MOLECULAR DETECTION/DIAGNOSIS REAGENT FOR TUMOR

Abstract

The present invention discloses a tumor molecular detection/diagnostic reagent, which takes excrement as a detection sample and includes an SDC2 gene methylation detection reagent. The methylation level of the SDC2 gene detected in the excrement has an extremely high relevance to the onset of the colorectal cancer. The sensitivity of the SDC2 gene in the excrement is 87 percent and the specificity is up to 98 percent or even higher than that in tissue.

Claims

1. A tumor molecular detection/diagnostic reagent, characterized by taking excrement as a detection sample, and comprising an SDC2 gene methylation detection reagent.

2. The detection/diagnostic reagent according to claim 1, characterized by further comprising DNA capturing reagents.

3. The detection/diagnostic reagent according to claim 2, characterized in that the DNA capturing reagents are capturing magnetic beads.

4. The detection/diagnostic reagent according to claim 3, characterized in that the capturing magnetic beads contain capturing sequences for the SDC2 gene, preferably containing capturing sequences for CpG island of the SDC2 gene.

5. The detection/diagnostic reagent according to claim 3, characterized in that the capturing sequences are as shown in SEQ ID NO.1 or SEQ ID NO.2.

6. The detection/diagnostic reagent according to claim 1, characterized in that the SDC2 gene methylation detection reagent is a methylation detection reagent for the CpG island.

7. The detection/diagnostic reagent according to claim 1, characterized in that the SDC2 gene methylation detection reagent contains amplification primers, and preferably, the amplification primers are as shown in any one of SEQ ID NO.3 to 24; and preferably, the primers are as shown in SEQ ID NO.3 and SEQ ID NO.4.

8. The detection/diagnostic reagent according to claim 1, characterized by further comprising a detection probe; preferably, the detection probe is as shown in SEQ ID NO.25 or SEQ ID NO.26, preferably the probe is as shown in SEQ ID NO.26.

9. The detection/diagnostic reagent according to claim 1, characterized in that the tumor is intestinal cancer or precancerous adenoma.

10. The detection/diagnostic reagent according to claim 1, characterized in that the tumor is intestinal cancer or precancerous adenoma, and preferably, the intestinal cancer is colorectal cancer.

11. A tumor detection/diagnostic kit, characterized by comprising the detection/diagnostic reagent according to claim 1; preferably, the tumor is intestinal cancer or precancerous adenoma; and more preferably, the intestinal cancer is colorectal cancer.

12. A tumor detection method, characterized in that excrement is used as a detection sample; after the detection sample is mixed with the detection/diagnostic reagent according to claim 1, the mixture is subjected to extraction and amplification; and a detection result is obtained according to an amplification result.

13. The detection method according to claim 12, characterized in that an object of amplification is a tumor marker which is selected from the SDC2 gene, NDRG4 gene, BMP3 gene or Septin9 gene.

14. The detection method according to claim 12, characterized in that the detection result is obtained by comparing an amplification result of a sample to be detected with an amplification result of a normal sample; and if the amplification result of the sample to be detected and the normal sample have significant difference or extremely significant difference, the donor of the sample presents a positive result.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0031] FIG. 1 is an ROC (receiver operating characteristic) curve of detecting colorectal cancer (A) and precancerous adenoma (polypus having a diameter more than or equal to 1 cm) (B) based on the SDC2 gene;

[0032] FIG. 2 is an ROC curve of detecting colorectal cancer (A) and precancerous adenoma (polypus having a diameter more than or equal to 1 cm) (B) based on the NDRG4 gene;

[0033] FIG. 3 is an ROC curve of detecting colorectal cancer (A) and precancerous adenoma (polypus having a diameter more than or equal to 1 cm) (B) based on the BMP3 gene;

[0034] FIG. 4 is an ROC curve of detecting colorectal cancer (A) and precancerous adenoma (polypus having a diameter more than or equal to 1 cm) (B) based on the Septin9 gene;

[0035] FIGS. 5 to 15 are amplification curves of primers SM-0 to SM-10, successively;

[0036] FIG. 16 is a fluorescent PCR detection result (probe 1);

[0037] FIG. 17 is a fluorescent PCR detection result (probe 2).

