receptor alpha (MAB230, R&D Systems; 1 hour washing) or short incubation times (10 minutes), respectively. Three or four rounds of selection were performed.
Example 6: Affinity Screening of IL-4 Receptor Alpha-Binding Muteins Using High-Throughput ELISA Screening
[0271] Screening was performed as described in Example 3 with the modification that a concentration of 3 nM IL-4 receptor alpha-Fc (R&D Systems) was used and the additions that i) a monoclonal anti-Strep tag antibody (Qiagen) was coated onto the ELISA plate in order to capture the produced muteins and binding of IL-4 receptor alpha-Fc (R&D Systems, 3 nM and 0.75 nM) to the captured muteins of tear lipocalin was detected using a HRP (horseradish peroxidase)-conjugated poly clonal antibody against the Fc domain of IL-4 receptor alpha-Fc. Additionally in an alternative screening setup ii) IL-4 was coated onto the ELISA plate and IL-4 receptor alpha-Fc (R&D Systems, 3 nM) was incubated with the expressed muteins and binding of IL-4 receptor alpha-Fc with an unoccupied IL-4 binding site was detected using a HRP-conjugated polyclonal antibody against the Fc domain of IL-4 receptor alpha-Fc.
[0272] A result from such a screen is depicted in
Example 7: Production of IL-4 Receptor Alpha-Binding Muteins
[0273] For preparative production of IL-4 receptor alpha-specific muteins, E. coli K12 strain JM83 harbouring the respective mutein encoded on the expression vector pTLPC10 (
[0274] The muteins were purified from the periplasmic fraction in a single step via streptavidin affinity chromatography using a column of appropriate bed volume according to the procedure described by Skerra, A. & Schmidt, T. G. M. (2000) (Use of the Strep-tag and streptavidin for detection and purification of recombinant proteins. Methods Enzymol. 326A, 271-304). To achieve higher purity and to remove any aggregated recombinant protein, a gel filtration the muteins was finally carried out on a Superdex 75 HR 10/30 column (24-ml bed volume, Amersham Pharmacia Biotech) in the presence of PBS buffer. The monomeric protein fractions were pooled, checked for purity by SDS-PAGE, and used for further biochemical characterization.
Example 8: Affinity Measurement Using Biacore
[0275] Affinity measurements were performed essentially as described in Example 9 of WO 2006/56464 with the modifications that approximately 400 RU of IL-4 receptor alpha-Fc (R&D Systems) was immobilized (instead of 2000 RU of human CTLA-4 or murine CTLA-4-Fc used as target in WO 2006/56464) and 100 l of mutein was injected at a concentration of 25 nM (instead of 40 l sample purified lipocalin muteins at concentrations of 5-0.3 M as used in WO 2006/56464).
[0276] Results from the affinity measurements employing S148.3 J14, S191.5 K12, S191.4 B24, S191.4 K19, S191.5 H16, S197.8 D22 and S148.3 J14AM2C2 are depicted in
TABLE-US-00001 TABLE I Affinities of selected muteins of the invention for IL-4 receptor alpha as determined by Biacore. Averages (standard deviation) of five experiments are shown. Affinity Biacore k.sub.on k.sub.off Clone (pM) (1/Ms 10.sup.5) (1/s 10.sup.5) S148.3 J14 37500 1.4 517 S191.5 K12 13.5 (2.9) 58 (27) 7.7 (3.3) S148.3 AM2C2 17.9 (2.7) 23 (1.7) 4.2 (0.7) S191.4 B24 19.3 (3.3) 26 (6.7) 4.9 (1.0) S191.4 K19 20.1 (14) 17 (2.7) 3.6 (2.8) S191.5 H16 24.3 (12) 17 (1.8) 4.1 (1.6) S197.8 D22 55.8 (4.2) 11 (1.3) 6.3 (1.0)
Example 9: Identification of Antagonists of IL-4 Using an Inhibition ELISA
[0277] Inhibition of the interaction between IL-4 and IL-4 receptor alpha by the selected muteins was evaluated in an inhibition ELISA. Therefore, a constant concentration of IL-4 receptor alpha (0.5 nM biotinylated IL-4 receptor alpha, Peprotech, or 15 nM IL-4 receptor alpha-Fc, R&D Systems) was incubated with a dilution series of tear lipocalin mutein and the amount of IL-4 receptor alpha with an unoccupied IL-4 binding site was quantified in an ELISA where the plate had been coated with IL-4 or an antagonistic anti IL-4 receptor alpha monoclonal antibody. Bound biotinylated IL-4 receptor alpha was detected using HRP-conjugated Extravidin (Sigma) and compared to a standard curve of defined amounts of biotinylated IL-4 receptor alpha. Results from measurements employing the muteins of S148.3 J14, S191.5 K12, S191.4 B24, S191.4 K19, S191.5 H16, S197.8 D22 and S148.3 J14AM2C2 are depicted in
TABLE-US-00002 TABLE II Antagonistic ability and affinities for IL-4 receptor alpha of selected tear lipocalin muteins of the invention as determined by competition ELISA. Averages (standard deviation) of three experiments are shown. Clone Affinity Competition ELISA (pM) S148.3 J14 17300 S191.5 K12 25.3 (9.9) S148.3 AM2C2 40.7 (14.8) S191.4 B24 49.2 (14) S191.4 K19 120 (32) S191.5 H16 61.7 (11.4) S197.8 D22 140 (37)
Example 10: Identification of Antagonists of IL-4 and IL-13 Signalling Using a TF-1 Proliferation Assay
[0278] IL-4 and IL-13-stimulated TF-1 cell proliferation assays were performed essentially as described in Lefort et al. (Lefort S., Vita N., Reeb R., Caput D., Ferrara P. (1995) FEBS Lett. 366(2-3), 122-126). The results from a TF-1 proliferation assay is depicted in
Example 11: Anti-IL-4 Receptor Alpha Muteins of Human Tear Lipocalin Inhibit the STAT6 Mediated Pathway
[0279] TF-1 cells were cultured in RPMI 1640 containing 10% heat-inactivated fetal calf serum, 2 mM L-glutamine, 100 Units/ml penicillin, 100 g/ml streptomycin and supplemented with 2 ng/ml recombinant human granulocyte-macrophage colony-stimulating factor. The cells were seeded at 510.sup.4 cells/ml in a total volume of 20 ml medium in 100 mm diameter tissue culture dishes, split and reseeded at this concentration every 2 to 3 days and cultured at 37 C. in a humidified atmosphere of 5% CO.sub.2.
[0280] TF-1 cells were harvested by centrifugation at 1200 rpm for 5 min and washed twice by centrifugation at 1200 rpm for 5 min in RPMI 1640 containing 1% heat-inactivated fetal calf serum, 2 mM L-glutamine, 100 Units/ml penicillin and 100 g/ml streptomycin (RPMI-1% FCS). Cells were resuspended at 110.sup.6 cells/ml in RPMI-1% FCS, plated out at 1 ml in 24 well plates and cultured overnight. On the following day, TF-1 cells were cultured for 1 hr with 20 g/ml of IL-4 receptor alpha-specific muteins or with negative control muteins. Further aliquots of cells were cultured with medium alone for 1 hr at 37 C. in a humidified atmosphere of 5% CO.sub.2 in air. Subsequently, human recombinant IL-4 or IL-13 was added at a final concentration of 0.8 ng/ml or 12 ng/ml respectively and the cultures were incubated for 10 min at 37 C. in a humidified atmosphere of 5% CO.sub.2 in air.
