METHODS, SYNTHETIC HOSTS AND REAGENTS FOR THE BIOSYNTHESIS OF HYDROCARBONS
20190002927 ยท 2019-01-03
Inventors
- Alexander Brett Foster (Redcar, GB)
- Leonard Keith Pattenden (Redcar, GB)
- Jonathan David Rand (Redcar, GB)
- Ana Teresa dos Santos Brito Mendes Roberts (Redcar, GB)
- Andrew Shaw (Redcar, GB)
- Mark Paul Taylor (Redcar, GB)
Cpc classification
C12P5/007
CHEMISTRY; METALLURGY
C12N9/1022
CHEMISTRY; METALLURGY
International classification
C12P5/00
CHEMISTRY; METALLURGY
Abstract
Systems, networks, methods, compositions and recombinant hosts for biosynthesizing hydrocarbons from a feedstock, such as gas, are provided.
Claims
1: A method for biosynthesising a hydrocarbon in a recombinant host, said method comprising: providing a fermentation reactor, the fermentation reactor comprising at least one recombinant host, wherein said recombinant host comprises an exogenous nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 2.2.1.7, and providing a stream comprising a gas or a biological or nonbiological feedstock to the fermentation reactor, and operating the fermentation reactor at conditions for said recombinant host to metabolize the gas or feedstock and produce the hydrocarbon.
2: The method according to claim 1, wherein said hydrocarbon comprises one or more isoprene units as depicted in Formula I ##STR00015## or a salt or derivative thereof.
3: The method according to claim 1, wherein said polypeptide having an enzyme activity of EC 2.2.1.7 converts glyceraldehyde-3-phosphate and pyruvate to 1 deoxy-d-xylulose-phosphate.
4: The method according to claim 1, wherein said polypeptide having an enzyme activity of EC 2.2.1.7 is: (i) encoded by a nucleic acid sequence having at least 49% sequence identity to the nucleic acid sequence set forth in SEQ ID NO:4 or 5 or a functional fragment thereof; (ii) encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NO:4 or 5 or a functional fragment thereof; (iii) has at least 49% sequence identity to the amino acid sequence set forth in SEQ ID NO:1 or 2 or a functional fragment thereof; or (iv) comprises the amino acid sequence set forth in SEQ ID NO: 1 or 2 or a functional fragment thereof.
5-7. (canceled)
8: The method according to claim 1, wherein the recombinant host further comprises an exogenous nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 4.2.3.27.
9: The method according to claim 8, wherein said polypeptide having an enzyme activity of EC 4.2.3.27 converts dimethylallylpyrophosphate to a hydrocarbon comprising one or more isoprene units as depicted in Formula I ##STR00016## or a salt or derivative thereof.
10: The method according to claim 8, wherein said polypeptide having an enzyme activity of EC 4.2.3.27 is: (i) encoded by a nucleic acid sequence having at least 70% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 6 or a functional fragment thereof; (ii) encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NO:6 or a functional fragment thereof; (iii) encoded by an amino acid sequence having at least 70% sequence identity to the amino acid sequence set forth in SEQ ID NO:3 or a functional fragment thereof; or (iv) encoded by an amino acid sequence comprising the amino acid sequence set forth in SEQ ID NO:3 or a functional fragment thereof.
11-13. (canceled)
14: The method according to claim 1 wherein the recombinant host: (i) has one or more properties of Cupriavidus necator; (ii) is selected from non-pathogenic members of the genera Ralstonia, Wausteria, Cupriavidus, Alcaligenes, Burkholderia or Pandoraea; or (iii) is Cupriavidus necator.
15-16. (canceled)
17: The method according to claim 1 wherein the exogenous nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 2.2.1.7 is codon optimized for Cupriavidus necator.
18: The method according to claim 1, wherein said stream comprises at least one of natural gas, syngas, CO.sub.2/H.sub.2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream, or derivative thereof, optionally obtained from a chemical or petrochemical industry.
19. (canceled)
20: The method according to claim 1 wherein the host is transfected with a vector selected from SEQ ID NOs: 7, 8 or 9.
21: The method according to claim 1 wherein the fermentation reactor is operated under phosphate limiting conditions.
22-37. (canceled)
38: The method according to claim 1, wherein the feedstock comprises a biological feedstock comprising monosaccharides, disaccharides, lignocellulose, hemicellulose, cellulose, lignin, levulinic acid and formic acid, triglycerides, glycerol, fatty acids, agricultural waste, condensed distillers' solubles or municipal waste.
39. (canceled)
40: A method for synthesizing a hydrocarbon in a recombinant host having one or more properties of Cupriavidus necator, said method comprising enzymatically converting glyceraldehyde-3-phosphate and pyruvate to 1 deoxy-d-xylulose-phosphate using a polypeptide having an enzyme activity of EC 2.2.1.7; and enzymatically converting dimethylallylpyrophosphate to isoprene using a polypeptide having an enzyme activity of EC 4.2.3.27.
41: The method according to claim 40 wherein the hydrocarbon comprises one or more isoprene units as depicted in Formula I ##STR00017## or a salt or derivative thereof.
42: The method according to claim 40 wherein the polypeptide having an enzyme activity of EC 2.2.1.7 is: (i) encoded by a nucleic acid sequence having at least 70% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 4 or SEQ ID NO:5 or a functional fragment thereof; (ii) encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NO:4 or SEQ ID NO:5 or a functional fragment thereof; (iii) has an amino acid sequence having at least 70% sequence identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 or a functional fragment thereof; or (iv) comprises an amino acid sequence comprising the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 or a functional fragment thereof.
43-45. (canceled)
46: The method according to claim 40, wherein said polypeptide having an enzyme activity of EC 4.2.3.27 is: (i) encoded by a nucleic acid sequence having at least 49% sequence identity to the nucleic acid sequence set forth in SEQ ID NO:6 or a functional fragment thereof; (ii) encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NO:6 or a functional fragment thereof; (iii) has at least 49% sequence identity to the amino acid sequence set forth in SEQ ID NO:3 or a functional fragment thereof; or (iv) comprises the amino acid sequence set forth in SEQ ID NO: 3 or a functional fragment thereof.
47-49. (canceled)
50: The method according to claim 40 wherein the recombinant host having one or more properties of Cupriavidus necator is transfected with a vector selected from SEQ ID NOs: 7, 8 or 9.
51-52. (canceled)
53: The method of claim 1, further comprising recovering produced hydrocarbon.
54: The method of claim 53 wherein the hydrocarbon recovered is gaseous isoprene.
55: A recombinant host capable of producing a hydrocarbon via a methylerythritol phosphate (MEP) pathway, wherein said host comprises an exogenous nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 2.2.1.7.
56: The recombinant host of claim 55 further comprising an exogenous nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 4.2.3.27.
