MINERALIZED FOOT-AND-MOUTH DISEASE VIRUS LIKE PARTICLES, AND PREPARATION METHOD AND USE THEREOF

Abstract

Foot-and-mouth disease virus like particles, the particles including a structural protein VP0, a structural protein VP1 including a mineralization peptide, a structural protein VP3, and a calcium phosphate coat. The structural protein VP1 including a mineralization peptide is encoded by a gene sequence represented by SEQ ID NO. 7, SEQ ID NO. 8 or SEQ ID NO. 9. The structural protein VP0 is encoded by a gene sequence represented by SEQ ID NO. 2. The structural protein VP3 is encoded by a gene sequence represented by SEQ ID NO. 3. The calcium phosphate coat covers the structural protein VP0, the structural protein VP1 including a mineralization peptide, and the structural protein VP3.

Claims

1. Foot-and-mouth disease (FMD) virus like particles (VLPs), the VLPs comprising: a structural protein VPO; a structural protein VP1 comprising a mineralization peptide; a structural protein VP3; and a calcium phosphate coat; wherein: the structural protein VP1 comprising a mineralization peptide is encoded by a gene sequence represented by SEQ ID NO. 7, SEQ ID NO. 8 or SEQ ID NO. 9; the structural protein VPO is encoded by a gene sequence represented by SEQ ID NO. 2; the structural protein VP3 is encoded by a gene sequence represented by SEQ ID NO. 3; and the calcium phosphate coat covers the structural protein VP0, the structural protein VP1 comprising a mineralization peptide, and the structural protein VP3.

2. The VLPs of claim 1, wherein the structural protein VP1 comprising a mineralization peptide is encoded by the gene sequence represented by SEQ ID NO. 9.

3. The VLPs of claim 1, wherein the mineralization peptide of the structural protein VP1 is encoded by a gene sequence represented by SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6.

4. A method for preparing foot-and-mouth disease (FMD) virus like particles (VLPs), the method comprising: (1) constructing a recombinant plasmid comprising genes encoding a structural protein VP0, a structural protein VP1 comprising a mineralization peptide, and a structural protein VP3 of foot-and-mouth disease virus (FMDV), wherein: the structural protein VP1 comprising a mineralization peptide is encoded by a gene sequence represented by SEQ ID NO. 7, SEQ ID NO. 8 or SEQ ID NO. 9; the structural protein VP0 is encoded by a gene sequence represented by SEQ ID NO. 2; the structural protein VP3 is encoded by a gene sequence represented by SEQ ID NO. 3; (2) expressing and purifying the structural protein VP0, the structural protein VP1 comprising a mineralization peptide, and the structural protein VP3 of FMDV; (3) assembling FMD VLPs; and (4) mineralizing the FMD VLPs.

