Animal models of cancer

10172333 ยท 2019-01-08

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides transgenic, large non-human animal models of cancer, as well as methods of using such animal models in the identification and characterization of therapies for cancer.

Claims

1. A viable transgenic pig whose genome comprises a homozygous R167H mutation in exon 5 on both alleles of the endogenous p53gene, wherein the p53 mutation results in an altered expression of a p53 translation product and/or in expression of a non-functional p53 protein; wherein said p53 mutation results in a phenotype of at least one of lymphoma, a renal tumor, a mesenteric tumor or an osteogenic tumor formation; and wherein said transgenic pig is the progeny of mated p53.sup.R167H/+ founder pigs or a descendant of said progeny, wherein said p53 .sup.R167H/+ founder pigs are made by a process of introducing a p53.sup.R167H targeting vector into porcine fibroblast cells, utilizing the p53.sup.R167H/+fibroblasts as nuclear donors for somatic cell nuclear transfer (SCNT), thereby producing p53.sup.R167H/+ founder pigs.

2. The transgenic pig of claim 1, wherein the homozygous R167H mutation in exon 5 of the endogenous pig p53 gene is a gain of function mutation.

3. The transgenic pig of claim 1, wherein the p53.sup.R167H targeting vector comprises SEQ ID NO: 1.

4. The transgenic pig of claim 1, wherein the p53.sup.R167H targeting vector further comprises a selectable marker gene flanked by LoxP sites, and upon introduction of Cre recombinase, the selectable marker gene is excised, thereby producing a selectable marker-free pig.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) This patent application file contains at least one drawing executed in color. Copies of this patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

(2) FIG. 1 is a schematic drawing showing one example of a method for generating TP53-targeted pigs. Fibroblasts are obtained from day 35 Yucatan fetuses. The targeting vector (with TP53 mutation indicated by asterisk) is introduced to fetal fibroblasts via AAV infection. Properly targeted cells are identified by PCR and Southern blot. Following nuclear transfer and fusion/activation, nuclear transfer embryos are transferred to recipient animals. After a 114 day gestation period, resulting piglets are TP53-targeted.

(3) FIG. 2 is a schematic drawing showing one example of a method for generating KRAS/TP53-targeted pigs. Fibroblasts are obtained from day 35 TP53-targeted Yucatan fetuses. The targeting vector (with KRAS mutation indicated by asterisk) is introduced to fetal fibroblasts via AAV infection. Properly targeted cells are identified by PCR and Southern blot. Following nuclear transfer and fusion/activation, nuclear transfer embryos are transferred to recipient animals. After a 114 day gestation period, resulting piglets will contain mutated KRAS and TP53.

(4) FIG. 3 shows a schematic drawing (not drawn to scale) of the gene targeting vector (SEQ ID NO: 1) used to modify porcine TP53. FIG. 3A shows a knockin targeting construct where R167H is represented by an asterisk. Porcine R167H corresponds to human R172H and murine R172H. FIG. 3B shows a knockout targeting construct where the termination codon is represented by the red STOP. Exons 2-11 of porcine TP53 are depicted as black boxes. Neo.sup.R contains a neomycin phosphotransferase cDNA driven by the phosphoglycerate kinase (PGK) promoter and flanked by loxP sites. The rAAV inverted terminal repeats (ITRs) are in shown as white dotted boxes. Each homology arm is 1.2-1.4 kb in length.

(5) FIG. 4 shows a schematic drawing (not drawn to scale) of the gene targeting vector (SEQ ID NO: 2) used to disrupt porcine ATM, described in corresponding Appln. Ser. No. 61/788,080, filed Mar. 15, 2013. Exons 55-58 of porcine ATM are depicted in black boxes. Neo.sup.R contains a neomycin resistance cDNA driven by the phosphoglycerate kinase (PGK) promoter and flanked by loxP sites. The rAAV inverted terminal repeats (ITRs) are also shown as white dotted boxes. Each homology arm is about 1.4 kb in length.

(6) FIG. 5 shows a schematic drawing (not drawn to scale) of the gene targeting vector (SEQ ID NOS: 3 and 4) used to modify porcine KRAS. Exons 1 and 2 of porcine KRAS are depicted as black boxes. The G12D mutation is shown with an asterisk. The LSL cassette contains a transcriptional/translational stop domain (STOP), a puromycin resistance cassette (puro.sup.R) driven by the phosphoglycerate kinase (PGK) promoter and is flanked by loxP sites. The rAAV inverted terminal repeats (ITRs) are shown as white dotted boxes. Each homology arm is 1.0 kb in length.

(7) FIG. 6 shows a PCR screen identifying TP53-targeted cells. FIG. 6A shows a representative 96-well gel containing 3 PCR-positive clone (boxed in white). The other wells represent Neo.sup.R clones resulting from random integration, or in the case of lighter bands, leftover DNA from dead cells. Each PCR-positive clone was re-electrophoresed on a conventional agarose gel to confirm proper size as seen in FIG. 6B. Expected sizes were 1.9 kb for targeted TP53 and 4.3 kb for an internal control sequence (wild-type LDLR). All lanes except 8 and 10 represent TP53-targeted cells.

(8) FIG. 7 shows a Southern blot of TP53-targeted cells. AflII/EcoNI digested DNA from PCR-positive cells was hybridized with a probe that detects porcine TP53 downstream of the targeting vector boundary. The TP53-targeted allele produced an approximately 6.0 kb band, and the wild-type band is approximately 4.3 kb. (Right) The same DNA was hybridized with a probe that detects the Neo.sup.R cassette, yielding only the targeted 7.8 kb band. Lanes 1 and 2 contain DNA from TP53.sup.R167H/+ cells, while lane 3 represents non-targeted cells. Lane 4 contains DNA from a wild-type pig.

(9) FIG. 8 shows TP53-targeted pigs. FIG. 8A shows four 1-day old TP53.sup.R167H/+ piglets. FIG. 8B shows a Southern blot of genomic DNA from TP53-targeted pigs. On the left, AflII/EcoNI digested genomic DNA was hybridized with a probe that detects porcine TP53 downstream of the targeting vector boundary. The TP53-targeted allele produced an approximately 6.0 kb band, and the wild-type band is approximately 4.3 kb. On the right, the same DNA was hybridized with a probe that detects the Neo.sup.R cassette, yielding only the targeted 7.8 kb band. Lanes 1-7 contain DNA from TP53.sup.R167H/+ piglets. Lane 8 contains DNA from a wild-type pig. FIG. 8C presents DNA sequence chromatographs (SEQ ID NOS: 5 and 6, respectively, in order of appearance) showing the R167 codon from a wild-type pig and a TP53-targeted pig.

(10) FIG. 9 shows a genomic Southern blot of wild-type, TP53-heterozygote, and TP53-homozygote piglets. On the left, AflII/EcoNI digested genomic DNA was hybridized with a probe that detects porcine TP53 downstream of the targeting vector boundary. The TP53-targeted allele produced an approximately 6.0 kb band, and the wild-type band is approximately 4.3 kb. On the right, the same DNA was hybridized with a probe that detects the Neo.sup.R cassette, yielding only the targeted 7.8 kb band. Lane 1 contains DNA from a wild-type piglet. Lanes 2, 5, 6, and 7 contain DNA from TP53.sup.R167H/+ piglets. Lanes 3 and 4 contain DNA from TP53.sup.R167H/R167H piglets.

(11) FIG. 10 is a schematic of the gene targeting strategy in one embodiment of the invention. In FIG. 10A, exons 1 and 2 of porcine KRAS are depicted as gray boxes. The G12D mutation is shown with an asterisk. The stop cassette contains a transcriptional/translational stop domain and a promoterless neomycin resistance cassette (STOP arrow) and is flanked by loxP sites (white arrowheads). Small black arrows are the PCR screen primers described in FIG. 10B. Homologous recombination junctions are shown as vertical dashed lines. Genomic Southern blot restriction enzyme sites are indicated by H (HindIII) and B (Bsu36I). Figure is not to scale. FIG. 10B shows the results of the PCR screen and allele specific Southern blot. Lanes 1-11 represent a portion of the PCR-positive cell clones from the initial screen. Lane 12 is a G12D positive control. Lane 13 is a WT KRAS sequence. A G12D-specific, biotin-labeled oligonucleotide probe was used to determine which of the KRAS-targeted clones also contained the desired G12D mutation. Lanes 1, 2, 5, 7, 9, and 11 contain G12D.

(12) FIG. 11 shows KRAS/TP53 pigs generated by the methods described herein. FIG. 11A shows KRAS/TP53 piglets at 1 day of age. In FIG. 11B (Left), HindIII/Bsu36I digested genomic DNA was hybridized with a probe that detects porcine KRAS downstream of the targeting vector boundary. The KRAS-targeted allele produced a 5.0 kb band, and the wild-type band is approximately 7.4 kb. (Right) The same DNA was hybridized with a probe that detects the Neo.sup.R cassette, yielding only the targeted 7.4 kb band. FIG. 11C is a DNA sequence chromatogram targeted KRAS locus from KRAS/TP53 pig. G12D is shown as the underlined GAT codon. FIG. 11D shows a Cre-mediated induction of KRASG12D expression. RT-PCR KRAS mRNA was probed by a G12D-specific biotin-labeled oligonucleotide. Presence of absence of reverse transcriptase (RT) or Cre recombinase is noted.

(13) FIG. 12 is a photo of liver from a neonatal TP53.sup.R167H/R167H pig, Case 1. FIG. 12A, 12B: Within the liver, focal atypia (arrows) was composed of irregular hepatic cords with enlarged hepatocellular cells and nuclei, 100 and 400. Inset: A binucleate hepatocyte (arrow) with marginated chromatin and a prominent nucleolus was much larger than adjacent hepatocytes (FIG. 12B, lower left, inset).

(14) FIG. 13 shows lymphoma in TP53.sup.R167H/R167H pigs. Early stage enlargement in inguinal lymph nodes were detected. FIG. 13A is a Coronal CT cross-sections illustrating the difference in lymph node short axis size: 26 mm in TP53.sup.R167H/R167H (m/m, Case 3) relative to 9 mm the TP53.sup.+/+ (+/+, Case 7). Image data was acquired was acquired four months prior to necropsy at 27 weeks of age. FIGS. 13B and 13C show lymphadenopathy was a consistent finding on external examination (arrows, FIG. 13B, Case 3) and at necropsy (FIG. 13C, Case 6). FIG. 13D show lymph nodes were consistently effaced by sheets of neoplastic lymphocytes (asterisks, Case 3, 100). FIG. 13E shows microscopically, the lymphomas had numerous mitotic figures (arrows) and frequent tingible body macrophages (arrowheads, 600).

(15) FIG. 14 shows lymphoma in TP53.sup.R167H/R167H pigs (m/m). FIG. 14A shows splenomegaly was a consistent finding (bottom, Case 3). FIG. 14B shows spleens were effaced by neoplastic lymphocytes (asterisks, bottom panel, Case 3), 40. In Case 2 (FIG. 14C), the spleen had ruptured with fibrinous exudate on the surface of the capsule (arrows). Microscopically, the ruptured spleen (Case 2) had necrotic foci (asterisks) and hemorrhage (red color, 20) (FIG. 14D). The lung in Case 2 (FIG. 14E, 14F) had intravascular emboli composed of cellular and nuclear debris with neoplastic cells occluding numerous arteries (arrows, FIG. 14E, 400) and capillaries in alveolar septa (arrows, FIG. 14F, 400)consistent with tumor lysis syndrome. Lymphoma pigs often had bridging infiltration by lymphoma cells (FIG. 14G, 14H) (asterisks) in portal regions of the liver (right panel, Case 4), 40. FIG. 14I shows trends for liver and spleen volumes as segmented from CT, relative to animal weight for a cohort of TP53.sup.R167H/+ pigs, showing the significantly elevated liver volume for lymphoma Case 4 (diamond) and slightly elevated spleen volume (square).

(16) FIG. 15 reflects peripheral blood parameters from non-diseased control (+/+,+/m), Cases 7, 9, 10) and lymphoma cases in TP53.sup.R167H/R167H pigs (m/m, Cases 2-4) at time periods 4-6 weeks prior to (1) and the week of (2) euthanasia/death. TP53.sup.R167H/R167H pigs were similar to non-diseased controls at time period 1, but had significant decreases in albumin (FIG. 15A, P<0.001), red blood cells (FIG. 15B, P<0.001) and platelets (FIG. 15C, P<0.05) compared to controls at time period 2. Lymphocyte counts (FIG. 15D) were similar to controls at time period 1, but by time point 2 there was a nonsignificant (P>0.05) trend toward increased numbers. Statistical analysis was performed with Two-Way ANOVA (repeated measures) with Bonferroni post-test.

(17) FIG. 16 shows an osteogenic tumor in a TP53.sup.R167H/R167H pig (Case 5). FIG. 16A: in-vivo imaging with computed tomography (CT) and magnetic resonance (MR) non-invasively identified a 28 mm cranial tumor shown in sagittal, coronal and axial views. CT data revealed the tumor had a mean density (137 HU) below that of bone, and had invaded the calvarium/skull. MR imaging with a 3D SPACE sequence demonstrated the heterogeneous content of the tumor and compression of brain tissue. FIG. 16B: The tumor (arrows, left panel) was external to but attached to the dura. FIGS. 16C, 16D: Removal of the tumor (FIG. 16C) revealed lysis and invasion of the tumor into the adjacent calvarium (arrows, FIG. 16D). FIG. 16E: The tumor was composed of spindle to round cells that produced irregular trabeculae of osteoid (arrows), 200.

(18) FIG. 17 shows an osteogenic tumor a in a TP53.sup.R167H/R167H pig (Case 6). In-vivo imaging with computed tomography (CT), showing coronal and sagittal cross-sectional views. Views from imaging time point 1 (FIG. 17A) show no evidence of tumor lesion, views from imaging time point 2 in CT and Magnetic Resonance Imaging (MRI) (51 days later) reveal aggressive tumor growth (39 mm). FIG. 17B, 17C) The extradural mass (arrows, FIG. 17B) expanded into the cranial vault (arrows, FIG. 17C) compressing the brain. FIG. 17D: The mass (asterisks) invaded into the frontal sinus cavity. FIG. 17E: The calvarial mass was composed of round to spindle cells that produced irregular trabeculae of osteoid (asterisks, 200). FIG. 17F: The neoplastic cells had varying sized nuclei with a prominent nucleoli (arrows, 600).

(19) FIG. 18 shows an osteogenic tumor in a TP53.sup.R167H/R167H pig. FIG. 18A shows an 18 mm lesion in the left distal femur with heterogeneous computed tomography (CT) density (Case 6). Time point 2 views show growth in the solid component of the lesion compared to time point 1. FIG. 18B: The tumor was composed of irregular trabeculae of osteoid and bone extending from the edge of the cortex (asterisks, 20). FIG. 18C: The bony trabeculae were at times lined by loose mesenchymal to fibrous tissue and uncommon rims of osteoblasts, 400.

(20) FIG. 19 shows an osteogenic tumor in a TP53.sup.R167H/R167H pig FIG. 19A: A 13 mm lytic tumor was identified through non-contrast enhanced computed tomography in the left distal femur (Case 5) FIGS. 19B and 19C: The tumor (arrows, FIG. 19B, 40) effaced bone marrow (note absence of trabeculae, right edge FIG. 19B) and was composed of sheets of pleomorphic round to spindle cells with scant osteoid deposition and multinucleate osteoclasts (arrows, FIG. 19C, 400) were prominent within the tumor.

