Antibody specifically binding to HER2

10174116 ยท 2019-01-08

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to HER2 (Human Epidermal Growth Factor Receptor 2) antibodies to prevent or treat cancers. The antibodies of the invention binds specifically to HER2 over-expressed in cancer cells (particularly, breast cancer and stomach cancer cells), specifically to an epitope on HER2 being different from epitope for trastuzumab. The CDR sequences of the present antibodies exhibit low similarity to CDR sequences of publicly known HER2 antibodies, addressing that the CDR sequences are unique. The antibodies of the present invention in combination with trastuzumab kill cancer cells with significantly enhanced cytotoxicity and therefore very effective in therapy of cancer (particularly, breast cancer and stomach cancer). Without wishing to be bound by theory, the enhanced efficacies of the combined therapy would address that the antibodies of the present invention bind to epitope on HER2 being different from epitope for trastuzumab, and inhibit HER2 in a cooperative manner with trastuzumab.

Claims

1. An antibody to human epidermal growth factor receptor 2 (HER2) or antigen-binding fragment thereof, comprising: (i) a heavy chain variable region comprising a complementarity determining region (CDR) H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:3 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:6; (ii) a heavy chain variable region comprising CDRH1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:3 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:218; (iii) a heavy chain variable region comprising CDRH1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:3 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:239; (iv) a heavy chain variable region comprising CDRH1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:3 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:88; (v) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:76 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:6; (vi) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:43 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:6; (vii) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:84 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:6; (viii) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:85 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:6; (ix) a heavy chain variable region comprising CDRH1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:76 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:222; (x) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:67 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:156; (xi) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:3 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:109; (xii) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:76 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:157; (xiii) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:67 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:154; (xiv) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:3 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:220; (xv) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:64 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:178; (xvi) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:64 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:6; (xvii) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:71 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:155; (xviii) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:3 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:131; (xix) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:71 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:6 or (xx) a heavy chain variable region comprising CDR H1 of SEQ ID NO:1, CDRH2 of SEQ ID NO:2 and CDRH3 of SEQ ID NO:83 and a light chain variable region comprising CDRL1 of SEQ ID NO:4, CDRL2 of SEQ ID NO:5 and CDRL3 of SEQ ID NO:6.

2. The antibody or antigen-binding fragment thereof according to claim 1, wherein the heavy chain variable region of (i), (ii), (iii), (iv), (xi), (xiv) and (xviii) comprises the amino acid sequence of SEQ ID NOs: 8 or 24.

3. The antibody or antigen-binding fragment thereof according to claim 1, wherein the light chain variable region of (i), (v), (vi), (vii), (viii), (xvi), (xix), and (xx) comprises the amino acid sequence of SEQ ID NOs: 10 or 26.

4. A pharmaceutical composition comprising: (a) a pharmaceutically effective amount of the antibody to HER2 or antigen-binding fragment thereof according to claim 1; and (b) a pharmaceutically acceptable carrier.

5. The pharmaceutical composition according to claim 4, wherein the composition further comprises trastuzumab.

6. A pharmaceutical composition for inducing apoptosis, comprising: (a) a pharmaceutically effective amount of the antibody to HER2 or antigen-binding fragment thereof according to claim 1; and (b) a pharmaceutically acceptable carrier.

7. The pharmaceutical composition according to claim 6, wherein the pharmaceutical composition induces apoptosis for treatment of a hyperproliferative disease that expresses HER2; and wherein the hyperproliferative disease is cancer, hyperplasia, keloid, Cushing syndrome, primary aldosteronism, erythroplakia, polycythemia vera, leukoplakia, hyperplastic scar, lichen planus, lentiginosis, arteriosclerosis, atherosclerosis, restenosis, or stenosis.

8. A kit for detecting HER2 in a biological sample comprising the antibody to HER2 or antigen-binding fragment thereof according to claim 1.

9. A pharmaceutical composition comprising: (a) a pharmaceutically effective amount of the antibody to HER2 or antigen-binding fragment thereof according to claim 2; and (b) a pharmaceutically acceptable carrier.

10. A pharmaceutical composition comprising: (a) a pharmaceutically effective amount of the antibody to HER2 or antigen-binding fragment thereof according to claim 3; and (b) a pharmaceutically acceptable carrier.

11. The pharmaceutical composition according to claim 9, wherein the composition further comprises trastuzumab.

12. The pharmaceutical composition according to claim 10, wherein the composition further comprises trastuzumab.

13. A pharmaceutical composition for inducing apoptosis, comprising: (a) a pharmaceutically effective amount of the antibody to HER2 or antigen-binding fragment thereof according to claim 2; and (b) a pharmaceutically acceptable carrier.

14. The pharmaceutical composition according to claim 13, wherein the pharmaceutical composition induces apoptosis for treatment of a hyperproliferative disease that expresses HER2; wherein the hyperproliferative disease is cancer, hyperplasia, keloid, Cushing syndrome, primary aldosteronism, erythroplakia, polycythemia vera, leukoplakia, hyperplastic scar, lichen planus, lentiginosis, arteriosclerosis, atherosclerosis, restenosis or stenosis.

15. A pharmaceutical composition for inducing apoptosis, comprising: (a) a pharmaceutically effective amount of the antibody to HER2 or antigen-binding fragment thereof according to claim 3; and (b) a pharmaceutically acceptable carrier.

16. The pharmaceutical composition according to claim 15, wherein the pharmaceutical composition induces apoptosis for treatment of a hyperproliferative disease that express HER2; and wherein the hyperproliferative disease is cancer, hyperplasia, keloid, Cushing syndrome, primary aldosteronism, erythroplakia, polycythemia vera, leukoplakia, hyperplastic scar, lichen planus, lentiginosis, arteriosclerosis, atherosclerosis, restenosis or stenosis.

17. A kit for detecting HER2 in a biological sample comprising the antibody to HER2 or antigen-binding fragment thereof according to claim 2.

18. A kit for detecting HER2 in a biological comprising the antibody to HER2 or antigen-binding fragment thereof according to claim 3.

19. A method for treating a cancer and/or inducing apoptosis for treatment of a hyperproliferative disease of a subject, comprising administering to the subject in need thereof a composition comprising (a) a pharmaceutically effective amount of the antibody to HER2 or antigen-binding fragment thereof according to claim 1; and (b) a pharmaceutically acceptable carrier, wherein the cancer and the hyperproliferative disease express HER2.

20. The method according to claim 19, which further comprises administering trastuzumab.

21. The method according to claim 19, wherein the cancer that expresses HER2 is breast cancer, ovarian cancer, stomach cancer, lung cancer, liver cancer, bronchus cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colorectal cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, head and neck cancer, skin cancer, thyroid cancer, parathyroid cancer, or ureteral cancer.

22. The method according to claim 19, wherein the hyperproliferative disease that expresses HER2 is cancer, hyperplasia, keloid, Cushing syndrome, primary aldosteronism, erythroplakia, polycythemia vera, leukoplakia, hyperplastic scar, lichen planus, lentiginosis, arteriosclerosis, atherosclerosis, restenosis or stenosis.

23. A method for treating a cancer and/or inducing apoptosis for treatment of a hyperproliferative disease of a subject, comprising administering to the subject in need thereof a composition comprising (a) a pharmaceutically effective amount of the antibody to HER2 or antigen-binding fragment thereof according to claim 2; and (b) a pharmaceutically acceptable carrier, wherein the cancer and the hyperproliferative disease express HER2.

24. The method according to claim 23, which further comprises administering trastuzumab.

25. The method according to claim 23, wherein the cancer that expresses HER2 is breast cancer, ovarian cancer, stomach cancer, lung cancer, liver cancer, bronchus cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colorectal cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, head and neck cancer, skin cancer, thyroid cancer, parathyroid cancer, or ureteral cancer.

26. The method according to claim 23, wherein the hyperproliferative disease that expresses HER2 is cancer, hyperplasia, keloid, Cushing syndrome, primary aldosteronism, erythroplakia, polycythemia vera, leukoplakia, hyperplastic scar, lichen planus, lentiginosis, arteriosclerosis, atherosclerosis, restenosis or stenosis.

27. A method for treating a cancer and/or inducing apoptosis for treatment of a hyperproliferative disease of a subject, comprising administering to the subject in need thereof a composition comprising (a) a pharmaceutically effective amount of the antibody to HER2 or antigen-binding fragment thereof according to claim 3; and (b) a pharmaceutically acceptable carrier, wherein the cancer and the hyperproliferative disease express HER2.

28. The method according to claim 27, which further comprises administering trastuzumab.

29. The method according to claim 27, wherein the cancer that expresses HER2 is breast cancer, ovarian cancer, stomach cancer, lung cancer, liver cancer, bronchus cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, colorectal cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, head and neck cancer, skin cancer, thyroid cancer, parathyroid cancer, or ureteral cancer.

30. The method according to claim 27, wherein the hyperproliferative disease that expresses HER2 is cancer, hyperplasia, keloid, Cushing syndrome, primary aldosteronism, erythroplakia, polycythemia vera, leukoplakia, hyperplastic scar, lichen planus, lentiginosis, arteriosclerosis, atherosclerosis, restenosis or stenosis.