57: The recombinant host according to claim 55 wherein the hydrocarbon comprises one or more isoprene units as depicted in Formula I ##STR00018## or a salt or derivative thereof.
58: The recombinant host according to claim 56, wherein said polypeptide having an enzyme activity of EC 4.2.3.27 is: (i) encoded by a nucleic acid sequence having at least 49% sequence identity to the nucleic acid sequence set forth in SEQ ID NO:6 or a functional fragment thereof; (ii) encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NO:6 or a functional fragment thereof; (iii) has at least 49% sequence identity to the amino acid sequence set forth in SEQ ID NO:3 or a functional fragment thereof; or (iv) comprises the amino acid sequence set forth in SEQ ID NO: 3 or a functional fragment thereof.
59-61. (canceled)
62: The recombinant host according to claim 55, wherein said polypeptide having an enzyme activity of EC 2.2.1.7 is: (i) encoded by a nucleic acid sequence having at least 70% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 4 or SEQ ID NO:5 or a functional fragment thereof; (ii) encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NO:4 or SEQ ID NO:5 or a functional fragment thereof; (iii) encoded by an amino acid sequence having at least 70% sequence identity to the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 or a functional fragment thereof; (iv) encoded by an amino acid sequence comprising the amino acid sequence set forth in SEQ ID NO:1 or SEQ ID NO:2 or a functional fragment thereof.
63-65. (canceled)
66: The recombinant host according to claim 55: having one or more properties of Cupriavidus necator; selected from non-pathogenic members of the genera Ralstonia, Wausteria, Cupriavidus, Alcaligenes, Burkholderia or Pandoraea; or which is Cupriavidus necator.
67-68. (canceled)
69: The recombinant host according to claim 56, wherein at least one of the exogenous nucleic acid sequences is contained within a plasmid or is integrated into a chromosome of the host.
70. (canceled)
71: The recombinant host according to claim 55 transfected with a vector selected from SEQ ID NOs: 7, 8 or 9.
72: The recombinant host according to claim 55, wherein the host performs the enzymatic synthesis by gas fermentation or on a biological or nonbiological feedstock.
73: The recombinant host according to claim 72, wherein said gas for fermentation comprises at least one of natural gas, syngas, CO.sub.2/H.sub.2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream, or derivative thereof, optionally obtained from a chemical or petrochemical industry.
74-75. (canceled)
76: The recombinant host according to claim 72 wherein the host performs the enzymatic synthesis on a biological feedstock comprising monosaccharides, disaccharides, lignocellulose, hemicellulose, cellulose, lignin, levulinic acid and formic acid, triglycerides, glycerol, fatty acids, agricultural waste, condensed distillers' solubles or municipal waste.
77: A bioderived hydrocarbon produced in a recombinant host according to claim 55.
78: A bio-derived, bio-based, or fermentation-derived product produced from the method of claim 1, wherein said product comprises: (i) a composition comprising at least one bio-derived, bio-based, or fermentation-derived compound or any combination thereof; (ii) a bio-derived, bio-based, or fermentation-derived polymer comprising the bio-derived, bio-based, or fermentation-derived composition or compound of (i), or any combination thereof; (iii) a bio-derived, bio-based, or fermentation-derived cis-polyisoprene rubber, trans-polyisoprene rubber, or liquid polyisoprene rubber, comprising the bio-derived, bio-based, or fermentation-derived compound or bio-derived, bio-based, or fermentation-derived composition of (i), or any combination thereof or the bio-derived, bio-based, or fermentation-derived polymer of (ii), or any combination thereof; (iv) a molded substance obtained by molding the bio-derived, bio-based, or fermentation-derived polymer of (ii), or the bio-derived, bio-based, or fermentation-derived rubber of (iii), or any combination thereof; (v) a bio-derived, bio-based, or fermentation-derived formulation comprising the bio-derived, bio-based, or fermentation-derived composition of (i), the bio-derived, bio-based, or fermentation-derived compound of (i), the bio-derived, bio-based, or fermentation-derived polymer of (ii), the bio-derived, bio-based, or fermentation-derived rubber of (iii), or the bio-derived, bio-based, or fermentation-derived molded substance of (iv), or any combination thereof; or (vi) a bio-derived, bio-based, or fermentation-derived semi-solid or a non-semi-solid stream, comprising the bio-derived, bio-based, or fermentation-derived composition of (i), the bio-derived, bio-based, or fermentation-derived compound of (i), the bio-derived, bio-based, or fermentation-derived polymer of (ii), the bio-derived, bio-based, or fermentation-derived rubber of (iii), the bio-derived, bio-based, or fermentation-derived formulation of (iv), or the bio-derived, bio-based, or fermentation-derived molded substance of (v), or any combination thereof.
79: A method for producing a recombinant host capable of producing a hydrocarbon from a gas stream, said method comprising transfecting a host cell with an exogenous nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 2.2.1.7.
80: The method according to claim 79 further comprising transfecting the host with an exogenous nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 4.2.3.27.
81: The method according to claim 79 wherein the hydrocarbon comprises one or more isoprene units as depicted in Formula I ##STR00019## or a salt or derivative thereof.
82: The method according to claim 79 wherein the host cell: has one or more properties of Cupriavidus necator; is selected from non-pathogenic members of the genera Ralstonia, Wausteria, Cupriavidus, Alcaligenes, Burkholderia or Pandoraea; or is Cupriavidus necator.
83-84. (canceled)
Description
BRIEF DESCRIPTION OF THE FIGURES
[0024]
[0025]
DETAILED DESCRIPTION
[0026] Disclosed herein are biological systems, networks, and recombinant cells comprising an engineered enzymatic pathway that catalyze the conversion of a gas to a hydrocarbon, compositions and methods for their production, and methods for their use in production of hydrocarbons. The compositions and methods disclosed herein provide low cost processes for conversion of industrial gases to chemicals in a fermenter. In the methods of the present invention, recombinant cells are introduced into a fermenter, mixed with gas feedstocks which are enzymatically converted to a hydrocarbon by the recombinant cells, and the hydrocarbon is then separated from the off-gases from the fermenter.
[0027] By recombinant cell or recombinant host as used herein, it is meant to encompass any genetically engineered cell or host as described herein and such terms as recombinant, engineered, and genetically engineered are used interchangeably herein.
[0028] By hydrocarbon or hydrocarbons as used herein, it is meant to encompass any organic compound comprised of carbons and hydrogens which can be enzymatically synthesized from a gas and is inclusive of saturated as well as unsaturated structures with double or triple bonds formed between carbon atoms, ring structures, salts and derivatives thereof. In one nonlimiting embodiment, the hydrocarbon comprises one or more isoprene units as depicted in Formula I
##STR00013##
or a salt or derivative thereof.