DETAILED DESCRIPTION OF THE INVENTION

[0038] The present invention discloses a tumor molecular detection/diagnostic reagent. A person skilled in the art can make proper improvements on process parameters by referring to contents in this text. It should be particularly noted that it is evident for the person skilled in the art to make all similar replacements and changes that shall all be deemed as being included in the present invention. The method and application of the present invention have been described by means of preferred embodiments, and it is obvious for relevant persons to make changes or proper alterations and combinations to the method and application described in this text without departing from the contents, spirit and scope of the present invention to implement and apply the technologies of the present invention.

[0039] Raw materials and reagents which are used in the tumor molecular detection/diagnostic reagent provided by the present invention may be all purchased on the market.

[0040] A further description will be made to the technical solution of the present invention by specific embodiments, and the specific embodiments are not representative of limitations to the scope of protection of the present invention. Some nonessential modifications and adjustments that are made by others according to the theory of the present invention shall still fall within the scope of protection of the present invention.

Embodiment 1 Sample Treatment and DNA Extraction

[0041] An excrement sample and a buffer solution are mixed and ground according to a ratio of 1 g of excrement to 4 ml of buffer solution, and then the mixture is centrifugated so as to reserve supernate and abandon precipitates.

[0042] 8 ml of the supernate is centrifugated at 4000 rpm for 5 min, and then 5 ml of the centrifugated supernate is transferred into a new centrifugal tube which is pre-filled with 3 ml of cell lysis buffer and has the volume of 15 ml.

[0043] 100 ul of capturing magnetic beads are added into each centrifugal tubes which are incubated in a water bath kettle at 92 DEG C for 10 min and incubated in a table concentrator at 100 rpm at room temperature for 1 h, and then after short centrifugation, the centrifugal tubes are placed on a magnetic frame for 5 min so as to abandon the supernate.

[0044] There are two available capturing probes, which are both effective and can capture target fragments.

TABLE-US-00001 Capturingprobe1: SEQIDNO.1: AGCCCGCGCACACGAATCCGGAGCAGAGTACCG Capturingprobe2: SEQIDNO.2: CTCCTGCCCAGCGCTCGGCGCAGCCCGC

[0045] 500 ul of a cleaning solution is added into the centrifugal tube having the volume of 15 ml, and then the centrifugal tube is shaken for uniform mixing to enable the magnetic beads on the tube wall to be suspended completely; and after short centrifugation, the solution is transferred into a new centrifugal tube having the volume of 2 ml. The centrifugal tube is incubated in a dry bath incubator at 900 rpm at room temperature for 1 min, and then is placed on the magnetic frame for 1 min so as to abandon the supernate. The above-mentioned operation is repeated for 4 times. 55 ul of eluent is added, and after short centrifugation, the centrifugal tube is incubated in the dry bath incubator at 900 rpm at 92 DEG C for 10 min. After short centrifugation, the centrifugal tube is placed on the magnetic frame, and 50 ul of eluent is transferred into a new EP tube within 3 min.

[0046] A DNA fragment in the step 6 is methylated with an EZ methylation kit (a product of the Zymo Research Company), and a final sample is subjected to PCR detection.

[0047] Analysis of the capturing efficiency of the capturing probes:

[0048] The two capturing probes are used for capturing the same sample, and the concentrations of the captured DNA fragments are measured through an ultraviolet spectrophotometer, obtaining results as follows:

TABLE-US-00002 Concentration of DNA (ng/uL) Used probe OD260 (50(ng/uL) OD260) SEQ ID NO. 1 1.9 95 SEQ ID NO. 2 1.7 85

[0049] The two probes can capture the target fragments. The effect of SEQ ID NO.1 is better than that of SEQ ID NO : 2, the optimal experiment adopts the probes.

Embodiment 2 PCR (Polymerase Chain Reaction) Detection Process

[0050] A PCR system and procedures are respectively as shown in Table 1 and Table 2.

TABLE-US-00003 TABLE 1 PCR system Component Adding amount (ul) Forward primer (FP) (100 uM) 0.125 Backward primer (RP) (100 uM) 0.125 Probe (100 uM) 0.05 dNTP (10 mM) 1 Magnesium ion 5 5*buffer 5 Reaction enzyme 0.5 Nuclease-free water 8.2 DNA to be detected 5 Total 25

TABLE-US-00004 TABLE 2 PCR procedures Cycle number Temperature ( C.) Time (s) 1 95 300 10 95 20 62 30 70 30 40 95 20 58 60 72 30 (Collection of fluorescence) 1 37 30

[0051] Primers are designed, and their amplification efficiency is researched (as shown in Table 3). The amplification system and the procedures are as mentioned above.

