APPARATUS FOR IMMOBILIZING MICROBIAL CELL AND METHOD OF IMMOBILIZING MICROBIAL CELL USING SAME
20190002866 ยท 2019-01-03
Inventors
- Baek Joong KIM (Chuncheon-si, Gangwon-do, KR)
- Tae Gun KIM (Yongsan-gu, Seoul, KR)
- Min Su KIM (Jungnang-gu, Seoul, KR)
- Tae Yong KIM (Gwangjin-gu, Seoul, KR)
- Eun Bum SONG (Seocho-gu, Seoul, KR)
Cpc classification
C12M1/40
CHEMISTRY; METALLURGY
C12Y501/03
CHEMISTRY; METALLURGY
C12M25/16
CHEMISTRY; METALLURGY
C12M27/00
CHEMISTRY; METALLURGY
C12N11/00
CHEMISTRY; METALLURGY
International classification
Abstract
An embodiment of the present disclosure provides an apparatus for immobilizing a microbial cell, the apparatus including: a mixing tank in which a cell-carrier-containing mixed solution is accommodated; a nozzle part through which the cell-carrier-containing mixed solution is injected from the mixing tank and is discharged to the outside; and a reaction tank in which a cell immobilized bead is formed by contact between the cell-carrier-containing mixed solution discharged from the nozzle part and an aqueous curing agent solution. In the apparatus for immobilizing a microbial cell according to the present disclosure, since the cell-carrier-containing mixed solution is injected through an air spraying nozzle, even when an immobilized carrier solution having a high viscosity is used, a microbial cell immobilized bead having a small size and having a spherical shape, or an almost spherical shape may be mass-produced.
Claims
1. An apparatus for immobilizing a microbial cell, the apparatus comprising: a mixing tank in which a cell-carrier-containing mixed solution is accommodated; a nozzle part through which the cell-carrier-containing mixed solution is injected from the mixing tank and is discharged to the outside; and a reaction tank in which a cell immobilized bead is formed by contact between the cell-carrier-containing mixed solution discharged from the nozzle part and an aqueous curing agent solution, wherein the cell-carrier-containing mixed solution is formed by mixing a cell suspension of a microorganism and an aqueous carrier solution with each other, wherein the nozzle part has a cell-carrier-containing mixed solution discharging part and an air discharging part, and wherein the air discharging part injects air toward the cell-carrier-containing mixed solution discharged from the cell-carrier-containing mixed solution discharging part.
2. The apparatus of claim 1, wherein the nozzle part includes: a body part; a first injection part which is provided on one side of the body part and into which the cell-carrier-containing mixed solution is injected; a first discharging part having one end thereof connected to the first injection part and the other end exposed to the outside of the body part by a predetermined distance to discharge the cell-carrier-containing mixed solution injected into the first injection part to the outside; a second injection part which is provided on one side of the body part and into which air is injected; and at least one second discharging part through which the air injected through the second injection part is injected toward the cell-carrier-containing mixed solution discharged from the first discharging part.
3. The apparatus of claim 1, wherein the microorganism is a strain that produces an endoenzyme.
4. The apparatus of claim 3, wherein the endoenzyme is a ketose 3-epimerase.
5. The apparatus of claim 3, wherein the strain is a recombinant strain transformed by introduction of a gene encoding a ketose 3-epimerase or introduction of a recombined vector containing the gene encoding a ketose 3-epimerase.
6. The apparatus of claim 5, wherein a host strain of the recombinant strain is Saccharomyces cerevisiae, bacillus subtilis, or Corynebacterium glutamicum.
7. The apparatus of claim 1, wherein the carrier is alginate, and the curing agent is calcium chloride.
8. The apparatus of claim 2, wherein one side of an inside of the body part connected to the second injection part is a hollow such that predetermined air is stored in the body part.
9. The apparatus of claim 2, wherein the plurality of second discharging parts are formed radically with respect to the first discharging part.