[0281] Cells were fixed for 10 min at room temperature (RT) by the addition of 42 l of 37% formaldehyde (1.5% final concentration) and transferred to 5 ml round bottomed polystyrene tubes (BD Falcon). Cells were washed with 2 ml PBS containing 1% FCS (PBS-FCS), pelleted by centrifugation at 1200 rpm for 5 min and the supernatant was discarded. Cells were permeabilized by the addition of 500 l ice-cold methanol whilst vortexing vigorously. After 10 min incubation at 4 C. the cells were washed twice by centrifugation at 1200 rpm for 5 min with 2 ml of PBS-FCS. The cells were resuspended in 100 l of PBS-FCS and stained with 20 l of anti-phosphorylated STAT-6 phycoerythrin (PE)-labelled antibody (clone Y641; BD Biosciences) for 30 min at RT protected from light. Finally, the cells were washed twice with 2 ml of PBS-FCS by centrifugation at 1200 rpm for 5 min and resuspended in 500 l of PBS-FCS. The cells were analyzed by flow cytometry using a FACScalibur cytometer (BD Biosciences). Data were collected from at least 10000 gated cells.
[0282] The ability of the IL-4 receptor alpha-specific muteins S191.4 B24 (SEQ ID NO: 5) and S191.4 K19 (SEQ ID NO: 6) to inhibit IL-4 and IL-13 mediated STAT-6 phosphorylation in TF-1 cells was measured by flow cytometry. A gate was set on intact cells to exclude 99% of the control unstained population on the basis of FL2 values (channel 2 fluorescence; PE intensity) using control TF-1 cells (unstimulated and unstained) on the basis of cell size (forward scatter; FSC) and cell granularity (side scatter; SSC). A further aliquot of unstimulated cells was stained with anti-phosphorylated STAT-6 PE-labelled antibody.
[0283] Results of the STAT-6 phosphorylation assay clearly show that the IL-4 receptor alpha-specific muteins S191.4 B24 and S191.4 K19 markedly inhibit IL-4 and IL-13 induced STAT-6 phosphorylation in TF-1 cells (data summarized in Table III).
TABLE-US-00003 TABLE III Ability of S191.4 B24 and S191.4 K19 (SEQ ID NO: 5 and 6) to inhibit STAT-6-phosphorylation-induced in TF-cells by IL-4 and IL-13 was measured by flow cytometry. The percentage of gated cells staining positive for STAT-6 phosphorylation and the median fluorescence intensity (MFI) of all gated cells are depicted. Treatment % Positive MFI Unstained 1 3.8 Stained unstimulated 6 5.8 IL-4 75 15.8 IL-13 77 16.4 pTLPC10 + IL-4 72 13.1 (neg control) pTLPC10 + IL-13 84 18.6 (neg control) S191.4 K19 + IL-4 6 4.9 S191.4 K19 + IL-13 8 5.0 S191.4 B24 + IL-4 6 4.8 S191.4 B24 + IL-13 11 5.5
Example 12: Anti-Human IL-4 Receptor Alpha Muteins are Cross-Reactive Against Cynomolgus Peripheral Blood Lymphocytes
[0284] Whole blood from healthy human volunteers was collected by the clinical pharmacology unit (CPU) at Astra Zeneca (Macclesfield, UK) in 9 ml lithium-heparin tubes. Samples of heparinized whole blood from cynomolgus (pooled from a minimum of two animals) were obtained from Harlan Sera-Lab (Bicester, UK) or B and K Universal Ltd (Hull, UK).
[0285] Human and cynomolgus whole blood was diluted 1:5 with erythrocyte lysis buffer (0.15 M NH.sub.4Cl, 1.0 mM KHCO.sub.3, 0.1 mM EDTA, pH 7.2-7.4) and following inversion incubated at room temperature for 10 min. Cells were centrifuged at 1200 rpm for 5 min and supernatant removed. Cells were resuspended in lysis buffer and the procedure repeated until the supernatant no longer contained hemoglobin. Cells were re-suspended in the same volume of freezing medium (1:10, dimethyl sulfoxide:fetal calf serum) as the original volume of blood and transferred to cryogenic vials. Each vial contained the cells from 1 ml of blood. Cells were frozen overnight at 80 C. and transferred to liquid nitrogen for storage.
[0286] Frozen peripheral blood cells were rapidly thawed at 37 C. and washed with FACS buffer (PBS/1% FCS). Cell pellets were re-suspended in FACS buffer (1 ml buffer/vial). 100 l aliquots were placed into 96 well round-bottomed plates, 100 l of FACS buffer added per well, the plates centrifuged at 1200 rpm for 5 min at 4 C. and the supernatant discarded. Subsequently, cells were resuspended by vortexing at low speed and 100 l of diluted primary antibody (anti-CD124 or IgG1 isotype control, eBioscience, 10 g/ml) or anti-IL-4 receptor alpha muteins (10 g/ml) were added and cells were incubated on ice for 30 min. Cells were washed once by the addition of 100 l FACS buffer and centrifugation at 1200 rpm for 5 min at 4 C., the supernatant was discarded and the cells were resuspended by vortexing at low speed. This was repeated twice more using 200 l of FACS buffer to wash cells. After the final centrifugation the cell pellet was re-suspended in 100 l of the appropriate secondary antibody at 5 g/ml (biotinylated anti-human lipocalin-1 antibody (R&D Systems) or biotinylated rat anti-mouse IgG (Insight Biotechnology Ltd)) and cells were incubated on ice for 30 min. Cells were washed once in 100 l of FACS buffer by centrifugation at 1200 rpm for 5 min at 4 C., the supernatant discarded and cells resuspended by vortexing at low speed. Two further washes were performed using 200 l of FACS buffer and centrifugation at 1200 rpm for 5 min at 4 C. After the final centrifugation the cell pellet was re-suspended in 100 l of the detection reagent (phycoerthyrin [PE]-labelled streptavidin (eBioscience); 1.25 g/ml) and incubated for 30 min on ice in the dark. After three further wash steps as before, the cells were taken up in 200 l FACS buffer, transferred into 406 mm test tubes and analyzed by flow cytometry using a FACScalibur cytometer. Control cells were unstained. Using the unstained control cells, an intact lymphocyte cell gate was set on cell size (forward scatter; FSC) and cell granularity (side scatter; SSC) (Chrest, F. J. et al. (1993). Identification and quantification of apoptotic cells following anti-CD3 activation of murine G0 T cells. Cytometry 14: 883-90). This region was unaltered between samples analyzed on the same day. A marker was drawn to discriminate between IL-4 receptor alpha.sup.+ and IL-4 receptor alpha.sup. populations, based on FL2 (channel 2 fluorescence; PE intensity) values in the control unstained population; marker 1 (M1) IL-4R.sup.+ cells was set on the basis of exclusion of 99% of the unstained population. For each sample, data from at least 110.sup.4 cells were acquired.