TABLE-US-00005 TABLE3 Primersandamplificationefficiency Sequence Amplification number Primername Sequence result SEQIDNO.3 SM-0FP GAGGAAGCGAGCGTTTTC FIG.5 SEQIDNO.4 SM-0RP AAAATACCGCAACGATTACGA SEQIDNO.5 SM-1FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.6 SEQIDNO.6 SM-1RP CGCAACGATTACGACTCAAACTCGA SEQIDNO.7 SM-2FP TAGGAGGAGGAAGTGAGTGTTTTTG FIG.7 SEQIDNO.8 SM-2RP ACCACAACAATTACAACTCAAACTCAA SEQIDNO.9 SM-3FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.8 SEQIDNO.10 SM-3RP CCGCAACGATTACGACTCAAACTCG SEQIDNO.11 SM-4FP TAGGAGGAGGAAGTGAGTGTTTTTG FIG.9 SEQIDNO.12 SM-4RP ACCACAACAATTACAACTCAAACTCAA SEQIDNO.13 SM-5FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.10 SEQIDNO.14 SM-SRP CGCAACGATTACGACTCAAACTCGA SEQIDNO.15 SM-6FP TAGGAGGAGGAAGTGAGTGTTTTTG FIG.11 SEQIDNO.16 SM-6RP CCACAACAATTACAACTCAAACTCAA SEQIDNO.17 SM-7FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.12 SEQIDNO.18 SM-7RP CCGCAACGATTACGACTCAAACTCG SEQIDNO.19 SM-8FP TAGGAGGAGGAAGTGAGTGTTTTTG FIG.13 SEQIDNO.20 SM-8RP CCACAACAATTACAACTCAAACTCAA SEQIDNO.21 SM-9FP GTAGGAGGAGGAAGCGAGCGTTTTC FIG.14 SEQIDNO.22 SM-9RP CGCAACGATTACGACTCAAACTCGA SEQIDNO.23 SM-10FP GTAGGAGGAGGAAGTGAGTGTTTTTG FIG.15 SEQIDNO.24 SM-10RP ACCACAACAATTACAACTCAAACTCAA

[0052] The PCR results of the primers are respectively as shown in FIGS. 5 to 15. It can be seen from the results that the primers SEQ ID NO.3 and SEQ ID NO.4 have the highest amplification efficiency.

[0053] The primer pair of SEQ ID NO.3 and SEQ ID NO.4, which has the highest amplification efficiency, is used.

[0054] The detection probes are further designed. Optimized detection probe examples are as follows.

TABLE-US-00006 Probe1:SEQIDNO.25: AGTTTCGAGTTCGAGTTTTCGAGTTTG Probe2:SEQIDNO.26: CAAACTCGAAAACTCGAACTCGAAACT

[0055] Ten holes are repeated. The experiment is performed twice. The PCR system and procedures are as shown in Table 1 and Table 2.

[0056] Fluorescence curves of the probe 1 and probe 2 are respectively as shown in FIG. 16 and FIG. 17.

[0057] It can be seen from the results that the probe 1 and the probe 2 can ensure that the PCR process is performed normally. By contrast, a fluorescence value obtained by the probe 2 is higher, and is more favorable for the judgment on the result, particularly for the judgment on a positive sample. The probe 2 is adopted to detect the sample in the optimal experiment.

Embodiment 3 Sample Detection

[0058] Excrement samples of 46 patients definitely diagnosed as suffering from intestinal cancer based on enteroscopy and pathological examination, excrement samples of 46 patients definitely diagnosed as suffering from precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on enteroscopy and pathological examination, and excrement samples of 46 patients definitely diagnosed as normal based on enteroscopy were clinically collected.

[0059] The above-mentioned excrement samples were treated and subjected to DNA extraction according to the method in Embodiment 1. The 138 samples were subjected to PCR detection by using the PCR detection process in Embodiment 2.

[0060] The 46 intestinal cancer patients (Ca) (definitely diagnosed as suffering from the intestinal cancer based on the enteroscopy), the 46 normal patients (Norm) (definitely diagnosed as normal based on the enteroscopy), and the 46 precancerous adenoma patients (polypus having a diameter more than or equal to 1 cm, LA, definitely diagnosed that the diameter of the polypus is more than or equal to 1 cm based on the enteroscopy) were detected.