10. The apparatus of claim 2, wherein the second discharging parts are formed to have a slot shape with respect to the first discharging part.
11. A method of immobilizing a microbial cell, the method comprising: forming a cell-carrier-containing mixed solution by mixing a cell suspension of a microorganism and an aqueous carrier solution; and forming a cell immobilized bead by discharging the cell-carrier-containing mixed solution through a nozzle part and by contact between the cell-carrier-containing mixed solution and an aqueous curing agent solution, wherein the nozzle part has a cell-carrier-containing mixed solution discharging part and an air discharging part, and wherein the air discharging part injects air toward the cell-carrier-containing mixed solution discharged from the cell-carrier-containing mixed solution discharging part.
12. The method of claim 11, wherein the microorganism is a recombinant strain that produces an allulose 3-epimerase as an endoenzyme, the carrier is alginate, and the curing agent is calcium chloride.
Description
DESCRIPTION OF DRAWINGS
[0008]
[0009]
[0010]
[0011]
[0012]
DESCRIPTION OF MAIN REFERENCE NUMERALS OF DRAWINGS
[0013]
TABLE-US-00001 10: Microorganism culturing 15: Microbial cell recovery unit tank 20: Aqueous carrier solution 30: Mixing tank storing tank 40: Nozzle part 50: Aqueous curing agent storing tank 60: Reaction tank 70: Aqueous curing agent storing tank 41: Body part 42: First injection part 43: First discharging part 44: Second injection part 45: Second discharging part 46: Hollow 47: Cover L: Mixed solution A: Air
DETAILED DESCRIPTION OF EMBODIMENT
[0014] Hereinafter, the present disclosure will be described in detail with reference to the accompanying drawings.
[0015] An aspect of the present disclosure relates to an apparatus for immobilizing a microbial cell.
[0016] Mixing Tank 30
[0017] The mixing tank, in which the cell-carrier-containing mixed solution formed by mixing a microbial cell suspension and an aqueous carrier solution with each other is accommodated, preferably has a predetermined stirring means (for example, an impeller) formed therein for uniform mixing between the microbial cell suspension and the aqueous carrier solution or uniform distribution of a cell and a carrier inside the mixed solution. The cell-carrier-containing mixed solution accommodated in the mixing tank is transferred to the nozzle part along a transfer line by a metering pump. The concentration of cells in the cell-carrier-containing mixed solution accommodated in the mixing tank is not particularly limited. However, considering the maximum number of cells collected in a carrier, the concentration is preferably 5% to 15% (w/v), and is more preferably 5% to 12% (w/v) with respect to the entire volume of the mixed solution. Further, the concentration of carriers in the cell-carrier-containing mixed solution is not particularly limited. However, considering resistance of transfer due to the viscosity of the carriers, discharge from the nozzle part which will be described below, and formation of beads, the concentration is preferably 1% to 4% (w/v) and is more preferably 1% to 2.5% (w/v) with respect to the entire volume of the mixed solution. When the concentration of carriers in the cell-carrier-containing mixed solution is smaller than 1% (w/v) with respect to the entire volume of the mixed solution, it is difficult to form a bead, and when the concentration exceeds 4% (w/v), transfer to the nozzle part or discharge from the nozzle part may be difficult.