[0287] Muteins S191.5 K12, S.148.3 J14-AM2C2, S.191.4 B24, S.191.4 K19, and S.197.8 D22 (SEQ ID NOs: 3-6 and 8) displayed high levels of binding to cynomolgus lymphocytes, IL-4 receptor alpha.sup.+ cells varied between 61% and 80% and MFI values varied between 6.0 and 9.2 (Table 2). Variant 5.191.5 H16 (SEQ ID NO: 7) also specifically binds to cynomolgus lymphocytes but with reduced affinity compared to the remaining muteins (41% IL-4 receptor alpha.sup.+ cells; MFI values 4.1).
[0288] In parallel, the ability of these IL-4 receptor alpha-specific muteins to bind to peripheral blood lymphocytes from one human donor was also analyzed by flow cytometry. All anti-IL-4 receptor alpha muteins exhibited considerably higher levels of binding to human cells than those observed for the pTLPC10 negative control. IL-4 receptor alpha.sup.+ cells varied between 60% and 76% and MFI values varied between 7.4 and 9.7. Cells stained with pTLPC10 negative control displayed low levels of nonspecific binding, with 9% cells recorded as IL-4 receptor alpha.sup.+ with MFI values of 3.2. Muteins S191.5 K12, S.191.4 B24, and S.191.4 K19 (SEQ ID NOs: 3, 5 and 6) displayed similar binding affinity to peripheral blood lymphocyte of a second human donor (data not shown).
TABLE-US-00004 TABLE IV Ability of IL-4 receptor alpha-specific muteins to bind human and cynomolgus peripheral blood lymphocytes, analyzed by flow cytometry. The percentage of gated cells staining positive for IL-4 receptor alpha and the median fluorescence intensity (MFI) of all gated cells are shown. Human peripheral Cynomolgus peripheral blood cells blood cells Treatment % Positive MFI % Positive MFI Unstained 1 2.4 1 1.7 pTLPC10 9 3.2 5 1.9 (neg control) S.191.4 K19 72 8.9 65 6.6 S.191.5 K12 74 9.7 78 9.0 S.191.4 B24 74 9.3 80 9.2 S.148.3 76 9.6 68 6.8 J14-AM2C2 S.191.5 H16 72 9.0 42 4.1 S.197.8 D22 72 9.3 70 7.1
Example 13: Phagemid Presentation and Selection of Tlc Muteins with Affinity for Human VEGF
[0289] Phagemid display and selection employing the phagemids obtained from Example 1 was performed essentially as described in Example 2 with the following modifications: The target protein, i.e. a recombinant fragment of human VEGF-A (VEGF.sub.8-109, amino acids 8-109 of the mature polypeptide chain) was employed at a concentration of 200 nM and was presented to the phagemid library as biotinylated protein with subsequent capture of the phage-target complex using streptavidin beads (Dynal) according to the instructions of the manufacturer. Four rounds of selection were performed.
[0290] The target protein was obtained by introducing the nucleic acids coding for amino acids 8 to 109 of the mature polypeptide chain of human VEGF A (SWISS PROT Data Bank Accession No. P15692) into the expression vector pET11c (Novagen). Therefore, BamHI and NdeI restriction sites were introduced at the 3 and the 5 end of the cDNA of the human VEGF fragment, respectively, and used for subcloning of the VEGF gene fragment.
[0291] E. coli BL21(DE3) was transformed with the resulting expression plasmid and cytoplasmic production of VEGF.sub.8-109 was achieved after induction of an expression culture in ampicillin-containing LB medium with IPTG for 3 h at 37 C. After centrifugation at 5000 g for 20 min the cell pellet was resuspended in 200 ml PBS for each 2 l of culture broth and again centrifuged at 5000 g for 10 min prior to incubation at 20 C. over night. Each cell pellet obtained from 500 ml culture broth was resuspended in 20 ml 20 mM Tris-HCl (pH 7.5), 5 mM EDTA and sonificated on ice, four times for 10 seconds. After centrifugation for 10 min with 10000 g at 4 C., inclusion bodies were solubilized with 15 ml pre-chilled IB buffer (2 M urea, 20 mM Tris-HCl (pH 7.5), 0.5 M NaCl), sonificated and centrifuged as above. Afterwards, the cell pellets were solubilized with 20 ml IB buffer and again centrifuged like above prior to solubilization in 25 ml solubilization buffer (7.5 M urea, 20 mM Tris-HCl (pH 7.5), 4 mM DTT). The cell suspension was stirred for 2 h at ambient temperature, centrifuged at 40000 g for 15 min at 4 C. and the supernatant containing the recombinant VEGF was filtrated (0.45 m). Refolding was achieved by dialysis (3.5 kDa molecular weight cut-off) at ambient temperature over night against 51 buffer 1 (20 mM Tris-HCl (pH 8.4), 400 mM NaCl, 1 mM Cystein) followed by dialysis against 5 l buffer 2 (20 mM Tris-HCl (pH 8.4), 1 mM Cystein) and 2 subsequent dialysis steps with 5 l buffer 3 (20 mM Tris-HCl (pH 8.4)). After centrifugation (40000 g, 20 min, 4 C.) and concentration the recombinant VEGF fragment was purified according to standard methodologies by subsequent ion exchange chromatograpy (Q-Sepharose) and size exclusion chromatography (Superdex 75).
Example 14: Identification of VEGF-Binding Muteins Using a High-Throughput ELISA Screen
[0292] Screening of the Tlc muteins obtained in Example 13 was performed essentially as described in Example 3 with the modification that the recombinant target protein VEGF.sub.8-109 obtained from Example 11 was employed at 5 g/ml and was directly coated to the microtitre plate. Screening of altogether 2124 clones lead to the identification of 972 primary hits indicating that successful isolation of muteins from the library had taken place. Using this approach the Tlc mutein S168.4-L01 (SEQ ID NO:26) was identified.
Example 15: Affinity Maturation of Tlc Mutein S168.4-L01 Using Error-Prone PCR
[0293] Generation of a library of variants based on mutein S168.4-L01 was performed essentially as described in Example 4 using the oligonucleotides TL50 bio (SEQ ID NO:15) and TL51 bio (SEQ ID NO:16) resulting in a library with 5 substitutions per structural gene on average.
[0294] Phagemid selection was carried out as described in Example 13 using limited target concentration (10 nM, 1 nM and 0.2 nM VEGF.sub.8-109), or short incubation times (1 and 5 minutes) with and without limiting target concentrations (10 nM, 100 nM). Four rounds of selection were performed.
Example 16: Affinity Screening of VEGF-Binding Muteins Using a High-Throughput ELISA Screen
[0295] Screening of the muteins selected in Example 15 was performed as described in Example 14 with the modification that a monoclonal anti-T7 tag antibody (Novagen) was coated onto the ELISA plate in order to capture the produced muteins and binding of biotinylated VEGF.sub.8-109 (500 nM and 50 nM) to the captured Tlc muteins was detected using HRP-conjugated Extravidin.