[0029] By the phrase one or more isoprene units as depicted in Formula I it is meant to encompass any saturated or unsaturated 5 carbon branched structure derived from an isoprenoid including, isoprene as well as isoprenoids, terpenes and terpenoids as well as derivatives such as, but not limited to isoprenols, and salts thereof.
[0030] Nonlimiting examples of hydrocarbons comprising one or more isoprene units produced in accordance with the present invention include isoprene as well as any isoprenoid, terpene or terpenoid derivative of 5, including C5, C10, C15, C20, C25, C30, C35, C40, C45, C50, etc. Nonlimiting examples include hemiterpene, monoterpene, diterpene, triterpene, tetraterpene, polyterpene, lycopene, abietadiene, amorphadiene, carene, alpha-farnesene, beta-farnesene, farnesol, geraniol, geranylgeraniol, isoprene, linalool, limonene, myrcene, nerolidol, ocimene, patchoulol, beta-pinene, sabinene, gamma-terpinene, terpinolene and valencene, as well as derivatives and salts thereof.
[0031] In one nonlimiting embodiment, the present invention relates to methods for the design and subsequent introduction of non-native DNA into Cupriavidus necator, to produce the recombinant cells. In some non-limiting embodiments, the host of the present invention is Cupriavidus necator, such as a genetically engineered strain of Cupriavidus necator capable of stable hydrocarbon production. In one nonlimiting embodiment, the present invention relates to a Cupriavidus necator host capable of producing hydrocarbons via a methylerythritol phosphate (MEP) pathway. Cupriavidus necator is a Gram-negative, flagellated soil bacterium of the Betaproteobacteria class. This hydrogen-oxidizing bacterium is capable of growing at the interface of anaerobic and aerobic environments and easily adapts between heterotrophic and autotrophic lifestyles. Sources of energy for the bacterium include both organic compounds and hydrogen. C. necator does not naturally contain genes for isoprene synthase (ISPS) and therefore does not express this enzyme. Additional properties of Cupriavidus necator include microaerophilicity, copper resistance (Makar and Casida; 1987), bacterial predation (Byrd et al., 1985; Sillman & Casida, 1986; Zeph & Casida, 1986) and polyhydrobutyrate (PHB) synthesis. In addition, the cells have been reported to be capable of both aerobic and nitrate dependent anaerobic growth.
[0032] In another nonlimiting embodiment, the present invention relates to methods for the design and subsequent introduction of non-native DNA into a recombinant host having one or more of the above-mentioned properties of Cupriavidus necator.
[0033] In yet another nonlimiting embodiment, the present invention relates to methods for the design and subsequent introduction of non-native DNA into a recombinant host selected from non-pathogenic members of the genera Ralstonia, Wausteria, Cupriavidus, Alcaligenes, Burkholderia or Pandoraea.
[0034] The present invention provides methods and compositions for synthesizing hydrocarbons in these recombinant cells. In the methods and compositions of the present invention, a host of the invention, such as organisms such as C. necator, as well as non-pathogenic members of the genera Ralstonia, Wausteria, Alcaligenes, Burkholderia and Pandoraea, and other organisms having one or more of the above-mentioned properties of Cupriavidus necator can be used to synthesize hydrocarbons via a methylerythritol phosphate (MEP) pathway.
[0035] Surprisingly, the inventors herein have found that expression of a polypeptide having an activity of EC 2.2.1.7 and a polypeptide having an activity of EC 4.2.3.27 in C. necator resulted in the production of isoprene, via the MEP pathway. Specifically, recombinant Cupriavidus necator cells were transformed with novel non-native DNA encoding enzymes that catalyze the conversion of glyceraldehyde-3-phosphate and pyruvate to 1 deoxy-d-xylulose-phosphate, and dimethylallylpyrophosphate (DMAPP) to isoprene, in a plasmid, along with standard regulatory DNA elements. The effect of the addition of non-native gene encoding a polypeptide having an activity of EC 2.2.1.7 from B. subtilis and E. coli into Cupriavidus necator was to increase the flux through the native metabolic MEP pathway, which ultimately increases the flux of an added raw material to DMAPP. The addition of the non-native gene encoding a polypeptide having an activity of EC 4.2.3.27 allowed the recombinant cell to convert DMAPP to isoprene. Testing of the recombinant organism, referred to herein as DXS+/ISPS+, showed that isoprene was produced by the recombinant organism. Moreover, this recombinant organism produced more isoprene than a recombinant Cupriavidus necator in which only a non-native gene encoding a polypeptide having an activity of EC 4.2.3.27 was introduced (referred to herein ISPS+). Cupriavidus necator cells in which the non-native gene encoding a polypeptide having an activity of EC 4.2.3.27 is not added did not produce isoprene.
[0036] A nonlimiting example of a C. necator host useful in the present invention is a C. necator of the H16 strain. In one nonlimiting embodiment, a C. necator host of the H16 strain with the phaCAB gene locus knocked out (fphaCAB) is used.
[0037] In one nonlimiting embodiment, the method comprises enzymatically converting glyceraldehyde-3-phosphate and pyruvate to 1 deoxy-d-xylulose-phosphate using a polypeptide having an activity of EC 2.2.1.7, such as an enzyme with classification EC 2.2.1.7. In one nonlimiting embodiment, the activity of EC 2.2.1.7 is 1-deoxy-D-xylulose-5-phosphate synthase (DXS) activity. In one nonlimiting embodiment, the polypeptide is a 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Polypeptides having DXS enzyme activity have been identified from various organisms and are readily available in publicly available databases such as GenBank or EMBL. Nonlimiting examples are the DXS of E. coli and B. subtilis. In one nonlimiting embodiment, the polypeptide having DXS enzyme activity has at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the amino acid sequences set forth in SEQ ID NO: 1 or 2 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having DXS enzyme activity comprises the amino acid sequence set forth in SEQ ID NO: 1 or 2 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having DXS enzyme activity is encoded by a nucleic acid sequence having at least 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 4 or 5 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having DXS enzyme activity is encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NOs: 4 or 5 or a functional fragment thereof. In one nonlimiting embodiment, the nucleic acid sequence is codon optimized for Cupriavidus necator.
[0038] In one nonlimiting embodiment, the method further comprises enzymatically converting dimethylallylpyrophosphate to a hydrocarbon using a polypeptide having an activity of EC 4.2.3.27, such as an enzyme with classification EC 4.2.3.27. In one nonlimiting embodiment, the activity of EC 4.2.3.27 is isoprene synthase enzyme activity. In one nonlimiting embodiment, the polypeptide is an isoprene synthase enzyme Polypeptides having ISPS enzyme activity and nucleic acids encoding ISPSs have been identified from various organisms and are readily available in publicly available databases such as GenBank or EMBL. A nonlimiting example is the ISPS of Populus alba. In one nonlimiting embodiment, the polypeptide having ISPS enzyme activity has at least 49%, 50%, 55%, 60%, 65%, 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the amino acid sequence set forth in SEQ ID NO: 3 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having ISPS enzyme activity comprises the amino acid sequence set forth in SEQ ID NO: 3 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having ISPS enzyme activity is encoded by a nucleic acid sequence having at least 49%, 50%, 55%, 60%, 65%, 70%, 75%, 80, 85, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 6 or a functional fragment thereof. In one nonlimiting embodiment, the polypeptide having ISPS enzyme activity is encoded by a nucleic acid sequence comprising the nucleic acid sequence set forth in SEQ ID NO: 6 or a functional fragment thereof.