[0018] In the present disclosure, the microbial cell suspension is obtained by suspending a microbial cell recovered after culturing in a predetermined buffer solution. The kind of the buffer solution is not particularly limited as long as the buffer solution may maintain activity of a microorganism, and various widely-known buffer solutions may be used. It is preferable that the microorganism is a strain which produces an endoenzyme, and is a recombinant strain transformed by introducing a gene that codes a Ketose 3-epimerase or introducing a recombined vector including the gene that codes a ketose 3-epimerase. Further, it is preferable that a host strain of the recombinant strain is a food-safe strain. The food-safe strain means a generally recognized as safe (GRAS) strain, and may be selected from, for example, Saccharomyces sp., Bacillus sp., Corynebacterium sp., and the like. The strains are industrial microorganisms that produce chemical materials having various purposes in fields of feeds, medicines, foods, and the like. The strains are easy to genetically manipulate and mass-culture or have high stability in various process conditions. Further, since the strains have a cell membrane structure that is relatively harder than the other bacteria, the strains have biological characteristics in which cells exist in a stable state even under an influence of an osmotic pressure resulting from a high sugar concentration and the like. Detailed examples of the GRAS strains include Saccharomyces cerevisiae, bacillus subtilis, Corynebacterium glutamicum, and the like. Further, the endoenzyme may be an isomerization enzyme and an epimerization enzyme but the kind of the endoenzyme is not particularly limited. Considering usefulness of an enzyme reaction product, it is preferable that the endoenzyme is a ketose 3-epimerase. In the present disclosure, the ketose 3-epimerase has an activity of producing D- or L-ketohexose by epimerizing a 3 position of the corresponding D- or L-ketohexose and catalyzes mutual conversion between D- or L-fructose and D- or L-allulose and mutual conversion between D- or L-tagatose and D- or L-sorbose. Further, in the present disclosure, the ketose 3-epimerase has an activity of producing D- or L-ketopentose by epimerizing a 3 position of the corresponding D- or L-ketopentose and catalyzes mutual conversion between D- or L-xylose and D- or L-ribulose. The ketohexose is a hexose having a ketose structure, and means fructose, allulose, tagatose, and sorbose in detail. The D- or L-ketohexose means a D- or L-form thereof. Further, the ketopentose is a pentose having a ketose structure, and means xylose and ribulose in detail. The D- or L-ketopentose means a D- or L-form thereof. In the method according to the embodiment of the present disclosure, the ketose 3-epimerase is preferably an allulose 3-epimerase or a tagatose 3-epimerase and is more preferably an allulose 3-epimerase. The allulose 3-epimerase may catalyze mutual conversion between fructose and allulose and may have an amino acid sequence represented by SEQ ID NO.: 1 as a specific example.
[0019] In the present disclosure, the aqueous carrier solution is obtained by dissolving a carrier in water. In this case, the kind of the carrier is not particularly limited as long as the carrier is aqueous, and at the same time, has an internal structure having a matrix form to contain microorganisms. For example, it is preferable that the aqueous carrier solution is selected from agar, agarose, carrageenan, alginate, and chitosan. Further, the alginate may be selected from sodium alginate, potassium alginate, and the like.
[0020] Nozzle Part 40
[0021] The cell-carrier-containing mixed solution transferred from the mixing tank is introduced into the nozzle part and is discharged in a predetermined form. The nozzle part has a cell-carrier-containing mixed solution discharging part and an air discharging part, and the air discharging part injects air toward the cell-carrier-containing mixed solution discharged from the cell-carrier-containing mixed solution discharging part to adjust the size of the cell-carrier-containing mixed solution discharged by the nozzle part and to adjust the shape of the cell-carrier-containing mixed solution to be spherical or almost spherical.
[0022]
[0023] The body part 41 provides a space in which the first injection part 42, the first discharging part 43, the second injection part 44, the second discharging parts 45, and the cover 47 may be provided, to adjust the cell-carrier-containing mixed solution L discharged by the nozzle part to have a predetermined size and a predetermined shape depending on a use aspect.
