NEGATIVELY CHARGED NUCLEIC ACID COMPRISING COMPLEXES FOR IMMUNOSTIMULATION
20190008954 · 2019-01-10
Assignee
Inventors
Cpc classification
A61K39/001156
HUMAN NECESSITIES
A61K47/645
HUMAN NECESSITIES
A61P31/00
HUMAN NECESSITIES
A61K39/001193
HUMAN NECESSITIES
A61K47/59
HUMAN NECESSITIES
A61K47/543
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C12N2760/16134
CHEMISTRY; METALLURGY
A61K39/39
HUMAN NECESSITIES
A61K39/001157
HUMAN NECESSITIES
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
A61K47/646
HUMAN NECESSITIES
A61K2039/55561
HUMAN NECESSITIES
A61K39/001109
HUMAN NECESSITIES
A61K2039/57
HUMAN NECESSITIES
International classification
A61K39/39
HUMAN NECESSITIES
A61K47/64
HUMAN NECESSITIES
A61K47/59
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
Abstract
The present invention is directed to a pharmaceutical composition including (e.g., for use as an adjuvant) a (negatively charged) nucleic acid comprising complex comprising as a carrier cationic or polycationic compounds (e.g. peptides, proteins or polymers) and as a cargo at least one nucleic acid (molecule) and at least one antigen that is selected from an antigen from a pathogen associated with infectious disease; an antigen associated with allergy or allergic disease; an antigen associated with autoimmune disease; or an antigen associated with a cancer or tumour disease, or in each case a fragment, variant and/or derivative of said antigen. The pharmaceutical composition allows for efficient induction of an adaptive immune response directed against said antigen. The present invention furthermore provides kits, as well as the use of the pharmaceutical composition or the kit as a vaccine, particularly in the treatment of infectious diseases, allergies, autoimmune diseases and tumour or cancer diseases.
Claims
1. A pharmaceutical composition comprising: (A) a complex, comprising: a) cationic and/or polycationic components comprising PEI and lipidic cationic components; and b) at least one RNA molecule; wherein the charge of complex (A) is negative; and wherein the complex does not include a mRNA encoding an antigen, and (B) at least one polypeptide antigen selected from the group consisting of: (i) an antigen from a pathogen associated with infectious disease; (ii) an antigen associated with allergy or allergic disease; (iii) an antigen associated with autoimmune disease; and (iv) an antigen associated with a cancer or tumour disease, or an antigenic fragment of said antigen.
2. The pharmaceutical composition of claim 1, wherein the charge of complex (A) is negative and wherein the cationic and/or polycationic components and the RNA molecule comprised in said complex (A) are present in an N/P ratio of below 1.
3. The pharmaceutical composition of claim 1, wherein in complex (A) the cationic and/or polycationic component of the carrier and the RNA molecule comprised in said complex are present in a N/P ratio of below 1.
4. (canceled)
5. The pharmaceutical composition of claim 3, wherein the N/P ratio is below 0.7.
6-12. (canceled)
13. The pharmaceutical composition of claim 1, wherein said RNA molecule is an immunostimulatory RNA (isRNA).
14-15. (canceled)
16. The pharmaceutical composition of claim 1, wherein said complex includes said polypeptide antigen.
17-18. (canceled)
19. The pharmaceutical composition of claim 1, wherein the lipidic cationic components and the RNA molecule comprised in complex (A) are provided in a cationic component: RNA molecule mass ratio in the range of 1:1.2 to 1:15.
20. A kit or kit of parts comprising: (A) a complex as defined according to claim 1; and (B) at least one polypeptide antigen.
21-24. (canceled)
25. A pharmaceutical package, including: (A) a complex as defined according to claim 1; and (B) instructions describing the use of said complex in therapy in combination with at least one polypeptide antigen.