31. The antibody or antigen-binding fragment thereof according to claim 1, wherein the heavy chain variable region of (i) comprises the amino acid sequence of SEQ ID NOs: 8 or 24.

32. The antibody or antigen-binding fragment thereof according to claim 1, wherein the light chain variable region of (i), (iv), (ii), and (iii) comprises the amino acid sequence of SEQ ID NOs: 26, 247, 249, and 251, respectively.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows genetic maps of pcDNA3.3-IgG Heavy vector and pOptiVEC-IgG Kappa vector.

(2) FIGS. 2A and 2B are graphs respectively showing the proliferation inhibitory effects of a single treatment by 1E11 antibody and a combined treatment of 1E11 antibody and trastuzumab against NCI-N87 cancer cell line and BT-474 cancer cell line. TRA, PER, and hIgG respectively indicate trastuzumab, pertuzumab, and human IgG (negative control).

(3) FIGS. 3A and 3B show that 1E11 antibody binds to a domain of HER2 sub-domain which is different from the binding domain of trastuzumab. FIGS. 3A and 3B respectively show the results of SPR analysis and ELISA analysis.

(4) FIG. 4A shows the result of ELISA analysis to examine whether 1E11 antibody binds specifically to HER2 among ErbB family proteins to which HER2 belongs. Cetuximab (CET) was used as a control antibody against EGFR protein.

(5) FIG. 4B shows the result of ELISA analysis to examine whether 1E11 antibody binds to HER2 other than humans.

(6) FIG. 5A shows the analysis result of the percentage of cancer cells where apoptosis occurred when NCI-N87 cells were treated with 1E11 antibody or trastuzumab alone or in combination thereof.

(7) FIG. 5B shows the analysis result of the percentage of cancer cells where apoptosis occurred when BT-474 cells were treated with 1E11 antibody or trastuzumab alone or in combination thereof.

(8) FIG. 5C shows the result of cell viability analyses 24 hours and 48 hours after treating NCI-N87 cells with 1E11 antibody or trastuzumab alone or in combination thereof. The control group shows the viability of cells treated with PBS only, the solvent for the antibodies.

(9) FIG. 5D shows the analysis result of Caspase-3/7 activity, 24 hours after treating NCI-N87 cells with 1E11 antibody or trastuzumab alone or in combination thereof. The control group shows the viability of cells treated with PBS only, the solvent for the antibodies.

(10) FIG. 6A shows the result of western blot analysis illustrating the decrease in HER2 downstream signaling by treatment with 1E11 antibody or trastuzumab alone or in combination thereof.

(11) FIG. 6B is a graph showing the inhibitory effect for the heterodimerization-induced cell proliferation by the treatment with 1E11 antibody or trastuzumab alone or in combination thereof. A negative control (Negative ctrl) shows the viability of cells neither treated with ligands nor antibodies, and a positive control (Positive ctrl) shows the viability of cells treated with ligands only without treatment with antibodies.

(12) FIGS. 7A through 7C show the tumor cell growth inhibitory effects in an NCI-N87 xenograft animal model by the treatment with 1E11 antibody or trastuzumab alone or in combination thereof. FIG. 7A shows a graph illustrating the change in tumor volume, FIG. 7B shows a graph illustrating the change in tumor weight, and FIG. 7C shows an image illustrating the staining result of tumor tissues. Control Ab is palivizumab.

(13) FIGS. 8A and 8B are graphs respectively showing the proliferation inhibitory effects for NCI-N87 cancer cell line and OE-19 cancer cell line, by a single treatment with hz1E11 antibody, which is a humanized antibody, and a combined treatment of hz1E11 antibody and trastuzumab.

(14) FIG. 9 shows the tumor cell growth inhibitory effect in an NCI-N87 xenograft animal model by the treatment with hz1E11 antibody or trastuzumab alone or in combination thereof. Control Ab is palivizumab.

(15) FIGS. 10A and 10B respectively show alanine scanning results of CDRH3 and CDRL3 of the hz1E11 antibody.

(16) FIGS. 11A through 11F are graphs showing the proliferation inhibitory effects for NCI-N87, OE-19, and BT-474 cancer cell lines by a single treatment with hz1E11-3, hz1E11-133, and hz1E11-154 antibodies, which are affinity-improved humanized antibodies, and a combined treatment of trastuzumab therewith.

(17) The present invention will now be described in further detail by examples. It would be obvious to those skilled in the art that these examples are intended to be more concretely illustrative and the scope of the present invention as set forth in the appended claims is not limited to or by the examples.

EXAMPLES

Example 1: Development of HER2 Antibodies

(18) For preparing antibodies, the extracellular domain (ECD) of HER2 protein was produced using animal cells and then used it as an antigen. The DNA, where a hinge region of human IgG1 and Fc portion (CH2-CH3) were bound to the C-terminus of ECD, was cloned using HindIII and BamHI restriction enzymes. Then, the cloned vector was transiently transfected into the FreeStyle 293F (Invitrogen, Cat. No. R790-07) cell using polyethyleneimine (Polyscience Inc., Cat. No. 23966), and HER2-ECD Fc fusion protein was purified from the cell culture using Protein-A Ceramic HyperD F resin (PALL, Cat No. 20078-028). The purified protein was quantitated using a Protein assay dye (Bio-Rad, Cat. No. 500-0006), subjected to SDS-PAGE, and its concentration and purity were confirmed via Coomassie staining. 100 g of the purified protein antigen was mixed with Freund's adjuvant (Sigma, Cat. No. F5506) and then intraperitoneally injected into BALB/c mice (DBL Co., Ltd., Korea). In two weeks, 100 g of the antigen was diluted in PBS and injected again, and three days thereafter, the spleen of the mouse was taken out and lymphocytes were isolated therefrom. The isolated lymphocytes were mixed with the myeloma cell line SP2/0-Ag14 (ATCC, Cat. No. CRL-1581) at a 5:1 ratio, and fused using PEG-1500 (Roche, Cat. No. 783641). The fused cells were cultured in a medium containing the HAT supplement (Sigma, Cat. No. H0262), and the fused cells (hybridoma) were selectively sorted out and cultured.

(19) The thus-obtained hybridoma cells were examined via ELISA assay to determine whether they were the cells producing antibodies that bind to antigens. HER2-ECD-Fc or ChromPure human IgG (hIgG, Jackson Immunoresearch Lab. Inc., Cat. No. 009-000-003) was immobilized at room temperature to a Costar 96-well plate (Corning, Cat. No. 3590) at a concentration of 1 g/mL for 1 hour. The resultant was washed 3 times with TBS-T (0.05% Triton X-100) and then blocked at room temperature with 300 L of TBS-T/SM (2% skim milk) for 30 minutes. The blocked plate was washed 3 times and added with a hybridoma culture broth, and allowed to bind to antibodies at 37 C. for 1 hour. After washing the resultant 3 times, anti-mouse IgG-HRP (Pierce, Cat. No. 31439) as a secondary antibody was diluted in TBS-T/SM at a 1:5,000 ratio and allowed to bind thereto at 37 C. for 1 hour. After washing the resultant 3 times, TMB (SurModics, Cat. No. TMBC-1000-01) was added thereto and allowed to develop a color at room temperature for 5 minutes and added with 1 N sulfuric acid (DukSan, Cat. No. 254) to stop the color development. The absorbance was measured at 450 nm using Victor X3 (PerkinElmer, Cat. No. 2030-0030), and the antibodies that bind specifically to HER2-ECD-Fc were selected.

(20) Since HER2 is a protein expressed on the cell surface, it was examined whether the developed antibodies were bound to HER2-overexpressing cells via cell-based ELISA assay. The HER2-overexpressing ovary cancer cell line, SKOV-3 (Korean Cell Line Bank (KCLB), Cat. No. 30077) was aliquoted into the Costar 96-well cell culture plate (Corning, Cat. No. 3595) at a concentration of 10,000 cell/well and cultured for 24 hours. On the following day, after removing the cell culture supernatant, the resultant was washed with PBS 3 times, added with hybridoma culture broth, and cultured further at 37 C. for 2 hours. After washing the resultant 3 times with TBS-T, goat anti-mouse IgG-HRP as a secondary antibody which was diluted in PBS/FBS (3% FBS) at a 1:5,000 ratio, added thereto, and treated at room temperature for 1 hour. After washing the resultant 3 times with TBS-T, it was allowed to develop a color using TMB. 61 clones showing higher absorbance than that of the SP2/0 cell culture as a negative control were selected.

Example 2: Comparison of Inhibitory Effects of Developed Antibodies Against the Growth of Breast Cancer Cells

(21) In order to perform a cell viability assay for confirming the inhibitory effect against the proliferation of breast cancer cells, the antibodies from the hybridoma culture broth were purified. The hybridoma was cultured in a culture medium containing 3% FBS, and the antibodies in the form of IgG were purified using Protein-A resin. The purified antibodies were quantitated via BCA assay (Pierce, Cat. No. 23227), subjected to SDS-PAGE, and their concentration and purity were confirmed via Coomassie staining.