[0024] The first injection part 42 is formed on one side of the body part 41 to serve as a connector such that the cell-carrier-containing mixed solution L may be injected into the body part 41. The first injection part 42 may protrude outward from the one side of the body part 41 or be inserted into the body part 41 such that the nozzle part may be connected to the mixing tank in which the cell-carrier-containing mixed solution is accommodated, through a pipe, a hose, or the like. In this case, as illustrated in
[0025] The first discharging part 43 serves to discharge, to the outside of the body part 41, the cell-carrier-containing mixed liquid L introduced into the body part 41 through the first injection part 42. The first discharging part 43 has one end connected to the first injection part 42 through which the cell-carrier-containing mixed liquid L is injected into the body part 41 and the other end exposed to the one side of the body part 41 by a predetermined interval such that the cell-carrier-containing mixed liquid L may be discharged to the outside of the body part 41. In this case, the first discharging part 43 has any shape as long as the first discharging part 43 may discharge or inject, through the body part 41, the cell-carrier-containing mixed liquid L injected through the first injection part 42. However, it is preferable that the first discharging part 43 has a shape of a pipe passing through an inside of the body part 41. It is preferable that the inner diameter of the first discharging part 43 is 0.5 mm to 1.5 mm in consideration of the size and the shape of the cell immobilized bead.
[0026] The second injection part 44 is formed on the one side of the body part 41 to serve to inject air A such that the air A passes through the inside of the body part 41. The second injection part 44 may be inwardly inserted into the one side of the body part 41 or protrude outward such that the second injection part 44 may be connected to an air supply device configured to supply the air A through a pipe or a hose, such as an air pump. The second injection part 44 may be formed integrally with the body part 41 or may be coupled to the body part 41 through a separate connection bracket or the like depending on a use aspect, which is like the first injection part 42.
[0027] In this case, a hollow 46 may be formed on one side of the inside of the body part 41, which corresponds to the second injection part 44, such that the predetermined air A may be stored. The hollow 46 may allow the air A injected into the body to be smoothly discharged even without a connection device connected to the second discharging parts 45. The hollow 46 may be formed inside the body part 41 as a whole or may be formed only in a space between the second injection part 44 and the second discharging parts 45.
[0028]
[0029] Further, the second discharging parts 45 may be gradually inclined inward as it goes to a lower side of the body part 41, such that the air A injected by the second discharging parts 45 may be smoothly injected toward the cell-carrier-containing mixed solution L injected by the first discharging part 43. In this way, as the second discharging parts 45 are inclined, the air A injected by the second discharging parts 45 may be smoothly injected toward the cell-carrier-containing mixed solution L injected or discharged by the first discharging part 43.
[0030] In the above-described configuration, the second discharging parts 45 pass through the body part 41 to have a through-hole shape. However, as illustrated in
[0031] A use aspect of the nozzle part 40 having the above-described configuration will be described below in detail. As illustrated in
[0032] At the same time, the high-pressure air A is injected into the second injection part 44 through an air supply device such as an air pump, sequentially passes through the hollow 46 and the second discharging parts 45 inside the body part 41 and is injected to the outside. In this case, since the air A injected by the second discharging parts 45 is discharged toward the cell-carrier-containing mixed solution L injected by the first discharging part 43, the high-viscosity cell-carrier-containing mixed solution L discharged or injected by the first discharging part 43 is cut by the air A injected by the second discharging parts 45 at a high pressure, and thus has a small size and a spherical shape or an almost spherical shape. Further, the shape or the size of the discharged cell-carrier-containing mixed solution L may be controlled by controlling the injection pressure and the injection period of the air A injected by the second discharging parts 45. The cell-carrier-containing mixed solution discharged or injected by the first discharging part 43 of the nozzle part is dropped into the reaction tank and reacts with the aqueous curing agent solution accommodated in the reaction tank to be cured in the form of a hard bead.
[0033] Reaction Tank 60
[0034] The cell-carrier-containing mixed solution discharged by the nozzle part in a predetermined size and a predetermined shape is dropped into the reaction tank 60. When the cell-carrier-containing mixed solution comes into contact with the aqueous curing agent solution accommodated in the reaction tank, a curing reaction occurs so that a hard cell immobilized bead is formed. A predetermined stirring means (for example, an impeller) is provided inside the reaction tank to make uniform contact between the cell-carrier-containing mixed solution and the aqueous curing agent solution.