5. The method of claim 4, comprising: a) employing genomic DNA of Saccharomyces cerevisiae as a template and using smt3F and smt3R as primers, amplifying a smt3 gene, wherein gene sequences of the primers smt3F and smt3R are represented by SEQ ID NO. 10 and SEQ ID NO. 11, respectively; b) digesting the smt3 gene and a vector pET-28a using Nco I and BamH I, inserting the digested smt3 gene into the digested pET-28a vector, to yield a vector pSMK; and replacing a kanamycin resistance gene of the vector pSMK by an ampicillin resistance gene, to yield a vector pSMA; c) synthesizing coding genes of structural proteins VP0, VP3, and VP1 according to a gene sequence of serotype 0 FMD virus, where the coding gene of the structural protein VP1 is represented by SEQ ID NO. 1, the coding gene of the structural protein VP0 is represented by SEQ ID NO. 2, and the coding gene of the structural protein VP3 is represented by SEQ ID NO. 3; employing the synthesized coding genes of structural proteins VP0, VP3, and VP1 as templates, employing VP1F/VP1R, VPOF/VPOR, and VP3F/VP3R as primers, and amplifying the coding genes of the structural proteins VP0, VP3, and VP1, respectively; wherein a gene sequence of the primer VP1F is represented by SEQ ID NO. 12, a gene sequence of the primer VP1R is represented by SEQ ID NO. 13, a gene sequence of the primer VPOF is represented by SEQ ID NO. 14, a gene sequence of the primer VPOR is represented by SEQ ID NO. 15, a gene sequence of the primer VP3F is represented by SEQ ID NO. 16, a gene sequence of the primer VP3R is represented by SEQ ID NO. 17; d) digesting the amplified coding genes of the structural proteins VP0, VP3, and VP1 using the restriction enzymes BsmBI/BamH I, digesting the vector pSMK and pSMA using the restriction enzyme BsaI, inserting the digested coding genes of the structural proteins VP0, VP3, and VP1 into the digested vector pSMK or pSMA, to yield recombinant expression vectors pSMK/VP0, pSMK/VP1, and pSMA/VP3, respectively; e) employing the recombinant expression vector pSMK/VP1 as a template, employing T7BamHI/VP1XhoI as primers, and amplifying a DNA fragment comprising T7 promoter and the coding gene of the structural protein VP1; digesting the DNA fragment and the recombinant expression vector pSMK/VP0 using restriction enzymes BamHI/XhoI, to yield a recombinant co-expression vector pSMK/VP0-VP1, where a gene sequence of the primer T7BamHI is represented by SEQ ID NO. 18, and a gene sequence of the primer VP1XhoI is represented by SEQ ID NO. 19; 0 providing a mineralization peptide represented by SEQ ID NO. 4, SEQ ID NO. 5, or SEQ ID NO. 6, employing the recombinant co-expression vector pSMK/VP0-VP1 as a template, inserting the gene sequence of the mineralization peptide into a gene point of the VP1 gene sequence corresponding to the 150t.sup.h amino acid of the structural protein VP1 using inverse polymerase chain reaction (PCR), to yield a VP1 recombinant plasmid comprising the gene sequence of the mineralization peptide, wherein the VP1 recombinant plasmid comprising the gene sequence of the mineralization peptide is represented by SEQ ID NO. 7, SEQ ID NO. 8, or SEQ ID NO. 9; g) co-transforming the recombinant plasmid comprising the gene sequence of the mineralization peptide and the vector pSMA/VP3 into an expression strain BL21(DE3), inoculating the expression strain onto a culture plate containing kanamycin, chloromycetin, and ampicillinum, incubating overnight, screening out and scale-up culturing positive clones containing the mineralization peptide, purifying the positive clones, to yield target proteins; h) digesting the target proteins using a ubiquitin protease, removing ubiquitin-modified proteins using HisTrap HP chromatography, collecting and putting a flow-through liquid containing the structural proteins VP0, VP1, and VP3 from the chromatography into a pH 8.0 buffer solution containing 20 mM Tris-HC and 500 mM NaCl, and allowing the buffer solution to stand at 4 C. overnight, to yield VLPs; and i) adding the VLPs to a first solution, pH 7.4, comprising 80-100 mM Na.sup.+, 1-10 mM K.sup.+, 1-5 mM Ca.sup.2+, 1-10 mM Mg.sup.2+, 100-200 mM Cl.sup., 10-20 mM HCO.sup.3, 1-10 mM HPO4.sup.2, and 1-10 mM PO4.sup.3, and incubating for 10 min at room temperature; adding a second solution, pH 7.4 and equal to the first solution in volume, comprising 80-150 mM Na.sup.+, 2-20 mM Mg.sup.2-P, 1-20 mM Ca.sup.2-P, 100-200 mM Cl.sup., 100-200 mM HCO.sup.3, 1-10 mM HPO4.sup.2, and 1-10 mM PO44.sup.3 to the first solution, incubating at 4 C. overnight, and centrifuging for 10 min at 16000 rpm, to yield mineralized VLPs.

6. The method of claim 5, wherein the structural protein VP1 comprising a mineralization peptide is encoded by SEQ ID NO. 9.

7. A method of preparing a foot-and-mouth disease vaccine, the method comprising applying the foot-and-mouth disease (FMD) virus like particles (VLPs) of claim 1.

8. The method of claim 7, wherein the foot-and-mouth disease vaccine is prepared and stored at normal temperature.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0030] FIG. 1 shows the induced expression and purification of fusion proteins containing different mineralization peptides;

[0031] 1. N6VP1/VP3, after being induced; 2. N6VP1/VP3, before being induced; 3-4. purified N6VP1/VP3 sample; 5-6. purified W6 VP1/VP3 sample; 7. purified NwVP1/VP3 sample; 8. W6 VP1/VP3, before being induced; 9. W6 VP1/ VP3, after being induced; 10. Marker; 11. NwVP1/VP3, after being induced; 12. NwVP1/VP3, before being induced;

[0032] FIG. 2 shows the sucrose density gradient centrifugation of FMD VLPs containing a mineralization peptide;

[0033] FIG. 3 is an SEM image of mineralized VLPs;

