DETECTING NUCLEIC ACIDS IN IMPURE SAMPLES WITH AN ACOUSTIC WAVE SENSOR

Abstract

An acoustic sensor detects binding of a nucleic acid analyte in an impure liquid sample by measurement of the energy of the acoustic wave resulting from the binding of the nucleic acid target to the sensor surface. The analysis may be preceded by carrying out a nucleic acid amplification procedure in situ on a crude or impure biological sample and the analysis is tolerant of the presence of reagents or by-products of the amplification procedure, and also materials present from the initial biological sample.

Claims

1. A method of measuring a nucleic acid target in an impure liquid sample, the method comprising providing an acoustic wave sensor having a sensing surface, generating an acoustic wave in the impure liquid sample through the sensing surface while the impure liquid sample is in contact with the sensing surface, measuring the energy loss of the acoustic wave, and comparing the measured energy loss with a reference to thereby determine the presence or amount of the nucleic acid target.

2. A method according to claim 1, wherein the method comprises bringing the impure liquid sample into contact with the sensing surface, optionally wherein the reference is the measured energy loss before the impure liquid sample is brought into contact with the sensing surface.

3. A method according to claim 1, wherein the reference is a predetermined stored value or a measured energy loss of a control.

4. A method according to claim 1, wherein the impure liquid sample comprises biological molecules and/or cell fragments, at least some of which adhere to the sensing surface.

5. A method according to claim 1, wherein the nucleic acid target is the analyte and is detected in the impure liquid sample without a step of forming the nucleic acid target by a nucleic acid amplification procedure.

6. A method according to claim 1, wherein the nucleic acid target is formed in the presence of an analyte by a nucleic acid amplification procedure.

7. A method according to claim 6, wherein the impure liquid sample brought into contact with the sensing surface comprises reagents of the nucleic acid amplification procedure, at least some of which adhere to the sensing surface.

8. A method according to claim 6, wherein the nucleic acid amplification procedure is carried out on a crude initial sample, the crude initial sample comprising biological molecules and/or cell fragments, and wherein the crude liquid sample which is brought into contact with the sensing surface comprises biological molecules and/or cell fragments from the crude initial sample, at least some of which adhere to the sensing surface.

9. A method according to claim 7, wherein the impure sample is a crude sample extracted from a patient, or a food sample, or an environmental sample.

10. A method according to claim 6, wherein the nucleic acid amplification procedure is carried out in an amplification chamber which is connected to the acoustic wave sensor and the method comprises transferring product of the amplification procedure as the impure liquid sample to the sensing surface through a channel.

11. A method according to claim 10, wherein the amplification chamber and the channel are formed as an integral unit.

12. A method according to claim 10, wherein the amplification chamber is brought into thermal communication with a heater and the temperature within the amplification chamber is regulated.

13. A method according to claim 10, wherein the transfer of product of the amplification procedure is effected by a peristaltic pump, syringe pump, gravity or capillary forces.

14. A method according to claim 10, wherein the product of the amplification procedure is transferred to the sensing surface without an intermediate filter or purification step.

15. A method according to claim 6, wherein the nucleic acid amplification procedure is carried out in an amplification chamber which is defined in part by the sensing surface.

16. A method according to claim 15, wherein the nucleic acid amplification procedure and the detection of the nucleic acid at the sensing surface are carried our concurrently.

17. A method according to claim 6, wherein the nucleic acid target is formed in the presence of an analyte by a nucleic acid amplification procedure, and the nucleic acid target includes a first specific recognition molecule, and wherein the sensing surface comprises a second specific recognition molecule which binds specifically to the first specific recognition molecule in the presence of the impure liquid sample.

18. A method according to claim 1, wherein the adherence of the nucleic acid target to the sensing surface is non-specific and thereby independent of the nucleotide sequence of the nucleic acid target.

19. A method according to claim 1, wherein the nucleic acid target in the crude initial sample adheres electrostatically to the sensing surface, changing the energy of the acoustic wave.

20. A method according to claim 1, wherein the sensing surface has a cationic layer, such as layer of a co-polymer comprising PLL, thereon, to which the nucleic acid target adheres, changing the energy of the acoustic wave.

21. A method according to claim 1, wherein biological macromolecules other than the nucleic acid target, and/or cell fragments and/or (added) reagents, adhere to the sensing surface, either without affecting the energy of the wave or affecting the energy significantly less than the adhered nucleic acid analyte.