[0039] Various vectors have been constructed for use in the present invention and confirmed by sequencing. Vectors constructed included pBBR1-ISPS, pBBR1-E. coli DXD-ISPS, and pBBR1-B. subtilis DXD-ISPS. Images of the constructed vectors are set forth in
[0040] In one nonlimiting embodiment, the method for synthesizing a hydrocarbon in a recombinant host as described herein comprises enzymatically converting glyceraldehyde-3-phosphate and pyruvate to 1 deoxy-d-xylulose-phosphate using a polypeptide having an enzyme activity of EC 2.2.1.7 and enzymatically converting dimethylallylpyrophosphate to a hydrocarbon using a polypeptide having an enzyme activity of EC 4.2.3.27. In one nonlimiting embodiment, the enzyme activity of EC 2.2.1.7 is 1-deoxy-D-xylulose-5-phosphate synthase (DXS) activity. In one nonlimiting embodiment, the enzyme activity of EC 4.2.3.27 is ISPS enzyme activity. In one nonlimiting embodiment, the hydrocarbon comprises one or more isoprene units as depicted in Formula I
##STR00014##
or a salt or derivative thereof. In this embodiment, any of the polypeptides having an EC 2.2.1.7 enzyme activity or EC 4.2.3.27 enzyme activity described supra can be used.
[0041] The percent identity (homology) between two amino acid sequences can be determined as follows. First, the amino acid sequences are aligned using the BLAST 2 Sequences (B12seq) program from the stand-alone version of BLAST containing BLASTP version 2.0.14. This stand-alone version of BLAST can be obtained from the U.S. government's National Center for Biotechnology Information web site (www with the extension ncbi.nlm.nih.gov). Instructions explaining how to use the B12seq program can be found in the readme file accompanying BLASTZ. B12seq performs a comparison between two amino acid sequences using the BLASTP algorithm. To compare two amino acid sequences, the options of B12seq are set as follows: -i is set to a file containing the first amino acid sequence to be compared (e.g., C:\seq1.txt); -j is set to a file containing the second amino acid sequence to be compared (e.g., C:\seq2.txt); -p is set to blastp; -o is set to any desired file name (e.g., C:\output.txt); and all other options are left at their default setting. For example, the following command can be used to generate an output file containing a comparison between two amino acid sequences: C:\B12seq-i c:\seq1.txt-j c:\seq2.txt-p blastp-o c:\output.txt. If the two compared sequences share homology (identity), then the designated output file will present those regions of homology as aligned sequences. If the two compared sequences do not share homology (identity), then the designated output file will not present aligned sequences. Similar procedures can be following for nucleic acid sequences except that blastn is used.
[0042] Once aligned, the number of matches is determined by counting the number of positions where an identical amino acid residue is presented in both sequences. The percent identity (or homology) is determined by dividing the number of matches by the length of the full-length polypeptide amino acid sequence followed by multiplying the resulting value by 100. It is noted that the percent identity (or homology) value is rounded to the nearest tenth. For example, 90.11, 90.12, 90.13, and 90.14 is rounded down to 90.1, while 90.15, 90.16, 90.17, 90.18, and 90.19 is rounded up to 90.2. It also is noted that the length value will always be an integer.
[0043] It will be appreciated that a number of nucleic acids can encode a polypeptide having a particular amino acid sequence. The degeneracy of the genetic code is well known to the art; i.e., for many amino acids, there is more than one nucleotide triplet that serves as the codon for the amino acid. For example, codons in the coding sequence for a given enzyme can be modified such that optimal expression in a particular species (e.g., bacteria or fungus) is obtained, using appropriate codon bias tables for that species.
[0044] Functional fragments of any of the polypeptides or nucleic acid sequences described herein can also be used in the methods of the document. The term functional fragment as used herein refers to a peptide fragment of a polypeptide or a nucleic acid sequence fragment encoding a peptide fragment of a polypeptide that has at least 25% (e.g., at least: 30%; 40%; 50%; 60%; 70%; 75%; 80%; 85%; 90%; 95%; 98%; 99%; 100%; or even greater than 100%) of the activity of the corresponding mature, full-length, polypeptide. The functional fragment can generally, but not always, be comprised of a continuous region of the polypeptide, wherein the region has functional activity.
[0045] In one nonlimiting embodiment, methods of the present invention are performed in a recombinant Cupriavidus necator host.
[0046] In another nonlimiting embodiment, methods of the present invention are performed in a recombinant host having one or more of the above-mentioned properties of Cupriavidus necator.
[0047] In yet another nonlimiting embodiment, methods of the present invention are performed in a recombinant host selected from non-pathogenic members of the genera Ralstonia, Wausteria, Cupriavidus, Alcaligenes, Burkholderia or Pandoraea.
[0048] Recombinant hosts can naturally express none or some (e.g., one or more, two or more) of the enzymes of the pathways described herein. Endogenous genes of the recombinant hosts also can be disrupted to prevent the formation of undesirable metabolites or prevent the loss of intermediates in the pathway through other enzymes acting on such intermediates. Recombinant hosts can be referred to as recombinant host cells, engineered cells, or engineered hosts. Thus, as described herein, recombinant hosts can include exogenous nucleic acids encoding one or more of IDIs and/or ISPSs, as described herein.
[0049] The term exogenous as used herein with reference to a nucleic acid (or a protein) and a host refers to a nucleic acid that does not occur in (and cannot be obtained from) a cell of that particular type as it is found in nature or a protein encoded by such a nucleic acid. Thus, a non-naturally-occurring nucleic acid is considered to be exogenous to a host once in the host. It is important to note that non-naturally-occurring nucleic acids can contain nucleic acid subsequences or fragments of nucleic acid sequences that are found in nature provided the nucleic acid as a whole does not exist in nature. For example, a nucleic acid molecule containing a genomic DNA sequence within an expression vector is non-naturally-occurring nucleic acid, and thus is exogenous to a host cell once introduced into the host, since that nucleic acid molecule as a whole (genomic DNA plus vector DNA) does not exist in nature. Thus, any vector, autonomously replicating plasmid, or virus (e.g., retrovirus, adenovirus, or herpes virus) that as a whole does not exist in nature is considered to be non-naturally-occurring nucleic acid. It follows that genomic DNA fragments produced by PCR or restriction endonuclease treatment as well as cDNAs are considered to be non-naturally-occurring nucleic acid since they exist as separate molecules not found in nature. An exogenous sequence may therefore be integrated into the genome of the host. It also follows that any nucleic acid containing a promoter sequence and polypeptide-encoding sequence (e.g., cDNA or genomic DNA) in an arrangement not found in nature is non-naturally-occurring nucleic acid. A nucleic acid that is naturally-occurring can be exogenous to a particular host microorganism. For example, an entire chromosome isolated from a cell of yeast x is an exogenous nucleic acid with respect to a cell of yeast y once that chromosome is introduced into a cell of yeast y.