[0034] FIG. 4 is a TEM image of mineralized VLPs (non-stained);

[0035] FIG. 5 shows energy dispersive spectrometer (EDS) analysis of the surface of mineralized VLPs;

[0036] FIG. 6 shows dynamic light scattering(DLS) analysis of supernatants obtained from centrifugation of mineralized systems at various pH values;

[0037] FIG. 7 shows Western-blotting analysis of mineralized systems at various pH values;

[0038] 1. Supernatant at pH 8.0; 2. Supernatant at pH 7.5; 3. Supernatant at pH 7.0; 4. supernatant at pH 6.5; 5. Supernatant at pH 6.0; 6. Pellet at pH 8.0; 7. Pellet at pH 7.5; 8. Pellet at pH 7.0; 9. Pellet at pH 6.5; 10. Pellet at pH 6.0; and 11. Non-mineralized VLPs;

[0039] FIGS. 8A-8D show DLS analysis of the stability of mineralized VLPs at various temperatures;

[0040] 8A. DLS analysis of a supernatant after standing for 1 day; 8B. DLS analysis of a supernatant after standing for 3 days; 8C. DLS analysis of a supernatant after standing for 5 days; and 8D. DLS analysis of a supernatant after standing for 7 days;

[0041] FIGS. 9A-9B show Western-blotting analysis of the stability of mineralized VLP at different temperature; and

[0042] FIG. 10 shows changes in antibody levels in guinea pigs immunized with various VLPs.

DETAILED DESCRIPTION

[0043] To further illustrate, experiments detailing foot-and-mouth disease (FMD) virus like particles (VLPs) and preparation method and use thereof are described below. It should be noted that the following examples are intended to describe and not to limit the description.

EXAMPLE 1

Construction of Foot-and-Mouth Disease (FMD) Virus Like Particles (VLPs)

[0044] 1. Construction of Recombinant Plasmids pSMK/VP0-VP1 and pSMA/VP3

[0045] (1) Construction of Small Ubiquitin-Like Modifier protein Fusion Expression Vectors pSMA and pSMK

[0046] a. The smt3 gene was amplified with the genomic DNA of Saccharomyces cerevisiae as a template and using smt3F and smt3R as primers. The primer sequences were:

TABLE-US-00004 smt3F: (SEQIDNO.10) 5GCCATGGGTCATCACCATCATCATCACGGGTCGGACTCAGAAGTCAAT CAA3; smt3R: (SEQIDNO.11) 5GGATCCGAGACCTTAAGGTCTCAACCTCCAATCTGTTCGCGGTG3;

[0047] b. The smt3 gene was digested by restriction enzymes Nco I and BamH I and inserted into the pET-28a vector that was digested by restriction enzymes Nco I and BamH I to obtain the vector pSMK, and replacing the kanamycin resistance gene of the pSMK by the ampicillin resistance gene, to obtain the vector pSMA.

[0048] (2) Construction of Recombinant Expression Vectors Comprising Genes Encoding the Structural Proteins of FMD Virus

[0049] The structural protein VP0, VP3, and VP1 coding genes were synthesized according to the sequence of serotype O FMD virus deposited under GenBank Accession No. JN998085.1, following the method as described in Hoover DM1, Lubkowski J. DNAWorks: an automated method for designing oligonucleotides for PCR-based gene synthesis. Nucl. Acids Res. (2002) 30 (10): e43.

[0050] The VP0, VP1 and VP3 coding genes were amplified with the synthesized genes as templates and using the following primers as below:

TABLE-US-00005 VP1F: (SEQIDNO.12) 5GGTCTCTAGGTACCACCAGCACGGGCGAA3 VP1R: (SEQIDNO.13) 5CGCGGATCCTCACAGACTTTGTTTGACCGG3 VP0F: (SEQIDNO.14) 5GGTCTCTAGGTGGTGCGGGCCAGTCATCTCC3 VP0R: (SEQIDNO.15) 5CGCGGATCCTCATTCTTTACTCGGAAATTC3 VP3F: (SEQIDNO.16) 5GGTCTCTAGGTGGTATCTTCCCGGTGGCGTG3 VP3R: (SEQIDNO.17) 5CGCGGATCCTCATTGCTGACGGGCATCAACC3