22. A method according to claim 21, wherein the mass of biological macromolecules other than the nucleic acid target, and/or cell fragments and/or (added) reagents which adheres to the sensing surface may be greater than 20%, or greater than 50% of the mass of the nucleic acid target which adheres to the sensing surface.

23. A method according to claim 1, in which changes in the frequency of the acoustic waves arising from the adherence of the nucleic acid target and/or non-target nucleic acids and/or biological molecules and/or cell fragments and/or (added) reagents are not monitored by virtue of measurements of acoustic wave frequency or phase or velocity.

Description

DESCRIPTION OF THE DRAWINGS

[0022] An example embodiment of the present invention will now be illustrated with reference to the following Figures in which:

[0023] FIG. 1A is a schematic representation of a nucleic acid probe binding to an acoustic sensor sensing surface, along with some non-specific binding components; and FIG. 1B is a schematic representation of a corresponding negative.

[0024] FIGS. 2A and 2B show the changes over time (x-axis) in frequency (F) (FIG. 2A) and dissipation (D) (FIG. 2B), in the presence of positive (100) and negative (102) samples monitored in real-time with a QCM E4 acoustic sensor and using a device surface similar to that illustrated in FIG. 1A positive and FIG. 1B negative, respectively.

[0025] FIGS. 3A, 3B and 3C shows the changes in dissipation (D) (FIG. 3A) frequency (F) (FIG. 3B) and acoustic ratio (D/F) (FIG. 3C) between the positive (grey bars corresponding to 100) and negative (white bars corresponding to 102) samples (5 repeats), obtained with a QCM device and the surfaces shown in FIGS. 1A and 1B. Better discrimination between positive and negative samples can occur through dissipation measurement.

[0026] FIG. 4A is a schematic representation of a nucleic acid probe binding to an acoustic sensor sensing surface by virtue of specific interaction between neutravidin and biotin, along with some non-specific binding components; and FIG. 4B is a schematic representation of a corresponding negative.

[0027] FIGS. 5A and 5B represent dissipation (FIG. 5A) and frequency change (FIG. 5B) during the binding of biotinylated target NA to a neutravidin-modified QCM acoustic device surface illustrated in FIGS. 4A and 4B, in the presence of a positive sample (202) and a negative sample (200).

[0028] FIGS. 6A, 6B and 6C show the changes in dissipation (D) (FIG. 6A), frequency (F) (FIG. 6B) and acoustic ratio (D/F) (FIG. 6C) between positive (50 and 1000 cells in the initial sample) (202) and negative (0 cells in the initial sample) (200) samples (5 repeats each), obtained with the QCM device and the surfaces shown in FIGS. 4A and 4B. A much better discrimination capability is illustrated through dissipation (and here acoustic ratio) measurements.

[0029] FIGS. 7A, 7B, and 7C show the changes in amplitude, phase and acoustic ratio obtained with a Love wave acoustic device, utilizing a surface similar to that illustrated in FIGS. 1A and 1B (PEG-PLL); discrimination between positive and negative samples is only possible through amplitude measurements.

[0030] FIGS. 8A, 8B, 8C, and 8D are schematic diagrams of sensing apparatus with integrated nucleic acid amplification and acoustic detection, useful with either the implementation of FIGS. 1A and 1B or the implementation of FIGS. 4A and 4B. FIG. 8A is an exploded side view of a base unit (bottom of the figure) and disposable microfluidic cassette (top part of the figure); FIG. 8B is a top view of the base unit without the microfluidic cassette present; FIG. 8C is a top view of a disposable microfluidic cassette; FIG. 8D is a top view of the disposable microfluidic cassette fitted onto the base unit.

DETAILED DESCRIPTION OF EXAMPLE EMBODIMENTS

Example 1Polymer Layer

[0031] With reference to FIGS. 1A and 1B, a QCM acoustic wave device 1 has a substrate 2 having a gold surface 4 with a PEG-PLL co-polymer layer 6 formed thereon. The PEG-PLL co-polymer layer contains a layer of PLL (25)-g-PEG(2) with a layer of PLL (25)-g-PEG(5) thereon and is formed as set out in the experimental example below.