(22) Cell viability assay was performed by a single treatment or a combined treatment along with trastuzumab regarding BT-474, the representative breast cancer cell line, and NCI-N87 cell line, the representative stomach cancer cell line, where HER2 is overexpressed. For the combined treatment, a mixture of the developed antibodies and trastuzumab mixed at a 1:1 ratio (weight ratio) was used. To the 96-well plate were aliquoted BT-474 (ATCC, Cat. No. HTB-20, 10,000 cells/well) and NCI-N87 (ATCC, Cat No. CRL-5822, 10,000 cells/well) cells, and cultured for 24 hours. The purified antibodies were respectively treated to have a concentration of 5 g/mL, and BT-474 and NCI-N87 cell lines were cultured further for 4 days. For cell viability assay, CCK-8 (Dojindo, Cat. No. CK-04-13) was added to a final concentration of 10%, treated at 37 C. for 3 hours, and their absorbance was measured. The relative viability was calculated relative to the absorbance of the well not treated with the antibody, which was set at 100% of viability. Based on the above, 1E11 antibody was selected.

Example 3: Analysis of Antibody Sequence

(23) For antibody sequence assay, a phage Fab antibody library was constructed using the respective hybridoma RNA, and a three-step panning was proceeded to obtain a phage that binds to the HER2-ECD-Fc (Phage display: a laboratory manual, Carlos Barbas III, et al., Cold Spring Harbor Laboratory Press). After culturing the hybridoma, RNA was isolated using SV Total RNA Isolation System (Promega, Cat. No. Z3100) and a cDNA was synthesized therefrom. Using a known primer set (see: Phage display: a laboratory manual, Carlos Barbas III, et al., Cold Spring Harbor Laboratory Press), the variable region of the antibody was amplified, and cloned into pComb3X vector (Barbas laboratory, The Scripps Research Institute) using SfiI restriction enzyme after ligating to human Ck and CH1, and then transformed into ER2537 bacteria (New England Biolabs, Cat. No. 801-N). The transformed bacteria were transfected with VCSM13 helper phage (Stratagene, Cat. No. 200251) to obtain a phage, and a clone which binds to HER2-ECD-Fc was acquired using an immunotube, to which HER2-ECD-Fc was immobilized.

(24) Among the colonies for each of the antibodies, the antibodies that bind to HER2-ECD-Fc were confirmed via ELISA assay. The colonies of the transformed bacteria were cultured at 37 C. until their absorbance at 600 nm reached 0.5, and treated with IPTG at a final concentration of 1 mM, allowed to and expressed antibodies in the form of Fab while culturing overnight at 30 C. After culturing 5 mL, cells were collected by centrifugation, suspended in 0.4 mL 1TES (50 mM Tris, 1 mM EDTA, 20% (v/v) sucrose, pH 8.0), and treated at 4 C. for 10 minutes. After adding 0.6 mL of 0.2TES thereto, the resultant was treated at 4 C. for 30 minutes, centrifuged and the supernatant was recovered. After washing the Costar 96-well half area plate (Corning Inc., Cat. No. 3690), which was coated with HER2-ECD-Fc at a concentration of 1 g/mL, 3 times with TBS-T, it was blocked with TBS-T/SM (3% non-fat skim milk, 0.05% Triton X-100) at room temperature for 1 hour. The culture broth or periplasmic extract (Periplasm) for each colony was treated by diluting it at a 1:3 ratio using TBS-T/SM, and allowed to bind at room temperature for 1 hour. After washing 3 times, anti-HA-HRP (Roche, Cat. No. 120-138-190-01) as a secondary antibody was diluted at a 1:5000 ratio, allowed to bind at room temperature for 1 hour, washed 3 times, and allowed to develop a color using TMB.

(25) Most colonies in the cell culture broth or periplasmic extract had absorbance of 0.2 or higher, and the sequences of the antibodies were analyzed regarding these clones. The sequence analysis revealed that the colonies derived from a single hybridoma were shown to have the same sequences. The amino acid sequences of complementarity determining region (CDR) of the 1E11 antibody are summarized in Table 1 below.

(26) TABLE-US-00001 TABLE1 Aminoacidsequencesofcomplementarity determiningregion(CDR)ofthe1E11antibody LightChain HeavyChain CDR1 LASQTIGTWLA SYTMS (SEQIDNO:4) (SEQIDNO:1) CDR2 ATSLAD YISNGGGSTYYPDTVKG (SEQIDNO:5) (SEQIDNO:2) CDR3 QQLYSTPWT HLGGTASFDY (SEQIDNO:6) (SEQIDNO:3)

Example 4: Construction and Production of Chimeric Antibodies

(27) Chimeric antibodies were constructed to prepare the antibodies of the present invention in a more druggable form.

(28) The variable region of the mouse antibodies, for which the nucleotide sequence analysis was completed, was amplified and bound to the human constant regions C and CH, and the heavy chain part was TA cloned by pcDNA3.3-TOPO (Invitrogen, Cat. No., K8300-01) vector, whereas the light chain part was TA cloned by pOptiVEC-TOPO (Invitrogen, Cat. No., 12744-017) vector. The primers used for amplification are shown in Tables 2 and 3 below. The forward primers were inserted with a ClaI restriction site, whereas the reverse primers were added with NheI restriction site for the heavy chain and BsiWI restriction site for the light chain, respectively. Additionally, the forward primers in the variable region were added with a signal sequence so that the chimeric antibodies could be secreted in cell culture broth. The nucleotide sequences and amino acid sequences of C and CH used in the present invention are described in SEQ ID NOs: 11 through 14.

(29) A PCR reaction (30 sec. at 95 C.; 30 sec. at 58 C.; and 30 sec. at 72 C.) was repeatedly performed for 35 cycles using the primers and GoTaq DNA polymerase (Promega, Cat. No. M3005) described above. Each of the amplified PCR products of the variable regions and the constant regions, after being subjected to a 1% agarose gel electrophoresis, was purified using a Qiaquick gel extraction kit (QIAGEN, Cat. No. 28706). In order to connect the variable regions and the constant regions, the PCR products of the variable regions and the constant regions were mixed in an equal amount, and an overlap extension PCR was performed using the forward primers for the variable regions and the reverse primers for the constant regions to obtain gene products, and the products were purified in the same manner as described above. The overlap extension PCR (30 sec. at 95 C.; 30 sec. at 58 C.; and 45 sec. at 72 C.) was repeatedly performed for 35 cycles using the primers and was performed using the GoTaq DNA polymerase (Promega, Cat. No. M3005). The amplified gene products were TA cloned into pcDNA3.3-TOPO (Invitrogen, Cat. No., K8300-01) vector for the heavy chain part, and TA cloned into pOptiVEC-TOPO (Invitrogen, Cat. No., 12744-017) vector for the light chain part, according to the manufacturer's manual.

(30) TABLE-US-00002 TABLE2 Primersforamplificationofvariableregions Primers Sequence LF-1 CCGATCGATATGGAGACAGACACACTCCTGCTATGGG TACTGCTGCTCTGGGTTCCAGGTTCCACGTGGGATAT TCAGATG(SEQIDNO:15) LR-1 CGGCGTACGTTTCAGCTCCAGCTTGG(SEQIDNO:16) HF-1 CCGATCGATATGGAGACAGACACACTCCTGCTATGGG TACTGCTGCTCTGGGTTCCAGGTTCCACGTGGGAGGT GAAGCT(SEQIDNO:17) HR-1 CGGGCTAGCTGAGGAGACGGTGAC(SEQIDNO:18)

(31) TABLE-US-00003 TABLE3 Primersforamplificationofconstantregions Primers Sequence Ck-F GGAGCTGAAACGTACGGTGGCTGCACC (SEQIDNO:19) Ck-R CCGCTCGAGTTAACACTCTCCCCTGTTG (SEQIDNO:20) CH-F CACCGTCTCCTCAGCTAGCACCAAGGGCCCATCG (SEQIDNO:21) CH-R CCGCTCGAGTCATTTACCCGGGGACAGGGAG (SEQIDNO:22)

(32) In the above Tables, the bold letters indicate the restriction sites for restriction enzymes, whereas the underlined parts indicate signal sequences.

(33) The maps of the finally constructed pcDNA3.3-IgG Heavy vector and pOptiVEC-IgG Kappa vector are illustrated in FIG. 1.

(34) Then, the cloned vectors were transiently transfected into FreeStyle 293F (Invitrogen, Cat. No. R790-07) animal cells using polyethyleneimine (Polyscience Inc., Cat. No. 23966), and chimeric antibodies were purified from the cell culture broth using Protein-A Ceramic HyperD F resin (PALL, Cat No. 20078-028). The purified chimeric antibodies were quantitated via BCA assay (Pierce, Cat. No. 23227), subjected to SDS-PAGE, and their concentration and purity were confirmed via Coomassie staining.