[0296] A large number of clones were identified having improved affinity as compared to the mutein S168.4-L01, which served as the basis for affinity maturation. Using this approach clones S209.2-C23, S209.2-D16, S209.2-N9, S209.6-H7, S209.6-H10, S209.2-M17, S209.2-O10 (SEQ ID NOs:27-33) were identified.
Example 17: Production of VEGF Binding Muteins
[0297] Production was performed essentially as described in Example 7.
Example 18: Affinity Determination of VEGF-Specific Muteins Employing Biacore
[0298] Affinity measurements were performed essentially as described in Example 8 with the modification that approximately 250 RU of recombinant VEGF was directly coupled to the sensor chip using standard amine chemistry. 40 l of the Tlc muteins obtained from Example 15 was injected at a concentration of 400 nM.
[0299] Results from the affinity determinations of the muteins S209.2-C23, S209.2-D16, S209.2-N9, S209.6-H7, S209.6H10, S209.2-M17 and S209.2-O10 (SEQ ID NOs:27-33) are summarized in Table V.
TABLE-US-00005 TABLE V Affinities of selected muteins of the invention for VEGF as determined by Biacore measurements at 25 C. k.sub.on k.sub.off Affinity Clone [10.sup.4 1/Ms] [10.sup.5 1/s] [nM] S209.2-C23 3.6 1.3 0.37 S209.2-D16 3.8 3 0.79 S209.2-N9 5.9 7.1 1.2 S209.6-H7 6.4 4.4 0.68 S209.6-H10 4.6 4.4 0.97 S209.2-M17 2.8 2.0 0.72 S209.2-O10 3.2 0.67 0.21
Example 19: Identification of Antagonists of VEGF Using an Inhibition ELISA
[0300] Inhibition of the interaction between VEGF and VEGF Receptor 2 (VEGF-R2) was evaluated in an inhibition ELISA. To this end, a constant concentration of biotinylated VEGF.sub.8-109 (1 nM) was incubated with a dilution series of the respective Tlc mutein and the amount of VEGF with an unoccupied VEGF-R2 binding site was quantified in an ELISA where an anti-VEGF antibody interfering with the VEGF/VEGF-R2 interaction (MAB293, R&D Systems) had been coated. Bound VEGF was detected using HRP-conjugated Extravidin (Sigma) and compared to a standard curve of defined amounts of VEGF. Results from measurements employing muteins S209.2-C23, S209.2-D16, S209.2-N9, S209.6-H7, S209.6-H10, S209.2-M17 and S209.2-O10 (SEQ ID NOs:27-33) are summarized in Table VI.
TABLE-US-00006 TABLE VI Antagonistic ability and affinities for VEGF of selected tear lipocalin muteins of the invention as determined by competition ELISA. Affinity Competition ELISA Clone Ki [nM] S209.2-C23 2.3 S209.2-D16 3.9 S209.2-N9 2.8 S209.6-H7 2.4 S209.6-H10 1.3 S209.2-M17 2.0 S209.2-O10 0.83
Example 20: Identification of VEGF Antagonists Using a HUVEC Proliferation Assay
[0301] Inhibition of VEGF and FGF-2 stimulated HUVEC cell proliferation was assessed essentially as previously described (Korherr C., Gille H, Schafer R., Koenig-Hoffmann K., Dixelius J., Egland K. A., Pastan I. & Brinkmann U. (2006) Proc. Natl. Acad. Sci (USA) 103(11) 4240-4245) with the following modifications: HUVEC cells (Promocell) were grown according to the manufacturer's recommendations and used between passage 2 and 6. On day one, 1.400 cells were seeded in complete medium (Promocell). On the following day, cells were washed and basal medium containing 0.5% FCS, hydrocortisone and gentamycin/amphotericin but no other supplements (Promocell) was added. VEGF-specific mutein S209.2-C23, S209.2-D16, S209.2-N9, S209.6-H7, S209.6-H10, S209.2-M17, S209.2-O10 (SEQ ID NOs:27-33), wildtype tear lipocalin (gene product of pTLPC10; as control) or VEGF-specific therapeutic monoclonal antibody Avastin (Roche; as control) was added in a dilution series at the indicated concentration in triplicate wells and after 30 min either human VEGF165 (R&D Systems) or human FGF-2 (Reliatech) was added. Viability of the cells was assessed after 6 days with CellTiter 96 Aqueous One (Promega) according to the manufacturer's instructions.
[0302] Results from measurements employing muteins 5209.2-C23, S209.2-D16, S209.2-N9, S209.6-H7, S209.6-H10, S209.2-M17 and S209.2-O10 (SEQ ID NOs:27-33) are shown in
Example 21: Phagemid Presentation and Selection of Tlc Muteins Against VEGF-R2
[0303] Phagemid display and selection employing the phagemids obtained from Example 1 was performed essentially as described in Example 2 with the following modifications: Target protein VEGF-R2-Fc (R&D Systems) was employed at a concentration of 200 nM and was presented to the library as Fc-fusion protein with subsequent capture of the phage-target complex using protein G beads (Dynal) according to the instructions of the manufacturer. Four rounds of selection were performed.
Example 22: Identification of VEGF-R2-Binding Muteins Using a High-Throughput ELISA Screen
[0304] Screening was performed essentially as described in Example 3 with the modification that the target protein VEGF-R2-Fc (R&D Systems) was used at a concentration of 2.5 g/ml.
[0305] Screening of 1416 clones, obtained from the procedure described under Example 21 lead to the identification of 593 primary hits indicating that successful isolation of muteins from the library of the invention had taken place. Using this approach the mutein S175.4 H11 (SEQ ID NO:34) was identified.
Example 23: Affinity Maturation of VEGF-R2-Specific Mutein S175.4 H11 Using Error-Prone PCR
[0306] Generation of a library of variants based on the mutein S175.4 H11 was performed essentially as described in Example 4 using the oligodeoxynucleotides TL50 bio (SEQ ID NO:15) and TL51 bio (SEQ ID NO:16) resulting in a library with 2 substitutions per structural gene on average.
[0307] Phagemid selection was carried out as described in Example 21 using limited target concentration (5 nM, 1 nM and 0.2 nM of VEGF-R2-Fc), extended washing times (1 h) in the presence of competing recombinant VEGF.sub.8-109 (100 nM) or short incubation times (2 and 5 minutes) with and without limiting target concentrations (10 nM, 100 nM). Four rounds of selection were performed.
Example 24: Affinity Screening of VEGF-R2-Binding Muteins Using a High-Throughput ELISA Screen
[0308] Screening was performed as described in Example 3 with the modification that monoclonal anti-T7 tag antibody (Novagen) was coated onto the ELISA plate in order to capture the produced Tlc muteins and binding of VEGF-R2-Fc (R&D Systems, 3 nM and 1 nM) to the captured muteins was detected using a HRP-conjugated antibody against the Fc domain of VEGF-R2-Fc.