[0032] In use, a sample liquid 8, containing both target DNA 10 (in the case of a positive sample such as FIG. 1A, although it is absent in the case of a negative sample such as FIG. 1B) and other components 12, is brought into contact with the polymer layer (functioning as the sensing surface). The target DNA (or other NA analyte) may be amplified using an amplification process or may be detected without any amplification. The other components of the sample liquid include reagents for and/or products of a polymerisation reaction, and/or components from a patient sample, including biomolecules (such as protein, carbohydrates and/or lipids), cell fragments and so forth.

[0033] The PEG repels proteins and the PLL binds DNA, however there is still non-specific binding despite the presence of PEG. In the positive sample, the target DNA 10 binds to the sensing surface. In both the positive and negative samples, some of the other components 12 bind to the sensing surface.

[0034] An acoustic wave is generated by acoustic wave sensor 14, at a predetermined frequency, and the energy losses of the acoustic wave (in the case of a QCM device, the dissipation) in the presence of the sample liquid is measured. Example operating frequencies are set out in the experimental example below.

[0035] The energy loss of the acoustic wave is then compared with a reference value, which may be a measurement of the energy in the presence of a reference liquid, before the sample liquid was brought into contact with the sensing surface; a measurement of the energy loss at a second reference sensor; or a stored reference value. If the energy loss has changed sufficiently relative to the reference value, it is determined that the target DNA is present. In some embodiments, the amount of the target DNA present is estimated qualitatively from the magnitude of the difference between the measured energy and the reference value.

[0036] The DNA binds to the surface through electrostatic interactions, independently of nucleic acid sequence, producing a high change in energy loss (e.g. dissipation in the case of a QCM device). We have found that non-specific species that bind, e.g. cell-fragments, PCR-reagents, proteins, fats and carbohydrates present in the impure sample of milk containing lysed cells and cell growing medium bind tightly to the surface, producing a much lower change in energy loss (see FIG. 2B, where the dissipation of the control is much lower than that of the sample with the target NA). This happens even though the amount of non-specifically adsorbed mass is almost the same between the negative and positive samples (see FIG. 2A).

Experimental Results of Example 1: Polymer Layer

[0037] First Validation on a QCM

[0038] Results shown in FIG. 2, were produced by using the PLL-PEG on a QCM-gold surface depicted in FIG. 1 and as an impure liquid sample (8) milk containing, in the case of the positive sample, both the target DNA 10 (here 635 bp Salmonella DNA amplified during PCR) and other components 12 (here cell fragments produced from cell lysis, PCR reagents and polymerization by-products and nutrients from cell culture medium also present in the impure sample, such as proteins, carbohydrates and lipids). In the control experiment the sample 8 was similar to the above with the exception of Salmonella DNA which was not included. When each one of the two samples is brought into contact with the polymer layer (functioning as the sensing surface), the PEG repels the proteins and the PLL binds the DNA; however there is still non-specific binding despite the presence of PEG. In both the positive and negative samples, some of the other components 12 bind to the sensing surface.

[0039] It can be seen from FIG. 2A that there is a significant change in the frequency of the acoustic wave whether or not the target nucleic acid is present. This is as a result of non-specific binding to the sensing surface, which is inherently unreproducible and variable depending on the composition of the complex liquid applied to the sensing surface. However, it is apparent from FIG. 2B that, after an equilibration period, the change in dissipation due to non-specific binding in the negative sample is low whereas there is a clear change in the dissipation due to the binding of the target nucleic acid to the sensing surface.

[0040] Furthermore, FIGS. 3A through 3C show average results from five experiments similar to the one described above and shown in FIGS. 2A and 2B; indeed, a measurement of the change in dissipation (D) clearly distinguishes the positive sample from the negative sample, but a measurement of the change in frequency (F) is not reliable (large error bars) due to a strong signal arising from the mass of non-analyte material in the complex sample binding non-specifically to the sensing surface. With reference to FIG. 3C, a measurement of the acoustic ratio (D/F) is slightly better than a measure of the change in frequency (F) alone but, surprisingly, a measurement of the change in dissipation (D) alone gives the most reliable measurement of the presence or absence of the analyte, in an impure sample.

[0041] Second Validation on a Love Wave Device

[0042] Experiments were also carried out using a Love wave surface acoustic wave-based (SAW) sensor. The SAW sensor surface was covered with a PLL-PEG copolymer as set out above and cleaned by air plasma etching.