Example 5: Comparison of Inhibitory Effects of Developed Antibodies Against the Growth of Breast Cancer and Stomach Cancer

(35) In order to confirm the anticancer effects of the developed antibodies according to their concentration, a cell viability assay was performed regarding cancer cell lines which overexpress HER2 such as, BT-474 (a breast cancer cell line), and NCI-N87 (a stomach cancer cell line). BT-474 (10,000 cells/well) and NCI-N87 (10,000 cells/well) at a volume of 70 L were aliquoted to a 96-well plate, and immobilized thereto while culturing for 24 hours. On the next day, 30 L of the antibodies were added to the culturing cells. The final concentration of the treated antibodies was at maximum 20 g/mL per each antibody and sequentially diluted at a 1:4 ratio, and the assay was performed at 5 different concentrations. When treated in combination of trastuzumab, the ratio between the developed antibodies and trastuzumab was set at a 1:1 ratio (for example, in FIGS. 2A and 2B, when the amount of administration was 1 g/mL, 1 g/mL of TRA and 1 g/mL of 1E11 were administered). After the treatment with the antibodies, BT-474 and NCI-N87 cells were cultured for 4 additional days, added with CCK-8 to a final concentration of 10%, and treated at 37 C. for 3 hours. Then, the absorbance of the treated cells was measured at 450 nm using Victor X-3. The absorbance of the cells not treated with the antibodies was set at 100%, and their relative viability was calculated (FIGS. 2A and 2B).

(36) The developed 1E11 antibody showed an inhibitory effect against the proliferation of NCI-N87 (FIG. 2A) and BT-474 (FIG. 2B) cell lines, which were responsive to trastuzumab. Furthermore, the combined treatment of 1E11 antibody and trastuzumab showed a higher inhibitory activity against cancer cell proliferation than trastuzumab treatment alone, regarding the NCI-N87 and BT-474 cell lines. Interestingly, the combined treatment of 1E11 antibody and trastuzumab showed a higher inhibitory activity against cancer cell proliferation than the combined treatment of trastuzumab and pertuzumab, regarding the NCI-N87 cell line (FIG. 2A).

Example 6: Confirmation of Synergistic Effect of Developed Antibodies in Combination Treatment with Trastuzumab

(37) In order to confirm whether the anticancer effect of the combined treatment of the developed 1E11 antibody and trastuzumab in stomach cancer was synergistic effect, NCI-N87 cells were treated with 1E11 antibody or trastuzumab alone or in combination thereof the anticancer effects were analyzed (FIG. 2A). The anticancer effect according to concentration was analyzed via CalcuSyn program (Biosoft) using Chou & Talalay method (Chou et al., Adv. Enzyme. Regul. 22:27-55(1984)) which analyzes the effect of combined administration of at least two drugs (Table 4). When two drugs are administered in combination they either become agonistic, additive, or synergistic. The mutual interactions of drugs can be analyzed using Chou & Talalay method in terms of combination index (CI). The CI value of 1 or greater indicates an agonistic effect, while CI values of 1, and 1 or less indicate an additive effect, and a synergistic effect, respectively.

(38) TABLE-US-00004 TABLE 4 1E11 + Trastuzumab C.I. ED50 ED75 ED90 r 0.0315 0.0459 0.0751 0.95921

(39) In the above Table, ED50, ED75 and ED90 indicate the effective doses, which show effects in 50%, 75% and 90% populations, respectively. r indicates a linear correlation coefficient of a median-effect plot.

(40) As can be seen in FIG. 2A and Table 4, the CI value of the two drugs of trastuzumab and 1E11 clones at the time of their combined treatment was below 0.1, and thus the two antibodies were confirmed to have a synergistic effect when administered in combination.

Example 7: Comparison of Epitopes Between the Developed Antibodies and Trastuzumab

(41) Trastuzumab, the antibody to HER2, is known to bind to domain-4 among the four domains of the HER2 ECD. In order to confirm whether the epitopes on HER2 of the developed antibodies overlap with those of trastuzumab, an epitope binning was performed via surface plasmon resonance (SPR) using Biacore 3000 (GE Healthcare). About 1,000 RU (response unit) of trastuzumab was immobilized to a CM5 sensor chip (GE Healthcare, Cat. No. BR-1000-12) via an amine coupling method using ECD/NHS. HER2-ECD-His protein at a concentration of 320 nM was allowed to bind to the sensor chip, to which the trastuzumab was immobilized, using HBS-P buffer (10 mM HEPES, 150 mM NaCl, 1 mM EDTA, 0.005% Tween-20, pH 7.4) for 4 minutes, and only the buffer was flowed thereonto for 5 minutes thereafter to stabilize the binding between trastuzumab and HER2-ECD. Then, the secondary antibodies at a concentration of 1 g/mL were allowed to bind thereto for 4 minutes, and the buffer was allowed to flow thereonto. In all experiments, the flow rate was set at 50 L/min. If the secondarily bound antibodies further bind to the HER2-ECD protein, to which trastuzumab was bound, they are antibodies that do not share the common epitope with trastuzumab.

(42) As can be seen in FIG. 3A, hIgG, which was used as a secondary antibody, does not bind to HER2 and thus there was no additional binding, and since trastuzumab has the same epitope it did not bind further. In contrast, the 1E11 antibody was additionally bound to HER2-ECD, which was bound to trastuzumab, and thus it was confirmed to have an epitope which is different from that of trastuzumab.

(43) In order to confirm the domain region to which the 1E11 clones bind, the four sub-domains (domains 1-4) which constitute the extracellular domain of HER2 protein were individually produced using animal cells, to which the hinge region and the Fc region of human IgG1 were bound, and purified using Protein-A. The binding of the 1E11 clones, trastuzumab, pertuzumab was confirmed via ELISA assay regarding the thus-produced recombinant protein. As can be seen in FIG. 3B, the 1E11 clones were shown to bind to the sub-domain 4, as in the case with trastuzumab.

(44) From the foregoing results, it was confirmed that 1E11 clones bind to the sub-domain 4 of ECD of the HER2 protein but they bind to an epitope which is different from that of trastuzumab (FIG. 3).

Example 8: Specificity of Developed Antibody to HER2

(45) Whether the developed 1E11 antibodies bind specifically to HER2 among the ErbB family proteins, to which HER2 belongs, and whether they bind to HER2 of species other than humans were confirmed via ELISA assay. In order to confirm whether the developed 1E11 antibodies bind specifically to HER2 among the ErbB family proteins, the extracellular domains of EGFR, HER2, HER3 and HER4, which belong to the ErbB family, were examined via ELISA assay. The extracellular domains of EGFR (EGFR-ECD-Fc) were produced in the same manner as in HER2-ECD-Fc, and HER3 (R&D Systems, #348-RB-050) and HER4 (R&D Systems, #1131-ER-050) were purchased. In order to confirm whether the developed antibodies exhibit interspecific cross-reactions to HER2 proteins of different species, HER2 extracellular domains of humans, a rhesus monkey, a cynomolgus monkey, a mouse, and a rat were used and confirmed via ELISA assay. The extracellular domain of a cynomolgus monkey was produced in the same manner as in human HER2-ECD-Fc, and the HER2 extracellular domain of a rhesus monkey (Sino Biological Inc., #90020-K08H), the HER2 extracellular domain of a mouse (Sino Biological Inc., #50714-M08H), and the HER2 extracellular domain of a rat (Sino Biological Inc., #80079-R08H) were purchased.

(46) As can be seen in FIGS. 4A and 4B, it was confirmed that the developed 1E11 antibodies specifically bind to HER2 among the human ErbB family proteins, and have interspecific cross-reactions to HER2 proteins of a rhesus monkey and a cynomolgus monkey.

Example 9: Apoptosis Analysis of HER2 Antibodies

(47) We analyzed apoptosis induction abilities of HER2 antibodies to elucidate an underlying molecular mechanism of anticancer effects of 1E11 antibody co-administered with trastuzumab. To investigate apoptosis induction abilities, NCI-N87 and BT-474 cells were treated with 10 g/mL of 1E11 antibody, trastuzumab or its combination for 48 hr (10 g/mL of 1E11 and 10 g/mL of trastuzumab for combined administration). After the antibody treatment, cells were detached with trypsin and 500,000 cells were analyzed using ApoScreen Annexin V Apoptosis kit (SouthernBiotech, #10010-02) by a flow cytometry analysis (Cytomics FC500, Beckman Coulter Inc.) (FIGS. 5A and 5B).

(48) To measure activities of caspase-3 and caspase-7 playing a crucial role in apoptosis, anticancer efficacies of 1E11 antibody, trastuzumab or combination thereof were analyzed over treatment time. NCI-N87 cells were treated with 10 g/mL of antibodies. After 24 hr and 48 hr of the treatment, cell viability assay was performed using Caspase-Glo (Promega, #G7571) (FIG. 5C). It was shown that the cell viability was sharply decreased after 24 hr of the treatment. Based on such results, the activities of caspase-3/7 were measured after 24 hr of the treatment. NCI-N87 cells were treated with 10 g/mL of antibodies for 24 hours. Caspase-Glo 3/7 Assay (Promega, #G809) was used to measure caspase-3/7 activity (FIG. 5D).