[0035] The aqueous curing agent solution is obtained by dissolving a curing agent in water. In this case, the kind of the curing agent is not particularly limited as long as the curing agent may be cured together with the carrier so that a hard bead is formed. The curing agent may be variously selected according to the kind of the carrier. When the carrier is sodium alginate or potassium alginate, the curing agent may be selected from calcium compounds capable of calcium substitution reaction with a carrier and is preferably calcium chloride. Although the concentration of the curing agent in the aqueous curing agent solution is not particularly limited, the concentration is preferably 200 to 600 mM, and is more preferably 300 to 500 mM in view of securing an appropriate curing reaction rate with the cell-carrier-containing mixed solution.
[0036] The Other Components
[0037] The apparatus for immobilizing a microbial cell according to an exemplary embodiment of the present disclosure may further include a microorganism culturing tank 10, a microbial cell recovery unit 15, an aqueous carrier solution storing tank 20, an aqueous curing agent solution storing tank 50, or a cell immobilized bead washing/storing tank 70. The microorganism culturing tank 10 serves to grow microbial cells by culturing microorganisms in a predetermined medium. Thereafter, a microorganism culturing solution in the microorganism culturing tank 10 is transferred to the microbial cell recovery unit 15. The microbial cell recovery unit 15 may serve to separate microbial cells from the microorganism culturing solution, and may be, for example, a centrifugal separator. The aqueous carrier solution storing tank 20 serves to store the aqueous carrier solution, and if necessary, supply the aqueous carrier solution to the mixing tank 30. The aqueous curing agent solution storing tank 50 serves to store the aqueous curing agent solution, and if necessary, supply the aqueous curing agent solution to the reaction tank 60. The cell immobilized bead washing/storing tank 70 serves to remove impurities by washing the cell immobilized bead transferred from the reaction tank using a predetermined solvent (for example, water), and to store the cell immobilized bead from which the impurities are removed, under an appropriate condition. The cell immobilized bead stored in the cell immobilized bead washing/storing tank 70 may be used in various enzyme reaction processes such as an isomerization reaction through an endoenzyme existing in a cell.
[0038] Another aspect of the present disclosure relates to the method of immobilizing a microbial cell. The method of immobilizing a microbial cell according to the present disclosure includes: forming a cell-carrier-containing mixed solution by mixing a microbial cell suspension and an aqueous carrier solution with each other; and forming a cell immobilized bead by discharging the cell-carrier-containing mixed solution through the nozzle part and allowing the cell-carrier-containing mixed solution to come into contact with the aqueous curing agent solution. In this case, the nozzle part has a cell-carrier-containing mixed solution discharging part and an air discharging part, and the air discharging part injects air to the cell-carrier-containing mixed solution discharged from the cell-carrier-containing mixed solution discharging part to adjust the size and the shape of the cell-carrier-containing mixed solution discharged by the nozzle part. The method of immobilizing a microbial cell according to the present disclosure may further preferably include recovering the cell immobilized bead formed by reaction between the cell-carrier-containing mixed solution and the aqueous curing agent solution. Further, it is preferable that the microorganisms are recombinant strains which produce an allulose 3-epimerase as an endoenzyme, and it is preferable that the curing agent is calcium chloride. The method of immobilizing a microbial cell according to the present disclosure includes all the contents of the above-described apparatus for immobilizing a microbial cell.
[0039] Hereinafter, the present disclosure will be described in detail through embodiments. However, the following embodiments are merely intended to clearly describe the technical features of the present disclosure, and do not limit the protection scope of the present disclosure.
[0040] 1. Producing of Recombinant Strain that Produces D-Allulose 3-Epimerase
[0041] After a genomic deoxyribonucleic acid (DNA) was extracted from Flavonifractor plautii KCTC 5970 received from Korean Collection for Type Cultures, the genomic DNA was used as a template. A polymerase chain reaction (PCR) was performed using an Ex-Taq (TAKARA) polymerase and a primer for cloning a gene (polynucleotide represented by SEQ ID NO.: 2) encoding the D-allulose 3-epimerase. Table 1 shows the primer for cloning the gene encoding the D-allulose 3-epimerase from the genomic DNA of Flavonifractor plautii. The primer shown in Table 1 is produced by Bioneer co., KR.