[0051] The VP1, VP0, and VP3 coding genes were obtained by Polymerase Chain Reaction (PCR) amplification using the primers VP1F/VP1R, VP3F/VP3R, and VPOF/VPOR respectively, in which the gene encoding VP1 has a sequence as shown in SEQ ID NO.1, the gene encoding VP0 has a sequence as shown in SEQ ID NO.2, and the gene encoding VP3 has a sequence as shown in SEQ ID NO.3. The amplified VP1, VP0 and VP3 coding genes were digested by BsmBI/BamH I, and inserted into the pSMK or pSMA that was digested by BsaI, to yield recombinant expression vectors which are designated as pSMK/VP0, pSMK/VP1, and pSMA/VP3 respectively. A DNA fragment comprising T7 promoter and prokaryotic expression elements and the VP1 coding gene was obtained by amplification with pSMK/VP1 as a template and using T7BamHI/VP1XhoI as primers, and the DNA fragment was digested by BamH I/Xho I, and inserted into the pSMK/VP0 that was also digested by BamH I/Xho I, to obtain a recombinant co-expression vector that was designated as pSMK/VP0-VP1. The T7BamHI/VP1XhoI primer sequences were:

TABLE-US-00006 T7BamHI: (SEQIDNO.18) 5GCAATTGGATCCCGTCCGGCGTAGAGGATCGA3 VP1XhoI: (SEQIDNO.19) 5GCGCACCTCGAGTCACAGAGTCTGTTTCTCAGG3

[0052] 2. Construction of VP1 Recombinant Plasmid Comprising the Gene Sequence of a Mineralization Peptide

[0053] Mineralization peptides N6 (SEQ ID NO.4), NW (SEQ ID NO.5), and W6(SEQ ID NO.6) were respectively inserted to the gene point of the VP1 gene sequence corresponding to the 15.sup.th amino acid of the structural protein VP1 using inverse PCR (polymerase chain reaction), using the recombinant co-expression vector pSMK/VP0-VP1 as a template, to yield a VP1 recombinant plasmid comprising the gene sequence of the mineralization peptide, which is represented by SEQ ID NO. 7, SEQ ID NO. 8, or SEQ ID NO. 9. The primers used in the amplification of the mineralization peptide N6 were A1/A2; the primers used in the amplification of the mineralization peptide W6 were B1/B2; and the primers used in the amplification of the mineralization peptide NW were C1/C2.

TABLE-US-00007 A1: (SEQIDNO.20) 5GGCATGAAGCCAAGTCCACGCCCATTGGCCCAGAAAGCGGCAAG3 A2: (SEQIDNO.21) 5GACACTGGTCCCACGTTTTACGCTTACTTGCAGGTCACCTCTCGC3 B1: (SEQIDNO.22) 5CGCCGCATTGGCCGCTTTGGCTTGGCCCAGAAAGCGGCAAG3 B2: (SEQIDNO.23) 5AAGAAATTTTTCTTCGCTGCTGTCTACTTGCAGGTCACCTCTCGC3 C1: (SEQIDNO.24) 5GAACCGGAAAGCCAGCGTCGTATTGGCCGTTTTGGCTTGGCCCAGAAA GCGGCAAGA3 C2: (SEQIDNO.25) 5TTCTTTATCATCGGTGCCTTCCAGACGCCAACGTACTTGCAGGTCACC TCTCGCAT3

[0054] The VP1 recombinant plasmid comprising the gene sequence of the mineralization peptide were obtained, which were designated as pSMK/VP0-N6VP1, pSMK/VP0-NWVP1, and pSMK/VP0-W6VP1, respectively.

[0055] 3. Expression and Purification of Capsid Protein

[0056] (1) The expression vectors pSMK/VP0-N6VP1, pSMK/VP0-NWVP1, and pSMK/VP0-W6VP1 were respectively co-transformed with the vector pSMA/VP3 into an expression strain BL21(DE3). The strain was inoculated onto a culture plate containing kanamycin, chloromycetin, and ampicillinum, and incubated overnight. A positive clone was screened out, and single clones were picked into an LB medium containing kanamycin, chloromycetin, and ampicillinum, and incubated at 37 C. and 220 rpm. A positive clone was identified, screened and sequenced by PCR.