[0043] Salmonella cells isolated from milk or LB growth medium were lysed with Triton-X 100 and a genomic DNA region was amplified at 63 C. using the LAMP method. The amplification reaction was diluted 5 and loaded directly on the SAW surface covered with the PLL-PEG copolymer.

[0044] FIGS. 7A through 7C show corresponding measurements of the change in amplitude, phase and the acoustic ratio for a sample of lysed whole Salmonella cells together with the LAMP reagents, with (positive) and without (negative) the target nucleic acid. Both positive data shown are in milk but represent measurements carried out by a different person. Again, it can be seen that the change in amplitude, which is related to energy dissipation, is more reliable than the change in phase or the acoustic ratio.

Example 2Specific Binding

[0045] In an alternative embodiment, shown in FIGS. 4A and 4B, the gold surface 4 of a QCM sensor has a neutravidin layer 20 formed thereon. Neutravidin (deglycosylated avidin, Neutravidin is a trade mark) adheres directly to a gold surface. Formation of neutravidin layers is well understood by those skilled in the art.

[0046] An analyte NA (where present) may be amplified using an amplification procedure (e.g. PCR, LAMP, HDA, RCA) but the product NA includes a biotin moiety towards one end (for example, by using biotinylated primers in a nucleic acid amplification step).

[0047] The product of the amplification reaction, sample liquid 8, is brought into contact with the sensing surface. The sample liquid includes target nucleic acid 22 (where present in a positive sample) as well as other components 12 as before. In this case, the sample liquid includes unused reagents and by-products of the amplification reaction.

[0048] The biotin in the target NA (where present) binds specifically to the neutravidin through one or several specific points, and so the DNA is adhered to the sensing surface, extending away from the sensing surface, typically at a defined orientation. We have found that this has a substantial effect on the energy loss of the acoustic wave generated by the device 14 while other components (22) bind tightly to the device surface and have little effect on the energy loss of the acoustic wave but do significantly alter the mass-related signal of the acoustic wave and so the ratio of the change in energy loss to the change in frequency or phase.

[0049] Thus, this configuration also provides a suitable arrangement to reliably detect a target nucleic acid using a measurement related to the change in the energy loss of an acoustic wave produced by the acoustic wave sensor.

Experimental Results of Example 2: Specific Binding

[0050] Validation on a QCM

[0051] Experiments to validate the second example embodiment were carried out as follows:

[0052] In another example (FIG. 5), the impure sample is whole blood containing both the target DNA, here Salmonella amplified to have a biotin at one end (22) during Lamp amplification, and other components (12) such as the Lamp reagents and by-products and other non-specific DNA molecules and proteins present in the blood sample. The biotinylated NA Salmonella amplification products were detected after loading the impure LAMP amplification mixture on the surface of a device coated with neutravidin, to which biotin specifically binds.

[0053] 0, 50 or 1000 bacteria were spiked into 2.5 l of whole blood (with anticoagulant) and then mixed with LAMP reagents containing one biotinylated primer. A LAMP reaction took place for 30 min and the products of the reaction was loaded on a QCM gold crystal covered with Neutravidin (Neutravidin is a trade mark of Pierce Biotechnology, Inc.).

[0054] FIGS. 5A and 5B show the real-time change in dissipation and frequency for the reactions with 0 and 50 cells respectively. The experiment with 0 cells is labelled 200 (negative) and the experiment with 50 cells is labelled 202 (positive). FIGS. 6A to 6C summarize corresponding measurements of changes in dissipation, frequency and acoustic ratio.

[0055] It can be seen from FIGS. 6A through 6C, where the average changes over 5 experiments are presented, the change in dissipation provides a useful and reliable measurement with which to detect the presence of target NA.

[0056] In some embodiments, the NA has multiple specific binding moieties, for example it may be multi-biotinylated, and so typically binds the surface with multiple specific bonds.