TABLE-US-00002 TABLE 1 restriction enzyme recog- SEQ nition site ID contained in NO. Kind of primer Base sequence (5.fwdarw.3) primer 3 Forward primer agtcactgcagaccctacttagctgccaa Pst I for cloning gene of allulose epimerase 4 Reverse primer aattcggatccttacgcggtcagctccttg BamH I for cloning gene of allulose epimerase
[0042] Thereafter, a desired target DNA was isolated from a PCR by-product using a gel extraction kit (Qiagen), and was then coupled to an easy T-vector (Promega), and a base sequence of the isolated target DNA was analyzed by Bioneer co., KR. As a result, it was identified that the target DNA amplified by the PCR corresponded to a polynucleotide represented by SEQ ID NO.: 2. Thereafter, a recombined plasmid pDSFDPE was produced by inserting the target DNA amplified by the PCR into the same restriction enzyme recognition site of a PDS vector, a Corynebacterium shuttle vector, using Pst I and BamH I, restriction enzymes. Thereafter, a recombinant strain was produced by inserting the recombined plasmid pDSFDPE into a cell of a Corynebacterium glutamicum ATCC 13032 strain using an electroporation. The Corynebacterium glutamicum ATCC 13032 strain into which the recombined plasmid pDSFDPE was inserted was named a Corynebacterium glutamicum DS00001, was donated to a microorganism preservation center of Korea Research Institute of Bioscience and Biotechnology (KRIBB) on Oct. 7, 2015 and was granted an accession number KCCM 80101.
[0043] Thereafter, after a single colony of the recombinant strain was inoculated in 15 ml of LB-ampicilline medium (Difco), the single colony was pre-cultured for about six hours under the conditions of 37 C. and 200 rpm. Thereafter, a pre-culturing liquid was inoculated into 500 ml of LB-ampicilline medium and was shake-cultured under conditions at 37 C. and 200 rpm. Thereafter, when an optical density (at 600 nm) of a culturing liquid was 0.5, IPTG was added thereto such that a concentration was 0.1 mM. Thus, overexpression of a target enzyme was induced. In this case, since induction of the overexpression, the culture was switched to conditions of 16 C. and 150 rpm and was maintained under the conditions for about 16 hours. Thereafter, a culturing liquid of the recombinant strain was centrifuged at 13000 rpm for 2 minutes so that a supernatant thereof was removed, and a cell of the recombinant strain was recovered.
[0044] The recovered cell of the recombinant strains was suspended in lysis buffer (50 mM of Tris-HCl, 300 mM of NaCl pH 8.0, and 10 mM of imidazole), and was destroyed through sonication. A cell lysis was centrifuged at 13000 rpm for 10 minutes so that only the supernatant was collected and was then applied to a Ni-NTA column (Bio-Rad, Profinia) previously equilibrated with a lysis buffer. Then, a buffer solution containing 20 mM imidazole and 200 mM imidazole sequentially flowed in 50 mM of Tris-HCl and 300 mM of NaCl pH 8.0. Finally, 50 mM Tris-HCl, 300 mM of NaCl, pH 8.0, and 200 mM of imidazole flowed to elute a target protein. It was identified that the eluted protein was a D-allulose 3-epimerase including the amino acid sequence represented by SEQ ID NO.: 1.