[0309] A large number of clones were identified having improved affinity compared to the muteins S175.4 H11, which served as the basis for affinity maturation. Using this approach the clones S197.7-N1, S197.2-I18, S197.2-L22, S197.7-B6 and S197.2-N24 (SEQ ID NOs:35-39) were identified.
Example 25: Production of VEGF-R2 Binding Muteins
[0310] Production was performed essentially as described in Example 7.
Example 26: Affinity Determination of VEGF-R2-Specific Muteins Using Biacore
[0311] Affinity measurements were performed essentially as described in Example 8 with the modifications that approximately 500 RU of VEGF-R2-Fc (R&D Systems) was captured and 80 l of mutein was injected at a concentration of 1.5 M.
[0312] Results from the measurements employing S175.4-H11, S197.7-N1, S197.2-I18, S197.2-L22, S197.7-B6 and S197.2-N24 (SEQ ID NOs:35-39) are summarized in Table VII.
TABLE-US-00007 TABLE VII Affinities of selected muteins of the invention for VEGF-R2 as determined by Biacore measurements. k.sub.on k.sub.off Affinity Clone [10.sup.4 1/Ms] [10.sup.5 1/s] [nM] S175.4-H11 0.9 36 35 S197.7-N1 2.1 11 5.5 S197.2-I18 2.7 8.3 3.1 S197.2-L22 1.2 2.4 3.3 S197.7-B6 2.3 13 6 S197.2-N24 2.4 6.4 2.7
Example 27: Identification of Antagonists of VEGF Using an Inhibition ELISA
[0313] Inhibition of the interaction between VEGF and VEGF-R2 by the VEGF-R2-specific muteins was evaluated in an inhibition ELISA. Therefore, a constant concentration of VEGF-R2 (4 nM VEGF-R2-Fc, R&D Systems) was incubated with a dilution series of the respective mutein and the amount of VEGF-R2 with an unoccupied VEGF binding site was quantified in an ELISA where VEGF.sub.8-109 had been coated. Bound VEGF-R2 was detected using HRP-conjugated anti-human Fc antibody (Dianova) and compared to a standard curve of defined amounts of VEGF-R2-Fc. Results from measurements of S175.4-H11, S197.7-N1, S197.2-118, S197.2-L22, S197.7-B6 and S197.2-N24 (SEQ ID NOs:35-39) are summarized in Table VIII.
TABLE-US-00008 TABLE VIII Antagonistic ability and affinities for VEGF-R2 of selected tear lipocalin muteins of the invention as determined by competition ELISA. Affinity competition ELISA Clone Ki [nM] S175.4-H11 12.9 S197.7-N1 12 S197.2-I18 5.5 S197.2-L22 3.5 S197.7-B6 3.8 S197.2-N24 2.3
Example 28: Site-Specific Modification of IL-4 Receptor Alpha-Specific Muteins with Polyethylene Glycol (PEG)
[0314] An unpaired cysteine residue was introduced instead of the amino acid Glu at position 131 of the IL-4 receptor alpha-specific mutein S148.3 J14 (SEQ ID NO:2) by point mutation in order to provide a reactive group for coupling with activated PEG. The recombinant mutein carrying the free Cys residue was subsequently produced in E. coli as described in Example 7.
[0315] For coupling of the mutein S148.3 J14 with PEG, 5.1 mg polyethylene glycol maleimide (average molecular weight 20 kDa, linear carbon chain; NOF) was mixed with 3 mg of the protein in PBS and stirred for 3 h at ambient temperature. The reaction was stopped by the addition of beta-mercaptoethanol to a final concentration of 85 M. After dialysis against 10 mM Tris-HCl (pH 7.4), the reaction mixture was applied to a HiTrap Q-XL Sepharose column (Amersham) and the flow-through was discarded. The PEGylated mutein was eluted and separated from unreacted protein applying a linear salt gradient from 0 mM to 100 mM NaCl.
Example 29: Affinity Measurement of the PEGylated Mutein S148.3 J14 Using Biacore
[0316] Affinity measurements were performed essentially as described in Example 8 with the modifications that approximately 500 RU of IL-4 receptor alpha-Fc (R&D Systems) was immobilized and 80 l of the purified PEGylated mutein was injected at concentrations of 200 nM, 67 nM and 22 nM. The result of the measurement is depicted in
TABLE-US-00009 TABLE IX Affinity of the PEGylated mutein of the invention S148.3 J14 for IL-4 receptor alpha as determined by Biacore. k.sub.on k.sub.off Affinity Clone [10.sup.5 1/Ms] [10.sup.3 1/s] [nM] S148.3 J14-PEG 1.64 4.93 30
Example 30: Affinity Maturation of the Mutein S209.6-H10 Using a Site-Directed Random Approach
[0317] A library of variants based on the mutein S209.6-H10 (SEQ ID NO:30) was designed by randomization of the residue positions 26, 69, 76, 87, 89 and 106 to allow for all 20 amino acids on these positions. The library was constructed essentially as described in Example 1 with the modification that the deoxynucleotides TL107 (covering position 26), TL109 (covering positions 87 and 89), TL110 (covering position 106) and TL111 (covering positions 69 and 76) were used instead of TL46, TL47, TL48 and TL49, respectively. Phagemid selection was carried out essentially as described in Example 13 using either limited target concentration (10 pM and 2 pM and 0.5 pM of VEGF.sub.8-109) or combined with a competitive monoclonal antibody against VEGF (Avastin). Four rounds of selection were performed.
TABLE-US-00010 TL107 (SEQ ID NO: 40) GAAGGCCATGACGGTGGACNNSGGCGCGCTGAGGTGCCTC TL109 (SEQ ID NO: 41) GGCCATCGGGGGCATCCACGTGGCANNSATCNNSAGGTCGCACGTGAA GGAC TL110 (SEQ ID NO: 42) CACCCCTGGGACCGGGACCCCSNNCAAGCAGCCCTCAGAG TL 111 (SEQ ID NO: 43) CCCCCGATGGCCGTGTASNNCCCCGGCTCATCAGTTTTSNNCAGGACGG CCCTCACCTC
Example 31: Affinity Screening of VEGF-Binding Muteins Using High-Throughput ELISA Screening
[0318] Screening was performed as described in Example 14 with the modification that a concentration of 1 g/ml VEGF was used and the additions that [0319] i) a monoclonal anti-T7 tag antibody (Novagen) was coated onto the ELISA plate in order to capture the produced muteins and binding of biotinylated VEGF (3 nM and 1 nM) to the captured muteins of tear lipocalin was detected using a HRP (horseradish peroxidase)-conjugated extravidin. Additionally, in alternative screening setups [0320] ii) instead of human VEGF.sub.8-109 mouse VEGF.sub.164 (R&D Systems) was directly coated to the microtiter plate (1 g/ml). [0321] iii) the extract containing the VEGF-binding muteins was heated to 60 C. for 1 hour. [0322] iv) mAB293 (R&D Systems, 5 g/ml) was coated onto the ELISA plate and biotinylated VEGF.sub.8-109 was preincubated with the expressed muteins. Binding of VEGF.sub.8-109 to mAB293 was detected using HRP (horseradish peroxidase)-conjugated extravidin.