(21) FIG. 20 shows examples of osteogenic tumors in the TP53.sup.R167H/R167H pigs. FIG. 20A: Proximal tibia tumor (arrows, 20) was composed of coalescing bone trabeculae that effaced most of bone marrow to edges of cortex. Inter-trabecular bone marrow had plump spindle cells (right, 400) with 1-2 nucleoli. 20 and 400. FIG. 20B: Sacrum tumor (arrows) was composed of large blood filled spaces that were partially surrounded by dense bone (asterisk, 20) and in other areas by loose connective tissue (right, 200) with cartilaginous/osteoid production. FIG. 20C: The tumor (arrows) was surrounded by a rim of hyperdense osteosclerosis (asterisks, middle, 20) and composed of a low cellularity non-mineralized zone (black asterisk, right, 200) that merged into a mineralized zone (white asterisk, right) and eventual sclerotic bone (top left of right image). FIG. 20D: Proximal tibial tumor was composed of focal increase of coalescing trabeculae (middle, 20) of osteoid and lamellar bone sometimes with central cartilage-like cores (deep blue color, right, 400) and lined by scattered loose connective tissue with uncommon osteoblasts.

(22) FIG. 21 shows a mesenteric lesion in a TP53.sup.R167H/R167H pig (Case 6). FIGS. 21A and 21B: Volumetric reconstruction of the skeletal system and mesenteric lesion from computed tomography data at time point 1 (FIG. 21A) and time point 2 (FIG. 21B) showing change in the structure of the lesion over the 7 week time period between data points. FIG. 21C: The mesentery had locally extensive ossification (arrows, FIG. 21C). FIG. 21D-F: The bony tissue (FIG. 21D, 40) ranged from plump spindle cells with progressive osteoid/mineralization (FIG. 21E, 400) to mature bone with a thin with rim of fibrous tissue (FIG. 21F, 400).

(23) FIG. 22 shows a renal tumor in a TP53.sup.R167H/R167H pig (Case 5). Change in renal tumor size over time was assessed with iodinated contrast enhanced computed tomography at time point 1 (FIG. 22A) and 51 days later at time point 2 (FIG. 22B), sagittal view shown. FIG. 22C: The renal tumor (arrow) was elevated from the cortex at the cranial pole of the right kidney. FIG. 22D: Cut surface of the tumor (T) showed a encapsulated (arrow) mass that was well-demarcated from normal kidney (K). FIG. 22E: The tumor (T) was composed of necrosis and hemorrhages (arrows pointing to patches) that were distinct from the unaffected kidney (K), 20. FIG. 22F: The necrotic tumor tissue had irregular tubules separated by cords of connective tissue (asterisks, 100). FIG. 22G: At the edges of the tumor, invading through the tumor capsule were small nests (See FIG. 13E, arrows) of poorly differentiated tubules with a high mitotic rate (arrows, G, 600).

(24) FIG. 23 shows molecular changes and cytogenetic abnormalities in TP53.sup.R167H/R167H pig tumors. FIG. 23A: Western blots show increased expression of mutant p53-R167H protein and its transcriptional target cyclin B1, in lymph nodes (LN) and osteogenic tumor (Os) from p53 homozygote (m/m) pigs relative to low levels of each wild-type protein in the brain (Br) of normal p53+/+ pigs. GAPDH levels serve as the loading control. The case number for each specimen is indicated. FIG. 23B: Representative karyotypes from wild-type pig skin tissue (+/+, left panel) and from p53 mutant homozygote (m/m, right panels); lymph node tissue and an osteosarcoma from Case 5 showing abnormal chromosome number and structures in the malignant cells.

(25) FIG. 24 shows defective molecular and biological activity of the porcine p53-R167H mutant protein. FIG. 24A: Schematic showing the known differential response of cells expressing wild-type p53 (+/+) and mutated (m) p53 alleles (+/m or m/m) to DNA damage. Adapted from Lane, 1992. FIG. 24B: Western blots of p53, p21 and GAPDH (loading control) levels in pig fibroblasts expressing wild-type p53 (+4), one mutant allele of R167H (+/m) or two R167H p53 alleles (m/m). Cells were treated with DMSO vehicle () or 400 ng/ml doxorubicin for 3 days (+Dxn). FIG. 24C: Representative histograms of cell cycle distributions for doxorubicin-treated cells from FIG. 24B. The percent of cells arrested in G1 phase (2N DNA content) is denoted in red, and cells undergoing apoptosis (<2N DNA content) highlighted in blue regions. FIG. 24D: Schematic showing that mutant KRAS induces cellular senescence in p53+/+ cells whereas cells expressing one or two mutant alleles of p53 escape KRAS-induced senescence and proliferate, during which time they sustain chromosomal alterations that foster cell transformation. FIGS. 24E and 24F: Pig fibroblasts of the indicated p53 genotype were infected with KRAS-G12V viruses, selected with puromycin for 3 days, and replated. FIG. 24E shows cell counts and FIG. 24F shows phase contrast microscopy. Cells expressing mutant p53 evade senescence and proliferate whereas those with wild-type p53 adopt the enlarged, flattened morphology of senescent cells.

(26) FIG. 25 shows examples of tumor free tissues in TP53.sup.+/+ (FIGS. 25A, 25B, 25D, 25E) and TP53.sup.+/R167H (FIG. 25C) pigs. Liver (Case 9) (FIG. 25A), 40. Spleen (Case 9) (FIG. 25B), 40. Lung (Case 8) (FIG. 25C), 400. Bone marrow (Case 10) (FIG. 25D), 40. Lymph node (Case 9) (FIG. 25E), 40.

DETAILED DESCRIPTION OF THE INVENTION

(27) The invention provides animal models of human disease (e.g., cancer), which can be used in the identification and characterization of approaches for treating the diseases and conditions. As is discussed further below, the animal models of the invention are large, non-human animals, such as pigs, which have been genetically modified to include one or more mutations in a gene associated with a particular disease or condition, for example, the TP53 gene, the ATM gene and/or the KRAS gene. The genetic modifications can result in the animals having one or more symptoms characteristic of the disease or condition. Animals exhibiting such symptoms are particularly advantageous in the development of therapeutic approaches, as candidate drugs and other approaches to treatment can be evaluated for effects on the symptoms in such animals. Thus, in addition to the animal models themselves, the invention also provides methods of using the animals for identifying and characterizing treatments.

(28) Further, the invention includes methods of making transgenic, large non-human animal models and cells that can be used in these methods. The animal models systems, methods, and cells of the invention are described further, below.

(29) In one embodiment, the invention provides a heterozygous or homozygous knock-out non-human mammal (e.g., a pig). In one example, the invention provides a pig with its endogenous porcine TP53 gene knocked-out (i.e., a TP53+/ or TP53/ pig). In another example, the invention provides a pig with its endogenous porcine ATM gene knocked-out (i.e., an ATM+/ or ATM/ pig). In yet another example, the invention provides a pig with both its endogenous porcine ATM and TP53 genes knocked-out.

(30) In another embodiment, the invention provides a heterozygous or homozygous knock-in non-human mammal (e.g., a pig). In one example, the invention provides a pig with its endogenous porcine TP53 gene modified by a knock-in mutation. In another example, the invention provides a pig with its endogenous porcine KRAS gene modified by a knock-in mutation. In yet another example, the invention provides a pig with both of its endogenous porcine TP53 and KRAS genes each modified by a knock-in mutation. In yet another example, the invention provides a pig with its endogenous porcine TP53 gene knocked out, and its endogenous KRAS gene modified by a knock-in mutation.

(31) In addition to animals including knock-outs or mutations in endogenous genes, the invention also includes transgenic, large non-human animal models of human diseases and conditions (e.g., pigs), in which one or more endogenous genes associated with the diseases or conditions are knocked-out (i.e., genetically altered in such way as to inhibit the production or function of the products of these genes) and replaced with a comparable wild-type or mutated gene derived from a different animal (e.g., a human). In one example, a pig with its endogenous porcine TP53, ATM and/or KRAS gene knocked-out, expresses a mutant human TP53, ATM and/or KRAS transgene. Alternatively, the human transgene may encode a normal, wild-type copy of a gene of interest (e.g., TP53, ATM or KRAS). These embodiments of the invention are especially useful for the generation of non-human animal models of human diseases and conditions that can be used to test existing and potential therapeutics that may only (or may preferentially) modulate or treat the disease when contacting, or being in the presence of, human copies of the disease gene or protein in question.

(32) The invention is described herein in reference to large animal models of cancer, which are generated by mutation, deletion or replacement of one or more of the TP53, ATM and KRAS genes. However, the methods of the invention are also applicable to the development of animal models of additional diseases and conditions.

(33) The transgenic animals of the invention can be made using the following general strategy, which combines gene targeting and somatic cell nuclear transfer (SCNT), also known as cloning. Briefly, the genome of a cell (e.g., a fetal fibroblast) from an animal of interest, such as a pig, is genetically modified by, for example, gene targeting by homologous recombination, to create a donor cell. According to the methods of the invention, the genetic modification results in at least partial inactivation of a gene associated with a particular disease or condition (e.g., a TP53 or ATM gene in cancer), as will be described in further detail below. The nucleus of such a genetically modified donor cell (or the entire donor cell, including the nucleus) is then transferred into a so-called recipient cell, such as an enucleated oocyte. After activation and, typically, a brief period of in vitro culture, the resulting embryo is implanted into a surrogate female in which development of the embryo proceeds. This approach is illustrated with respect to pigs in FIG. 1. Typically, the donor cell, oocyte, and surrogate female are of the same species, but the sources can be different species, as is known in the art.

(34) In this example, the genetic modification may also result in activation or overexpression of a gene associated with a particular disease or condition, or the expression of a mutated form of such a gene (e.g., a KRAS gene in cancer), as will be described in further detail below. This modification may be introduced alone or in connection with a second modification to another gene (for example, TP53). This approach is illustrated with respect to pigs in FIG. 2. While the genotype discussed in the Examples below is KRAS.sup.G12D-LSL/+/TP53.sup.R167H/+ (LSL stands for lox-Stop-lox, or a Stop cassette), these pigs are referred to herein as KRAS/TP53-targeted for simplicity and clarity. Further, while the Examples describe a conditional KRAS mutation inserted on the background of TP53-targeted pigs, the invention also includes large animal models with only the conditional KRAS mutation.

(35) Similar procedures have been used to develop two different gene-targeted porcine models of cystic fibrosis, and a model of atherosclerosis. See, e.g., Rogers, C. S., et al. J Clin Invest 2008, 118 (4), 1571-7; Rogers, C. S., et al. Science 2008, 321 (5897), 1837-41; U.S. Pat. No. 7,989,675; U.S. patent application Ser. Nos. 13/288,720, 13/368,312 and 13/624,967. In studies for which genetic variability can be problematic, the ability to generate genetically identical large animals (for example, pigs), as well as control animals that are genetically identical except for the specific mutation, provides a resource that allows researchers to study specific mechanisms and treatments without concern of extraneous genetic factors.

(36) Large animal models for cancer (for example, the TP53-targeted pig, the ATM-targeted pig, and the KRAS-targeted pig), will also provide a basis for research into aspects of cancer development and progression which are currently lacking in mouse models.

(37) Details of methods for making large genetically modified animals according to the invention are provided below. Additional information concerning methods for making genetically modified pigs and other large animals is known in the art and can also be used in the present invention (see, e.g., U.S. Pat. No. 7,547,816; and WO 2005/104835; Prather et al., Reproductive Biology and Endocrinology 1:82, 1-6, 2003; Hao et al., Transgenic Res. 15:739-750, 2006; Li et al., Biology of Reproduction 75:226-230, 2006; Lai et al., Nature Biotechnology 24(4):435-436, 2006; Lai et al., Methods in Molecular Biology 254(2):149-163, 2004; Lai et al., Cloning and Stem Cells 5(4):233-241, 2003; Park et al., Animal Biotechnology 12(2):173-181, 2001; Lai et al., Science 295:1089-1092, 2002; Park et al., Biology of Reproduction 65:1681-1685, 2001).

(38) The transgenic animals of the invention can be any transgenic, large non-human animal. In one embodiment of the present invention, the transgenic animal is a swine or pig. Pigs share many similarities with humans including anatomy, biochemistry, physiology, size (particularly miniature pig breeds), lifespan, and genetics. The pig has proven to be an excellent model for obesity, diabetes, alcoholism, hypertension, skin physiology, intestinal function, nutrition, and injury (see, e.g., Rogers, C. S., et al. Am J Physiol Lung Cell Mol Physiol 2008, 295 (2), L240-63). Recently, two porcine models of cystic fibrosis were developed that demonstrate all of the clinical manifestations of the human disease, including meconium ileus, pancreatic insufficiency, and lung disease. See, e.g., Rogers, C. S., et al. Science 2008, 321 (5897), 1837-41; Meyerholz, D. K., et al. Am J Respir Crit Care Med 2010, 182 (10), 1251-61; Stoltz, D. A., et al. Sci Transl Med 2010, 2 (29), 29ra31; and Meyerholz, D. K., et al. Am J Pathol 2010, 176 (3), 1377-89. In addition, similarity of porcine and human organs has led to a large effort to develop them as a source of organs for xenotransplantation (see, e.g., Cooper, D. K., et al. Annu Rev Med 2002, 53, 133-47). Furthermore, the reproductive characteristics of swine are favorable for their use as a model (See Table 1). Their relatively fast maturation rate and the large number of offspring generated from a single sow in one year allow a colony to rapidly expand.

(39) TABLE-US-00001 TABLE 1 Reproductive characteristics of several species (values are approximate). Gestation Sexual Offspring Deliveries Offspring Species time maturity per delivery per year per year Mouse 20-22 d 40-60 d ~6 ~17 100 NH primate 150-175 d 4-5 yr 1 2 1-2 Minipig 114 d 5-6 mo 4-7 ~3 12-21

(40) Cancer has not been widely studied in pigs, primarily because the vast majority of pigs are used for commercial pork production, where the average lifespan is 6-8 months, and any pigs displaying poor health are culled from the herd. However, there is a significant body of literature describing porcine cancers that are remarkably similar to humans in terms of frequency, tumor biology, diversity, and genetics. Like humans, cancer in pigs is rare, and when it does develop, tumors appear to be of epithelial cell origin, which is in stark contrast to the mesodermal origin predominant in mice. See Adam, S. J., et al., Oncogene 2007, 26 (7), 1038-45; Harmon, B. G., et al., J Vet Diagn Invest 2004, 16 (6), 587-9; Kleinschmidt, S., et al., Vet Pathol 2006, 43 (4), 569-73. Spontaneous tumors have been seen in the mouth, kidney, liver, GI tract, skin, and endometrium, with many of these metastasizing to lymph nodes, lungs and other organs. See Pathak, S., et al., Int J Oncol 2000, 17 (6), 1219-24; Harmon, B. G., et al., J Vet Diagn Invest 2004, 16 (6), 587-9; Kleinschmidt, S., et al., Vet Pathol 2006, 43 (4), 569-73; Grieco, V., et al., J Comp Pathol 2006, 134 (2-3), 143-51; Fisher, L. F., et al., J Comp Pathol 1978, 88 (4), 505-17; Sandison, A. T., et al., Cancer 1968, 21 (4), 727-42; Madewell, B. R., Yale J Biol Med 1981, 54 (2), 111-25. Induced porcine models are being attempted in numerous tissues including liver, pancreas, skin, and esophagus. See Li, X., et al., Cardiovasc Intervent Radiol 2006, 29 (3), 420-8; Vinter-Jensen, L., et al., Gastroenterology 1997, 113 (4), 1367-74; Monteiro-Riviere, N., et al., Cutan Ocul Toxicol 2006, 25 (2), 103-19; Azzi, C., et al., Carcinogenesis 2006, 27 (1), 137-45.