Experimental Details

[0057] Materials

[0058] H.sub.2O.sub.2, H.sub.2SO.sub.4, Tris(hydroxymethyl)aminomethane hydrochloride (TRIS HCl), Phosphate buffered saline; 10 mM phosphate buffer; 138 mM NaCl; 2.7 mM KCl (PBS, P4417), PLL(225) and fetal bovine serum (FBS) were purchased from Sigma-Aldrich/Merck KGaA (Darmstadt, Germany). PLL(25)-g-PEG(2) and PLL(25)-g-PEG(5) were purchased from Nanocs Inc. (PG2K-PLY and PGSK-PLY, New York, U.S.A.). QCM gold sensors were purchased from Biolin Scientific (QSX301, Stockholm, Sweden). Nucleospin Gel and PCR clean-up kit (Macherey-Nagel, Germany). DNA primers 100 M (Metabion, Germany). APstl ladder (Minotech, Greece). NeutrAvidin Biotin-binding Protein (ThermoFisher, U.S.A.). Bst 3.0 DNA polymerase (NEB, U.S.A.). Salmonella Typhymurium cells were kindly provided by Institut Pasteur (Paris, France). UHT milk was used as a model real complex sample (milk consists of 3.5% fat, 3.5% proteins, 5% lactose (carbohydrate) and 10.sup.4 to 10.sup.5 somatic cells per mL). Luria-Bertani (LB) a nutrient-rich microbial broth that contains peptides, amino acids, water-soluble vitamins, and carbohydrates was prepared by mixing 10 g/L Tryptone, 5 g/L Yeast Extract and 5 g/L NaCl. Whole blood from a healthy donor was provided by the General University Hospital of Heraklion in a standard tube containing EDTA anticoagulant.

[0059] Methods

[0060] 1. Experimental Setup of Acoustic Measurements

[0061] 1.1. QCM-D Measurements:

[0062] Gold sensors were cleaned with piranha solution prepared in situ, adding 4 drops H.sub.2SO.sub.4 (95-97%) and 2 drops H.sub.2O.sub.2 (30%) on a gold surface. The surface was then rinsed with H.sub.2O and dried under a stream of nitrogen gas. All the experiments were carried out in buffer solution. Resonance frequency (F) and energy dissipation (D) changes were measured using a Q-Sense E4 QCM-D sensor (Biolin Scientific, Stockholm, Sweden) at operating frequency of 5 MHz and its overtones, with continuous a flow rate of 50 L/min at 25 C. PLL (25)-g-PEG (2) and PLL (25)-g-PEG (5), as well as PLL (225) films were formed on the clean gold-coated QCM surface by applying a solution of 0.1 mg/ml in PBS or Tris buffer on the device surface; PLL films were formed by applying a solution of 0.01% (w/v) in Tris or PBS. All results reported in this study regard the 7.sup.th harmonic overtone i.e. 35 MHz and the frequency is not divided by the overtone number.

[0063] 1.2: SAW Measurements:

[0064] Surface Acoustic Wave devices (SAW) operating at 155 MHz were prepared by photolithography. These devices were used to support a Love wave in a configuration employing a photoresist S1805 (Rohm and Haas, USA) waveguide layer of 1 m thickness. A Network analyzer (E5061A, Agilent Technologies, USA) and a LabVIEWsoftware (National Instruments, Austin, Tex.) were used for signal generation/detection and real-time monitoring of the acoustic signal. Prior to use, the polymer coated device surface was cleaned by air plasma etching (PDC-002, Harrick) for 150 s.

[0065] 2. DNA Amplification from Whole Salmonella Cells

[0066] 2.1 PCR Reactions:

[0067] DNA amplicons were produced from 1 L of Salmonella Typhimurium cells (provided by Pasteur Institute, Paris, France) added in various concentrations in the PCR reactions using the Hotstart polymerase kit (KAPA Biosystems Inc., Wilmington, Mass., USA) and following the manufacturer instructions. 10 pmoles of each of the forwardand reverse primers were included in each amplification reaction. The reactions were conducted with a PeqStar 2 (Peqlab Biotechnologie GmbH, Erlangen, Germany) thermocycler at 95 C. for 3 min, followed by 40 cycles of 95 C. for 10 sec, 62.5 C. for 10 sec and 72 C. for 10 sec. The final step was at 72 C. for 1 min. The primers used for the 635 bp DNA were:

TABLE-US-00001 Forward: 5-GACACCTCAAAAGCAGCGT-3, Reverse: 5-AGACGGCGATACCCAGCGG-3
and for the 195 bp fragment were:

TABLE-US-00002 Forward: 5-GGATCACTAAGCTGTGGATTACCTATTATC-3, Reverse: 5-CTGTTATTTCCTGCGTGGATATTTCTTTAG-3.