(49) As represented in FIGS. 5a and 5b, 1E11 antibody alone was shown to exert apoptotic activity to HER2-overexpressing stomach cancer (NCI-N87 cells) and breast cancer (BT-474 cells), which are unlike trastuzumab. The apoptotic activity of 1E11 antibody was further increased with combined treatment with trastuzumab. The increased apoptotic activity of the combined treatment with 1E11 and trastuzumab was analyzed to be due to increase in caspase-3/7 activity playing a crucial role in apoptosis (FIG. 5D).

Example 10: HER2 Cell Signaling Inhibition by Antibodies

(50) To elucidate the anticancer mechanism of 1E11 in combination with trastuzumab against HER2-overexpressing stomach cancer and breast cancer, we analyzed HER2 signaling activities in cells. NCI-N87 cells were treated with 10 g/mL of antibodies for 24 hours. Then cells were lysed with cell lysis solution [50 mM Tris, pH 7.4, 150 mM NaCl, 1% NP-40, 0.1% sodium dodecyl sulfate, 1 mM NaF, 1 mM Na3VO4, 1 mM PMSF and protease inhibitor cocktail (Sigma)] for obtaining a cell lysate. The cell lysate underwent the Western blot analysis. HER2 (#4290), pHER2 (#2243), pHER3 (#4791), EGFR (#4267), pEGFR (#3777), AKT (#4691), pAKT (#4060), ERK (#4695), and pERK (#4370) antibodies were purchased from Cell Signaling Technology. HER3 (sc-285) antibody was purchased from Santa Cruz Biotechnology and GAPDH (AbC-1001) antibody as a loading control was purchased from AbClon. The horseradish peroxidase-conjugated anti-mouse (AbC-5001) and anti-rat (AbC-5003) antibodies were also purchased from AbClon. The bands were visualized using AbSignal (AbClon, AbC-3001).

(51) We further examined whether the combined treatment of 1E11 and trastuzumab inhibits heterodimerization between HER2 and EGFR or HER3 as another ErbB family proteins. NCI-N87 cells were treated with EGF for induction of heterodimerization between HER2 and EGFR, and treated with HRG for induction of heterodimerization between HER2 and HER3. NCI-N87 cells were aliquoted in a cell medium supplemented with 0.1% FBR and cultured for 24 hr. Then, the cells were treated with 10 g/mL of antibodies for 1 hr, and then with 200 ng/mL of EGF (R&D Systems, #236-EG-200) or HRG (R&D Systems, #377-HB/CF). Three-day later, the cell viability was tested.

(52) As shown in FIG. 6a, the combined treatment of 1E11 and trastuzumab contributes to decrease in level of the HER2 protein. Upon decrease in level of the HER2 protein, the phosphorylated HER2 protein was also decreased. We observed reduced phosphorylated HER3 and EGFR level without total protein level change. Such results demonstrate that the combined treatment of 1E11 and trastuzumab is able to control activities of HER2, HER3 and EGFR. By such activity controls, activities of AKT and ERK, well-known HER2 downstream factors, were also altered without total protein level change.

(53) It was shown that the combined treatment of 1E11 and trastuzumab resulted in reduction of cell proliferation by heterodimerization between HER2 and EGFR (or HER3) (FIG. 6b). NCI-N87 cell proliferation by EGF capable of inducing heterodimerization between HER2 and EGFR, and HRG capable of inducing heterodimerization between HER2 and HER3, was reduced by the combined treatment of 1E11 and trastuzumab to a similar level to pertuzumab known to inhibit HER2 binding to other receptors.

(54) These results address that cell signaling through heterodimerization between HER2 and EGFR (or HER3) was suppressed by the combined treatment of 1E11 and trastuzumab.

Example 11: Anticancer Efficacies of Antibodies in Animal Models

(55) The anticancer efficacies of 1E11 antibody were evaluated using animal models. Athymic nude female mice (Daehan Biolink, Korea) were injected subcutaneously with 510.sup.6 of NCI-N87 cells to prepare xenograft model. Tumors were allowed to grow about 200 mm.sup.3 in size, and mice were then randomized into four groups. Animals of the four groups received twice weekly intraperitoneal administration of 10 mg/kg of palivizumab (as isotype control of trastuzumab (MedImmune LLC.)), 1E11, trastuzumab, and combination of 1E11 and trastuzumab, respectively. For combined administration, each antibody was administered in a dose of 10 mg/kg. Tumor volumes were measured over time. On day 22, the animals were sacrificed and the tumors were isolated. Tumor volumes were calculated using the formula (L*W*W)/2, where L represents the larger tumor diameter and W represents the smallest tumor diameter. The isolated tumors were weighed and prepared for immunohistochemistry analyses. Tumor xenograft tissues were processed as formalin-fixed and paraffin-embedded specimen sections. These were examined by hematoxylin (DAKO, #CS700) and eosin (DAKO, #CS701) (H&E) staining and HER2 protein staining using HER2 antibody (Cell Signaling Technology, #4290).

(56) 1E11 alone inhibited tumor growth to an extent similar to trastuzumab (FIG. 7a). 1E11 showed dramatically increased antitumor activity in combination with trastuzumab compared with each single antibody treatment. The antitumor activity was also confirmed by analyzing tumor mass extracted after experiments (FIG. 7b). The reduction of HER2-expressing cells by the combined treatment of 1E11 and trastuzumab was observed in immunohistochemistry staining (FIG. 7c), which is compatible with results of the Western blotting (FIG. 6a). These results indicate that 1E11 in combination with trastuzumab dramatically inhibits tumor growth compared with single antibody treatment, which is due to suppression of expression of the HER2 protein.

Example 12: Development of Humanized Antibodies and Confirmation of their Effects

(57) The humanized antibodies of the chimeric 1E11 antibodies developed in Example 4 were developed using a CDR grafting method. Regarding the human antibodies to receive the CDR of the developed antibodies, V and J genes of human germline antibody genes with high nucleotide sequence based-homology were selected using IMGT/V-QUEST (Brochet, X. et al., Nucl Acids Res. 36:503-508(2008)). As a V gene and a J gene of a heavy chain, IGHV3-48*03 gene and IGHJ4*01 gene were selected, respectively, and their sequence homology was 85.07% and 87.23%, respectively. Additionally, as a V gene and a J gene of a light chain, IGKV1-39*01 gene and IGKJ1*01 gene were selected, respectively, and their sequence homology was 81.36% and 81.08%, respectively. Considering a report that grafting of CDR only decreases affinity, H49 based on the Kabat numbering of the heavy chain corresponding to the Vernier zone that can affect the entire structure of an antibody was replaced with alanine instead of serine, which is on the human germline gene. The developed humanized antibody hz1E11 was produced in the form of IgG using FreeStyle 293F cell line. The amino acid sequences of the heavy chain variable region and the light chain variable region of the developed hz1E11 are described in SEQ ID NOS: 24 and 26, respectively.

(58) The affinity of hz1E11, the developed humanized antibody of 1E11, for HER2 was measured via surface plasmon resonance (SPR) assay. All the experiments were performed using Biacore 3000. First, the goat antibodies to human IgG were immobilized at a concentration of 1000 RU to a CMS sensor chip via an amine coupling method. Trastuzumab, pertuzumab, and hz1E11 were respectively diluted to 2.84 M, 5.68 M, and 7.1 M using a HBS-P buffer. Before binding to HER2-ECD-His protein, each antibody was bound at a rate of 50 L/min for 180 seconds, and allowed the buffer to flow thereonto for stabilization purpose. Then, HER2-ECD-His protein was allowed to bind at concentrations of 640 nM, 320 nM, 160 nM, 80 nM, 40 nM, 20 nM, and 0 nM for 4 minutes, and allowed the buffer to flow thereonto for 15 minutes. The sensor chip was recycled by allowing 10 mM Glycine-HCl (pH 1.5) buffer to flow thereonto. All the sensorgram data was analyzed via a 1:1 interaction model using BIAevaluation software. The affinities of antibodies are summarized in Table 5 below. The affinities of trastuzumab and pertuzumab were 1.94 nM and 1.89 nM, respectively, whereas the affinity of the developed antibody 1E11 was 16.0 nM. The affinity of the humanized antibody of 1E11 was 10.4 nM, showing almost no difference from the existing 1E11 antibody.