[0050] In contrast, the term endogenous as used herein with reference to a nucleic acid (e.g., a gene) (or a protein) and a host refers to a nucleic acid (or protein) that does occur in (and can be obtained from) that particular host as it is found in nature. Moreover, a cell endogenously expressing a nucleic acid (or protein) expresses that nucleic acid (or protein) as does a host of the same particular type as it is found in nature. Moreover, a host endogenously producing or that endogenously produces a nucleic acid, protein, or other compound produces that nucleic acid, protein, or compound as does a host of the same particular type as it is found in nature.
[0051] In a non-limiting embodiment, a method of hydrocarbon production as described herein is carried out using any host of the invention.
[0052] In a non-limiting embodiment is provided the use of a host of the invention, such as a recombinant or genetically engineered host as described herein, for the production of a hydrocarbon. The use may involve any method of hydrocarbon production as described herein.
[0053] In one nonlimiting embodiment of the present invention, the method for hydrocarbon production is performed in a recombinant host comprising an exogenous nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 2.2.1.7. In one nonlimiting embodiment, the enzyme activity of EC 2.2.1.7 is DXS enzyme activity. In this embodiment, any of the nucleic acid sequences encoding a polypeptide having an EC 2.2.1.7 enzyme activity as described supra can be used.
[0054] In another nonlimiting embodiment, the method is performed using a recombinant host comprising an exogenous nucleic acid encoding a polypeptide having an enzyme activity of EC 2.2.1.7 and an exogenous nucleic acid encoding a polypeptide having an enzyme activity of EC 4.2.3.27. In one nonlimiting embodiment, the enzyme activity of EC 2.2.1.7 is DXS enzyme activity. In one nonlimiting embodiment, the enzyme activity of EC 4.2.3.27 is ISPS enzyme activity. In this embodiment, any of the nucleic acid sequences encoding a polypeptide having an EC 2.2.1.7 enzyme activity and any of the nucleic acid sequences having an EC 4.2.3.27 enzyme activity as described supra can be used.
[0055] In another nonlimiting embodiment, the method for hydrocarbon production of the present invention is performed in a recombinant host which has been transformed with a vector comprising any of SEQ ID NOs:7, 8 or 9.
[0056] In some non-limiting embodiments, the method comprises contacting a host of the invention with a suitable substrate under conditions such that the host is capable of producing a hydrocarbon from the substrate via a MEP pathway. Such a method may comprise culturing a host of the invention in the presence of a suitable substrate. In some non-limiting embodiments, the substrate comprises glyceraldehyde-3-phosphate and/or pyruvate, or the substrate can be converted to form glyceraldehyde-3-phosphate and/or pyruvate by the host.
[0057] In some non-limiting embodiments, the method of the invention comprises a fermentation reaction and the method is carried out in a fermentation reactor. In any of the methods described herein, a fermentation strategy can be used that entails anaerobic, micro-aerobic or aerobic cultivation. A variety of fermentation strategies can be employed with the present invention, and are familiar to one skilled in the art. Examples include batch, fed batch and continuous systems including chemostat, auxostat and may utilize cell retention or concentration systems to increase biomass, for example. Retention/concentration systems can include hydrocyclones, cross flow/tangential flow filtration, inclined settlers and process centrifuges. A fermentation strategy can entail nutrient limitation such as nitrogen, phosphate or oxygen limitation. The substrate, or the principal carbon source fed to the fermentation, can be or can derive from a biological or non-biological feedstock. The biological feedstock can be, or can derived from, monosaccharides, disaccharides, lignocellulose, hemicellulose, cellulose, lignin, levulinic acid and formic acid, triglycerides, glycerol, fatty acids, agricultural waste, condensed distillers' solubles or municipal waste. The non-biological feedstock can be, or can derive from, natural gas, syngas, CO.sub.2/H.sub.2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream, or derivative thereof, optionally obtained from a chemical or petrochemical industry.
[0058] In one nonlimiting embodiment, at least one of the enzymatic conversions of the hydrocarbon production method comprises gas fermentation within the recombinant host. In this embodiment, a gaseous stream is provided to a fermentation reactor, also known as a bioreactor. A recombinant host as described supra is also added to the fermentation reactor. The fermentation reactor is then operated at conditions under which the recombinant host metabolizes the gaseous stream and produces the hydrocarbon. In this embodiment, the gas fermentation may comprise at least one of natural gas, syngas, CO.sub.2/H.sub.2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream, or derivative thereof, optionally obtained from a chemical or petrochemical industry. In one nonlimiting embodiment, the gas fermentation comprises CO.sub.2/H.sub.2 or syngas.
[0059] In some non-limiting embodiments the substrate is a gas. In some non-limiting embodiments, the method comprises contacting the host with a gas. In some of these embodiments, the gas comprises at least one of natural gas, syngas, CO.sub.2/H.sub.2, methanol, ethanol, non-volatile residue, caustic wash from cyclohexane oxidation processes, or waste stream, or derivative thereof, optionally obtained from a chemical or petrochemical industry. In one non-limiting embodiment, the gas comprises CO.sub.2/H.sub.2 or syngas.
[0060] In one nonlimiting embodiment, the fermentation reactor is fed at least one growth rate limiting nutrient such as described in PCT/EP2010/054401, teachings of which are incorporated herein by reference. In one nonlimiting embodiment, the fermentation reactor is operated under phosphate limiting conditions such as described in U.S. Pat. No. 4,605,620, teachings of which are herein incorporated by reference. More specifically, the information in the Examples of U.S. Pat. No. 4,605,620 is hereby incorporated by reference in its entirety.
[0061] The methods of the present invention may further comprise recovering produced hydrocarbon from the recombinant host. In these embodiments, the hydrocarbons may comprise one or more isoprene units, as described herein. In some non-limiting embodiments, the hydrocarbon produced by a method of the invention is a gas. In some non-limiting embodiments the method further comprises recovering produced gaseous hydrocarbon from the host.