[0068] For the direct amplification from milk samples UHT whole milk was diluted 10 times (according to EU regulation) in LB growth medium and then spiked with Salmonella cells to a final concentration of 10.sup.3 CFU/L. 1 L of the complex sample was added in the PCR mix (25 L in total) along with 1.5 L of MgCl.sub.2 (25 mM) that was required to compensate for the PCR inhibitory effect of high calcium present in the milk sample.

[0069] 2.2 LAMP Reactions:

[0070] DNA amplicons were produced from 1 L of Salmonella Typhimurium cells added in various concentrations in the LAMP reactions using the Bst 3 polymerase. Salmonella cells were lysed for 10 min with 0.1% Triton-X 100. The reactions were conducted at 63 C. for 15-30 min. Six (6) primers were used:

TABLE-US-00003 F3 CGGCCCGATTTTCTCTGG 503-520 B3 CGGCAATAGCGTCACCTT 665-682 FIP GCGCGGCATCCGCATCAATA-TGCCCGGTAAACAGATGAGT 573-592(F1c),527-546(F2) BIP GCGAACGGCGAAGCGTACTG-TCGCACCGTCAAAGGAAC 593-612(B1c),635-652(B2) Loop-F GGCCTTCAAATCGGCATCAAT 547-567 Loop-B GAAAGGGAAAGCCAGCTTTACG 613-634.

[0071] The amplification mix contained the following:

[0072] 5.25 ul H.sub.2O, 2.5 L Isothermal Amplification Buffer II, 1.5 L MgSO4 100 mM, 3 L dNTPs 10 mM each, 0.25 L F3 10 uM, 0.25 L B3 10 uM, 4.5 L FIP 10 uM, 4.5 L BIP 10 uM, 1 L LoopF 10 uM, 1 L LoopB 10 uM, 0.25 L Bst 3.0 Polymerase

[0073] For the direct amplification from whole blood, 2.5 L of blood was spiked with Salmonella cells and added in the LAMP reaction.

[0074] Integrated Amplification and Detection Apparatus

[0075] One skilled in the art will appreciate that there are numerous ways in which the liquid sample may be brought into contact with the sensing surface.

[0076] In one example, shown in FIGS. 8A through 8D, an integrated amplification and detection device comprises a base 300 into which fits a disposable plastics cassette 302. The disposable plastics cassette comprises an inlet 304 and a channel 306 which extends from the inlet through an amplification chamber 308 to an acoustic detection region 310 and thereby to an outlet 312.

[0077] The chassis retains a heating element (resistive heater or peltier) 314 in thermal communication with the amplification chamber of a disposable cassette, when present. A temperature controller (not shown) regulates the temperature in the amplification chamber. An acoustic sensor 318 having electrodes 320, 322 is formed on the underside of the acoustic detection region 310 of the cassette, but with the sensing surface in contact with the interior of the acoustic detection region. The base 300 has a recess 324 for receiving the acoustic sensor, with electrical contacts 326 which connect to electrical contacts of the acoustic sensor, to drive the acoustic sensor and measure properties of the acoustic wave.

[0078] In use, a fresh cassette is fitted into the base. Buffer fills the cassette. A crude sample for analysis (e.g. a sample of patient tissue, blood, urine etc.) is mixed with amplification reagents and introduced into the inlet. The heating element and temperature controller are used to control the temperature in the amplification chamber as is known in the art while an amplification reaction takes place. The amplification reaction produces a target nucleic acid in large amounts if an analyte (which may or may not be the target nucleic acid) is present in the received crude sample. The liquid product of the amplification reaction is then drawn or pushed through the channel into the acoustic detection region by a pump or with a pipette, without an intermediate filter or another purification step. Material in the liquid product of the amplification reaction then adheres to the sensing surface. The acoustic sensor measures the dissipation of energy by the sensing surface once the liquid product is present and a processor determines the presence and optionally amount of nucleic acid analyte which is present.

[0079] In a still further alternative embodiment, a single chamber in a disposable cassette includes both the amplification and acoustic detection regions. In that case, amplification and acoustic detection can be carried out in the same chamber, at the same time. The temperature in the chamber is varied according to the requirements of the amplification procedure (e.g. kept constant in the case of an isothermal procedure, or cycled in the case of PCT etc.).

[0080] Further modifications and variations may be made within the scope of the invention herein disclosed.