[0045] 2. Productions of Cell Suspension, Aqueous Sodium Alginate Solution, and Aqueous Calcium Chloride Solution
[0046] (1) Production of Cell Suspension
[0047] The cell of the recombinant strain, Corynebacterium glutamicum DS00001 prepared above was added to a culture container containing a brain heart infusion (BHI) medium at a volume of 2 vol % based on the total volume of the medium. Then, the culture container was transferred into a shaking incubator and was shake-cultured at 30 C. and 200 rpm for 48 hours. Thereafter, the culturing liquid was centrifuged so that the cell of the recombinant strain was recovered. Thereafter, the recovered cell of the recombinant strain was suspended in a buffer solution, PIPES (piperazine-N, N-bis(2-ethanesulfonic acid)) at a concentration of 50 mM so that a cell suspension having a pH of about 7.0 and a cell concentration of 16% (dry cell weight/suspension volume) based on the total volume of the suspension was produced.
[0048] (2) Production of Aqueous Sodium Alginate Solution
[0049] Sodium alginate was dissolved in water so that aqueous sodium alginate solutions having concentrations of sodium alginate of 2.0% (w/v), 3.0% (w/v), 4.0% (w/v), and 5.0% (w/v) based on the total volume of the solution were produced.
[0050] (3) Production of Aqueous Calcium Chloride Solution
[0051] Calcium chloride (CaCl.sub.2) was dissolved in water so that an aqueous calcium chloride solution having a calcium chloride concentration of 400 mM was produced.
[0052] 3. Production of Cell Immobilized Bead
Embodiment 1: Production of Cell Immobilized Bead Using Needle Having a Flat Cross Section of Discharging Part
[0053] The above-prepared cell suspension and an aqueous sodium alginate solution having a predetermined concentration were mixed with each other in a first mixing tank at a volume ratio of 1:1 so that four kinds of cell-sodium alginate-containing mixed solutions were produced. The four kinds of cell-sodium alginate-containing mixed solutions had a cell concentration of 8% (w/v) and concentrations of sodium alginate of 1.0% (w/v), 1.5% (w/v), 2.0% (w/v), and 2.5% (w/v), respectively, based on the total volumes of the mixed solutions. Thereafter, the cell-sodium alginate-containing mixed solution contained in the first mixing tank was injected into a needle (the cross section of a discharging part is flat, and the inner diameter of the discharging part is about 1 mm) at a flow rate of 60 ml/min using a metering pump. The cell-sodium alginate-containing mixed solution injected into the needle was dropped into a second mixing tank containing the aqueous calcium chloride solution through the discharging part of the needle and was reacted with calcium chloride so that a bead in which a cell was collected was formed.
[0054]
TABLE-US-00003 TABLE 2 Concentration of sodium alginate (%, w/v) 1.0 1.5 2.0 2.5 Size of cell immobilized bead (mm) 1.97 2.07 3.11 3.28
[0055] As illustrated in
Embodiment 2: Production of Cell Immobilized Bead Using Air Spraying Nozzle
[0056] The above-prepared cell suspension and an aqueous sodium alginate solution having a predetermined concentration were mixed with each other in a first mixing tank at a volume ratio of 1:1 so that four kinds of cell-sodium alginate-containing mixed solutions were produced. The four kinds of cell-sodium alginate-containing mixed solutions had a cell concentration of 8% (w/v) and concentrations of sodium alginate of 1.0% (w/v), 1.5% (w/v), 2.0% (w/v), and 2.5% (w/v), respectively, based on the total volumes of the mixed solutions. Thereafter, the cell-sodium alginate-containing mixed solution contained in the first mixing tank was injected into the air spraying nozzle (as the nozzle having the cross section illustrated in
[0057]
TABLE-US-00004 TABLE 3 Concentration of sodium alginate (%, w/v) 1.0 1.5 2.0 2.5 Size of cell immobilized bead (mm) 0.82 0.89 1.03 1.08
[0058] As illustrated in
[0059] As described above, although the present disclosure has been described through the above embodiments, the present disclosure is not limited thereto. Further, it is apparent that various modifications may be made without departing from the scope and the spirit of the present disclosure. Thus, it is interpreted that the protection scope of the present disclosure includes all embodiments belonging to the appended claims.