[0062] Once produced, any method can be used to isolate the hydrocarbon. For example, the hydrocarbon isoprene can be recovered from the fermenter off-gas stream as a volatile product as the boiling point of isoprene is 34.1 C. One nonlimiting example of a fermentation range of the present invention is about 20 C. to 60 C. One nonlimiting example of a preferred fermentation range is about 25 C. to 42 C. Isoprene has a high vapor pressure and can be stripped by the gas flow rate through the broth for recovery from the off-gas. Isoprene can be selectively adsorbed onto, for example, an adsorbent and separated from the other off-gas components. Similar isolated methods can be adapted routinely for other hydrocarbons produced in accordance with the present invention.
[0063] Membrane separation technology may also be employed to separate the hydrocarbon from the other off-gas compounds. For example, the hydrocarbon isoprene may be desorbed from an adsorbent using, for example, nitrogen and condensed at low temperature and high pressure.
[0064] Because of the gaseous nature of isoprene, in embodiments of the present invention wherein the hydrocarbon produced is isoprene, an advantage is easy separation of the product.
[0065] Compositions for synthesizing hydrocarbons in recombinant hosts also provided by the present invention.
[0066] In one nonlimiting embodiment, a recombinant host capable of producing a hydrocarbon via a methylerythritol phosphate (MEP) pathway is provided. The host may be any host as described herein that capable of producing a hydrocarbon via a MEP pathway. In one nonlimiting embodiment, the recombinant host is a substantially pure culture.
[0067] As used herein, a substantially pure culture of a recombinant host microorganism is a culture of that microorganism in which less than about 40% (i.e., less than about 35%; 30%; 25%; 20%; 15%; 10%; 5%; 2%; 1%; 0.5%; 0.25%; 0.1%; 0.01%; 0.001%; 0.0001%; or even less) of the total number of viable cells in the culture are viable cells other than the recombinant microorganism, e.g., bacterial, fungal (including yeast), mycoplasmal, or protozoan cells. The term about in this context means that the relevant percentage can be 15% of the specified percentage above or below the specified percentage. Thus, for example, about 20% can be 17% to 23%. Such a culture of recombinant microorganisms includes the cells and a growth, storage, or transport medium. Media can be liquid, semi-solid (e.g., gelatinous media), or frozen. The culture includes the cells growing in the liquid or in/on the semi-solid medium or being stored or transported in a storage or transport medium, including a frozen storage or transport medium. The cultures are in a culture vessel or storage vessel or substrate (e.g., a culture dish, flask, or tube or a storage vial or tube).
[0068] In one nonlimiting embodiment, the recombinant host comprises an exogenous nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 2.2.1.7. In one nonlimiting embodiment, the enzyme activity of EC 2.2.1.7 is DXS enzyme activity. Any nucleic acid sequence encoding a polypeptide having an enzyme activity of EC 2.2.1.7 as described supra can be used in this embodiment.
[0069] In another nonlimiting embodiment, the recombinant host comprises an exogenous nucleic acid encoding a polypeptide having an enzyme activity of EC 2.2.1.7 and an exogenous nucleic acid encoding a polypeptide having an enzyme activity of EC 4.2.3.27. In one nonlimiting embodiment, the enzyme activity of EC 2.2.1.7 is DXS enzyme activity. In one nonlimiting embodiment, the enzyme activity of EC 4.2.3.27 is ISPS enzyme activity. Any of the nucleic acid sequences encoding a polypeptide having an enzyme activity of EC 2.2.1.7 or an enzyme activity of EC 4.2.3.27 as described supra can be used.
[0070] In one nonlimiting embodiment, at least one of the exogenous nucleic acid sequences in the recombinant host is contained within a plasmid.
[0071] In one nonlimiting embodiment, at least one of the exogenous nucleic acid sequences is integrated into a chromosome of the host.
[0072] In one nonlimiting embodiment, the recombinant host has been transfected with a vector comprising any of SEQ ID NOs:7, 8 or 9.
[0073] Also provided by the present invention are hydrocarbons bioderived from, produced by, or obtainable from, a recombinant host according to any of methods described herein. In one nonlimiting embodiment, the hydrocarbon has carbon isotope ratio that reflects an atmospheric carbon dioxide uptake source. Examples of such ratios include, but are not limited to, carbon-12, carbon-13, and carbon-14 isotopes.
[0074] In addition, the present invention provides a product such as a bio-derived, bio-based, or fermentation-derived product produced using the methods and/or compositions disclosed herein. Examples of such products include, but are not limited to, compositions comprising at least one bio-derived, bio-based, or fermentation-derived compound or any combination thereof, as well as polymers, rubbers such as cis-polyisoprene rubber, trans-polyisoprene rubber, or liquid polyisoprene rubber, molded substances, formulations and semi-solid or non-semi-solid streams comprising one or more of the bio-derived, bio-based, or fermentation-derived compounds or compositions, combinations or products thereof.
[0075] In addition, the present invention provides methods of producing such a product. In some non-limiting embodiments, the method comprises producing a hydrocarbon by a method of the invention and converting the hydrocarbon to said product. In one non-limiting embodiment, a method of producing a polymer comprises the steps of producing a hydrocarbon by a method as described herein and forming a polymer from said hydrocarbon.
[0076] Although specific advantages have been enumerated above, various embodiments may include some, none, or all of the enumerated advantages. Further, other technical advantages may become readily apparent to one of ordinary skill in the art after review of the figures and description herein. It should be understood at the outset that, although exemplary embodiments are illustrated in the figures and described herein, the principles of the present disclosure may be implemented using any number of techniques, whether currently known or not. The present disclosure should in no way be limited to the exemplary implementations and techniques illustrated in the drawings and described herein.
[0077] Unless otherwise specifically noted, articles depicted in the drawings are not necessarily drawn to scale.
[0078] Modifications, additions, or omissions may be made to the systems, apparatuses, and methods described herein without departing from the scope of the disclosure. For example, the components of the systems and apparatuses may be integrated or separated. Moreover, the operations of the systems and apparatuses disclosed herein may be performed by more, fewer, or other components and the methods described may include more, fewer, or other steps. Additionally, steps may be performed in any suitable order. As used in this document, each refers to each member of a set or each member of a subset of a set.
[0079] To aid the Patent Office and any readers of any patent issued on this application in interpreting the claims appended hereto, applicants wish to note that they do not intend any of the appended claims or claim elements to invoke 35 U.S.C. 112(f) unless the words means for or step for are explicitly used in the particular claim.
[0080] The following section provides further illustration of the methods and compositions of the present invention. These working examples are illustrative only and are not intended to limit the scope of the invention in any way.
EXAMPLES
Example 1: Primers
[0081] Primers as listed in Table 1 were used in the following disclosed experiments.