26-27. (canceled)
28. The pharmaceutical composition of claim 1, wherein the charge of complex (A) is negative.
29. The pharmaceutical composition of claim 1, wherein the polypeptide antigen is selected from the group consisting of: an antigen from a pathogen associated with infectious disease; and an antigen associated with a cancer or tumour disease.
30. The pharmaceutical composition of claim 29, wherein the polypeptide antigen is from a pathogen selected from the list consisting of: Influenza virus, Rabies virus, Hepatitis B virus, human Papilloma virus (hPV), Bacillus anthracis, Respiratory syncytial virus (RSV), Herpes simplex virus (HSV), and Mycobacterium tuberculosis.
31. The pharmaceutical composition of claim 30, wherein the polypeptide antigen is Hemagglutinin (HA), Neuraminidase (NA), Nucleoprotein (NP), M1 protein, M2 protein, NS 1 protein, NS2 protein, PA protein, PB 1 protein, PB 1-F2 protein and/or PB2 protein of Influenza virus;
32. The pharmaceutical composition of claim 29, wherein the polypeptide antigen is associated with a cancer or tumour disease and is selected from the list consisting of: p53, CA125, EGFR, Her2/neu, hTERT, PAP, MAGE-A1, MAGE-A3, Mesothelin, MUC-1, NY-ESO-1, GP100, MART-1, Tyrosinase, PSA, PSCA, PSMA VEGF, VEGFR1, VEGFR2, Ras, CEA and WT1.
33. The pharmaceutical composition of claim 3, wherein the N/P ratio is below 0.9.
34. The pharmaceutical composition of claim 33, wherein the N/P ratio is in the range of 0.1-0.9.
35. The pharmaceutical composition of claim 34, wherein the N/P ratio is in the range of 0.4-0.9.
36. The pharmaceutical composition of claim 35, wherein the N/P ratio is in the range of 0.5-0.9.
37. The pharmaceutical composition of claim 19, wherein the mass ratio is in the range of 1:1.5 to 1:10.
Description
FIGURES
[0467] The following Figures are intended to illustrate the invention further. They are not intended to limit the subject matter of the invention thereto.
[0468]
TABLE-US-00004 Ratio 4:1 2:1 1:1 1:2 1:4 Zetapetential 29.8 17.2 +0.09 +32.5 +33.1 (mV)
[0469]
[0470]
[0471] For this purpose 5 female Balb/c mice per group were vaccinated two times in two weeks with 0.1 g Influvac (Season 2010/2011) combined with 15 g R722 complexed with the indicated amount of PEI, Lipofectamine, or CR12C. For comparison mice were injected with Influvac or buffer alone. 7 days after the last vaccination sera were prepared and the induction of Influvac-specific IgG2a antibodies was measured.
[0472] As can be seen, the negatively charged complexes (R722/PEI N/P 0.5, R722/Lipofectamine 4:1 and R722/CR12C 2:1) strongly increase the B-cell response compared to the vaccine Influvac alone and the combination of the vaccine Influvac with positively charged complexes (R722/PEI N/P 5 and R722/Lipofectamine 1:2), which proofs the beneficial adjuvant properties of the negatively charged complexes, particularly in regard to the induction of a Th1-shifted immune response.
[0473]
[0474]
[0475] For this purpose hPBMCs were transfected with the negatively charged complexes and 3 h after transfection the cells were sorted by FACS analysis in CD3+ and CD19+ cells. As can be seen the negatively charged complexes were dominantly uptaken into CD19+ cells.
[0476]
[0477] For this purpose hPBMCs were transfected with the positively charged complexes and 3h after transfection the cells were sorted by FACS analysis in CD3+ and CD19+ cells. As can be seen the positively charged complexes were dominantly uptaken into CD3+ cells.
[0478]
EXAMPLES
[0479] The following examples are intended to illustrate the invention further. They are not intended to limit the subject matter of the invention thereto.