(59) TABLE-US-00005 TABLE 5 Antibodies Ka (M1s1) Kd (s1) KD (nM) Trastuzumab 3.9E+04 7.6E05 1.94 Pertuzumab 3.6E+04 6.8E05 1.89 1E11 3.0E+04 4.7E04 16.0 hz1E11 4.9E+04 5.1E04 10.4

(60) The anticancer effect of hz1E11, the developed humanized antibody of 1E11, was confirmed in human stomach cancer cell lines NCI-N87 and OE-19, which overexpress HER2 (FIG. 8). The single treatment of hz1E11 in NCI-N87 cells showed a decrease in cancer survival rate similar to that of trastuzumab treatment, whereas the combined treatment of hz1E11 and trastuzumab showed a significantly higher decrease in cancer survival rate compared to the single treatment by either antibody (FIG. 8A). Additionally, the combined treatment of hz1E11 and trastuzumab in OE-19, a different human stomach cancer cell line, showed a higher decrease in cancer survival rate compared to the single treatment by either antibody (FIG. 8B). Additionally, the combined treatment of hz1E11 and trastuzumab showed a bit higher inhibitory effect than the combined treatment of 1E11 and trastuzumab (FIG. 2A) against the proliferation of cancer cells (FIG. 8A). The combined treatment of hz1E11 and trastuzumab showed a higher inhibitory effect in NCI-N87 OE-19 cell lines than the combined treatment of trastuzumab and pertuzumab against the proliferation of cancer cells.

(61) The above results indicate that the hz1E11, the developed humanized antibody of 1E11, has an equal binding capacity and a bit improved anticancer effect as compared to the conventional 1E11.

(62) The anticancer effect of the combined treatment of the hz1E11, the developed humanized antibody of 1E11, along with trastuzumab was confirmed in a xenograft model using NCI-N87. The mice having a cancer formed via NCI-N87 transplantation were intraperitoneally injected twice a week with the developed antibody and an isotype control group of trastuzumab, hz1E11, trastuzumab, and a combination of hz1E11 and trastuzumab, respectively. The isotype control group and trastuzumab were administered at a dose of 10 mg/kg. In the case of a combined treatment, hz1E11 and trastuzumab were mixed at a 1:1 ratio, and administered at a dose of 1 mg/kg, 2.5 mg/kg, 5 mg/kg and 10 mg/kg based on each antibody. The combined treatment of hz1E11 and trastuzumab showed a decrease of cancer growth in a dose-dependent manner (FIG. 9). The anticancer effect observed with administration of 10 mg/kg of trastuzumab was also observed with administration of 1 mg/kg of hz1E11 or trastuzumab. The administration of hz1E11 and trastuzumab in a dose of greater than 5 mg/kg was shown to not only inhibit the growth of cancer but also decrease the cancer already formed.

Example 13: Confirmation of Binding Region of Developed Antibodies

(63) In order to confirm the important region of the developed antibodies for binding to antigens, an alanine scanning assay which examines the binding capacity by changing the amino acids corresponding to CDR3 of the heavy chain and the light chain to alanine was performed. Histidine (H), leucine (L), glycine (G), glycine (G), threonine (T) and serine (S) among the CDR3 region of the heavy chain which correspond to 95, 96, 97, 98, 99 and 100a according to the Kabat numbering, and glutamine (Q), glutamine (Q), leucine (L), tyrosine (Y), serine (S) and threonine (T) among the CDR3 region of the light chain which correspond to 89, 90, 91, 92, 93 and 94 according to the Kabat numbering, were changed to alanine using the QuikChange Site-directed Mutagenesis kit (Stratagene, #200518). Among the CDR3 of the heavy chain, A100 was excluded from the assay because the developed antibody has alanine. After expressing each modified antibody in bacteria, its expression was confirmed via a dot-blot after obtaining a periplasmic extract therefrom, and the binding capacity was analyzed regarding the HER2-ECD via ELISA assay (see: FIG. 10).

(64) TABLE-US-00006 TABLE6 Bindingcapacity toHer2-ECD Mutated Mutated (absorbanceat sequence position 450nm) CDR-L3 AQLYSTPWT Q89A 1.711 (SEQIDNO:33) QALYSTPWT Q90A 1.705 (SEQIDNO:34) QQAYSTPWT L91A 1.492 (SEQIDNO:35) QQLASTPWT Y92A 1.803 (SEQIDNO:36) QQLYATPWT S93A 1.733 (SEQIDNO:37) QQLYSAPWT T94A 1.628 (SEQIDNO:38) CDR-H3 ALGGTASFDY H95A 1.59 (SEQIDNO:27) HAGGTASFDY L96A 1.66 (SEQIDNO:28) HLAGTASFDY G97A 1.08 (SEQIDNO:29) HLGATASFDY G98A 0.051 (SEQIDNO:30) HLGGAASFDY T99A 0.839 (SEQIDNO:31) HLGGTAAFDY S100aA 1.597 (SEQIDNO:32) ParentAntibody hz1E11 1.75

(65) As can be seen in Table 6 and FIGS. 10A and 10B, the modified antibodies were expressed in a similar level, whereas G98A of the heavy chain showed a complete loss of its binding capacity, and G97A of the heavy chain showed a marked decrease in its binding capacity. The change in other regions did not show any noticeable effect on the antigen-antibody binding.

Example 14: Improvement of Affinities of Developed Antibodies

(66) In order to improve the affinities of the developed antibodies, a library with randomized CDR3 of the light chain and the heavy chain was developed. F, D, and Y among the CDR3 of the heavy chain which correspond to F100b, D101, and Y102, the amino acid numbers according to the Kabat numbering, and P, W, and T among the CDR3 of the light chain which correspond to P95, W96, and T97 according to the Kabat numbering were excluded from the randomization because they are commonly discovered amino acids in human antibodies. A phage antibody library with 20 randomized amino acids of CDR3 amino acids of the heavy chain and the light chain exclusive of the amino acids described in the above technology was developed (Phage display: a laboratory manual, Carlos Barbas III, et al., Cold Spring Harbor Laboratory Press). In particular, the primers used above relate to the region corresponding to CDR3 of the heavy chain and the light chain, and were synthesized such that adenine (A), cytosine (C), guanine (G) and thymine (T) were mixed in an equal ratio to be inserted randomly into the first and second positions of the codon corresponding to the amino acid to be randomized, and guanine (G) or cytosine (C) were mixed in an equal ratio to be inserted into the third position.

(67) In order to select the clones with improved affinities from the developed library, the HER2-ECD-His protein was biotinylated using the EZ-Link Sulfo-NHS-LC-Biotinylation kit (Thermo Scientific, #21435), and used as antigens for selecting antibodies. The developed phage antibody library and biotin-HER2-ECD-His protein were allowed to bind at room temperature for 2 hours, and the phages bound to the antigens were separated using 50 L of Dynabeads M-270 Streptavidin (Invitrogen, #653.06). The above selection process was performed 4 times, and the colonies that expressed antibodies that bind to HER2-ECD among the thus-selected colonies were selected via ELISA assay using periplasmic extracts, and the sequences of the antibodies expressed in the selected colonies were confirmed via nucleotide analysis. The amino acid sequences of CDR3 of the heavy chain and the light chain of the antibodies that bind to HER2-ECD are summarized in Tables 7 and 8 below. The number 1 in each Table represents the amino acid sequence of CDR3 of the heavy chain and the light chain of hz1E11.

(68) TABLE-US-00007 TABLE7 CDRH3sequencesofmutantsselectedfromthe processofimprovingaffinity 1 HLGGTASFDY(SEQIDNO:3) 2 AFGGTASFDY(SEQIDNO:39) 3 DLGGTASFDY(SEQIDNO:40) 4 FWGGTASFDY(SEQIDNO:41) 5 HCGGTASFDY(SEQIDNO:42) 6 HFGGTASFDY(SEQIDNO:43) 7 HHGGTASFDY(SEQIDNO:44) 8 HIGGTASFDY(SEQIDNO:45) 9 HLCSTASFDY(SEQIDNO:46) 10 HLCVTASFDY(SEQIDNO:47) 11 HLGGAASFDY(SEQIDNO:48) 12 HLGGLPSFDY(SEQIDNO:49) 13 HLGGMASFDY(SEQIDNO:50) 14 HLGGMSSFDY(SEQIDNO:51) 15 HLGGMTSFDY(SEQIDNO:52) 16 HLGGSSSFDY(SEQIDNO:53) 17 HLGGTACFDY(SEQIDNO:54) 18 HLGGTGAFDY(SEQIDNO:55) 19 HLGGTGSFDY(SEQIDNO:56) 20 HLGGTSTFDY(SEQIDNO:57) 21 HLGGTTSFDY(SEQIDNO:58) 22 HLGSTASFDY(SEQIDNO:59) 23 HLYRTASFDY(SEQIDNO:60) 24 HMGGTASFDY(SEQIDNO:61) 25 HRGGTASFDY(SEQIDNO:62) 26 HVGGTASFDY(SEQIDNO:63) 27 HWGGTASFDY(SEQIDNO:64) 28 HYGGTASFDY(SEQIDNO:65) 29 MNGGTASFDY(SEQIDNO:66) 30 NFGGTASFDY(SEQIDNO:67) 31 NHGGMASFDY(SEQIDNO:68) 32 NHGGTASFDY(SEQIDNO:69) 33 NIGGTASFDY(SEQIDNO:70) 34 NLGGTASFDY(SEQIDNO:71) 35 NMGGTASFDY(SEQIDNO:72) 36 NNGGTASFDY(SEQIDNO:73) 37 NWGGTASFDY(SEQIDNO:74) 38 NYGGAASFDY(SEQIDNO:75) 39 NYGGTASFDY(SEQIDNO:76) 40 PLGGTASFDY(SEQIDNO:77) 41 QLAGTASFDY(SEQIDNO:78) 42 SFGGTASFDY(SEQIDNO:79) 43 SHGGTASFDY(SEQIDNO:80) 44 SLGGTASFDY(SEQIDNO:81) 45 SMGGTASFDY(SEQIDNO:82) 46 SNGGTASFDY(SEQIDNO:83) 47 SWGGTASFDY(SEQIDNO:84) 48 SYGGTASFDY(SEQIDNO:85) 49 YYGGTASFDY(SEQIDNO:86)