(41) Genetic induction of tumorigenesis in porcine cells using genes known to cause cancer in humans has produced xenograft cancer models in pigs. See Adam, S. J., et al., Oncogene 2007, 26 (7), 1038-45; Cho, P. S., et al., Blood 2007, 110 (12), 3996-4004. Though these pigs have limited utility due to expensive immunosuppressant regimens, this study demonstrated that pig cells are similar to human cells in their resistance to transformation, suggesting a common tumorigenesis process. For example, porcine p53 response to DNA damaging agents has been studied in pig cells, and both UV radiation and chemical carcinogens stabilize the protein just as in humans. See Qiu, Y., et al., Biochem Biophys Res Commun 2008, 377 (1), 151-5.

(42) The porcine genome project was recently completed. The reference breed for the initial genome data was the domestic Duroc pig. The sequence of the TP53 locus was determined from the miniature pig breed (Yucatan). Like human TP53, the Yucatan pig ortholog has 11 exons and a highly conserved gene structure. Porcine p53 is 81% identical to human p53 (92% identical within the DNA-binding domain), with most of the differences found in the nonconserved and intrinsically disordered proline-rich region. See Joerger, A. C., et al., Cold Spring Harb Perspect Biol 2010, 2 (6), a000919. Also, all of the hotspot mutation (and potentially druggable) sites are conserved.

(43) Similarly, KRAS sequence and function is highly conserved across species (99% amino acid sequence identity). Thus, the porcine KRAS.sup.G12D mutation described in the Examples is believed to behave in a manner similar to the human ortholog. Further supporting this assumption, the orthologous mutation in mice recreates the constitutive activation seen in the human protein. See, e.g., Schubbert, S., et al., Nat Rev Cancer 2007, 7 (4), 295-308; Ellis, C. A., et al., Cell Signal 2000, 12 (7), 425-34.

(44) The invention includes animals in which only one allele of a targeted gene (e.g., TP53, ATM or KRAS) is disrupted or mutated, with the other allele remaining unaffected. These animals, which are referred to herein as heterozygous or hemizygous animals, can be used, for example, as models to study the development or progression of a disease (for example, cancer) in heterozygous animals. Further, these animals can be used in breeding approaches to generate homozygous mutants, if desired, for example, in the case of diseases caused or exasperated by homozygous recessive mutations.

(45) The heterozygous animals of the present invention can also be used as animal models themselves, for example, in the case of diseases caused by autosomal dominant mutations, or where disruption of one allele of the targeted gene may result in some phenotypic expression of the mutation that is less severe than disruption of both alleles.

(46) Also included in the invention are homozygous mutant animals, in which both alleles of a target gene (e.g., TP53, ATM or KRAS) are disrupted or mutated, by the same or different mutations. In addition to being obtainable by breeding approaches involving hemizygous animals, homozygous mutant animals can also be obtained using an approach in which a cell (e.g., a fetal fibroblast) including a mutation in one allele, such as a cell obtained from an animal produced using the method summarized above, is subjected to gene targeting by homologous recombination to achieve modification of the remaining allele. The resulting donor cell can then be used as a source of a modified nucleus for nuclear transfer into a recipient cell, such as an enucleated oocyte, leading to the formation of a homozygous mutant embryo which, when implanted into a surrogate female, develops into a homozygous mutant animal.

(47) A target gene (e.g., a TP53, ATM or KRAS gene) can be subject to genetic modification in any appropriate cell type of a species for which it is desired to create an animal model of a disease associated with mutation of the gene, according to the invention. As is understood in the art, it is necessary to be able to culture and carry out homologous recombination in a cell that is to be used as a donor cell. A particular example of such a cell, which is described in more detail below in connection with pigs, in the experimental examples, is the fetal fibroblast. These cells can be obtained using, for example, the approach described in U.S. Pat. No. 7,547,816 and other references cited herein.

(48) The invention also includes the use of other cell types that may be present in the cell preparations obtained using the method described in U.S. Pat. No. 7,547,816. Additional examples of cells that can be used as donor cells in making the transgenic animals of the invention include other fetal cells, placental cells, or adult cells. Specific examples of such cells for gene targeting include differentiated cells such as fibroblasts, epithelial cells, neural cells, epidermal cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, B-lymphocytes, T-lymphocytes, erythrocytes, macrophages, monocytes, placental, and muscle cells.

(49) If a cell to be genetically altered is derived from an embryo or a fetus, the cell (e.g., a fetal cell or placental cell) can be isolated at any time during the gestation period until the birth of the animal, which may or may not be itself genetically altered. In the case of a pig, such cells can be obtained, for example, between 20 to 90 days of gestation, between 25 to 60 days of gestation, between 30 to 45 days of gestation, or between 35 to 40 (e.g., at 35 days) of gestation. The time periods for obtaining cells from other animals is known in the art (see, e.g., U.S. Pat. Nos. 7,420,099 and 7,928,285).

(50) Gene targeting carried out to make the cells and animals of the invention can result in gene inactivation by disruption, removal, modification, or replacement of target gene sequences. For example, inactivation can take place by the insertion of a heterologous sequence and/or a stop codon into a target gene. Gene targeting can also result in a point mutation, e.g., a missense mutation, as is described in the Examples below. Further, gene targeting can also result in gene activation, for example, by the insertion of an activating mutation or a GOF mutation, as is also described in the Examples below.

(51) As is known in the art, inserted sequences can replace previously existing sequences in a gene or can be added to such sequences, depending on the design of the targeting construct. In another example, deletion of a sequence using homologous recombination results in a frameshift mutation that yields a prematurely truncated and non-functional protein. Also as is known in the art, the design of targeting constructs can be altered, depending upon whether it is desired to completely knock out the function of a gene, maintain some level of reduced function, or introduce a gain of function, e.g., by inducing expression of a mutated gene product or by inducing expression of a gene that would otherwise not be expressed. Such changes may be achieved by, for example, replacement with sequences that are identical to wild-type sequences, except for the presence of specific mutations giving rise to features of the target disease. In other approaches, coding sequences are not altered or are minimally altered and, rather, sequences impacting expression of a target gene, such as promoter sequences, are targeted. In any case, selectable marker insertion is often desirable to facilitate identification of cells in which targeting has occurred. If desired, such markers or other inserted sequences can later be removed by, e.g., cre-lox or similar systems.

(52) A humanized cancer model (for example, a TP53/ animal expressing a mutant human TP53 transgene) can be made numerous ways, including, but not limited to: i) introducing a mutant human TP53 cDNA, partial mutant human TP53 gene, or entire human TP53 gene carrying a mutation into animal (e.g., porcine) TP53/ cells, selecting for mutant human TP53 gene insertion, and using these cells as nuclear donors in somatic cell nuclear transfer, and ii) introducing a mutant human TP53 cDNA, partial mutant human TP53 gene, or entire human TP53 gene carrying a mutation to animal TP53/ cells into matured oocytes, fertilizing, then transferring to a recipient female. Additionally, this example can apply to any of several genes related to cancer development and progression in humans, for example, ATM and KRAS.

(53) As is known in the art, targeted gene modification requires the use of nucleic acid molecule constructs having regions of homology with a targeted gene (or flanking regions), such that integration of the construct into the genome alters expression of the gene, either by changing the sequence of the gene and/or the levels of expression of the gene. Thus, to alter a gene, a targeting construct is generally designed to contain three main regions: (i) a first region that is homologous to the locus to be targeted (e.g., the TP53, ATM or KRAS genes or a flanking sequence), (ii) a second region that is a heterologous polynucleotide sequence (e.g., encoding a selectable marker, such as an antibiotic resistance protein) that is to specifically replace a portion of the targeted locus or is inserted into the targeted locus, and (iii) a third region that, like the first region, is homologous to the targeted locus, but typically is not contiguous with the first region of the genome. Homologous recombination between the targeting construct and the targeted wild-type locus results in deletion of any locus sequences between the two regions of homology represented in the targeting vector and replacement of that sequence with, or insertion into that sequence of, a heterologous sequence that, for example, encodes a selectable marker. Use of such promoters may not be required in cases in which transcriptionally active genes are targeted, if the design of the construct results in the marker being transcribed as directed by an endogenous promoter. Exemplary constructs and vectors for carrying out such targeted modification are described herein. However, other vectors that can be used in such approaches are known in the art and can readily be adapted for use in the invention.

(54) In order to facilitate homologous recombination, the first and third regions of the targeting vectors (see above) include sequences that exhibit substantial identity to the genes to be targeted (or flanking regions). By substantially identical is meant having a sequence that is at least 80%, preferably at least 85%, preferably at least 90%, more preferably at least 95%, even more preferably at least 98%, and even more preferably 100% identical to that of another sequence. Sequence identity is typically measured using BLAST (Basic Local Alignment Search Tool) or BLAST 2 with the default parameters specified therein (see, Altschul et al., J. Mol. Biol. 215: 403-410, 1990; Tatiana et al., FEMS Microbiol. Lett. 174: 247-250, 1999). These software programs match similar sequences by assigning degrees of homology to various substitutions, deletions, and other modifications. Thus, sequences having at least 80%, preferably at least 85%, preferably at least 90%, more preferably at least 95%, even more preferably at least 98%, and even more preferably 100% sequence identity with the targeted gene loci can be used in the invention to facilitate homologous recombination.

(55) The total size of the two regions of homology (i.e., the first and third regions noted above) can be, for example, approximately between 1-25 kilobases (for example, approximately between 2-20 kilobases, approximately between 5-15 kilobases, or approximately between 6-10 kilobases), and the size of the second region that replaces a portion of the targeted locus can be, for example, approximately between 0.5-5 kilobases (for example, approximately between 1-4 kilobases, approximately between 1-3 kilobases, approximately between 1-2 kilobaeses, or approximately between 3-4 kilobases).

(56) The targeting constructs can be included within any appropriate vectors, such as plasmid or viral vectors (e.g., adenovirus or rAVV vectors), which can be introduced into cells using standard methods including, for example, viral transduction, electroporation, or microinjection.

(57) Recombinant adeno-associated virus has been used to deliver gene targeting vectors to cell lines and primary cells (see, e.g., Russell, D. W., et al. Nat Genet 1998, 18 (4), 325-30). For example, rAAV has been used to introduce two different targeted modifications to the porcine CFTR gene. See, e.g., Rogers, C. S., et al. J Clin Invest 2008, 118 (4), 1571-7, U.S. Pat. No. 7,989,675 and U.S. patent application Ser. No. 12/283,980.

(58) The use of a rAAV to deliver the targeting construct offers many benefits. First, rAAV1 (and other rAAV serotypes) infects pig fetal fibroblasts with nearly 100% efficiency. See, e.g., Rogers, C. S., et al. J Clin Invest 2008, 118 (4), 1571-7. Second, rAAV infection of pig fetal fibroblasts results in little or no cell toxicity. Third, rAAV infection results in the delivery of a single-stranded gene-targeting construct directly to the nucleus, the amount of DNA per cell is small, and it can infect many cell types. Importantly, the ratio of homologous recombination events to random integrations is more favorable than that seen with electroporation of lipid-mediated transfection. See, e.g., Vasquez, K. M., et al. Proc Natl Acad Sci USA 2001, 98 (15), 8403-10.

(59) The methods of the invention, employing rAAV vectors, resulted in high levels of gene targeting efficiency in these somatic cells, as compared to prior methods. Central to the methods of the invention is the fact that the entire procedure was performed in a time-sensitive manner, because excessive cell culture time (for example, more than 30 days) negatively impacts nuclear transfer efficiency (Lai et al., Cloning and Stem Cells 5(4):233-241, 2003). Following fibroblast harvest from day 35 fetuses, the cells were frozen within 48 hours. The use of an AAV vector to deliver the gene targeting construct allowed targeting to begin 24 hours after thawing cells and required no cell detachment and re-attachment, which is required in other methods. Multiple cell detachment and re-attachment events (trypsinization) are thought to decrease the ability of a cell to serve as a nuclear donor in nuclear transfer. Further, G418 selection in 48 96-well plates prevents the need for the more conventional, time-consuming isolation of resistant clones with cloning rings. The screen for gene targeted clones was designed such that all positive clones could be identified and frozen within a 3-5 day period. All clones were frozen by day 18, therefore the cells have been in culture approximately 20 days since being harvested from the fetus. In this aspect of the invention, reduction of the time in culture increases the likelihood that cells used as nuclear donors are viable, normal, and euploid.

(60) Accordingly, the invention provides a method of gene-targeting cells, such as pig cells (e.g. pig fetal fibroblasts), in which the number of days in culture (during which targeting and selection takes place) is preferably less than 30 days, preferably 25-29 days, preferably 20-24 days, and more preferably 19, 18, 17, 16, 15, or fewer days. To facilitate this method, the selection can take place in multi-well plates, as described further below. Further, the cells may be frozen shortly after harvest (for example, within 24, 48 or 96 hours). After cell thawing (or after harvest, if the cells are not previously frozen), gene targeting with a rAAV vector can be carried out within, for example, 12, 24, 36 or 48 hours, without the use of multiple detachment/re-attachment events, and selection can proceed in an expedited manner, such as by use of multi-well plates (e.g., 96 well plates), prior to freezing.

(61) Other types of vectors, or more specifically other types of targeting construct delivery methods, are also available to those of skill in the art and may be used in the present invention. Such methods include cell transfection methods, including calcium phosphate, lipofection, electroporation, and nuclear injection, all of which can be used to deliver the targeting construct. If the gene is transcriptionally active in the cell being used, then a promoterless selectable strategy can be employed, so that antibiotic resistance will only be found in cells that have had a recombination event within the transcribed unit.

(62) Genetically targeted cells are typically identified using a selectable marker, such as neomycin. If a cell already contains a selectable marker, however, a new targeting construct containing a different selectable marker can be used. Alternatively, if the same selectable marker is employed, cells can be selected in the second targeting round by raising the drug concentration (for example, by doubling the drug concentration), as is known in the art. As is noted above, targeting constructs can include selectable markers flanked by sites facilitating excision of the marker sequences. In one example, constructs can include loxP sites to facilitate the efficient deletion of the marker using the cre/lox system. Use of such systems is well known in the art, and a specific example of use of this system is provided below, in the experimental examples.

(63) Upon obtaining cells in which a target gene (e.g., a TP53, ATM or KRAS gene) has been targeted (one or both alleles, as described above), nuclear transfer can be carried out. Optionally, the genetically modified nuclear donor cells can be frozen prior to nuclear transfer. Recipient cells that can be used in the invention are typically oocytes, fertilized zygotes, or two-cell embryos, all of which may or may not have been enucleated. Typically, the donor and the recipient cells are derived from the same species. However, it is possible to obtain development from embryos reconstructed using donor and recipient cells from different species.

(64) Recipient oocytes can be obtained using methods that are known in the art or can be purchased from commercial sources. As is known in the art, the donor nucleus or the donor cell itself can be injected into the recipient cell or injected into the perivitelline space, adjacent to the oocyte membrane. The nuclear transfer complex formed in this manner can be activated by standard methods, which may involve electrical fusion/activation or electrical fusion/chemical activation, as is described further below. Further processing of the nuclear transfer complex, including implementation of the complexes into surrogate mothers, is described further below.