1. Reagents:
[0480] Carrier:
TABLE-US-00005 R.sub.12: (SEQ ID NO. 97) Arg-Arg-Arg-Arg-Arg-Arg-Arg Arg-Arg-Arg-Arg-Arg (Arg.sub.12) CR.sub.12C: (SEQ ID NO. 98) Cys-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg-Arg- Arg-Cys (Cys-Arg.sub.12-Cys) bPEI 25 kDa (Sigma Aldrich) Lipofectamine2000(Life Technologies)
[0481] Nucleic Acids as Cargo of the Complex:
TABLE-US-00006 (SEQ ID NO. 91) R722A: long non-coding isGU-rich RNA (SEQ ID NO. 101) R722B: long non-coding isGU-rich RNA (SEQ ID NO. 99) CpG 2216: CpG oligonucleotide GGGGGACGATCGTCGGGGGG
[0482] Experiments indicating the use of nucleic acid molecule R722 have been performed with the sequences R722A and/or R722B.
[0483] Antigens:
[0484] Influvac (Season 2010/2011) (Abbott Arzneimittel GmbH)
2. Preparation of Nucleic Acid Sequences:
[0485] For the present examples nucleic acid sequences as indicated in example 1 were prepared and used for formation of the polymerized complexes or for non-polymerized carrier cargo complexes for comparison. These complexes were used for in vitro and in vivo transaction, for in vitro immunostimulation and for particle characterizations.
[0486] According to a first preparation, the DNA sequences, coding for the corresponding RNA sequence R722 were prepared. The sequence of the corresponding RNA is shown in the sequence listing (SEQ ID NO: 91).
[0487] The CpG 2216 oligonucleotides were prepared by automatic solid-phase synthesis by means of phosphoramidite chemistry. The sequence is shown in the sequence listing (SEQ ID NO: 99).
3. In Vitro Transcription:
[0488] The respective DNA plasmid prepared according to Example 2 for R722 was transcribed in vitro using T7-Polymerase (T7-Opti mRNA Kit, CureVac, Tbingen, Germany) following the manufactures instructions. Subsequently the mRNA was purified using PureMessenger (CureVac, Tbingen, Germany).
4. Synthesis of Complexes:
[0489] The nucleic acid sequences defined above in Example 1 were mixed with the carrier as defined in Example 1. Therefore, the indicated amount of nucleic acid sequence was mixed with the respective carrier in mass ratios or N/P ratios as indicated, thereby forming a complex. Afterwards the resulting solution was adjusted with injection solution (e.g. RiLa) to a final volume of 50 l and incubated for 30 min at room temperature. [0490] N/P ratio=is a measure of the ionic charge of the cationic component of the carrier or of the carrier as such. In the case that the cationic properties of the cationic components are provided by nitrogen atoms the N/P ratio is the ratio of basic nitrogen atoms to phosphate residues, considering that nitrogen atoms confer to positive charges and phosphate of the phosphate backbone of the nucleic acid confers to the negative charge. [0491] N/P is preferably calculated by the following formula:
5. Cytokine Stimulation in hPBMCs:
[0493] HPBMC cells from peripheral blood of healthy donors were isolated using a Ficoll gradient and washed subsequently with 1PBS (phosphate-buffered saline). The cells were then seeded on 96-well microtiter plates (20010.sup.3/well). The hPBMC cells were incubated for 24 h with 10 pl of the complex from Example 3 containing the indicated amount of nucleic acid in X-VIVO 15 Medium (BioWhittaker). The immunostimulatory effect was measured by detecting the cytokine production of the hPBMCs (Interferon alpha). Therefore, ELISA microtiter plates (Nunc Maxisorb) were incubated over night (o/n) with binding buffer (0.02% NaN.sub.3, 15 mM Na.sub.2CO.sub.3, 15 mM NaHCO.sub.3, pH 9.7), additionally containing a specific cytokine antibody. Cells were then blocked with 1PBS, containing 1% BSA (bovine serum albumin). The cell supernatant was added and incubated for 4 h at 37 C. Subsequently, the microtiter plate was washed with 1PBS, containing 0.05% Tween-20 and then incubated with a Biotin-labelled secondary antibody (BD Pharmingen, Heidelberg, Germany). Streptavidin-coupled horseraddish peroxidase was added to the plate. Then, the plate was again washed with 1PBS, containing 0.05% Tween-20 and ABTS (2,2-azino-bis(3-ethyl-benzthiazoline-6-sulfonic acid) was added as a substrate. The amount of cytokine was determined by measuring the absorption at 405 nm (OD 405) using a standard curve with recombinant cytokines (BD Pharmingen, Heidelberg, Germany) with the Sunrise ELISA-Reader from Tecan (Crailsheim, Germany). The respective results are shown in
6. Zetapotential Measurements:
[0494] The Zeta potential of the complexes was evaluated by the laser Doppler electrophoresis method using a Zetasizer Nano (Malvern Instruments, Malvern, UK). The measurement was performed at 25 C. and a scattering angle of 173 was used. The results are shown in Table 1:
TABLE-US-00007 TABLE 1 Complex N/P or mass ratio Zeta potential R722/CR12C 2:1 (w/w) (N/P ratio 0.9) 2.8 mV R722/CR12C N/P 5.5 +24.7 mV R722/CR12C N/P 4.4 +20.1 mV R722/CR12C N/P 2.2 +1.89 mV R722/CR12C N/P 1.0 1.9 mV R722/CR12C N/P 0.55 6.31 mV R722/CR12C N/P 0.28 7.7 mV R722/CR12C N/P 0.18 19.3 mV R722/Lipofectamine 4:1 (w/w) 29.8 mV R722/Lipofectamine 1:1 (w/w) +0.1 mV R722/Lipofectamine 1:4 (w/w) +27.5 mV R722/PEI N/P 0.25 6.6 mV R722/PEI N/P 2.5 +22.4 mV R722/PEI N/P 5 +25 mV
7. Immunization Experiments:
[0495] a) Immunization with Seasonal Influenza Vaccine:
[0496] For immunization the seasonal influenza vaccine Influvac (comprises inactivated influenza virus strains as recommended by the WHO; season 2010/2011) (0.1 g/dose) was combined with 15 g R722 complexed with the indicated amount of PEI, Lipofectamine, or CR12C. 5 female Balb/c mice per group were vaccinated two times in two weeks. For comparison mice were injected with Influvac or buffer alone. 7 days after the last vaccination sera were prepared and the induction of Influvac-specific IgG2a antibodies was measured. The results of this induction of antibodies upon vaccination with an inventive pharmaceutical composition are shown in
b) Immunization with Ovalbumine or SIINFEKL:
[0497] For immunization the vaccines Ovalbumine protein (OVA) (5 g) or Ovalbumin-specific peptide SIINFEKL (50 g) are combined with the complexes R722/R.sub.12 (30 g R722/15 g R.sub.12) (in a mass ratio of 2:1 w/w), R722/Lipofectamine (30 g R722/15 g Lipofectamine) (in a mass ratio of 2:1 w/w), R722/PEI (in a N/P ratio of 0.5), as adjuvant and injected intradermally into female C57BL/6 mice (7 mice per group for tumour challenge and 5 mice per group for detection of an immune response). The vaccination was repeated 2 times in 2 weeks. For comparison mice were injected alone with the antigens.