(69) TABLE-US-00008 TABLE8 CDRL3sequencesofmutantsselectedfromthe processofimprovingaffinity 1 QQLYSTPWT(SEQIDNO:6) 2 DQLYGTPWT(SEQIDNO:87) 3 DQMYSTPWT(SEQIDNO:88) 4 HQLAFTPWT(SEQIDNO:89) 5 LQHNEFPWT(SEQIDNO:90) 6 QDMSRTPWT(SEQIDNO:91) 7 QELSTTPWT(SEQIDNO:92) 8 QEMMRTPWT(SEQIDNO:93) 9 QNLAYSPWT(SEQIDNO:94) 10 QNMYGTPWT(SEQIDNO:95) 11 QQAAFSPWT(SEQIDNO:96) 12 QQAAYSPWT(SEQIDNO:97) 13 QQAAYVPWT(SEQIDNO:98) 14 QQCTSDPWT(SEQIDNO:99) 15 QQHDVGPWT(SEQIDNO:100) 16 QQIAFGPWT(SEQIDNO:101) 17 QQIAFNPWT(SEQIDNO:102) 18 QQIAFSPWT(SEQIDNO:103) 19 QQIAFTPWT(SEQIDNO:104) 20 QQIAFVPWT(SEQIDNO:105) 21 QQIAKTPWT(SEQIDNO:106) 22 QQIAYSPWT(SEQIDNO:107) 23 QQIAYTPWT(SEQIDNO:108) 24 QQIAYVPWT(SEQIDNO:109) 25 QQIFSVPWT(SEQIDNO:110) 26 QQIGFSPWT(SEQIDNO:111) 27 QQIGWTPWT(SEQIDNO:112) 28 QQIMTLPWT(SEQIDNO:113) 29 QQIREIPWT(SEQIDNO:114) 30 QQISFMPWT(SEQIDNO:115) 31 QQISFSPWT(SEQIDNO:116) 32 QQIYITPWT(SEQIDNO:117) 33 QQKAYAPWT(SEQIDNO:118) 34 QQKKGIPWT(SEQIDNO:119) 35 QQKMGNPWT(SEQIDNO:120) 36 QQKSVAPWT(SEQIDNO:121) 37 QQLAFAPWT(SEQIDNO:122) 38 QQLAFMPWT(SEQIDNO:123) 39 QQLAFSPWT(SEQIDNO:124) 40 QQLAFVPWT(SEQIDNO:125) 41 QQLAYEPWT(SEQIDNO:126) 42 QQLAYSPWT(SEQIDNO:127) 43 QQLAYTPWT(SEQIDNO:128) 44 QQLAYVPWT(SEQIDNO:129) 45 QQLGFAPWT(SEQIDNO:130) 46 QQLGFIPWT(SEQIDNO:131) 47 QQLGFSPWT(SEQIDNO:132) 48 QQLGFVPWT(SEQIDNO:133) 49 QQLGYAPWT(SEQIDNO:134) 50 QQLGYSPWT(SEQIDNO:135) 51 QQLHSTPWT(SEQIDNO:136) 52 QQLKNTPWT(SEQIDNO:137) 53 QQLMRKPWT(SEQIDNO:138) 54 QQLRASPWT(SEQIDNO:139) 55 QQLRNLPWT(SEQIDNO:140) 56 QQLRNSPWT(SEQIDNO:141) 57 QQLRNVPWT(SEQIDNO:142) 58 QQLRSAPWT(SEQIDNO:143) 59 QQLRSSPWT(SEQIDNO:144) 60 QQLRSVPWT(SEQIDNO:145) 61 QQLRVIPWT(SEQIDNO:146) 62 QQLSFTPWT(SEQIDNO:147) 63 QQLSFVPWT(SEQIDNO:148) 64 QQLSKTPWT(SEQIDNO:149) 65 QQLSRAPWT(SEQIDNO:150) 66 QQLSRSPWT(SEQIDNO:151) 67 QQLSVTPWT(SEQIDNO:152) 68 QQLSYAPWT(SEQIDNO:153) 69 QQLSYSPWT(SEQIDNO:154) 70 QQLVRIPWT(SEQIDNO:155) 71 QQLVRNPWT(SEQIDNO:156) 72 QQLVRTPWT(SEQIDNO:157) 73 QQLVRVPWT(SEQIDNO:158) 74 OQLYSSPWT(SEQIDNO:159) 75 QQMAFAPWT(SEQIDNO:160) 76 QQMAFGPWT(SEQIDNO:161) 77 QQMAFIPWT(SEQIDNO:162) 78 QQMAFNPWT(SEQIDNO:163) 79 QQMAFSPWT(SEQIDNO:164) 80 QQMAFTPWT(SEQIDNO:165) 81 QQMAFVPWT(SEQIDNO:166) 82 QQMAFYPWT(SEQIDNO:167) 83 QQMAGFPWT(SEQIDNO:168) 84 QQMASVPWT(SEQIDNO:169) 85 QQMAYGPWT(SEQIDNO:170) 86 QQMAYSPWT(SEQIDNO:171) 87 QQMAYTPWT(SEQIDNO:172) 88 QQMDFTPWT(SEQIDNO:173) 89 QQMEHTPWT(SEQIDNO:174) 90 QQMFAIPWT(SEQIDNO:175) 91 QQMFGSPWT(SEQIDNO:176) 92 QQMFRTPWT(SEQIDNO:177) 93 QQMFSTPWT(SEQIDNO:178) 94 QQMFSVPWT(SEQIDNO:179) 95 QQMGFSPWT(SEQIDNO:180) 96 QQMGYAPWT(SEQIDNO:181) 97 QQMGYSPWT(SEQIDNO:182) 98 QQMHIFPWT(SEQIDNO:183) 99 QQMMAVPWT(SEQIDNO:184) 100 QQMMKSPWT(SEQIDNO:185) 101 QQMMRTPWT(SEQIDNO:186) 102 QQMMRVPWT(SEQIDNO:187) 103 QQMRKIPWT(SEQIDNO:188) 104 QQMRNVPWT(SEQIDNO:189) 105 QQMRRVPWT(SEQIDNO:190) 106 QQMRSTPWT(SEQIDNO:191) 107 QQMSFSPWT(SEQIDNO:192) 108 QOMSHSPWT(SEQIDNO:193) 109 QQMSKIPWT(SEQIDNO:194) 110 QQMSRVPWT(SEQIDNO:195) 111 QQMSYAPWT(SEQIDNO:196) 112 QQMSYGPWT(SEQIDNO:197) 113 QQMSYIPWT(SEQIDNO:198) 114 QQMSYSPWT(SEQIDNO:199) 115 QQMSYTPWT(SEQIDNO:200) 116 QQMSYVPWT(SEQIDNO:201) 117 QQMTRVPWT(SEQIDNO:202) 118 QQMVIIPWT(SEQIDNO:203) 119 QQMVREPWT(SEQIDNO:204) 120 QQMVRSPWT(SEQIDNO:205) 121 QQMVRTPWT(SEQIDNO:206) 122 QQMVRVPWT(SEQIDNO:207) 123 QQMVSIPWT(SEQIDNO:208) 124 QQMYGTPWT(SEQIDNO:209) 125 QQMYKTPWT(SEQIDNO:210) 126 QQMYRTPWT(SEQIDNO:211) 127 QQNAFEPWT(SEQIDNO:212) 128 QQNAFGPWT(SEQIDNO:213) 129 QQNAFIPWT(SEQIDNO:214) 130 QQNAFSPWT(SEQIDNO:215) 131 QQNAFTPWT(SEQIDNO:216) 132 QQNAFVPWT(SEQIDNO:217) 133 QQNAYAPWT(SEQIDNO:218) 134 QQNAYGPWT(SEQIDNO:219) 135 QQNAYNPWT(SEQIDNO:220) 136 QQNAYSPWT(SEQIDNO:221) 137 QQNFIAPWT(SEQIDNO:222) 138 QQNMIVPWT(SEQIDNO:223) 139 QQNRISPWT(SEQIDNO:224) 140 QQNRIWPWT(SEQIDNO:225) 141 QQNRVIPWT(SEQIDNO:226) 142 QQNRVVPWT(SEQIDNO:227) 143 QQNSYSPWT(SEQIDNO:228) 144 QQNVIVPWT(SEQIDNO:229) 145 QQNVNVPWT(SEQIDNO:230) 146 QQNYKLPWT(SEQIDNO:231) 147 QQSAFVPWT(SEQIDNO:232) 148 QQSAYAPWT(SEQIDNO:233) 149 QQSAYIPWT(SEQIDNO:234) 150 QQSEACPWT(SEQIDNO:235) 151 QQSFNTPWT(SEQIDNO:236) 152 QQSKTVPWT(SEQIDNO:237) 153 QQTAFGPWT(SEQIDNO:238) 154 QQTAFSPWT(SEQIDNO:239) 155 QQTAYAPWT(SEQIDNO:240) 156 QQTAYSPWT(SEQIDNO:241) 157 QQTRRTPWT(SEQIDNO:242) 158 QQTSFAPWT(SEQIDNO:243) 159 QQVAYSPWT(SEQIDNO:244) 160 QQVFAIPWT(SEQIDNO:245)