(65) The transgenic animals of the invention can be used in the identification and characterization of drug and other treatment methods for the disease or condition associated with mutation of the gene targeted according to the invention. In these methods, for example, a candidate therapeutic agent can be administered to an animal and the impact of the agent on a feature of the disease exhibited by the animal can be monitored. Optionally, the methods can also involve exposure of the animals to environmental or other conditions known to contribute to or exacerbate the disease or condition. For example, in cases of cancer, animal models having impaired function in a gene associated with the development or progression of cancer can be used to monitor the effect of a therapeutic agent, such as a drug, on the treatment or management of cancer. In another example, gene- and cell-based therapies for cancer can be administered in such an animal and the animal may be monitored for the effects on the development or progression of cancer, and further can be used to assess the effect and the impact on progression (or reversal) of cancer.

(66) With the porcine model of the invention, it is possible to test hypotheses that lead to new treatments, diagnostics, protocols, imaging technologies and medical devices, and to evaluate potential therapies for cancer. Likely activities involving the present invention may include evaluating current and future therapeutics for toxicity, pharmacokinetics and efficacy within the same animal. Medical devices makers may study the efficacy of products in a relevant, diseased setting. And in the context of medical instruments, noninvasive ultrasound imaging may be evaluated to diagnose and chart the development and progression of cancer.

(67) Availability of large animal models for cancer allows new investigations and tests of therapeutics. The screening methods of the invention can be carried out to test the efficacy of new compounds, combinations of new and old compounds, diagnostics, non-pharmaceutical treatments (such as gene- and cell-based therapies), medical devices, and combinations of the foregoing.

(68) Advantages of a Porcine Cancer Model

(69) In one embodiment of the invention, the large animal models are porcine or swine. Specific attributes of the porcine model offer new research opportunities that are not feasible in the current cancer models, for example, size and lifespan. A mutant TP53 model in the Yucatan miniature pig, for example, presents a breed that reaches a full-grown weight of 60-75 kg at 2 years of agesimilar to that of an adult human. This makes it better suited than small animal models for studies involving the optimization and validation of imaging technologies and surgical procedures. It is important to note that a model can also be too large. For example, domestic pig breeds, such as those being used in other cancer models are 2-3 times bigger. See, e.g., Basel, M. T., et al., BioResearch open access 1:63-68 (2012); Flisikowska, T., et al., Gastroenterology 143:1173-1175 e1171-1177 (2012); Leuchs, S., et al., PloS one 7:e43323 (2012). This would exclude domestic pigs from most longitudinal monitoring/treatment studies with clinical imaging technologies, as they would quickly outgrow the size capacity of a typical clinical imaging scanner with a bore diameter of 60-70 cm. Also related to size, tissues from Yucatan miniature pigs are available in sufficient quantities to develop porcine tissue repositories containing cancer and matched normal tissues for future studies. Likewise, the larger circulatory volume of Yucatan miniature pigs compared to mice permits more repeated sampling of peripheral blood for potential biomarkers of cancer, enabling a broader spectrum of disease parameters to be monitored over time. Finally, the lifespan of pigs (10-15 years) is quite long compared to other animal models facilitating investigations of the natural history of various cancers, long-term treatment effects, and successive surgical interventions.

(70) A large animal cancer model presents opportunities to improve clinical cancer outcomes in humans by serving as a controlled surrogate for human cancer patients. In so doing, research studies may be designed with a small target population of animals, studied extensively, and with unrestricted access to validating tissue samples. Thus, large amounts of data, with tightly controlled co-factors and low population variation may be achieved, requiring fewer subject numbers for equivalent statistical significance than a human cancer cohort. Furthermore, many cancer types are heterogeneous in content, composed not only of cancerous cells but also inflammatory mediators (see, e.g., Coussens, L. M., et al., Nature 420:860-867 (2002)), fibrotic stroma (see, e.g., Kalluri, R. et al., Cancer 6:392-401 (2006)), necrotic tissue and complex vascularity (see, e.g., Sieren, J. C., et al., Annals of biomedical engineering 38:3581-3591 (2010). This porcine model does not rely on an immunocompromised host for tumor development, unlike xenograft models (see, e.g., Basel, M. T., et al., BioResearch open access 1:63-68 (2012)). A mutant TP53 pig, for example, opens new lines of investigation to explore the interplay between a functional immune response and the tumor microenvironment as it relates to tumor progression, diagnosis, treatment and monitoring (see, e.g., Shiao, S. L., et al., Genes & Development 25:2559-2572 (2011)).

(71) The porcine cancer model provides new opportunities to improve cancer detection, monitoring, and treatment approaches in ways not possible with murine models or human patients. Medical imaging technologies (CT, MRI, and PET) play a key role in the clinical management of cancer patients in facilitating cancer detection, staging, and treatment response monitoring. However, the advanced capabilities of these systems are in many cases underutilized clinically due to significant challenges in protocol optimization and validation within the cancer patient population. See, e.g., Frangioni, J. V. Journal of clinical oncology: official journal of the American Society of Clinical Oncology 26:4012-4021 (2008). A large animal cancer model allows for the collection of many imaging datasets with varying protocols and/or modalities in the same cancerous tumor. Thus, resulting image data features can be directly compared and optimal protocols/modalities may be identified. This capability would be highly useful in the optimization of radiation dose, contrast delivery rate, and scan delay timing for dynamic dual energy CT. See, e.g., Simons, D. et al., European radiology (2014). The comparison of alternate PET radiotracers, along with improved acquisition strategies to optimize PET resolution, would also benefit from a human sized cancer model. See, e.g., Sharma, R. et al., British journal of pharmacology 163:1565-1585 (2011); Shiga, T. et al., Journal of nuclear medicine: official publication, Society of Nuclear Medicine 50:148-155 (2009).

(72) While micro-imaging technology exists for CT, PET, and MRI data acquisition in murine cancer models, these systems do not contain the same capabilities of the equivalent clinical systems. See, e.g., Ritman, E. L., Annual review of biomedical engineering 13:531-552 (2011); Weissleder, R., Nature reviews. Cancer 2:11-18 (2002). These differences in acquisition technology combined with large differences in subject size, as well as heart, respiratory, and metabolic rates make rodents ineffective models for translatable protocol development. In a human cancer cohort for research, there is often a high degree of variability in cancer type and stage, clinical treatment approach, subject co-morbidities, and access to endpoint data (mortality, comprehensive histopathology, etc.). There are also restrictions that limit the ability for multiple data point acquisition, such as minimizing exposure to medical ionizing radiation, study time limitations, and a primary concern for the patient's clinical treatment and survival. The porcine model overcomes these constraints.

(73) Another important capability provided by the porcine cancer model is to utilize medical imaging technology to monitor cancer development over time, with or without intervention. Studying cancer progression in the absence of treatment is not possible in humans. In this porcine model, data may be collected prior to tumor development, during tumor growth, and through to metastatic disease. This will provide insight into cancer pathogenesis and the ability of current medical imaging technologies to capture and classify the changing states of cancer progression. Medical imaging is key in planning clinical interventions. The similar anatomy and physiology to humans makes this porcine model ideal to test image guided, minimally invasive surgical techniques as well intensity modulated radiation therapy strategies (see, e.g., Bowen, S. R. et al., Clinical and translational medicine 1:18 (2012). Comprehensive post intervention evaluation in the porcine model is also feasible, utilizing multimodality imaging and tissue resection to determine if effective destruction of all cancer cells was achieved, if early indicators of metastatic disease can be found in other target organs, and/or if toxicity occurred in non-diseased tissue.

(74) TP53 and Cancer

(75) TP53 mutations, which occur in the majority of sporadic human cancers and some inherited cancer-prone disorders, compromise protective checkpoints in cells that normally ensure genomic integrity, thereby facilitating cellular transformation and tumorigenesis. See, e.g., Levine, A. J. et al., Nature Reviews Cancer 9:749-758 (2009); Freed-Pastor, W. a. et al., Genes & Development 26:1268-1286(2012).

(76) In the swine created as described in Example 5 below, all TP53.sup.R167H/R167H pigs that reached maturity developed some type of cancer including lymphoma, Wilms tumor (nephroblastoma), and osteogenic tumors (osteosarcoma). Each tumor type is associated with mutations of TP53 and/or its pathway(s) in humans and is found in Li-Fraumeni patients expressing the mutant form of p53 (R175H) modeled in the TP53.sup.R167H/R167H pigs of the present invention (see Birch, J. M. et al., Cancer research 54:1298-1304 (1994); Kleihues, P. et al., The American journal of pathology 150:1-13 (1997); Porter, D. E. et al., The Journal of bone and joint surgery. British volume 74:883-886 (1992)). The complete tumor penetrance obtained in TP53.sup.R167H/R167H pigs, and corresponding lack of tumor development in wild-type control animals, indicates that the cancers arising in these pigs are due to TP53 gene targeting and not spontaneous tumorigenesis, which occurs at exceedingly low incidences for the tumor types observed (between 2-20 per 100,000). See, e.g., Jacobs, R., Messick, J. et al., Ames, Iowa: Iowa State Press. 159-160 (2002); Migaki, G. et al., Journal of the American Veterinary Medical Association 159:441-442 (1971).

(77) The osteogenic tumors seen in TP53.sup.R167H/R167H pigs may be of particular clinical interest and relevance. While Li-Fraumeni patients develop this type of tumor (see Birch, J. M. et al., Cancer research 54:1298-1304 (1994); Porter, D. E. et al., The Journal of bone and joint surgery. British volume 74:883-886 (1992)) most osteosarcomas seen in people actually arise sporadically and are associated with somatic TP53 mutations (see Miller, C. W. et al., Cancer research 50:7950-7954 (1990)) which correlates with greatly reduced event-free survival. See, e.g., Tsuchiya, T. et al., Cancer genetics and cytogenetics 120:91-98 (2000); Wunder, J. S. et al., Journal of clinical oncology: official journal of the American Society of Clinical Oncology 23:1483-1490 (2005). Importantly, while the clinical aspects of osteosarcoma are well defined (Table 2) (see Luetke, A., et al., Cancer treatment reviews (2013)), the early pathogenesis of this malignancy is not well understood. A study of benign to malignant osteogenic tumors suggests that tumor progression is associated with an increased frequency of genetic alterations. See Radig, K., et al., Pathology, research and practice 194:669-677 (1998). Chromosome clonality (see Dal Cin, P., et al., British journal of cancer 78:344-348 (1998)) and TP53 alterations (see Oliveira, C. R., et al., Clinics 62:167-174 (2007)) have been described in benign osteogenic tumors and subsequent osteosarcoma arising from a benign osteogenic tumor has been reported (See Unni, K. Philadelphia: Lippencout-Raven (1996)).

(78) TABLE-US-00002 TABLE 2 Expected morphology and site of origin for selected bone tumors and tumor-like conditions in humans. Type Morphology Site(s) of origin Osteosarcoma Mesenchymal cells producing Metaphysis of long bones (esp. distal femur and osteoid/bone often subdivided into proximal tibia and humerus); skull, jaw and osteoblastic, chondroblastic and pelvis fibroblastic subtypes Osteoid osteoma Immature bone with increased Long bones especially of lower extremity (e.g. vascularity and nerves; often with a femur); also reported in foot and spine; rim of sclerotic bone preference for diaphysis/metaphysis regions of long bones often near cortex Giant cell tumor of Sheets of mononuclear osteoblastic Most common in epiphysis/metaphysis of long bone cells admixed with numerous, bones (e.g. distal femur, proximal tibia, and prominent multinucleate cells distal radius) and also in sacrum/spine; rare in (osteoclasts) hands, feet, patella, talus Aneurysmal bone cyst Lakes of bloods (not lined by Most common in long bones (~73%), also (ABC) endothelial cells) associated with reported in pelvis, spine, foot, scapula, sacrum proliferating fibroblasts, osteoclasts and ribs. 20% (2/10 cases) of ABCs in sacrum and reactive bone were associated with tumors Heterotopic Sclerosing mesenteritis with fat Bone formation in mesentery and/or serosa mesenteric ossification/ necrosis and eventual bone/osteoid often as a 54equel to traumatic injury or myositis ossificans formation hemorrhage

(79) The TP53.sup.R167H/R167H pigs of the present invention had a wide spectrum of osteogenic tumors ranging from osteosarcoma of the calvaria to various low-grade/benign tumors (e.g. giant cell tumor of bone) of long bones. See Table 3 below. There is no evidence that the multiple osteogenic tumors observed within a single animal are a result of metastasis. The ability to conduct broader interspecies comparisons in humans, mice, and swine, should strengthen the probability of identifying common and potentially causative molecular events required for malignant conversion to osteosarcoma (see Walkley, C. R., et al., Genes & Development 22:1662-1676 (2008)).

(80) The following Examples are meant to illustrate the invention and are not meant to limit the scope of the invention in any way.

EXPERIMENTAL EXAMPLES

Example 1

Yucatan Miniature Pigs and Cells for Gene Targeting

(81) The Yucatan miniature pig was selected for development of cancer model in large animals. While it possesses the same biological characteristics as domestic pigs, the Yucatan miniature pig is significantly smaller. Most domestic pig breeds reach 100 kg in less than six months and can achieve weights of 250-300 kg within a few years. Yucatan miniature pigs reach a full-grown size of 65-90 kg at two years of life, which is more similar to an adult human. Therefore, the Yucatan miniature pigs are less expensive to house and feed. Additionally, this breed is more docile in nature and better suited for interactions with researchers. See, e.g., Panepinto, L. M., et al., Lab Anim Sci 1986, 36 (4), 344-7.

(82) Due to the lack of suitable porcine embryonic stem cell lines, the standard methods for producing gene-targeted mice are not applicable in pigs (Piedrahita, J. A., Theriogenology 2000, 53 (1), 105-16). Instead, gene targeting must be achieved in a somatic cell that is then used as a nuclear donor for SCNT. While numerous cell types can be used as nuclear donors, only fetal fibroblasts have been used to successfully create gene-targeted pigs. Fibroblasts previously obtained from male and female Yucatan miniature pig fetuses at day 35 of gestation were selected. Fibroblasts from the Yucatan breed behave similar to domestic pig fibroblasts in culture, gene transfer, and for SCNT (Estrada, J. L., et al. Cloning Stem Cells 2008, 10 (2), 287-96).

Example 2

Creation of Targeting Constructs

(83) TP53

(84) As mentioned above, porcine TP53 has been sequenced and annotated, and the genomic structure is similar to the human gene. In one example, homologous recombination was used to create gain of function knockin in porcine TP53. Most mutations seen in human TP53 are missense mutations (Joerger, A. C., et al., Cold Spring Harb Perspect Biol 2010, 2 (6), a000919). Therefore, a pig with a human-relevant modification would be the preferred platform for developing specific models of human cancer. A knockin model with a missense mutation (R167H) that corresponds to the R175H hot-spot mutation commonly seen in human cancers was produced using the methods disclosed herein. FIG. 3A shows a structural mutation in the DNA-binding domain of p53 that is found prominently in patients with Li-Fraumeni syndrome (LFS). LFS is caused by germline mutations in TP53 and is characterized by a strong predisposition to tumor development. It is known that mice with this mutation suggest a gain of function mechanism that includes increased frequency of metastasis. See Olive, K. P., et al., Cell 2004, 119 (6), 847-60; Lang, G. A., et al., Cell 2004, 119 (6), 861-72. A neomycin-resistance cassette (Neo.sup.R) was inserted into the upstream intron in order to select properly targeted cells. The Neo.sup.R is flanked by loxP sites and will be excised by Cre recombinase at a later stage.