8. Detection of an Antigen-Specific Immune Response (B-Cell Immune Response):
[0498] a) Detection of Antibodies Directed Against Seasonal Influenza Virus Strains:
[0499] Detection of an antigen specific immune response (B-cell immune response) was carried out by detecting Influenza virus specific IgG2a antibodies. Therefore, blood samples were taken from vaccinated mice 7 days after last vaccination and sera were prepared. MaxiSorb plates (Nalgene Nunc International) were coated with Influvac season 2010/2011 (at 5 g/ml) containing the same viral Influenza antigens as the Influenza vaccine used for vaccination. After blocking with 1PBS containing 0.05% Tween-20 and 1% BSA the plates were incubated with diluted mouse serum. Subsequently a biotin-coupled secondary antibody (Anti-mouse-IgG2a Pharmingen) was added. After washing, the plate was incubated with Horseradish peroxidase-streptavidin and subsequently the conversion of the ABTS substrate (2,2-azino-bis(3-ethyl-benzthiazoline-6-sulfonic acid) was measured to determine the induction of IgG2a antibodies. The results of this induction of antibodies upon vaccination with an inventive pharmaceutical composition are shown in
b) Detection of Antibodies Directed Against Ovalbumine:
[0500] Detection of an antigen specific immune response (B-cell immune response) is carried out by detecting antigen specific antibodies. Therefore, blood samples are taken from vaccinated mice 5 days after the last vaccination and sera are prepared. MaxiSorb plates (Nalgene Nunc International) are coated with Gallus gallus ovalbumine protein. After blocking with 1PBS containing 0.05% Tween-20 and 1% BSA the plates are incubated with diluted mouse serum. Subsequently a biotin-coupled secondary antibody (Anti-mouse-IgG2a Pharmingen) is added. After washing, the plate is incubated with Horseradish peroxidase-streptavidin and subsequently the conversion of the ABTS substrate (2,2-azino-bis(3-ethyl-benzthiazoline-6-sulfonic acid) is measured.
9. Detection of an Antigen Specific Cellular Immune Response by ELISPOT:
[0501] a) Detection of Cytotoxic T Cell Response Directed Against Ovalbumine:
[0502] 5 days after the last vaccination mice are sacrificed, the spleens were removed and the splenocytes are isolated. For detection of INFgamma a coat multiscreen plate (Millipore) is incubated overnight with coating buffer (0.1 M Carbonat-Bicarbonat Buffer pH 9.6, 10.59 g/l Na.sub.2CO.sub.3, 8.4 g/l NaHCO.sub.3) comprising antibody against INF (BD Pharmingen, Heidelberg, Germany). The next day 110.sup.6 cells/well are added and re-stimulated with 1 g/well of relevant peptide (SIINFEKL of ovalbumine); irrelevant peptide (Connexin=control peptide) or buffer without peptide. Afterwards the cells are incubated for 24 h at 37 C. The next day the plates are washed 3 times with PBS, once with water and once with PBS/0.05% Tween-20 and afterwards incubated with a biotin-coupled secondary antibody for 11-24h at 4 C. Then the plates are washed with PBS/0.05% Tween-20 and incubated for 2h at room temperature with alkaline phosphatase coupled to streptavidin in blocking buffer. After washing with PBS/0.05% Tween-20 the substrate (5-Bromo-4-Cloro-3-Indolyl Phosphate/Nitro Blue Tetrazolium Liquid Substrate System from Sigma Aldrich, Taufkirchen, Germany) is added to the plate and the conversion of the substrate can be detected visually. The reaction is then stopped by washing the plates with water. The dried plates are then read out by an ELISPOT plate reader. For visualization of the spot levels the numbers are corrected by background subtraction.
10. Tumour Challenge:
[0503] One week after the last vaccination 110.sup.6 E.G7-OVA cells (tumour cells which stably express ovalbumine) are implanted subcutaneously in the vaccinated mice. Tumour growth is monitored by measuring the tumour size in 3 dimensions using a calliper.
11. Study of the Uptake of Complexes:
[0504] The uptake of negatively or positively charged complexes formed by the fluorescent labelled long non-coding GU-rich isRNA R722 as cargo and the cationic peptide CR12C in a mass ratio of 2:1 or 1:2 (w/w) were measured by FACS analysis in different cell types. Therefore [200000] hPBMCs were transfected with the complexes containing 5 g RNA and 3h after transfection the cells were stained by fluorescent Antibodies recognizing CD19, CD3 and CD8 and sorted by FACS analysis in CD3+ and CD19+ cells. The results of this uptake study are shown in