(70) In order to select clones with improved Koff among the selected clones, the clones were analyzed via Biacore 3000 (GE Healthcare). The HER2-ECD-His protein was immobilized to a CM5 sensor chip via an amine coupling method using ECD/NHS. After expressing the antibody from each clone using IPTG, a periplasmic extract was obtained therefrom, and allowed to bind to HER2-ECD-His. The Koff value for each antibody was analyzed via BIAevaluation software. Based on the above, the antibodies with improved Koff value were selected (see: Table 9a). Table 9a disclose the representative examples of the clones showing similar or improved Koff values compared to the hz1E11 parent antibody, among the clones developed by the present inventors.

(71) TABLE-US-00009 TABLE9a Mutation- Degreeof hz1E11 introduced reduction Clones LCDR3 HCDR3 chain koff (Fold) hz1E11 QQLYSTPWT HLGGTASFDY 1.13E-03 1.0 (SEQIDNO:6) (SEQIDNO:3) M3-L-A1-3- QQNAYAPWT HLGGTASFDY L 3.72E-05 30.4 1A12 (SEQIDNO:218) (SEQIDNO:3) (hz1E11-133) M3-L-A1-3- QQTAFSPWT HLGGTASFDY L 1.17E-04 9.7 1F11 (SEQIDNO:239) (SEQIDNO:3) (hz1E11-154) M1-L-A1-3-1C3 DQMYSTPWT HLGGTASFDY L 1.52E-04 7.4 (hz1E11-3) (SEQIDNO:88) (SEQIDNO:3) M3-H-A1-2- QQLYSTPWT NYGGTASFDY H 2.12E-04 5.3 1B12 (SEQIDNO:6) (SEQIDNO:76) M1-H-A1-2-1B5 QQLYSTPWT HFGGTASFDY H 4.53E-04 2.5 (SEQIDNO:6) (SEQIDNO:43) M3-H-A1-1- QQLYSTPWT SWGGTASFDY H 5.67E-04 2.0 1C11 (SEQIDNO:6) (SEQIDNO:84) M3-H-A1-1- QQLYSTPWT SYGGTASFDY H 1.16E-03 1.0 1A10 (SEQIDNO:6) (SEQIDNO:85) M3-LH-A1-1- QQNFIAPWT NYGGTASFDY LH 1.66E-03 0.7 1H1 (SEQIDNO:222) (SEQIDNO:76) M3-LH-A3-3- QQLVRNPWT NFGGTASFDY LH 1.65E-04 6.5 2B1 (SEQIDNO:156) (SEQIDNO:67) M3-L-A3-4-2E8 QQIAYVPWT HLGGTASFDY L 1.80E-04 5.9 (SEQIDNO:109) (SEQIDNO:3) M1-LH-A3-3- QQLVRTPWT NYGGTASFDY LH 1.84E-04 5.8 1A6 (SEQIDNO:157) (SEQIDNO:76) M3-H-A3-3-2A7 QQLSYSTPWT NFGGTASFDY H 2.26E-04 4.7 (SEQIDNO:154) (SEQIDNO:67) M3-LH-A3-3- QQNAYNPWT HLGGTASFDY L 2.45E-04 4.4 2F1 (SEQIDNO:220) (SEQIDNO:3) M3-LH-A3-3- QQMFSTPWT HWGGTASFDY LH 2.98E-04 3.6 2A5 (SEQIDNO:178) (SEQIDNO:64) M3-H-A3-3-2D8 QQLYSTPWT HWGGTASFDY H 3.30E-04 3.2 (SEQIDNO:6) (SEQIDNO:64) M3-LH-A1-2- QQLVRIPWT NLGGTASFDY LH 3.31E-04 3.2 2F4 (SEQIDNO:155) (SEQIDNO:71) M3-L-A1-3-2C2 QQLGFIPWT HLGGTASFDY L 5.26E-04 2.0 (SEQIDNO:131) (SEQIDNO:3) M3-H-A3-1-2F3 QQLYSTPWT NLGGTASFDY H 7.70E-04 1.4 (SEQIDNO:6) (SEQIDNO:71) M3-H-A2-1-1F2 QQLYSTPWT SNGGTASFDY H 1.27E-03 0.8 (SEQIDNO:6) (SEQIDNO:83)

(72) As can be seen in Table 9a, various CDRH3s represented by general formula 1 and CDRL3s represented by general formula 2 of the present invention show similar or improved Koff values compared to CDRH3 and CDRL3 of the parent antibody, hz1E11.

(73) Among the randomized CDR3 sequence of the light chain, experiments were performed using hz1E11-3, hz1E11-133 and hz1E11-154.

(74) The heavy chain variable regions of hz1E11-3, hz1E11-133 and hz1E11-154 were the same as that of hz1E11, and the amino acid sequence of the light chain variable regions are described in SEQ ID NOS: 247, 249 and 251, respectively.

(75) In order to confirm the increase in affinities of the selected 3 kinds of antibodies, the antibodies were produced in the form of IgG. The goat anti-human IgG (Invitrogen, #H10500) at a concentration of 2000 RU was immobilized to a CM5 sensor chip via ECD/NHS method. Then, the antibodies were allowed to bind at a rate of 50 L/min for 5 minutes, and allowed the buffer to flow thereonto for 5 minutes for stabilization purpose. The concentrations of the antibodies used for binding of the antibodies were 0.4 g/mL for Trastuzumab (TRA), 0.8 g/mL for pertuzumab (PER), and 1 g/mL for hz1E11 and the selected antibodies. After stabilizing the antibodies, the HER2-ECD-His protein at concentrations of 640 nM, 320 nM, 160 nM, 80 nM, 40 nM, 20 nM, and 0 nM was allowed to bind at a rate of 50 L/min for 4 minutes, and allowed the buffer to flow thereonto for 15 minutes to separate. After analyzing each of the concentrations, they were recycled using 10 mM Glycine (pH 1.5) and performed the subsequent assays. The affinities of the antibodies were analyzed via BIAevaluation software. The results of analysis are summarized in Table 9b.

(76) TABLE-US-00010 TABLE 9b Ka KD Antibodies (1/Ms) kd (1/s) Rmax (M) hz1E11 3.60E+04 8.30E04 61 2.30E08 hz1E11-3 3.80E+04 2.00E04 64 5.20E09 hz1E11-133 6.40E+04 9.90E05 68 1.50E09 hz1E11-154 8.60E+04 9.90E05 65 1.10E09 TRA 4.90E+04 1.50E04 43 3.00E09 PER 3.80E+04 1.20E04 56 3.30E09

(77) In Table 9b above, ka, kd Rmax and KD respectively indicate association rate constant, dissociation rate constant, maximum binding capacity, and equilibrium dissociation constant.

(78) As can be seen in Table 9b, hz1E11-133 and hz1E11-154 showed an 8.4-fold decrease in Koff value, i.e., kd values, compared to that of hz1E11, whereas they showed a bit increase in kon value, i.e., ka value. Conclusively, with respect to final affinity, hz1E11-133 showed 1.5 nM and hz1E11-154 showed 1.1 nM, which were a 15-fold improvement and a 20-fold improvement compared to that of hz1E11.

Example 15: Confirmation of Anticancer Effects of Antibodies with Improved Affinities

(79) The anticancer effects of the antibodies with improved affinities were confirmed regarding HER2-overexpressing stomach cancer and breast cancer. Cancer cell survival rates when NCI-N87 and OE-19, HER2-overexpressing stomach cancer cell lines, BT-474, a HER2-overexpressing breast cancer cell line treated with single treatment by each antibody alone or a combined treatment along with of trastuzumab, according to concentration, were analyzed

(80) As can be seen in FIGS. 11A to 11F, the hz1E11-3, hz1E11-133, and hz1E11-154 antibodies with improved affinities showed improved effects in single treatment and combined treatment compared to that of hz1E11.

(81) Having described a preferred embodiment of the present invention, it is to be understood that variants and modifications thereof falling within the spirit of the invention may become apparent to those skilled in this art, and the scope of this invention is to be determined by appended claims and their equivalents.