(85) Although this example describes a knockin model with a missense mutation corresponding to the known R167H mutation, other knockin mutations in TP53 are within the scope of the present invention. p53 sequence and function is highly conserved across species, and as previously mentioned, the orthologous mutation in mice recreates the human dysfunction. See, e.g., Olive, K. P., et al., Cell 2004, 119 (6), 847-60; Lang, G. A., et al., Cell 2004, 119 (6), 861-72; Donehower, L. A., et al., Nature 1992, 356 (6366), 215-21; Burr, P. D., et al., Oncogene 1999, 18 (35), 5005-9. Other frequently mutated sites in human TP53, including, for example, Y220, G245, R248, and R273, are conserved in porcine TP53 and are equally effective, alternate targets. See Joerger, A. C., et al., Cold Spring Harb Perspect Biol 2010, 2 (6), a000919.

(86) In another example, A TP53 knockout pig will allow for the development of cancer models in the absence of p53. The TP53-deficient animal will also provide a starting point for developing a humanized cancer pig in which mutant human TP53 can be inserted as a transgene on the knockout background. To generate the knockout model, the TP53 coding sequence must be disrupted. A Neo.sup.R cassette is inserted into exon 5 of porcine TP53, as shown in FIG. 3B. Exon 5 encodes a critical region of the DNA-binding domain (Joerger, A. C., et al., Cold Spring Harb Perspect Biol 2010, 2 (6), a000919). In addition, a premature termination codon is engineered immediately upstream of the Neo.sup.R insertion. This strategy maximizes the likelihood of a non-functional p53. The most likely consequence of this mutation is the induction of nonsense-mediated mRNA decay (Wen, J., et al., Biochem Soc Trans 2008, 36 (Pt 3), 514-6). However, should a protein be translated, it would be truncated in the DNA-binding domain and be non-functional. An additional possibility could be the skipping of exon 5 via nonsense-associated alternative splicing (Wang, J., et al., Mol Cell 2002, 10 (4), 951-7). This, too, would result in a protein with little or no ability to bind DNA or activate transcription. Importantly, a similar strategy to disrupt TP53 exon 5 in mice resulted in no detectable mRNA or protein. See Donehower, L. A., et al., Nature 1992, 356 (6366), 215-21.

(87) ATM

(88) The creation of an ATM-targeting vector is described in co-pending U.S. Appln. No. 61/788,080, filed Mar. 15, 2013. Homologous recombination was used to disrupt the endogenous ATM gene. Specifically, a neomycin-resistance cassette (Neo.sup.n) was inserted into exon 57 of porcine ATM (FIG. 4). Exon 57 encodes a significant portion of the ATP-binding region within the kinase domain and it is known that a similar strategy to target ATM exons 57 and 58 in mice abolished ATM function (Herzog, K. H., et al., Science, 1998. 280(5366): p. 1089-91). A premature termination codon was also engineered immediately upstream of the Neo.sup.R insertion. This strategy was adopted to maximize the likelihood of a non-functional ATM.

(89) A plasmid carrying the ATM targeting vector was generated using standard molecular biology techniques. Proper sequence was confirmed by DNA sequence analysis. The plasmid was then submitted to the University of Iowa Gene Transfer Vector Core for production of rAAV.

(90) TP53 and KRAS

(91) We chose to mutate both KRAS and TP53 as these are the most commonly mutated genes in human cancers, and altering these genes has been used to model many human cancers in mice. Importantly, mutations of these two genes co-operate to promote cancer. Specifically, activation of the oncogenic allele of KRAS in most mouse tissues leads to hyperplasia, and then only after an extended period of time and at a very low frequency, progresses to cancer. See Rangarajan, A., et al., Cancer Cell 2004, 6 (2), 171-83; Hamad, N. M., et al., Genes Dev 2002, 16 (16), 2045-57. However, the addition of a TP53 mutation greatly accelerates the progression to cancer. We chose to target KRAS (in the mutated TP53 knockin model described herein) at the endogenous level because transgenic over-expression of these mutant proteins can yield artifactual phenotypes. Tuveson, D. A., et al., Cancer Cell 2004, 5 (4), 375-87. For example, mouse cells proliferate in culture when an inducible oncogenic KRAS allele is activated, whereas ectopic expression of the same mutant protein arrests cells.

(92) Homologous recombination can be used to generate a conditional KRAS mutation in TP53-targeted (and wild-type) cells. Specifically, the common G12D mutation can be introduced in KRAS exon 1. KRAS.sup.G12D is an activating mutation resulting in constitutive GTPase activity and acts via a dominant mechanism of pathogenesis. Schubbert, S., et al., Nat Rev Cancer 2007, 7 (4), 295-308. A lox-Stop-lox cassette may also be introduced with the G12D mutation to allow for the conditional expression of the mutation. This KRAS targeting construct is packaged in recombinant adeno-associated virus (rAAV) for efficient delivery to porcine fetal fibroblasts.

(93) In order to conditionally express KRAS.sup.G12D, a lox-STOP-lox (LSL) cassette can be inserted upstream of exon 1, as shown in FIG. 5. The LSL cassette will prevent expression of KRAS.sup.G12D from the targeted allele except in the presence of Cre-recombinase. Tuveson, D. A., et al., Cancer Cell 2004, 5 (4), 375-87. In this model, the non-targeted allele is unaffected, which is important as homozygous KRAS mutations result in embryonic lethality. This inducible system allows for site-specific expression of the KRAS.sup.G12D allele in almost any tissue by delivering Cre with a virus or by crossing with a pig expressing Cre via a tissue-specific promoter. This method has been used successfully in several KRAS/TP53-targeted mouse models. See Tuveson, D. A., et al., Cancer Cell 2004, 5 (4), 375-87; Lakso, M., et al., Proc Natl Acad Sci USA 1992, 89 (14), 6232-6; Guerra, C., et al., Cancer Cell 2003, 4 (2), 111-20. The LSL-cassette also contains a puromycin resistance cassette (puroR) that can be used for antibiotic selection of gene targeted cells.

(94) Fibroblasts from TP53-targeted fetuses will be infected with rAAV carrying the KRAS targeting vector. The generation of targeted cells is designed to maximize the frequency of homologous recombination, minimize random integration, and minimize the number of cell passages before targeted cells are harvested. PCR and Southern blotting is used to identify properly targeted cells. KRAS-targeted cells are then prepared for somatic cell nuclear transfer.

(95) Targeting Vectors and Plasmid Creation

(96) Because of rAAV genome size constraints, the total length of the targeting vectors is limited to about 4.5 kb. In the example of a TP53 knockin targeting vector or a TP53 knockout targeting vector, the 1.7 kb Neo.sup.R is centrally located in the vector, with each homology arm being 1.2 to 1.4 kb, as shown in FIG. 3.

(97) In the example of a KRAS targeting vector, the 2.5 kb LSL-cassette is centrally located in the targeting vector, with each homology arm being about 1.0 kb, as shown in FIG. 5. These arms would be considered short for traditional gene targeting vectors, but are not unusual for rAAV-mediated gene targeting.

(98) A plasmid carrying the targeting vectors described herein was generated using standard molecular biology techniques. Proper sequence was confirmed by DNA sequence analysis. The plasmid was then submitted to the University of Iowa Gene Transfer Vector Core for production of rAAV. rAAV was chosen because it has been used to efficiently deliver gene targeting vectors to cell lines and primary cells (Meyerholz, D. K., et al., Am J Respir Crit Care Med 2010, 182 (10), 1251-61). Additionally, as mentioned above, rAAV has previously been used to engineer specific mutations in porcine CFTR and LDLR. See, e.g., Rogers, C. S., et al., J Clin Invest 2008, 118 (4), 1571-7; Rogers, C. S., et al., Science 2008, 321 (5897), 1837-41, U.S. Pat. No. 7,989,675; U.S. patent application Ser. Nos. 13/288,720, 13/368,312 and 13/624,967.

Example 3

Targeting TP53 and KRAS in Porcine Fetal Fibroblasts

(99) Approximately 1.510.sup.6 Yucatan miniature pig fetal fibroblastsboth male and femalewere infected with rAAV1 (MOI100,000) carrying a TP53 targeting vector (SEQ ID NO: 1). After 24 hours, cells were transferred to a series of 96-well plates and G418 (100 g/ml) was added to the media for selection of targeted cells. Fourteen days later, surviving cells were observed in 40-50% of wells, and each well of the 96-well plates were replicated by splitting among three plates: 1) 96-well culture plates for cell expansion, 2) 96-well culture plates for potential cryopreservation, and 3) 96-well PCR plates for cell lysis.

(100) Cell lysates were screened by PCR to identify wells containing gene-targeted clones and any PCR-positive clones were frozen. The PCR screen amplified a product that can only be the result of proper targeting and placement of Neo.sup.R. See FIGS. 6A and 6B. In this example, allele-specific Southern blot was employed to identify the Neo.sup.R-positive PCR products that also contain the R167H mutation.

(101) By the time any targeted cells were frozen, they had been in culture only 15-17 days. This short time frame is important as the longer cells are in culture, the less efficient they are as nuclear donors. Positive clones from the cell expansion plates were also passaged to provide genomic DNA for downstream applications. Because cell expansion plates often senesce before large quantities of genomic DNA can be obtained, genomic DNA from the 96-well expansion plate was isolated and used whole-genome amplification (REPLI-g, Qiagen) to provide DNA for Southern blot analysis. Results for the targeting construct are shown in FIG. 6.

(102) Genomic Southern blots with TP53- and Neo.sup.R-specific probes were used to identify clones with a targeted TP53 allele and that were free of random integration. DNA sequence analysis was used to confirm the desired TP53 mutation (FIG. 7). Furthermore, three TP53.sup.R167H/+ male cell lines and three TP53.sup.R167H/+ female cell lines were identified to date that meet the above criteriaprocessing all of the PCR-positive cell lines was not necessary; however, those cells and DNA have been preserved, if needed. It is believed the quality and quantity of these cells are ideal for SCNT, and they were used to generate TP53-targeted heterozygote pigs. Gene targeting statistics are shown in Table 3.

(103) TABLE-US-00003 TABLE 3 Summary of TP53 targeting efficiency and SCNT activity Gene Number Embryos Live targeting of per transfer Pregnancy pigs efficiency* transfers (average) rate per litter Male 1.1% 3 130 67% 3 Female 1.0% 4 130 75% 8 *Gene targeting efficiency reported as percentage of G418.sup.R clones that were properly targeted, as determined by PCR. Pregnancy rate refers to full-term gestation.

(104) Because of the current lack of Cre recombinase-expressing pigs, the Neo.sup.R cassette is removed from the knockin pigs after the generation of the first animals. In a further step, ear-derived fibroblasts are obtained from knockin pigs infected with AAV-Cre to excise the Neo.sup.R cassette, and then used as nuclear donors in another round of SCNT.

(105) The procedure described herein is repeated to identify and generate KRAS/TP53-targeted pigs. Specifically, after replication by splitting among three plates 96-well plates, cell lysates are screen by PCR to identify wells containing KRAS-targeted clones and any clones that are PCR-positive are frozen. The PCR screen takes advantage of the size difference caused by the insertion of the 2.5 kb LSL-cassette. An allele-specific Southern blot is employed to identify the PCR-positive products that also contain the G12D mutation.

(106) As discussed above, by the time cells are frozen, they will have been in culture only 15-17 days. Positive clones are also passaged from the cell expansion plates to provide genomic DNA for downstream applications. Should cell expansion plates senesce before sufficient genomic DNA can be obtained, we will use whole-genome amplification to provide DNA for the Southern blot. Genomic Southern blots using KRAS- and puro.sup.R-specific probes identify clones with a targeted KRAS allele and that are free of random integration. Furthermore, DNA sequence analysis is used to confirm the desired mutation. All clones that meet these criteria will be considered ideal for SCNT and used to generate KRAS/TP53-targeted pigs.

Example 4

Nuclear Transfer and Propagation

(107) TP53.sup.R167H/+ male and female cells were used for somatic cell nuclear transfer (SCNT) to produce live male and female TP53.sup.R167H/+ offspring. The resulting litters were born August 2011 and produced a total of 6 TP53.sup.R167H/+ male and 24 TP53.sup.R167H/+ female piglets.

(108) FIG. 8 shows some of the first TP53-targeted piglets (FIG. 8A) as well as Southern blot and DNA sequencing confirming the proper genotype (FIGS. 8B and 9C). Without intervention, these pigs are expected to develop a limited spectrum of tumors throughout the body, just as humans and mice with analogous TP53 mutations. While these animals may serve as a useful model on their own, an additional benefit results from being a sensitized platform for adding second hits, such as a conditional KRAS mutation. This has been a hugely successful approach with recent murine models. See, e.g., Jackson, E. L., et al., Genes Dev 2001, 15 (24), 3243-8; Caulin, C., et al., J Clin Invest 2007, 117 (7), 1893-901; Kirsch, D. G., et al., Nat Med 2007, 13 (8), 992-7.

(109) Male and female heterozygotes were also bread to produce TP53-homozygote pigs, which were born in August 2012 (FIG. 9). These animals could have an even more severe and early-onset tumor formation.

Example 5

Methods of Developing and Analyzing TP53R167H/R167H Pigs

(110) The following methods were used to create and evaluate the pigs discussed in Example 6.

(111) Fetal Fibroblast Isolation. Fetal fibroblasts were isolated from approximately day 35 Yucatan miniature pig fetuses by the methods described herein and known in the art. See also Lai, L. et al., Cloning Stem Cells 5:233-241 (2003). Cells were grown at 39 C. and 5% CO.sub.2 in F10 media (Invitrogen) containing 20% FCS and 30 g/ml gentamicin. Fetus genders were previously identified by PCR amplification of the Y-chromosome-specific Sry gene by methods known in the art. See, e.g., Pomp, D. et al., Journal of Animal Science 73:1408-1415 (1995).

(112) Cloning Porcine TP53 Genomic DNA. Genomic DNA was isolated from Yucatan fetal fibroblasts (Qiagen). A 7.1 kb PCR product which included a region from TP53 exon 2 to exon 11 was amplified using a high fidelity polymerase (Platinum Taq High Fidelity; Invitrogen) and TP53 primers GC2F and GC2R (see Table 4 for all primer sequences). The PCR product was subcloned into pCR2.1-TOPO (Invitrogen) and sequenced. This plasmid (referred to as pTP53) served as the template for PCR amplification of the 5 and 3 homologous targeting arms.