[0323] A large number of clones were identified having improved affinity as compared to the mutein S209.6-H10, which served as the basis for affinity maturation. Using this approach clones S236.1-A22, S236.1-J20, S236.1-M11 and S236.1-L03 (SEQ ID NOs:44-47) were identified.
[0324] In this context it is noted that due to the deletion of the first 4 amino acids of tear lipocalin in the muteins of the invention, the amino acid sequence is depicted starting from sequence position 5 (alanine) of the deposited wild type tear lipocalin sequence of tear lipocalin, so that Ala5 is depicted as N-terminal amino acid. In addition, the C-terminal amino acid Asp158 of the wild type tear lipocalin is replaced by an alanine residue (residue 154 in SEQ ID NO: 44-47, see also the other muteins of the invention such as SEQ ID NO: 26-40). Furthermore, the amino acid sequence of muteins 5236.1-A22, 5236.1-J20, 5236.1-M11 and 5236.1-L03 together with the STREP-TAG II that is fused to the C-terminus of tear lipocalin for the construction of the nave library of Example 1 is shown in SEQ ID NO:52 (S236.1-A22-strep), SEQ ID NO: 53 (S236.1-J20-strep), SEQ ID NO: 54 (S236.1-M11-strep) and SEQ ID NO: 55 (S236.1-L03-step). Also this illustrates the variability of the sequence of tear lipocalin muteins of the invention apart from the indicated mutated positions/mutations that are necessary to provide the respective mutein with the ability to specifically bind the given target such as VEGF, or VEGF-R2 or interleukin 4 receptor alpha chain (IL-4 receptor alpha).
Example 32: Production of VEGF Binding Muteins
[0325] Production was performed essentially as described in Example 7.
Example 33: Affinity Determination of VEGF-Specific Muteins Employing Biacore
[0326] Affinity measurements were performed essentially as described in Example 18. (See also
TABLE-US-00011 TABLE X Affinities of selected muteins of the invention for VEGF as determined by Biacore measurements at 25 C. k.sub.on k.sub.off Affinity Mutein [10.sup.4 1/Ms] [10.sup.5 1/s] [nM] S236.1-A22 8.8 2.2 0.25 S236.1-J20 7.9 2.2 0.28 S236.1-L03 6.8 4.4 0.64 S236.1-M11 7.3 2.3 0.31
Example 34: Identification of Antagonists of VEGF Using an Inhibition ELISA
[0327] Inhibition of the interaction between VEGF and VEGF Receptor 2 (VEGF-R2) was evaluated in an inhibition ELISA essentially as described in Example 19 with the modification that the incubation time of 1 hour was reduced to 10 minutes. Inhibition constants are summarized in the following Table:
TABLE-US-00012 TABLE XI Antagonistic ability and affinities for VEGF of selected tear lipocalin muteins of the invention as determined by competition ELISA. Affinity Competition ELISA Mutein Ki [nM] S236.1-A22 5.8 S236.1-J20 6.3 S236.1-L03 9.4 S236.1-M11 6.4
Example 35: Determination of Cross-Reactivity of VEGF-Specific Muteins S236.1-A22 Using Biacore
[0328] Affinity measurements were performed essentially as described in Example 18 with the modification that mutein S236.1-A22 (SEQ ID NO:44) was immobilized on the sensor chip. 70 l of sample was injected at a concentration of 250 nM.
[0329] The qualitative comparison of the results as shown in
Example 36: Determination of Thermal Denaturation for VEGF-Binding Muteins by Use of CD Spectroscopy
[0330] Circular dichroism measurements were performed essentially as described in Example 14 of the International patent application WO2006/056464, with the modification that the wavelength used was 228 nM. The melting temperature T.sub.m of the tear lipocalin mutein S236.1-A22 (SEQ ID NO:44) for example was determined to be 75 C.
Example 37: Stability Test of S236.1-A22
[0331] Stability of VEGF-binding mutein S236.1-A22 at 37 C. in PBS and human serum was tested essentially as described in Example 15 of the International patent application WO2006/056464 except that the concentration utilized was 1 mg/ml. No alteration of the mutein could be detected during the seven day incubation period in PBS as judged by HPLC-SEC (data not shown). Incubation of the lipocalin mutein in human serum resulted in a drop of affinity after 7 days to approx. 70% compared to the reference (See also
Example 38: Fusion of Anti-VEGF Muteins with an Albumin-Binding Domain
[0332] For serum half-life extension purposes anti-VEGF muteins were C-terminally fused with an albumin-binding domain (ABD). The genetic construct used for expression is termed pTLPC51_S236.1-A22 (SEQ ID NO:50). (See
[0333] The preparative production of VEGF-specific mutein-ABD fusions or Tlc-ABD (as control) was performed essentially as described in Example 7.
[0334] Affinity measurements using surface plasmon resonance (Biacore) were performed essentially as described in Example 18. The affinity of the ABD-fusion of tear lipocalin mutein S236.1-A22 (A22-ABD) (SEQ ID NO: 51) (200 pM) towards recombinant VEGF was found basically unaltered and measured to be 260 pM (see
[0335] Additionally, the integrity of the ABD-domain was tested by the same method, as described in Example 8, with the modification that approximately 850 RU of human serum albumin was directly coupled to the sensor chip using standard amine chemistry. 60 l of mutein-ABD fusions (A22-ABD (SEQ ID NO: 51) or wildtype Tlc-ABD (SEQ ID NO:49)) were injected at a concentration of 500 nM. Their affinity was measured to be approx. 20 nM
[0336] The stability of the ABD-fusion of S236.1-A22 (SEQ ID NO: 51) in human serum was tested essentially as described in Example 37. No loss of activity could be detected during the seven day incubation period. (See
[0337] The functionality of the lipocalin mutein A22-ABD (ABD-fusion of S236.1-A22) in the presence of human serum albumin was tested by its abitity to inhibit VEGF induced HUVEC proliferation. The assay was performed as described in Example 39 except that human serum albumin (HSA, 5 M) was added where indicated. At 5 M HSA, .fwdarw.99.8% of A22-ABD is associated with HSA at any given time due to the nanomolar affinity of A22-ABD for HSA (see
S236.1-A22-ABD IC50: 760 pM
S236.1-A22-ABD (+HSA) IC50: 470 pM
Example 39: Inhibition of VEGF Induced HUVEC Proliferation
[0338] HUVEC (Promocell) were propagated on gelatine-coated dishes and used between passages P2 and P8. On day 1, 1400 cells were seeded per well in a 96 well plate in complete medium. On day 2, cells were washed and 100 l of basal medium containing 0.5% FCS, hydrocortisone and gentamycin/amphotericin was added. Proliferation was stimulated with 20 ng/ml VEGF165 or 10 ng/ml FGF-2 which were mixed with the lipocalin mutein S236.1-A22 (SEQ ID NO:44), incubated for 30 min and added to the wells. Viability was determined on day 6, the results are expressed as % inhibition. IC50 values were determined to be as follows (see also
S236.1-A22 IC50: 0.51 nM
Avastin IC50: 0.56 nM
[0339] FGF-2 mediated stimulation was unaffected by VEGF antagonists (data not shown).