[0057] (2) The positive clone containing N6, NW, and W6 peptides was scaled up at 37 C. and 220 rpm, until the OD600 of the bacterial solution was about 0.8. Then, the bacterial solution was induced with IPTG at a final concentration of 0.25 mM, incubated at 4 C. and 200 rpm for 16 hrs, and then centrifuged at 8000 rpm for 15 min to collect a bacterial pellet. The bacterial pellet was re-suspended in 10-20 mL of a buffer solution A (20 mM Tris-HCl, 500 mM NaCl, 5 mM imidazole, pH=8.4) in an ice bath, and ultrasonically homogenized (3 s-ultrasonication, followed by 3s-break-off, 20 min in total, power 300 W). After centrifugation at 12,000 xg for 30 min, a supernatant was collected. The target protein was manually purified by Ni-NTA His.Math.Bind R filler.

[0058] (3) The supernatant was allowed to bind to the filler at 4 C. for about 1 hr, by flowing through under gravity. The non-specifically bound impurity proteins were removed by washing with buffer solution A that was 10 times the volume of the column, and then the target proteins were eluted off using a buffer solution B (20 mM Tris-HCl, 500 mM NaCl, 300 mM Imidazol, pH=8.4) and stored at 70 C. As determined by SDS-PAGE and Western blotting, proteins with expected sizes were obtained (s shown in FIG. 1).

[0059] A fusion protein containing no mineralization peptide was also prepared.

[0060] 4. In-Vitro Assembly of FMD VLPs and Determination of Assembly Efficiency F

[0061] Following the instruction for use recommended by Invitrogn, the fusion protein was digested by a small ubiquitin-like modifier protease as follows. 20 82 g of the purified fusion protein with or without mineralization peptide was digested at 37 C. for 30 min by using 200 L of a buffer (50 mM Tris-HCl, 150 mM NaCl, pH 8.0, 0.2% Igepal (NP-40), 1mM DTT), and 10 pL of small ubiquitin-like modifier protease (1U/L). The small ubiquitin-like modifier protein tag was removed from the digested mixture by HisTrap HP chromatography, and a flow-through liquid containing VP0, VP1, and VP3 was collected into an assembly buffer solution (20 mM Tris-HC1, 500 mM NaCl, pH8.0). VLPs were assembled at 4 C. overnight.

[0062] The VLPs were separated by sucrose density gradient centrifugation. Specifically, 1.5 mL of an assembled sample with or without a mineralization peptide was placed over a sucrose concentration gradient of 45%-15%, and centrifuged at 38000 rpm and 4 C. for 3.5 hrs. Then the sample was detected by a UV detector by means of continuous injection, and a spectrum was plotted to determine the assembly of the VLPs based on the peak area. The results show that the W6 peptide-containing VLPs (W6 139/VP3) have the highest assembly efficiency, as shown in FIG. 2.

[0063] A sample peak containing VLPs was collected, quantified by double-antibody sandwich ELISA, and finally the assembly efficiency was determined.


Assembly efficiency of VLPs=amount of antigen comprising VLP sample peak/total amount of antigen loaded100%


The results show that the assembly rate of VLPs containing W6 peptide is 45% and the assembly rate of non-mutated VLPs is 30%.

[0064] 5. Mineralization and Characteristics AnMFMD CVLVIalysis of FMD VLPs

[0065] (1) Mineralization of FMD VLPs

[0066] VLPs with or without a mineralization peptide were added in an equal amount based on antigen to a first solution (pH 7.4) (containing 80-100 mM Na.sup.+, 1-10 mM K.sup.+, 1-5 mM Ca.sup.2+, 1-10 mM Mg.sup.2+, 100-200 mM Cl.sup., 10-20 mM HCO.sup.3, 1-10 mM HPO4.sup.2, and 1-10 mM PO4.sup.3), and incubated for 10 min at room temperature. Then, an equal volume of a second solution (pH 7.4) (containing 80-150 mM Na.sup.+, 2-20 mM Mg.sup.2, 1-20 mM Ca.sup.2, 100-200 mM Cl.sup., 100-200 mM HCO.sup.3, 1-10 mM HPO4.sup.2, and 1-10 mM PO4.sup.3) was added to the first solution, incubated at 4 C. overnight, and centrifuged for 10 min at 16000 rpm. The supernatant and pellet were collected respectively. The antigen content was determined by double-antibody sandwich ELISA, the mineralization efficiency was calculated, and then the morphology was analyzed by TEM. X-ray energy analysis was performed to determine the elemental composition on the surface of the mineralized VLS. The results show that the mineralization effect of W6 mineralization peptide (W6 139/VP3) is the best, and the maximum antigen level mineralized is up to 94 g/mL. However, the mineralization effect of the mineralization peptide NW (NW150/VP3) leaves much to be desired. Although the VLPs without a mineralization peptide (VP01/VP3) can also be mineralized, the mineralization rate is relatively random and the maximum antigen level mineralized is less than 50 g (Table 1). SEM (FIG. 3) and TEM (FIG. 4) show that there are a large number of virus particles in the pellet collected after mineralization, and EDS analysis reveals that the virus particles have Ca, P, O, and other elements distributed on the surface (FIG. 5).