(113) TABLE-US-00004 TABLE4 PCRandSequencingprimers(allsequences5 to3) pTP53seq1F: CGCTCTCAATAATAGAGAACC(SEQIDNO:7) pTP53seq2F: GAAATCATGCAGTGAATTTAAGT(SEQIDNO:8) pTP53seq3F: CTAGGTCAACATAAAGGAGCG(SEQIDNO:9) pTP53seq4F: TGAGCTGGGAGATGAGATGA(SEQIDNO:10) pTP53seq5F: AGGGTGCTAGAAGATGAGATC(SEQIDNO:11) pTP53seq6F: TGCAATGGAGGAGTCGCAG(SEQIDNO:12) pTP53seq7F: CCTGGCAGCTATGATTTCCG(SEQIDNO:13) pTP53seq8F: GTGCAGCTGTGGGTCAGC(SEQIDNO:14) pTP53seq9F: CTCACTTGACCTGCCGCAG(SEQIDNO:15) pTP53seq10F: GCTGGCTTTCCTCACTGC(SEQIDNO:16) pTP53seq11F: GCTTGACTCTTGTAGTGCATA(SEQIDNO:17) pTP53seq12F: GCGAGTTAAGAACTGGACTAG(SEQIDNO:18) pTP53seq13F: TTCCCACTTCTAGCAACCCT(SEQIDNO:19) pTP53seq6R: CTGCGACTCCTCCATTGCA(SEQIDNO:20) pTP53seq7R: CGGAAATCATAGCTGCCAGG(SEQIDNO:21) pTP535armF(EcoRV): gatcgagatatcGAGGTGTTTTCAGTGCCATTA(SEQIDNO:22) pTP535armR(EcoRV): gatcgagatatcCAGCCAAGTGCTCGGTGG(SEQIDNO:23) pTP533armF(BamHI): gatcgaggatccCTAATCAGTATTTAGGCAGCG(SEQIDNO:24) pTP533armRv2(HindIII): gatcgaaagcttGGTTGCAGAAGAGACTCCG(SEQIDNO:25) R167H-F: TGACCGAGGTGGTGAGGCACTGTCCCCACCATGAGCG(SEQIDNO:26) R167H-R: CGCTCATGGTGGGGACAGTGCCTCACCACCTCGGTCA(SEQIDNO:27) TP53-R167H-AAV-F(NotI): agctacatgcggccgcGCTGAGTTACTTCATCCTGAT(SEQIDNO:28) TP53-R167H-R(NotI): agctacatgcggccgcCAAAAGGATGGCTAGAGAAAC(SEQIDNO:29) ScreenF(NeoR): AGACGTGCTACTTCCATTTGTCAC(SEQIDNO:30) pTP53PCR-R1: TCAATCTCTCAAACCCGATAG(SEQIDNO:31) LDLR5F: AGCCACAGCTCATCACTCC(SEQIDNO:32) LDLR-Exon5R1: AGCACTGGAACTCGTCAGG(SEQIDNO:33) P53oligoProbe-3: GTGAGGCACTGTCCCC(SEQIDNO:34) PGK-NeoF: CCAGTGTGCTGGAATTCGG(SEQIDNO:35) NeoR-R: CTGCAGAATTCGGCTTGTACT(SEQIDNO:36) pTP53Southernprobe3F: GATGTGGCTCGGATCTGGT(SEQIDNO:37) pTP53SouthernProbe3R: CCATGTTCCTCCCTGCTCC(SEQIDNO:38) PGK-F: GGCTGCTAAAGCGCATGCT(SEQIDNO:39) P53Geno4F: ACCCTGCCATCTCTGGCTA(SEQIDNO:40) P53NeoExc.Screen3R: AGAGCGAACAGAAGGTCAGA(SEQIDNO:41) Italicized letters indicate restriction enzyme sequences for cloning. Underlined letters indicate the R167H codon.

(114) Targeting Vector Construction. The 5 and 3 homologous recombination arms were amplified by PCR using plasmid pTP53 and subcloned sequentially into a plasmid containing a PGK-Neo cassette. The primers for the 5 arm were pTP53 5armF (EcoRV) and pTP53 5armR (EcoRV). The primers for the 3 arm were pTP53 3armF (BamHI) and pTP53 3armRv2 (HindIII). The R167H mutation was introduced using site-directed mutagenesis with primers R167H-F and R167H-R. This targeting construct (pTP53-Neo) was used as a template to create the amplicon for the generation of the TP53-R167H-targeting proviral vector.

(115) rAAV Production. PCR amplification of a 4.5 kb amplicon from plasmid pTP53-Neo was achieved by using the following primers: TP53-R167H-AAV-F (NotI) and TP53-R167H-R (NotI). This product was subcloned into the rAAV proviral plasmid, pFBAAV2-CMVP.NpA (obtained from University of Iowa Gene Transfer Vector Core) and grown in Sure2 cells (Stratagene) to ensure ITR integrity. This proviral plasmid is referred to as pAAV-TP53-R167H-Neo. The rAAV was produced by the University of Iowa Gene Transfer Vector Core.

(116) Fetal Fibroblast Infection and Selection. Passage zero male and female Yucatan fetal fibroblasts (1.010.sup.6) were thawed and plated on separate 100 mm collagen-coated culture dishes containing PFF media. Each cell line was infected with rAAV (18 l, 4.6510.sup.13 vg/ml) after 24 hours. Cells were subsequently detached with trypsin 24 hours later and plated on 64, 96-well collagen-coated plates at a density of 200 cells/well. Selection was initiated 48 hours later with G418 (100 g/ml). Ten days later each infected cell plate was split among three 96 well plates (one plate for freezing, one for propagation, and one to a PCR plate for immediate PCR screening). The freeze and propagation plates were returned to the incubator.

(117) PCR Screen and Cell Handling. Approximately 40% of wells contained live cell colonies following selection. Cells in the 96-well PCR plate were subjected to 5 l lysis buffer (50 mM KCl, 1.5 mM MgCl2, 10 mM Tris-Cl, pH 8.5, 0.5% Nonidet P40, 0.5% Tween, 400 g/ml Proteinase K) by methods known in the art. See, e.g., McCreath, K. J., et al., Nature 405:1066-1069 (2000). Cell lysis plates were incubated 65 C. for 30 minutes, followed by 95 C. for 10 minutes. Primers Screen F (NeoR), pTP53 PCR-R1, LDLR 5F, and LDLR-Exon5R1 were used to PCR amplify 2 l of lysate with the following conditions: 2 min. at 95 C., 30 cycles of 95 C. for 20 s, 56 C. for 20 s, and 68 C. for 4.5 min., and finally 68 C. for 7 min. The LDLR amplicon served as an internal control. The expected product for the targeted TP53 allele was 1.9-kb and 4.3-kb for the LDLR product. The PCR-positive cells were grown to 100% confluence and either cryo-preserved or expanded for the purpose of DNA isolation.

(118) R167H-specific Southern Blot. The PCR-positive PCR reactions were run on a 1.0% agarose gel and denatured in 0.5M NaOH/1.5M NaCl for 20 minutes and transferred to a positively charged nylon membrane (Roche) in 20SSC overnight. The membrane was washed in 5SSC for 5 minutes, air dried, and UV crosslinked. Detection of R167H was achieved by Chemiluminescent Nucleic Acid Detection (Thermo Scientific) and a biotin labeled probe. The membrane was prehybridized in 15 ml Hybridization solution at 53.5 C. The DNA was hybridized with 15 l (30 ng/l) of biotin labeled probe, P53oligoprobe-3 (IDT DNA), for 90 minutes at 53.5 C. The membrane was washed in Stringency Wash Buffer then incubated in Blocking Buffer. HRP conjugate was added to the Blocking Buffer and incubated at 15 minutes at room temperature. The membrane was washed in Wash Buffer then incubated in Substrate Equilibration Solution. Finally, the membrane was incubated in Luminol/Peroxidase Substrate and exposed to film (Kodak BioMax) for 1 second.

(119) Southern Blot. To validate PCR-positive cell lines, genomic DNA was isolated from the cells grown on propagation culture plates. Two to ten nanograms of genomic DNA was used for whole genome amplification (Repli-G; Qiagen) and digested with AflII and EcoNI overnight. Following gel electrophoresis, samples were transferred to a positively charged nylon membrane (Roche) using an alkaline transfer procedure. The membrane was briefly rinsed in 5SSC, completely dried and subjected to UV crosslinking. The DNA probes for TP53 and Neo.sup.R were produced by PCR amplification using the following primers: pTP53 Southern probe 3F/pTP53 Southern Probe 3R and PGK-NeoF/NeoR-R, respectively. Probes were labeled with -.sup.32P by random priming using Prime-a-Gene Labeling System (Promega), and the radioactive probes were purified using CHROMA SPIN+TE-100 columns (Clontech). Membranes were pre-hybridized in Rapid-hyb Buffer (GE Healthcare Life Sciences) for 30 minutes at 65 C., then 25 l of .sup.32P-labelled probe was added and hybridization proceeded at 65 C. for 2 hours. The membrane was washed in 2SSC, 0.1% SDS one time at room temperature for 20 minutes and in 0.1SSC, 0.1% SDS at 65 C. three times for 15 minutes each. The membrane was exposed to film (Kodak BioMax MS) at 80 C. overnight. For confirming animal genotype, high molecular weight genomic DNA was isolated from pig umbilicus and digested with AflII and EcoNI. The remaining steps were performed as described above.

(120) Genotyping of Offspring from Heterozygote Crosses. Lysis of fresh pig umbilicus was achieved using a Direct Amp Kit (Denville Scientific). The lysate was diluted in 50% water and 2 l was directly added to a master mix containing primers PGK-F, P53 Geno 4F, and P53NeoExc.Screen 3R. PCR amplification was performed with the following reaction conditions: 2 min at 95 C., 35 cycles of 95 C. for 10 s, 60 C. for 10 s, and 68 C. for 15 s, and finally 68 C. for 3 min. The expected product for the targeted allele was 211-bp and the wild type allele was 114-bp.

(121) Nuclear Transfer. Nuclear transfer was performed by Viagen, Inc. (Austin, Tex.) by methods known in the art. See, e.g., Walker, S. C., et al., Cloning Stem Cells 4:105-112 (2002). Briefly, TP53-targeted fetal fibroblasts were seeded in a 4-well plate and grown until contact inhibited. The cells were detached with trypsin and resuspended in salt-buffered NCSU-23 containing 10% FCS. Oocytes were matured in Earle's TC199-Hepes supplemented with 5 mg/mL insulin, 10 ng/mL EGF, 0.6 mM cysteine, 0.2 mM sodium pyruvate, 25 mg/mL gentamicin, 5 mg/mL FSH, and 10% porcine follicular fluid for 40 hours prior to manipulation.

(122) Embryo Transfer. Embryo transfer was performed at Exemplar Genetics. Reconstructed oocytes were transferred into synchronized post-pubertal domestic gilts on the first day of standing estrus. Recipient gilts were preanesthetized with IV propofol (0.5-5 mg/kg) and anesthesia was maintained with inhaled isoflurane (3-5% in oxygen via face mask). Following a midline incision to access the uterus, reconstructed embryos were transferred into the oviduct at the ampullary-isthmus junction. Intra- and post-operative analgesia was provided by intramuscular injection of flunixin meglumine (2.2 mg/kg). Recipient animals were checked for pregnancy by abdominal ultrasound after day 21 and throughout gestation.

(123) Checkpoint Analyses in Pig Fibroblasts. Induction of the DNA damage checkpoint or senescence in response to oncogene activation was examined in pig fetal fibroblasts expressing wild-type p53 or mutant alleles of TP53.sup.R167H following treatment with a DNA damaging agent or expression of mutant KRAS.sup.G12V protein, respectively. For the DNA damage response, early passage (P1 to P3) cells were plated at 510.sup.5 cells per 10 cm dish and treated with or without 0.4 g/ml doxorubicin (Adriamycin) for 3 days. Cells were harvested, cell viability measured by trypan blue staining and counting on a hemacytometer, and samples split for flow cytometric analysis of DNA content or western blot analysis, exactly as described (71). Antibodies used in western analyses were to p53 (Santa Cruz, sc-126 [DO-1], 1:200), p21 (BD Pharmingen, 554228, 1:100), and GAPDH (Abcam, Ab8245, 1:20,000). To assess senescence, early passage (P1 to P3) cells were infected with pBabe-puro control or pBabe-KRAS.sup.G12V-puro retroviruses for two days, using identical methods of virus preparation and infection as known in the art. See, e.g., Modestou, M., et al., Cancer research 61:3145-3150 (2001); Huang, J., et al., Oncogene (2013). Infected cells were selected with 1 g/ml puromycin for 2 days, replated at identical cell numbers, and the induction of senescence measured by cell counting and phase contrast microscopy 3 to 7 days later.

(124) Clinical Evaluation. Pigs were monitored daily (2+ times/day) for clinical signs of morbidity by experienced animal care staff. Parameters that were monitored included, but were not limited to, loss of condition, lameness, reduced feed consumption, general morbidity and enlarged peripheral lymph nodes. Additionally, peripheral blood was collected every two months for complete blood count (CBC) and chemistries Clinical presentations of the affected cases are described in Table 6.

(125) Peripheral Blood Analysis. Peripheral blood samples were collected from pigs every 4-6 weeks to monitor for signs of clinical disease. Samples were submitted to a commercial laboratory (Marshfield Labs, Marshfield, Wis.) for analysis. Values between non-diseased control cases and lymphoma cases were statistically analyzed using a two-way ANOVA (repeated measures) using Bonferroni post-tests and significance was placed at P<0.05.

(126) Animal Preparation for Imaging. Pigs were transported to and from the University of Iowa on the day of the imaging procedure. All procedures were performed under anesthesia, induced with a mixture of telazol (2.2 mg/kg), ketamine (1.1 mg/kg) and xylazine (1.1 mg/kg), and maintained with 3-5% isoflurane. Pigs were mechanically ventilated through intubation with a balloon cuffed 7 mm-8 mm tracheal tube. Ventilation was performed at 100% oxygen with 5 cm H.sub.2O positive end expiratory pressure (PEEP), tidal volume of 10 mL/kg and an appropriate respiration rate to maintain an end-tidal (ET) CO.sub.2 between 35 and 45 mmHg. Isoflurane anesthesia, ventilation and forced inspiratory breath-holds of 20 cm H.sub.2O were achieved throughout image data acquisition with a Primer SP MRI-Compatible Veterinary Anesthesia Ventilator (DRE Veterinary, Louisville, Ky.). Peripheral intravenous access was obtained via an ear vein cannula of size 20 gauge for the administration of contrast and flushed with heparinized saline (500 unit/L) to prevent unwanted blood clotting between administrations. Following computed tomography (CT) and magnetic resonance imaging (MRI) acquisition, animals were recovered.

(127) Computed Tomography Acquisition. Four computed tomography (CT) datasets (non-contrast head CT, non-contrast chest-abdomen-pelvis CT, contrast chest CT, contrast abdominal and pelvic CT) were acquired utilizing a Somatom Definition Flash 128-multidector dual-source CT scanner (Siemens Healthcare, Erlangen, Germany). The head CT (Spiral, 120 kV, 390 mAs, 1 sec rotation time, pitch of 0.5, H31 reconstruction kernel, 0.5 mm slice thickness) was acquired to assess the skeletal structure and indicate if a brain MRI was warranted. A non-contrast enhanced chest-abdomen-pelvis CT scan was acquired during an enforced inspiratory breath hold at 20 cm H.sub.2O (Spiral, 120 kV, 210 mAs, 0.5 sec rotation time, pitch of 1, B35 kernel, 0.5 mm slice thickness). The enforced breath-hold eliminated respiratory motion artifact and increased the diagnostic quality of the dataset acquired. Finally, contrast enhanced CT data was acquired: 2 mL/kg nonionic iodinated contrast injected at 4 mL/sec, with 15 sec delay for thorax scan and 70 sec delay for abdomen, both with enforced inspiratory breath-holds (Spiral, 120 kV, 210 mAs, 0.5 sec rotation time, pitch of 1, B35 kernel, 0.5 mm slice thickness).