Example 40: Inhibition of VEGF-Mediated MAP Kinase Activation in HUVEC
[0340] HUVEC were seeded in 96-well plates at 1,400 cells per well in standard medium (Promocell, Heidelberg). On the following day, FCS was reduced to 0.5% and cultivation was continued for 16 h. Cells were then starved in 0.5% BSA in basal medium for 5 h. HUVEC were stimulated with VEGF.sub.165 (Reliatech, Braunschweig) for 10 min in the presence of increasing concentrations of tear lipocalin mutein A22 or Avastin (bevacizumab, Genentech/Roche) in order to obtain a dose-response curve. Phosphorylation of the MAP kinases ERK1 and ERK2 was quantified using an ELISA according to the manufacturer's manual (Active Motif, Rixensart, Belgium). The IC 50 value was determined to be 4.5 nM for the mutein A22 (SEQ ID NO:44) and 13 nM for Avastin (see
Example 41: Vascular Permeability Assay with Local Administration of Tear Lipocalin Mutein
[0341] Duncan-Hartley guinea pigs weighing 35050 g were shaved on the shoulder and on the dorsum. The animals received an intravenous injection via the ear vein of 1 ml of 1% Evan's Blue dye. Thirty minutes later 20 ng VEGF.sub.165 (Calbiochem) was mixed with test substance or control article at a tenfold molar excess and injected intradermally on a 34 grid. Thirty minutes later, animals were euthanized by CO.sub.2 asphyxiation. One hour after the VEGF injections, the skin containing the grid pattern was removed and cleaned of connective tissue. The area of dye extravasation was quantified by use of an image analyzer (Image Pro Plus 1.3, Media Cybernetics) (see
Example 42: CAM (Chick Chorioallantoic Membrane) Assay
[0342] Collagen onplants containing FGF-2 (500 ng), VEGF (150 ng) and tear lipocalin mutein (1.35 g) or Avastin (10 g) as indicated were placed onto the CAM of 10 day chicken embryos (4/animal, 10 animals/group). At 24 h the tear lipocalin mutein or Avastin were reapplied topically to the onplant at the same dose. After 72 h onplants were collected and images were captured. The percentage of positive grids containing at least one vessel was determined by a blinded observer. The median angiogenic index is reported for the VEGF antagonists S209.2-O 10 (SEQ ID NO:33) and Avastin as well as wild type tear lipocalin control as the fraction of positive grids (see
Example 43: Determination of Pharmacokinetic (PK) Parameters for A22 and A22-ABD in Mice
[0343] Pharmacokinetic (PK) parameters (half-life plasma concentration, bioavailibity) for tear lipocalin mutein S236.1 A22 (SEQ ID NO:44) (4 mg/kg) after i.v. and the fusion protein of mutein S236.1 A22 with ABD (SEQ ID NO:51) (5.4 mg/kg) following i.v. or i.p. single bolus administration were determined in NMRI mice. Plasma was prepared from terminal blood samples taken at pre-determined timepoints and the concentrations of the lipocalin mutein were determines by ELISA. Results were analyzed using WinNonlin software (Pharsight Corp., Mountain View, USA). T.sub.1/2 A22 i.v.: 0.42 h; T.sub.1/2 A22-ABD i.v.: 18.32 h; T.sub.1/2 A22-ABD i.p.: 20.82 h. The bioavailability following i.p. administration of the fusion protein A22-ABD was 82.5% (see
Example 44: Vascular Permeability Assay with Systemic Administration of Tear Lipocalin Mutein
[0344] Twelve hours prior to the experiment, test substances or controls were injected intravenously into 3 animals per group. Group 1: PBS vehicle; Group 2: Avastin, 10 mg/kg; Group 3: mutein S236.1 A22-ABD, 6.1 mg/kg; Group 4: TLPC51: 6.1 mg/kg. At time=0 Evan's Blue was injected. Thirty minutes later, 4 doses of VEGF (5, 10, 20 or 40 ng) were injected intradermally in triplicate on a 34 grid. Thirty minutes after the VEGF injections the animals were sacrificed and dye extravasation was quantified as above (see
Example 45: Tumor Xenograft Model
[0345] Irradiated (2.5 Gy, Co.sup.60) Swiss nude mice were inoculated subcutaneously with 110.sup.7 A673 rhabdomyosarcoma cells (ATTC) in matrigel into the right flank (n=12 per group). Treatments were administered intraperitoneally and were initiated on the same day and continued for 21 days. Group 1: PBS vehicle, daily; Group 2: Avastin (bevacizumab, Genentech/Roche), 5 mg/kg every 3 days; Group 3: mutein A22-ABD (SEQ ID NO:51), daily, 3.1 mg/kg; Group 4: TLPC51, daily, 3.1 mg/kg. The dose of the lipocalin A22-ABD was chosen to achieve the constant presence of an equimolar number of VEGF binding sites of the mutein and Avastin based on the A22-ABD PK data and estimated serum half life of antibodies in mice. Tumor size was measured twice weekly with a calliper and the tumor volume was estimated according to the formula (lengthwidth.sup.2)/2. Mice were sacrificed when the tumor volume exceeded 2,000 mm.sup.3 (see
Example 46: Screening of Lipocalin Mutein-Cys Variants
[0346] In order to provide a reactive group for coupling with e.g. activated PEG, an unpaired cysteine residue was introduced by site-directed mutagenesis. The recombinant mutein carrying the free Cys residue was subsequently produced in E. coli as described in Example 7, the expression yield determined and the affinity measured by ELISA essentially as described in Example 14. Exemplary, results from the Cys-screening of the VEGF-specific mutein S236.1-A22 (SEQ ID NO:44) are given in the table below. Cystein was introduced instead of the amino acids Thr 40, Glu 73, As 95, Arg 90 and Glu 131 using the following oligonucleotides
TABLE-US-00013 A22_D95C forward: (SEQ ID NO: 56) GAGGTCGCACGTGAAGTGCCACTACATCTTTTACTCTGAGG, A22_D95C reverse: (SEQ ID NO: 57) CCTCAGAGTAAAAGATGTAGTGGCACTTCACGTGCGACCTC, A22_T40C forward: (SEQ ID NO: 58) GGGTCGGTGATACCCACGTGCCTCACGACCCTGGAAGGG, A22_T40C reverse: (SEQ ID NO: 59) CCCTTCCAGGGTCGTGAGGCACGTGGGTATCACCGACCC,, A22_E73C forward: (SEQ ID NO: 60) CCGTCCTGAGCAAAACTGATTGCCCGGGGATCTACACGG, A22_E73C reverse: (SEQ ID NO: 61) CCGTGTAGATCCCCGGGCAATCAGTTTTGCTCAGGACGG, A22_E131C forward: (SEQ ID NO: 62) GCCTTGGAGGACTTTTGTAAAGCCGCAGGAG, A22_E131C reverse: (SEQ ID NO: 63) CTCCTGCGGCTTTACAAAAGTCCTCCAAGGC, A22_R90C forward: (SEQ ID NO: 64) CGTGGCAAAGATCGGGTGCTCGCACGTGAAGGACC, and A22_R90C reverse: (SEQ ID NO: 65) GGTCCTTCACGTGCGAGCACCCGATCTTTGCCACG.