[0067] The results show that after the mineralization peptide is inserted, the expression of the target protein and the assembly of VLPs are not affected. The mineralization effects exhibited by the three mineralization peptides are quite different. The mineralization level of VLPs containing one of the mineralization peptides is as high as 100 g, with a mineralization level of 99.7%. Although the mineralization rate of VLPs without mineralization peptides can reach 75%, the mineralization is unstable, and the mineralization level of VLPs is only 45 pg at most. The disclosure provides a new technical means for the development of ambient-temperature FMD VLP vaccines at normal temperature.

TABLE-US-00008 TABLE 1 Comparison of Mineralization Effects of Different Types of VLPs NW150/ N6P150/ W6 139/ VP01/ Name VP3 VP3 VP3 VP3 Maximum antigen level 46 84 94 45.12 (g/mL) Average mineralization rate 79 88 99 83.6 (%)

[0068] (2) Acid Resistance Analysis of Mineralized VLPs

[0069] The pH of the mineralized VLPs (W6 139/VP3) was adjusted to 8.0, 7.5, 7.0, 6.5 and 6.0, respectively, and allowed to stand at room temperature for 1 hr, and then detected by dynamic light scattering (DLS), ELISA and western blotting, to determine the pH resistance of the mineralized layer. The results show that when the pH value reaches 6.5, dissolution of the mineralized shell occurs, and the content of the small molecule material in the mineralized system is increased significantly. The DLS analysis peak is shifted to the left at 6.5 and 6.0 (FIG. 6). ELISA and western blotting (FIG. 7) also show the highest detection value at 6.5.

[0070] (3) Thermal Stability Analysis of Mineralized VLPs

[0071] The mineralized VLPs (W6 139/VP3) were stood at 4 C., 26 C. and 37 C., respectively, and sampled at Days 1, 3, 5, 7 and 9. The supernatant was detected by dynamic light scattering (DLS) and western blotting, to determine the effect of mineralization on the thermal stability of VLPs. The results show that the mineralized VLPs can be stood at 26 C. for 9 days and at 37 C. for approximately 7 days. After standing at 37 C. for 7 days, the content of the small molecule material in the mineralized system is increased significantly, and the DLS analysis peak is clearly shifted to the left (FIGS. 8A-8D). Western blotting (FIGS. 9A-9B) show that the antigen content in the supernatant is significantly increased, after standing at normal temperature for 12 days. After standing at 37 C. for 7 days, the antigen content in the supernatant is increased significantly.

[0072] In the disclosure, three mineralization peptides capable of accumulating calcium ions are respectively inserted into the structural protein VP1 of the serotype 0 FMD virus through genetic engineering technology. Intact VLPs are successfully expressed and assembled in E. coli, without affecting the assembly efficiency. Then, the VLPs are mineralized with a mineralizing agent, and the assembly effect of the FMD VLPs is improved. The FMD VLPs and use thereof promote the transition of protein vaccines from cold-chain vaccines to normal temperature vaccines.

Example 2

IImmunogenic Aanalysis pof mineralized FMD VLPs

[0073] The mineralization peptide-containing W6 139/VP3 and mineralization peptide-free VP01/VP3 FMD VLPs were mineralized following the method in Example 1 and emulsified with ISA-206 adjuvant. The guinea pigs weighed 200 g were immunized to determine the effect of mineralization on the immunogenicity of VLPs. The non-mineralized W6 139/VP3 and VP01/VP3 VLPs were used as controls. Each vaccine had an immunization dose of 0.5 mL, a total protein content of 50 p.g, and a VLP content of about 3 g. Blood was collected at 0, 7, 14, 21, 28, and 35 days after immunization, and the content of specific antibodies was determined by LPB-ELISA. The results show that the mineralized shell has an action of sustained release, and the level of antibody production against the mineralized VLPs is low at an early stage of immunization, but comparable to that against non-mineralized VLPs at a later stage (FIG. 10).

[0074] Unless otherwise indicated, the numerical ranges involved include the beginning and end values. It will be obvious to those skilled in the art that changes and modifications may be made, and therefore, the aim in the appended claims is to cover all such changes and modifications.