(128) Magnetic Resonance Imaging Acquisition. Magnetic Resonance Imaging (MRI) data was obtained with a TIM Trio 3T MRI system (Siemens Healthcare, Erlangen, Germany). A high resolution brain scan was obtained to assess brain tumors using a 3D turbo spin echo with variable flip angle (SPACE) protocol [TR/TE=1630/119 milliseconds, flip angle 120, echo train length 141, resolution of 0.86 mm0.86 mm0.9 mm slice thickness]. An additional axial diffusion tensor imaging protocol [TR/TE=2800/83 milliseconds, flip angle 90, resolution of 1.5 mm1.5 mm5 mm slice thickness] was performed for detailed analysis of the white matter. For the chest and abdomen, standard T2-weighted scans acquired in the axial [TR/TE=4293/156, flip angle 120, echo train length 109, resolution of 1.37 mm1.37 mm5 mm slice thickness] and coronal [TR/TE=4286/157, flip angle 120, echo train length 109, resolution of 1.48 mm1.48 mm5 mm slice thickness] planes were used to assess areas of atypical fluid content, such as metastatic tumors or areas of inflammation. Due to the increased scan time, motion artifact was eliminated using respiratory navigation. A T1-weighted volume interpolated axial gradient echo (VIBE) contrast-enhanced abdominal sequence [TR/TE=4.34/1.9, flip angle 12, resolution of 1.37 mm1.37 mm3 mm slice thickness] was acquired pre-contrast and 30, 60 and 180 seconds post administration of 0.2 mL/kg gadolinium contrast (MultiHance, Bracco Diagnostics Inc., Princeton, N.J.) injected through a peripheral ear vein. These scans were used to analyze blood flow through the liver and obtain greater anatomical detail of the abdomen. An additional post-contrast axial VIBE chest scan [TR/TE=4.34/1.92, flip angle 12, resolution of 1.37 mm1.37 mm3 mm slice thickness] was acquired for additional anatomical detail of the lungs. Due to the short acquisition time with the VIBE scans, breath-holds at an inspiratory pressure of 20 cm H.sub.2O were used to reduce motion artifact.

(129) Radiological Assessment: All image data was qualitatively evaluated by a radiologist (J.N.) with experience in porcine studies, using the OsiriX platform. See Rosset, A., et al., Journal of digital imaging 17:205-216 (2004). The Response Evaluation Criteria in Solid Tumors (RECIST) 1.1 was used to measure the tumor and lymph node size. See Eisenhauer, E. A., et al., European journal of cancer 45:228-247 (2009). Segmentation and volumetric rendering of the osteogenic tumor in the mesentery was achieved using OsiriX threshold based three-dimensional region growing algorithm with a 250-2000 HU threshold range.

(130) Segmentation of the renal cell tumor at imaging time points 1 and 2 were achieved using tools from the Pulmonary Analysis Software Suite (PASS). See Guo, J., et al. Pulmonary Analysis Software Suite 9.0, New York City, USA. 283-292 (2008). The contrast enhanced venous phase (70 sec delay) 3.0 mm, thick axial CT scans were analyzed with PASS. Total volume (ml), as well as the mean, standard deviation and coefficient of variation of the CT attenuation (HU) were calculated from the segmented liver image. Using the pre and post contrast MRI sequences, the signal intensity of the tumor relative to that of the kidney was reported.

(131) The liver and spleen were quantitatively assessed to determine the presence of lymphoma. Manually segmented liver organ volumes in the venous phase from contrast enhanced CT scans were done using PASS. In addition to identifying the boundary of the organ, large internal vessels were segmented and excluded. Total volume (ml), and the mean and standard deviation of the CT attenuation (HU) were calculated from the segmented liver images. The dynamic perfusion heterogeneity of the liver and spleen were quantitatively assessed using the MRI abdominal VIBE sequence data, including pre-contrast and 30, 60 and 180 seconds post contrast data acquisitions. PASS was utilized to obtain three to four square regions of interest (ROIs) within the liver, spleen and flank muscle. Areas with prominent, large vessels were excluded from the regions of interest. The liver-to-muscle and spleen-to-muscle ratios were computed along with coefficient of variation to assess overall MRI signal intensity and heterogeneity.

(132) Tissues. Euthanasia was performed according to Institutional Animal Care and Use Committee approval. Necropsy examination and tissue collection procedures were coordinated by a veterinary pathologist experienced with genetically modified porcine models. Lesions identified by imaging techniques were targeted for examination and tissue collection, and the remaining tissues were screened for lesions. Collected tissues were placed in appropriate volumes (>20:1 fixative:tissue volumes) of 10% neutral buffered formalin for 3-5 days. Formic acid (25%) was used to decalcify bony lesions/tumors. Samples were submitted to the Comparative Pathology Laboratory (Department of Pathology, University of Iowa) for standard tissue processing, embedding, and sectioning (4 m). Tissues were stained with hematoxylin and eosin (HE) for general examination by the veterinary pathologist.

(133) Molecular Genetic Analyses of TP53.sup.R167H/R167H Tumors. Isolated tumors were quick frozen in liquid nitrogen for western analyses or placed in F10 media containing 20% FCS for subsequent culturing and cytogenetic analysis. Frozen tumor sections were pulverized with a mortar and pestle, lysed in an ice-cold RIPA lysis buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% SDS, 0.5% sodium deoxycholate with protease and phosphatase inhibitors) and protein quantified by BCA analysis (Pierce). Equivalent amounts of protein (100 g) from each sample were analyzed by SDS-PAGE and western blotting using enhanced chemiluminescence for protein detection (ECL, Amersham). Antibodies used included those against p53 and GAPDH (see above) as well as cyclin B1 (Santa Cruz, sc-752, 1:200).

(134) Chromosome Analysis. Cell cultures were established from either wildtype pig skin fibroblasts or tumor cells derived from TP53.sup.R167H/R167H pigs. Cells were arrested in metaphase by adding ethidium bromide (final concentration 12.5 g/ml) for 40 min followed by colcemid (final concentration 6 g/ml). After 1-2 h, the cells were incubated for 25 min at room temperature with hypotonic solution (3:1 mixture of 0.8% sodium citrate and 0.075 M potassium chloride). Cells were then fixed three times with a 3:1 methanol/acetic acid. Chromosome spreading was performed on coverslips in a Thermotron chamber (Holland, Mich.). Coverslips were mounted on glass slides after the drying process. Ten to twenty G-banded metaphases were analyzed. Karyotype images were captured using the CytoVision computerized imaging system (Applied Imaging, USA).

(135) Animals. This study was carried out in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All animals were developed and housed in Exemplar Genetics' AAALAC-accredited facilities. Standard procedures for animal husbandry were used throughout. The Institutional Animal Care and Use Committee (IACUC) of Exemplar Genetics and the University of Iowa approved all animal experiments. Imaging procedures were conducted at the University of Iowa in accordance with the IACUC approved protocol.

Example 6

Tumor Development in TP53R167H/R167H Pigs

(136) TP53.sup.R167H/R167H, TP53.sup.R167H/+, and TP53.sup.+/+ pigs were monitored with a combination of clinical evaluation, peripheral blood analysis, in-vivo CT and MRI, histopathology, and genetic characterization. The human-like size of this Yucatan miniature pig model enabled the use of clinical imaging technology and protocols (CT and MRI) for the longitudinal monitoring of tumorigenesis in this cohort. Table 5 provides a summary of the pigs having undergone necropsy, including age at necropsy, clinical signs, and type of tumors detected. There have been no tumors detected via in-vivo imaging or necropsy in the TP53.sup.R167H/+ or TP53.sup.+/+ cohort over 24 months of observation.

(137) TABLE-US-00005 TABLE 5 Case numbers, age, clinical and pathological features of necropsied pigs. Case Age Clinical signs Lesions 1 2 hours Perinatal death Liver: Hepatocellular TP53.sup.R167H/R167H atypia 2 6.75 months Sudden death Lymphoma TP53.sup.R167H/R167H Tumor lysis syndrome 3 7.75 months Loss of body condition, weight loss Lymphoma TP53.sup.R167H/R167H 4 10.75 months Progressive lethargy, anorexia, weight Lymphoma TP53.sup.R167H/R167H loss, and reduced mobility in the 3-4 weeks prior to necropsy 5 12.5 months Listless and hyporesponsive to external Osteogenic tumors TP53.sup.R167H/R167H stimuli at time of euthanasia 6 15.25 months None Osteogenic tumors TP53.sup.R167H/R167H Renal tumor (Wilms tumor/Nephroblastoma) 7 7.75 months None None TP53.sup.+/R167H 8 18.25 months None None TP53.sup.+/R167H 9 7.75 months None None TP53.sup.+/+ 10 14.5 months None None TP53.sup.+/+

(138) All TP53.sup.R167H/R167H pigs that reached sexual maturity developed neoplastic lesions including lymphomas, osteogenic tumors, and a renal tumor. However, one pig (Case 1) in the first litter of TP53.sup.R167H/R167H pigs died two hours after birth. The necropsy did not reveal any discreet tumors although the liver did have microscopic evidence of hepatocellular atypia (FIG. 12). While no other pigs in our cohort displayed similar atypia or overt tumors in any livers, TP53 mutations are associated with hepatocellular carcinoma. See, e.g., Hussain, S. P., et al., Oncogene 26:2166-2176 (2007). Therefore, future phenotypic studies of the model will help determine if this represents a precursor lesion for hepatocellular tumors.

(139) Three cases of lymphoma in the TP53.sup.R167H/R167H cohort were identified and confirmed histopathologically, with necropsy occurring over a range of 27 to 43 weeks of age (Cases 2-4). In-vivo CT and MRI data collected for Case 4 showed lymphadenopathy consistent with lymphoma 16 weeks prior to necropsy (27 weeks of age) (FIG. 13). Enlargement of the liver and spleen are both indicators of possible diffuse infiltration of the liver with lymphoma so further examination of these organs was performed. See Lee, W. K., et al. AJR. American journal of roentgenology 191:198-206 (2008); Leite, N. P., et al., Radiographics: a review publication of the Radiological Society of North America, Inc 27:1613-1634 (2007). The volume of the liver in Case 4 was assessed by CT and found to be much larger in the TP53.sup.R167H/R167H pig than its weight-matched TP53.sup.R167H/+ control pig (923 ml vs. 659 ml, respectively) (FIG. 14I). The liver volume to animal weight ratio in the TP53.sup.R167H/R167H pig (Case 4) was also larger compared to the liver to animal weight ratio in a TP53.sup.R167H/+ cohort (26.4 ml/kg vs. 15.6 ml/kg respectively). A mild elevation in quantitative CT determined spleen volume was noted in the TP53.sup.R167H/R167H lymphoma case when compared to the weight matched TP53.sup.R167H/+ pig (532 ml vs. 486 ml respectively) and evidence of spleen enlargement was also reflected in the corresponding values of the spleen volume to animal weight ratio for the TP53.sup.R167H/R167H lymphoma case compared to the TP53.sup.R167H/+ cohort (15.2 ml/kg vs. 13.5 ml/kg respectively) (FIG. 14I).

(140) Elevated levels of contrast enhancement and delayed contrast clearance in both the liver and spleen were observed in the 3D fast gradient echo gadolinium enhanced MRI imaging study of the liver and spleen. Further, quantitative assessment of the contrast enhanced MRI study was performed comparing the liver to muscle MRI signal ratio and the spleen to muscle MRI signal ratio. The liver-to muscle ratio (1.13 vs. 0.89 respectively) and spleen-to-muscle ratio (1.02 vs. 0.95 respectively) were both increased in the TP53.sup.R167H/R167H lymphoma case compared to the weight matched TP53.sup.R167H/+ pig. Heterogeneity in signal enhancement in the organs in the TP53.sup.R167H/R167H lymphoma case with respect to a weight matched TP53.sup.R167H/+ pig is reflected through calculation of the coefficient of variation in signal intensity in the spleen (27% vs. 14% respectively) and liver (15% vs. 10%). Heterogeneous organ perfusion and delayed clearance of contrast media in the TP53.sup.R167H/R167H pig supported an imaging diagnosis of lymphoma.

(141) At necropsy, enlargement of the lymph nodes and spleen were prominent and consistent features in affected TP53.sup.R167H/R167H pigs (FIG. 13B-E, FIG. 14A, 14B). Microscopically, sheets of neoplastic lymphocytes effaced tissue architecture in these organs (FIG. 13D, 13E, 14B) with extension into liver and lung (FIG. 14E-H). In Case 2, the animal died suddenly and had hemo-abdomen secondary to splenic rupture (FIG. 14C, 14D). The lungs (and other organs) had vessels filled with abundant cellular and nuclear debris (FIG. 14E, 14F) that is consistent with tumor lysis syndrome, seen in many models (see, e.g., Treuting, P. M., et al., Toxicologic pathology 38:476-485 (2010); Vogel, P., et al., Veterinary pathology 47:719-724 (2010)) and in humans undergoing cytolytic cancer therapy (see, e.g., McBride, A., et al., Journal of hematology & oncology 5:75 (2012); Schifter, T., et al., American journal of hematology 60:75-76 (1999)). All three TP53.sup.R167H/R167H lymphoma cases had changes in selected peripheral blood parameters in the final days prior to necropsy, relative to control animals (FIG. 15). Interestingly, a routine blood sample collected two days prior to necropsy did not distinguish Case 2 from the other lymphoma cases (Cases 3 and 4) suggesting that the tumor lysis syndrome was associated with acute splenic rupture as opposed to tumor burden.

(142) Osteogenic tumors were also identified through in-vivo imaging in two TP53.sup.R167H/R167H pigs (Cases 5 and 6). CT and MRI detected a 28 mm right parasagittal, calvarial lytic (137 HU) tumor in Case 5 at 53 weeks of age. The tumor expanded into the intracranial cavity and also caused destruction of adjacent bone tissue (FIG. 16). In-vivo CT and MRI data collection was completed for Case 6 at two time points. At 53 weeks of age osteogenic tumors in the long bones were detected but no skull/calvarial tumor was present (FIG. 17A, time point 1). At 60 weeks of age, 51 days later, a 39 mm intracranial tumor was detected (FIG. 17A, time point 2). The tumor infiltrated through the bony calvarium to invade both the frontal sinuses and the intracranial compartment with evidence of extrinsic compression of the brain parenchyma. The tumor contained bony matrix as indicated by the increased CT attenuation (305 HU). This was supported by the heterogeneous signal enhancement present in the SPACE MRI data for both Case 5 and Case 6 calvarial tumors, indicating areas of both soft tissue and calcification/ossification. Microscopically, the two calvarial tumors were composed of spindled to epitheloid cells that produced osteoid trabeculae (FIGS. 16 and 17). Both tumors had invasion and one infiltrated into the frontal sinus(es) (FIG. 17A-17D). The sum of the imaging, histological and biological features were consistent with osteosarcoma.

(143) The microscopic lesions in the calvarial tumors were similar in appearance, whereas the other osteogenic tumors in these animals had a varied microscopic appearance, even within the same pig. These changes ranged from osteoid/bone rich to osteoid poor lesions with proliferative mesenchymal cells (FIGS. 18, 19, 20 and 21). These other osteogenic tumors were located in the tibia, femur, and sacrum, ranging in size from 8 mm-18 mm (Table 6, Case 5 and 6). Lytic lesions presented with mean CT attenuations between 87 and 156 HU. Heterogeneous and hyper-dense lesions ranged in mean CT attenuation from 307 to 927 HU. The osteogenic tumors in the long bones of Case 6 were all present at time point 1, prior to development of the calvarial tumor. No significant change in tumor size was detected for any of the osteogenic tumors of the long bones while some subtle changes in CT attenuation were observed, such as the increased solid component of the tumor in FIG. 18. Importantly, no osteogenic tumors were seen in long bones of the pigs without osteosarcoma tumors (littermate TP53.sup.R167H/R167H pigs, TP53.sup.R167H/+ pigs, TP53.sup.+/+ pigs).

(144) In one of the TP53.sup.R167H/R167H pigs with osteogenic tumors (Case 6), a renal tumor was also detected via CT and MRI imaging (FIG. 22A-22D). The tumor (25.8 mm and 8.9 ml) was located in the right cranial pole of the kidney with an accompanying focus of hemorrhage (23.4 ml) at time point 1. Image data of the tumor 51 days later (60 weeks of age, time point 2) showed nominal changes in tumor size (26.3 mm and 7.1 ml), but had obvious resolution of the hemorrhage component. Contrast enhanced CT attenuation of the tumor decreased from time point 1 to 2 (62 HU to 55 HU respectively), reflecting an increase in necrotic tissue component, which was supported by histopathology findings (FIG. 22 E, 22F).