TABLE-US-00001 TABLE1 Primer Sequence 1 5 GGAAGGAGCGAAGCATGCGTTGTAGCGTTAGC3 (SEQIDNO:10) 2 5 GGGCTTTGTTAGCAGGCTTAGCGTTCGAACGGCAGAA T3 (SEQIDNO:11) 3 5 GCCTGCTAACAAAGCCCGAAA3 (SEQIDNO:12) 4 5 GCTTCGCTCCTTCCTTAAAG3 (SEQIDNO:13) 5 5 GCCGCCCTATACCTTGTCT3 (SEQIDNO:14) 6 5 ACGGCGTCACACTTTGCTAT3 (SEQIDNO:15) 7 5 CGCGTCGCGAACGCCAGCAA3 (SEQIDNO:16) 8 5 ACGGGGCCTGCCACCATACC3 (SEQIDNO:17) 9 5 CTTATCGATGATAAGCTGTC3 (SEQIDNO:18) 10 5 CAGCCCTAGATCGGCCACAG3 (SEQIDNO:19) 11 5 TGCCTGCCCCTCCCTTTTGG3 (SEQIDNO:20) 12 5 GCGGCGAGTGCGGGGGTTCC3 (SEQIDNO:21) 13 5 GGAAACCCACGGCGGCAATG3 (SEQIDNO:22) 14 5 ATCGGCTGTAGCCGCCTCTAGATT3 (SEQIDNO:23) 15 5 AGTAACAATTGCTCAAGCAG3 (SEQIDNO:24) 16 5 ATTCAGAGAAGAAACCAATT3 (SEQIDNO:25) 17 5 GCTAGAAATAATTTTGAGCTCAGGAAGGAGCGAAGCA TGGGCCATCATCATCATCATCACATGAGTTTTGATATTGC C3 (SEQIDNO:26) 18 5 GCTTCGCTCCTTCCTTAAAGTTATGCCAGCCAGGCCT T3 (SEQIDNO:27) 19 5 GCTAGAAATAATTTTGAGCTCAGGAAGGAGCGAAGCA TGGGCCATCATCATCATCATCACATGCTGGATCTGCTGTC GATC3 (SEQIDNO:28) 20 5 GCTTCGCTCCTTCCTTAAAGTCACGAGCCGATGCCCT T3 (SEQIDNO:29) 21 5 CACTTTGCTATGCCATAGC3 (SEQIDNO:30) 22 5 CTGCGGCGAGCTTCGGTTTC3 (SEQIDNO:31) 23 5 GACTCCCTGAAGTACATGCTCG3 (SEQIDNO:32)
Example 2: Genes
[0082] Genes as listed in Table 2 were used in the following disclosed experiments.
TABLE-US-00002 TABLE 2 Database Gene name Species of origin identifier Isoprene synthase Populus alba BAD98243.1 1-deoxy-D-xylulose-5- Escherichia coli BL21 NC_012892.2 phosphate synthase 1-deoxy-D-xylulose-5- Bacillus subtilis subsp. NP_390307.1 phosphate synthase subtilis str. 168
Example 3: Cloning of Poplar ISPS for Expression in C. necator spp.
[0083] The protein sequence for the Populus alba was obtained from GenBank and the full gene, codon optimized for E. coli was purchased from Eurofins MWG. This DNA was used as a template for amplification of the gene using primers 1 and 2 (see Table 1) and Phusion polymerase (NEB) with an annealing temperature of 45 C. The vector backbone of pBBR1MCS3-pBAD was generated with primer 3 and 4 (see Table 1) and with Merck Millipore KOD polymerase with annealing temperatures of 50-55 C. The two fragments were ligated using NEB Gibson Assembly reaction master mix as per the manufacturer's recommended protocol. The ligation mix was transformed into chemically competent E. coli NEB5 and correct clones verified via a combination of colony PCR and sequencing with primers 5 and 6 (see Table 1). Subsequently the whole construct was sequenced by MWG-Eurofins using primers 7-16 (see Table 1). A single verified construct was taken forward for further work and designated pBBR1-ISPS.
Example 4: Cloning of DXS-ISPS Bicistrons for Expression in C. necator spp.
[0084] A unique Sad restriction site was identified in pBBR1-ISPS, upstream of the ribosome binding site and downstream of the predicted transcriptional start site. pBBR1-ISPS was purified from NEB5 alpha using the Qiagen plasmid Midi prep kit, cut with Sad (NEB) and purified using the Qiagen PCR purification kit as per the recommended protocol. Nucleic acid sequences for DXSs from E. coli and B. subtilis were obtained from GenBank. E. coli DXS was amplified from genomic DNA. B. subtilis DXS was amplified from a codon optimized (C. necator) synthetic operon purchased from Eurofins MWG.
[0085] PCR products were generated with Merck Millipore KOD polymerase and an annealing temperature of 55 C. and using primers 17-20 (see Table 1) and purified by gel extraction using the Qiagen Gel Extraction kit and the recommended protocol. The purified DNA fragments were then used in a Gibson assembly with the Sad digested and purified pBBR1-ISPS and individual ligations transformed to E. coli NEB5a. Clones were verified via a combination of colony PCR with Taq polymerase (NEB) and sequencing with primers 21 to 23 (see Table 1). Single verified constructs representing each DXS coupled to ISPS were designated pBBR1-EC DXS-ISPS and pBBR1-BS DXS-ISPS.
Example 5: Vector Preparation and Transference to C. Necator H16 phaCAB
[0086] Vectors pBBR1-EC DXS-ISPS and pBBR1-BS DXS-ISPS were prepared from their respective NEB5 hosts using the Qiagen Midi prep kit and appropriate culture volumes. A C. necator H16 strain with the phaCAB gene locus knocked out (phaCAB) was grown to mid/late exponential phase in tryptic soy broth (TSB) media at 30 C. Cells were made competent with glycerol washes and used immediately. Competent cells were transformed with at least 1 g of vector DNA via electroporation and recovered in TSB medium. Transformants were identified on TSB agar with 10 g/ml tetracycline. Single transformants representative of each DXS-ISPS clone were further examined.
Example 6: Fermentation
[0087] Fermentations were by continuous cultivation with cell dilution rate of D=0.05 h.sup.1 and employed cell retention. Limitation was on phosphate with feeds being supplied at a total of 120 g/h. The pH was controlled at 6.60.05 and temperature at 30 C. DO (dissolved oxygen) is maintained by traditional methods such as cascading to the mixing speed and/or controlling oxygen/air sparge. Alternatively, DO is maintained using methods employed for gas fermentations. The DO uses three systems; (i) controlling the airflow and DO directly below 10% through an autotrophic start-up phase followed by (ii) bespoke off-gas control whereby an off-gas controller cascades to DO and sparge below a 5% DO setpoint. Alternatively, (iii) the DO can be controlled by a pre-determined gas blend below the flammability limits that is sparged and may be recirculated in the system. In such an approach oxygen/air can be supplemented to maintain DO required for growth and productivity.