[0061] Data were processed and analyzed by using MedCalc software.

[0062] Results are as shown in FIG. 1 and FIG. 2.

[0063] FIG. 1A is an ROC (receiver operating characteristic) curve of detecting the colorectal cancer based on the SDC2 gene, and FIG. 1B is an ROC curve of detecting the precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on the SDC2 gene.

[0064] For the colorectal cancer, the detection sensitivity of the SDC2 gene is 87 percent, and the specificity is 98 percent. The area under the receiver curve is 0.953.

[0065] For the precancerous adenoma (polypus having a diameter more than or equal to 1 cm), the detection sensitivity of the SDC2 gene is 73 percent, and the specificity is 96 percent. The area under the receiver curve is 0.882.

Embodiment 4 Detection Results of Other Exemplar Molecular Markers

[0066] In a process of exploring the technical solution of the present invention, the inventor had explored various intestinal cancer markers.

[0067] With reference to the system design methods of Embodiment 1, 2 and 3, excrement detection for the NDRG4 gene, the BMP3 gene and the Septin9 gene was explored in the present invention. After the optimal detection method was performed on those genes respectively, the clinically samples in Embodiment 3 were analyzed in the same way.

[0068] Results obtained by detecting the colorectal cancer and the precancerous adenoma based on the NDRG4 gene are as shown in FIG. 2.

[0069] FIG. 2A is an ROC curve of detecting the colorectal cancer based on the NDRG4 gene, and FIG. 2B is an ROC curve of detecting the precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on the NDRG4 gene.

[0070] For the colorectal cancer, the detection sensitivity of the NDRG4 gene is 65.2 percent, and the specificity is 97.8 percent. The area under the receiver curve is 0.826.

[0071] For the precancerous adenoma (polypus having a diameter more than or equal to 1 cm), the detection sensitivity of the NDRG4 gene is 45.7 percent, and the specificity is 97.8 percent. The area under the receiver curve is 0.694.

[0072] Results obtained by detecting the colorectal cancer and the precancerous adenoma based on the BMP3 gene are as shown in FIG. 3.

[0073] FIG. 3A is an ROC curve of detecting the colorectal cancer based on the BMP3 gene, and FIG. 3B is an ROC curve of detecting the precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on the BMP3 gene.

[0074] For the colorectal cancer, the detection sensitivity of the BMP3 gene is 50.0 percent, and the specificity is 89.1 percent. The area under the receiver curve is 0.694.

[0075] For the precancerous adenoma (polypus having a diameter more than or equal to 1 cm), the detection sensitivity of the BMP3 gene is 26.1 percent, and the specificity is 89.1 percent. The area under the receiver curve is 0.549.

[0076] Results obtained by detecting the colorectal cancer and the precancerous adenoma based on the Septin9 gene are as shown in FIG. 4.

[0077] FIG. 4A is an ROC curve of detecting the colorectal cancer based on the Septin9 gene, and FIG. 4B is an ROC curve of detecting the precancerous adenoma (polypus having a diameter more than or equal to 1 cm) based on the Septin9 gene.

[0078] For the colorectal cancer, the detection sensitivity of the Septin9 gene is 82.6 percent, and the specificity is 63.0 percent. The area under the receiver curve is 0.737.

[0079] For the precancerous adenoma (polypus having a diameter more than or equal to 1 cm), the detection sensitivity of the Septin9 gene is 13.0 percent, and the specificity is 97.8 percent. The area under the receiver curve is 0.534.

[0080] The above-mentioned embodiments are only preferred implementation modes of the present invention, but not intended to limit the implementation modes of the present invention. Any other changes, modifications, replacements, combinations and simplifications that are made without departing from the spirit and theory of the present invention shall all fall within the scope of protection of the present invention.

[0081] The above detailed description is made to the tumor molecular detection/diagnostic reagent provided by the present invention. In this text, specific cases are applied to describe the principle and implementation modes of the present invention, and descriptions of the above embodiments are only used for assisting in understanding the method of the present invention and its main idea.

[0082] It should be noted that a person skilled in the art further can make a plurality of improvements and modifications to the present invention without departing from the theory of the present invention, and these improvements and modifications shall also fall within the scope of protection of claims of the present invention.