(145) Signal intensity in the tumor relative to the unaffected renal cortex was assessed within the MRI data. Pre-contrast, T1-weighted (VIBE) MRI data revealed a shift from time point 1 to time point 2 from isointense to hypointense signal relative to the renal cortex. The hemorrhage in time point 1 was clearly evident as a hyperintense component. Post-contrast, T1-weighted (VIBE) MRI demonstrated a heterogeneous enhancement at time point 1 and a decrease in signal intensity relative to the renal cortex at time point 2. The resolution of the hemorrhage component and increase in necrosis between the time points is likely responsible for the relative decrease in signal intensity in the follow up post-contrast MRI data.

(146) Microscopically, the renal tumor was composed of necrotic tubules and intervening cords of connective tissue and foci of hemorrhage (FIG. 22 E, 22F). Within and extending through the tumor capsule were small invading nests of poorly differentiated tubules that had a high mitotic rate (FIG. 22E, 22G). The imaging and pathologic findings were consistent with a Wilms tumor (nephroblastoma), a malignancy commonly associated with p53 pathway perturbations in which TP53 mutation correlates with a less favorable prognosis. See Gylys-Morin, V., et al., Radiology 188:517-521 (1993); Stanhope-Baker, P., et al., The Journal of biological chemistry 279:33575-33585 (2004); Ordonez, N., et al., Rosai and Ackeman's Surgical Pathology. J. Rosai, editor. New York: Mosby (2004).

(147) In addition, a mesenteric tumor was detected for Case 6 (FIG. 21). The tumor shape was highly irregular and 78 peculated, with high mean CT attenuation (472 HU) compared to the surrounding soft tissues (30-50 HU) (FIG. 21C). A significant growth in tumor volume from 2.07 ml to 3.08 ml (48% increase) was measured from imaging time point 1 to time point 2 (51 days later), with minimal change in mean CT attenuation (+2 HU) (FIG. 21A, 21B). At necropsy, the irregularly shaped bony tumor was located within the mesentery. The location of the bony mesenteric tumor was near the site of hemorrhage from the renal tumor (FIG. 22); this and its general appearance were consistent with mesenteric myositis ossificans (see Table 2).

Example 7

Molecular Genetic Analyses of TP53R167H/R167H Tumors

(148) Several excised lymph nodes and osteogenic tumors were subjected to western blot analyses to confirm p53-R167H mutant protein expression and activity. Compared to the essentially undetectable expression of non-mutated p53 from wild-type pig brain tissue, mutant p53-R167H protein was expressed at higher levels in each malignant sample (FIG. 23A), as anticipated. The porcine p53-R167H mutation, like its human (R175H) and mouse (R172H) counterparts, is expected to behave as a gain-of-function mutant that fails to regulate normal p53 transcriptional targets (such as p21, see FIG. 24) and instead transactivates a new set of oncogenic gene targets, including cyclin B1. See Freed-Pastor, W. A., et al., Genes & Development 26:1268-1286 (2012); Brachova, P., et al., International Journal of Molecular Sciences 14:19257-19275 (2013). Indeed, tumors and lymph nodes expressing p53-R167H showed marked upregulation of cyclin B1 protein (FIG. 23A). Human tumors expressing mutant p53 primarily sustain chromosomal alterations as opposed to genomic sequence mutations. See Ciriello, G., et al., Nature Genetics 45:1127-1133 (2013). We conducted cytogenetic analyses of metaphases from a lymph node and osteosarcoma isolated from TP53.sup.R167H/R167H pigs, which revealed significant abnormalities in both chromosome number and structure (FIG. 23B). By comparison, a normal karyotype was seen in the skin tissue of a wild-type pig control. These findings confirm the altered expression and activity of mutant p53-R167H in the TP53.sup.R167H/R167H tumors, as well as the characteristic chromosomal instability known to accompany p53 mutation in human tumors.

(149) TABLE-US-00006 TABLE 6 Examples of imaging techniques linking to pathology findings in the TP53.sup.R167H/R167H pigs Case Site Imaging Pathology Case 5 Cranium Right parasagittal lytic tumor Extradural tumor composed of spindled to epitheloid (28 mm) cells that produced irregular trabeculae of osteoid. FIG. 16 Sacrum (L) Left side, lytic tumor (8 mm) Large blood-filled chamber partially surrounded by dense bone and by loose connective tissue with cartilaginous/osteoid production FIG. 20B Femur (L) Distal metaphysis, lytic tumor Solid sheets of tumor cells with scant osteoid (13 mm) production, but with numerous multinucleate osteoclast-like cells FIG. 19 Femur (L) Proximal metaphysis, Dense osteoid/bone trabeculae extending from the heterogeneous tumor (12 mm) edge of the cortex with a partial rim of osteosclerosis along periphery FIG. 20C Tibia Diaphysis/metaphysis, hyper- The tumor was composed of coalescing bone dense tumor (12 mm) trabeculae that effaced most of bone marrow to cortex FIG. 20A Case 6 Cranium Intracranial tumor extending Extradural tumor composed of spindled to epitheloid into frontal sinus (39 mm) cells that produced irregular trabeculae of osteoid FIG. 17 Femur (L) Distal diaphysis/metaphysis, Spindled cells on collagenous to mineralized matrix hyper-dense tumor (18 mm) with a peripheral rim of osteosclerosis FIG. 18 Tibia (L) Proximal metaphysis, hyper- The tumor was composed of coalescing bone dense tumor (13 mm) trabeculae lined by scattered loose connective tissue rare osteoblasts. FIG. 20 Kidney Superior pole, Hypo-dense Diffuse coagulation necrosis with hemorrhage; tumor tumor (26 mm) had numerous irregular tubules with interspersed bands of connective tissue; scattered nests of poorly differentiated tubules invaded through capsule. FIG. 22 Mesentery Irregular hyper-dense tumor Regional mesentery with irregular to elongate bony tumors composed of coalescing trabeculae of bone/osteoid; heterogeneity was seen with focal proliferations to mature bone line by low cellularity connective tissue. FIG. 21

Example 8

Monitoring the Development of Cancer in Various TP-53 Targeted Pigs

(150) TP53 pigs were created according to the methods described herein. Without intervention, these TP53-targeted pigs would be expected to develop a spectrum of tumors throughout the body, just as humans and mice with analogous TP53 mutations. When and where tumors would develop would be impossible to predict so phonotypical characterization was developed.

(151) Heterozygotes. A longitudinal, non-invasive monitoring protocol was developed and implemented utilizing computed tomography (CT) and magnetic resonance imaging (MRI). The pigs were anesthetized, intubated, and mechanically ventilated for the duration of the study. Head, thorax and abdominal imaging protocols were performed with both modalities, including iodine contrast (2 cc/kg) enhanced CT and gadolinium contrast (0.1 mmol/kg) MRI imaging of the thorax and abdomen. Enforced breath-holds at 25 cm H.sub.2O were utilized to eliminate respiratory motion. Seven TP53-heterozygote pigs were imaged at up to five time points throughout a year-long period (aged 1-2 years), allowing for the tracking of disease progression and the systematic comparison of CT and MR datasets for protocol optimization purposes. Structured reports were developed to provide an organized, systematic approach for guiding radiological assessment of the image data focusing on specified anatomies noted in the report. Through longitudinal imaging suspicious lung lesions were identified in two animals and a suspicious liver lesion in another pig. Additionally, enlarged lymph nodes were detected in six animals. Longitudinal assessment of these animals is continuing with imaging, blood-work, and clinical symptom development to track disease progression.

(152) Homozygotes. The TP53-homozygote animals would be expected to develop tumors more rapidly and progress over a shorter timeline. Indeed, homozygote animals developed cancers, including lymphomas and osteosarcomas, in the first year of life (see Example 6). Lymphomas developed as early as 6.5 months of age, commonly with splenomegaly, lymphadenomegaly and hepatomegaly. In one case, the spleen ruptured with additional clinical features of tumor lysis syndrome and sudden death. In other cohorts, osteosarcoma was a repeated finding with intracranial and intra-marrow masses readily detectable by imaging. These tumors match what would be expected in human Li-Fraumeni patients and mice bearing the orthologous R175H and R172H mutations, respectively, since both primarily develop lymphomas and osteosarcoma. See Olive K P, et al., Cell. 2004; 119(6):847-60 (doi: 10.1016/j.cell.2004.11.004. PubMed PMID: 15607980).

(153) Taken together, the results seen in the TP53-targeted pigs validate the utility of pigs as models of human cancer.

(154) It is well established that dual mutation of TP53 and KRAS genes in humans are critical events for the initiation and progression of numerous deadly cancers, including adenocarcinomas of the lung and pancreas. See Bardeesy N, et al., Nature reviews Cancer. 2002; 2(12):897-909; Herbst R S, et al., N Engl J Med. 2008; 359(13):1367-80; Tuveson D A, et al., Oncogene. 1999; 18(38):5318-24; Jackson E L, et al., Cancer Res. 2005; 65(22):10280-8; Hingorani S R, et al., Cancer cell. 2005; 7(5):469-83. In normal cells expressing wild-type p53, the mutagenic activation of KRAS provokes a permanent p53-mediated cell cycle arrest (senescence) that protects cells from oncogenic transformation. In contrast, mutation of p53 impairs its regulation of growth inhibitory genes and allows cells to continue proliferating in the face of mutant KRAS expression. P53 is required for chromosome stability; thus, cells with mutated p53 and KRAS acquire genetic alterations that promote their neoplastic transformation and ultimately the development of tumors (see Fukasawa K., et al., Science. 1996; 271(5256):1744-7; Sherr C J, et al., Cancer cell. 2002; 2(2):103-12). Consistent with those findings in mouse and human cells, pig fetal fibroblasts (PFFs) expressing one or two TP53.sup.R167H alleles effectively escaped mutant KRAS-induced senescence and continued to proliferate (FIG. 24). These data strongly predict that, similar to mouse tumor models, mutant KRAS.sup.G12D expression will accelerate tumorigenesis in heterozygous TP53.sup.R167H/+ pigs.

Example 9

Generation of a Conditional KRAS Mutation in TP53R167H/+ Cells

(155) Homologous recombination is used to generate a conditional KRAS mutation in TP53.sup.R167H/+ cells. The common G12D mutation was introduced in KRAS exon 1. KRAS.sup.G12D is an activating mutation resulting in constitutive GTPase activity and acts via a dominant mechanism of pathogenesis. See Schubbert S, et al., Nature reviews Cancer. 2007; 7(4):295-308 (doi: 10.1038/nrc2109. PubMed PMID: 17384584). In order to conditionally express KRAS.sup.G12D, we also inserted a floxed transcription/translation termination cassette (i.e., a stop cassette) was also upstream of exon 1 (FIG. 10A). The stop cassette is intended to prevent expression of KRAS.sup.G12D from the targeted allele except in the presence of Cre-recombinase. See Tuveson D A, et al., Cancer cell. 2004; 5(4):375-87 (PubMed PMID: 15093544). The non-targeted allele is unaffected, as homozygous KRAS mutations result in embryonic lethality. This inducible system would allow for site-specific expression of the KRAS.sup.G12D allele in almost any tissue by delivering Cre with a virus or by crossing with a pig expressing Cre via a tissue-specific promoter. This method has been used successfully in the generation of KRAS/TP53-targeted mouse models. See Tuveson D A, et al., Cancer cell. 2004; 5(4):375-87 (PubMed PMID: 15093544); Lakso M, et al., Proc Natl Acad Sci USA. 1992; 89(14):6232-6 (PubMed PMID: 1631115; PubMed Central PMCID: PMC49474); Olive K P, et al., Science. 2009; 324(5933):1457-61 (doi: 10.1126/science.1171362. PubMed PMID: 19460966; PubMed Central PMCID: PMC2998180); Guerra C, et al., Cancer cell. 2003; 4(2):111-20 (PubMed PMID: 12957286).

(156) Recombinant adeno-associated virus (rAAV) was used to deliver gene targeting vectors to TP53.sup.R167H/+ primary cells, similar to the process used to develop cystic fibrosis pigs. See, e.g., U.S. Pat. Nos. 7,989,675 and 8,618,352; Rogers C. S. et al., J Clin Invest. 2008; 118(4):1571-7 (Epub 2008/03/08. doi: 10.1172/JCI34773. PubMed PMID: 18324337; PubMed Central PMCID: PMC2265103). Approximately 1.510.sup.6 TP53.sup.R167H/+ porcine fetal fibroblasts were infected with rAAV carrying the KRAS targeting vector (100,000 MOI). After 24 hours, cells were transferred to a series of 96-well plates and G418 (100 g/ml) was added to the media for selection of targeted cells. Two weeks later, 221 G418-resistant colonies were identified, isolated, and split among three sets of 96-well plates for; 1) cell expansion, 2) cryopreservation, and 3) PCR from cell lysates.

(157) Cell lysates were screened by PCR and identified 28 KRAS-targeted clones, which were frozen for future SCNT. It is possible that in these KRAS-targeted cells the crossing over event occurred between the selectable marker and the desired G12D mutation. Therefore, an allele-specific Southern blot was used to identify 18 of the PCR-positive products that also contained G12D (FIG. 10B). By the time cells were frozen, they had been in culture only 15-17 days. We also passaged positive clones from the cell expansion plates to provide genomic DNA for downstream applications. Southern blots using KRAS- and Neo.sup.R-specific probes identified KRAS-targeted clones that were free of random integration (data not shown, but similar blots are shown in FIG. 11). Furthermore, DNA sequence analysis confirmed the desired mutation. These clones are considered ideal for SCNT and were used to generate KRAS/TP53-targeted pigs.

Example 10

Generation of KRAS/TP53 Targeted Pigs

(158) Four litters of KRAS.sup.G12D/+/TP53.sup.R167H/+ pigs (for simplicity, designated KRAS/TP53) were produced by SCNT using the KRAS/TP53 cells generated as set forth in Example 9 (FIG. 11A). The generation of these pigs confirms the viability of pigs produced by the processes described herein and provides cells and tissue in which to demonstrate Cre-mediated expression of KRAS.sup.G12D. PCR, Southern blot analysis, and DNA sequencing were performed to confirm the expected genotype (FIGS. 11B and 11C).

(159) KRAS/TP53 cells were isolated to test whether Cre-recombinase could induce expression of the G12D allele. Fibroblasts were infected with rAAV-Cre, and mRNA was isolated 24 hours later. RT-PCR was performed, followed by an allele-specific Southern blot to detect the presence of the G12D mutation. G12D mRNA was detected in KRAS/TP53 cells treated with Cre, but not in wild-type cells or untreated KRAS/TP53 cells (FIG. 11D).

Other Embodiments

(160) Unless otherwise defined herein, all technical and scientific terms used herein have the ordinary meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein.

(161) Although the invention has been described above in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims.

(162) Following long-standing patent law convention, the terms a, an, and the refer to one or more when used in this application, including the claims. Thus, for example, reference to a subject includes a plurality of subjects, unless the context clearly is to the contrary (e.g., a plurality of subjects), and so forth.

(163) The contents of the articles, patents, and patent applications, and all other documents and electronically available information mentioned or cited herein, are hereby incorporated by reference in their entirety to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference. Applicants reserve the right to physically incorporate into this application any and all materials and information from any such articles, patents, patent applications, or other documents.

(164) Other embodiments are within the following claims.