TABLE-US-00014 TABLE XII Affinity of the muteins S236.1-A22 and its Thr 40.fwdarw. Cys (SEQ ID NO: 66), Glu 73.fwdarw. Cys (SEQ ID NO: 67), Asp 95.fwdarw. Cys (SEQ ID NO: 68), Arg 90.fwdarw. Cys (SEQ ID NO: 69), and Glu 131.fwdarw. Cys (SEQ ID NO: 70) mutants for VEGF as determined by ELISA. Yield Affinity Clone [g/L] [nM] S236.1-A22 1000 10 S236.1-A22 T40C 420 14 S236.1-A22 E73C 300 13 S236.1-A22 D95C 750 10 S236.1-A22 R90C 470 10 S236.1-A22 E131C 150 >100
Example 47: Eotaxin-3 Secretion Assay
[0347] An Eotaxin-3 secretion assay was performed on A549 cells over 72 hours. Lung epithelial cells, such as A549 cells, secrete eotaxin-3 upon IL-4/IL-13 stimulation. Thus, A549 cells were treated with increasing concentrations of the IL-4 receptor alpha binding mutein S191.4 B24 (SEQ ID NO:4) and stimulated with 0.7 nM IL-4 or 0.83 nM IL-13, respectively. Eotaxin-3 secretion was assessed after 72 hours using a commercial sandwich ELISA (R&D Systems). The results (
TABLE-US-00015 TABLE XIII IC.sub.50 values of S191.4 B24 for IL-4 and IL-13 mediated eotaxin-3 secretion in A549 cells. IC.sub.50 (nM) IL-4 32 IL-13 5.1
Example 48: IL-4/IL-13 Mediated CD23 Induction on Peripheral Blood Mononuclear Cells
[0348] Total human PBMCs were isolated from buffy coat. PBMCs were treated with increasing concentrations of the IL-4 receptor alpha binding mutein S191.4 B24 and IL-4 or IL-13 were added to a final concentration of 1.0 nM and 2.5 nM, respectively. PBMCs were cultured for 48 hours in RPMI medium containing 10% FCS. Cells were stained with anti-CD14-FITC and anti-CD23-PE antibodies and analyzed by flow cytometry. For each point, the percentage of double-positive cells out of all CD14 positive monocytes was determined and plotted as a function of mutein concentration.
[0349] From the obtained results, the IC.sub.50 values of the mutein S191.4 B24 for inhibiting IL-4 and IL-13 mediated CD23 expression on monocytes was calculated (Table XIV).
TABLE-US-00016 TABLE XIV IC.sub.50 values of S191.4 B24 for IL-4 and IL- 13 mediated CD23 expression in PBMCs. IC.sub.50 (nM) IL-4 905 IL-13 72
Example 49: Schild Analysis of the Affinity of the IL-4 Receptor Alpha Binding Mutein S191.4 B24
[0350] A Schild analysis was carried out to confirm the hypothezised competitive binding mode of the muteins and to determine the K.sub.d on cells. TF-1 cells were treated with a fixed concentration of the IL-4 receptor alpha binding mutein S191.4 B24 (0, 4.1, 12.3, 37, 111.1, 333.3 or 1000 nM) and titrated with IL-4 and cell viability was assessed after 4 days (
Example 50: Picomolar Binding of the Mutein S191.4 B24 to Primary B Cells
[0351] PBMCs were isolated from human blood and incubated with different concentrations of the IL-4 receptor alpha binding human tear lipocalin mutein S191.4 B24 or the wild-type human tear lipocalin (TLPC26). Cells were then stained with anti-CD20-FITC monoclonar antibodies and a biotinylated anti-lipocalin antiserum followed by streptavidin-PE. Results for the wild-type lipocalin and the IL-4 receptor alpha binding lipocalin mutein S191.4 B24 are shown in
Example 51: Bioavailability of the Muteins after Subcutaneous and Intratracheal Administration
[0352] The bioavailability of the the IL-4 receptor alpha binding mutein S191.4 B24 was determined after intravenous, subcutaneous or intratracheal administration, by monitoring the plasma concentrations of the mutein S191.4 B24 for 4 hours after a 4 mg/kg bolus injection in rats. Intratracheal administration was carried out using a commercially available intratrachial dosing device (MicroSprayer, Penn-Century Inc, Philiadelphia, Pa., USA) that generates an aerosol from the tip of a long, thin tube attached to a syringe. The aerosol size was about 20 m. The results of the non-compartmental pharmacokinetic (PK) analysis demonstrate 100% bioavailability upon subcutaneous injection and that, in contrast to antibodies, the pulmonary delivery of the human tear lipocalin muteins appears to be feasible. The obtained results are shown in Table XV.
TABLE-US-00017 TABLE XV Half-life and bioavailability of S191.4 B24 after intravenous (i.v.), subcutaneous (s.c.) and intratracheal (i.t.) administration. i.v. s.c. i.t. t.sub.1/2 [h] 0.78 1.6 2.36 bioavailability (AUC.sub.last) n/a 97.2% .sup.10% bioavailability (AUC.sub.inf) n/a 119% 13.8%
Example 52: In Vitro Potency of PEGylated VEGF Antagonists Using a HUVEC Proliferation Assay
[0353] Inhibition of VEGF stimulated HUVEC cell proliferation was assessed essentially as described in Example 20 with the following modifications: The VEGF-specific mutein S236.1-A22 (SEQ ID NO:44) was coupled to PEG 20, PEG 30 or PEG 40 at position 95C as described in Example 28 above. The mutein, its PEGylated derivatives and wildtype tear lipocalin (gene product of pTLPC26; as control) were added in a dilution series to VEGF165 and incubated for 30 min. at room temperature. The mixtures were added to HUVEC cells in triplicate wells to yield a final concentration of 20 ng/ml VEGF and concentrations between 0.003 nM and 2,000 nM as indicated. Viability of the cells was assessed after 6 days with CellTiter-Glo (Promega) according to the manufacturer's instructions.
[0354] Results from measurements employing the above-mentioned muteins are shown in
TABLE-US-00018 TABLE XVI IC.sub.50 values of S236.1-A22 (SEQ ID NO: 44) and its derivatives PEGylated with PEG 20, PEG 30 or PEG 40 for HUVEC cell proliferation inhibition. IC.sub.50 (nM) S236.1-A22 0.4 S236.1-A22-PEG20 0.53 S236.1-A22-PEG30 2.13 S236.1-A22-PEG40 3.27
[0355] The inventions illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms comprising, including, containing, etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention. The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. Further embodiments of the invention will become apparent from the following claims.