[0088] The mass of the cultivations was maintained at 1.1 kg by removal of the permeate. The vectors were maintained by the addition of Tetracycline Hydrochloride at 20 g/ml to the feeds and media. Fermentations were inoculated by 100 g shake flask culture grown on a rich media at 30 C. (15 g/L Neutralized soya peptone and 5 g/L Yeast extract) into 1 kg of fermentation media. Broth samples were taken during the course of the fermentation, 2 mL being analyzed for isoprene by GC-MS headspace analysis. Induction was by 0.2% w/v Arabinose. Fermentation media and feed are shown in Table 3 and components of the trace metal solution are shown in Table 4.
TABLE-US-00003 TABLE 3 Mineral phosphate Initial feed (100 feed (pH 7) Charge g/h) (20 g/h) Main components g/kg g/kg g/kg Citric acid 0.5 KH.sub.2PO.sub.4 0.383 0.953 Na.sub.2HPO.sub.4 0.383 1.556 (NH.sub.4).sub.2SO.sub.4 1.24 1.24 MgSO.sub.47H.sub.2O 0.5 0.5 CaCl.sub.22H.sub.2O 0.01 0.01 Fe(NH.sub.4)-citrate 0.05 0.05 D-Fructose 5 50 mL/kg mL/kg Trace metal solution 10 10 Vitamins g/kg g/kg Thiamine-HCl 0.01 0.001 Nicotinic acid 0.01 0.001 Ca pantothenate 0.03 0.003 Pyridoxine-HCl 0.01 0.001 Biotin 0.006 0.0006 mL/kg mL/kg Antifoam 204 0.1 0.1 Tetracycline Hydrochloride 1 1 1 (20 mg/mL) pH 6.6 with 1M NaOH/Ammonium Hydroxide
TABLE-US-00004 TABLE 4 Component Unit [g/L] ZnSO.sub.47H.sub.2O 0.1 MnCl.sub.24H.sub.2O 0.03 H.sub.3B.sub.3O.sub.3 0.3 CoCl.sub.26H.sub.2O 0.2 NiSO.sub.46H.sub.2O 0.025 Na.sub.2MoO.sub.42H.sub.2O 0.03 CuSO.sub.45H.sub.2O 0.015 pH 2 with HCl Made up to volume with deionised water
Example 7: GC MS-Based Cupriavidus necator In Vivo Isoprene Assay
[0089] To test Cupriavidus necator strains, DXS+/ISPS+, DXS/ISPS+, DXS/ISPS, 20 ml Tryptic Soy Broth without dextrose (TSB-D) medium supplied with respective antibiotics were inoculated for each strain in 250 ml flasks and incubated at 30 C. for 48 hours with 230 rpm shaking. These pre-cultures were used to inoculate (1:50) 50 ml cultures in 250 ml flasks (TSB-D with antibiotics) and incubation followed for 7 hours after which time the cultures were induced with 1% arabinose and left again overnight at 30 C. at 230 rpm. Cultures were harvested (20 min, RT, 6000G) and the produced wet cell weight (WCW) was estimated. Cell pellets were subsequently resuspended in fresh TSB-D medium supplemented with antibiotic and inducer to achieve final cell density preferably 0.2 g WCW/ml. 2 ml of fresh TSB-D medium with antibiotic and inducer were distributed in duplicate to clean GC vials. 20 l of the respective cell suspensions were used to inoculate the medium directly in the GC vials. The vials were closed and incubated 24 h at 30 C. with 160 rpm. Samples were analyzed with GC MS for the presence of isoprene. Results are shown in Table 5.
TABLE-US-00005 TABLE 5 strain isoprene detected [ppm] std dev DXS+/ISPS+ 1.709 0.156 DXS/ISPS+ 0.082 0.002 DXS/ISPS 0.011 0.002
Example 8: Stock Solution of Isoprene and Standards
[0090] 1000 ppm of Isoprene in methanol was prepared in ice. The 20, 100, 200, 300 and 600 ppm standards were also prepared in methanol on ice. 1990 ul of broth spiked with 10 ul Isoprene in methanol to give the corresponding:
[0091] 0.1 ppm (10 ul of 20 ppm)
[0092] 0.5 ppm (10 ul of 100 ppm)
[0093] 1.0 ppm (10 ul of 200 ppm)
[0094] 1.5 ppm (10 ul of 300 ppm)
[0095] 3.0 ppm (10 ul of 600 ppm)
[0096] 5.0 ppm (10 ul of 1000 ppm)
Example 9: GCMS Equipment and General Conditions
[0097] Two GCMS Agilent equipment were used.
[0098] The gas chromatograph 7890A (Agilent) equipped with an electronically controlled split/split-less injection port was interfaced to a single quadropule 5975C inert XLMSD (Agilent) with Triple Axis detector with an electron impact ionization chamber. The instrument was equipped with a MultiPurposeSampler MPS (Gerstel) equipped with Head Space (HS) injection mono head device with a 2.5 ml syringe (010055-025-00, Gerstel). GC separation was performed on DB-624 capillary column, 30 m, 0.25 mm i.d., 0.25 m film thickness, for dimensions (122-1334, J&W Scientific, Agilent). The gas chromatograph 7890A (Agilent) equipped with an electronically controlled split/split-less injection port was interfaced to a single quadropule 5977A MSD (Agilent) detector with an electron impact ionization chamber. The instrument was equipped with a MultiPurposeSampler MPS (Gerstel) equipped with Head Space (HS) injection dual head device with a 2.5 ml syringe (010055-025-00, Gerstel). GC separation was performed on DB-624 capillary column, 60 m, 0.25 mm i.d., 0.25 m film thickness, for dimensions (122-1364, J&W Scientific, Agilent).
The liners used were Ultra Inert glass. (5190-3983, Agilent). The septa used was Premium Inlet (5183-4757, Agilent). Liner and septa were replaced before each analytical run.
[0099] Helium was the carrier gas with a constant flow of 2 ml/min. The initial pressure was constant but increasing along the chromatographic run. The septum purge flow was 3 ml/min and the gas saver was on at 20 ml/min after 2 minutes.
[0100] The MS transfer line temperature was held at 260 C. Mass spectrometer was set with a set an electron impact ionization energy of 70 eV. The instrument was tuned daily with PFTBA to check its performance and quality of signal. The tune file was selected as atune.u from the corresponding tuning folder.
Agilent Chemstation and/or Mass Hunter were the acquisition software used for data collection/processing. A summary of GCMS specific conditions is provided in Tables 6A through 6C.
TABLE-US-00006 TABLE 6A GCMS CONDITIONS (7890A-5975C) MPS Gerstel PARAMETER VALUE Carrier Gas Helium at constant flow (2.0 ml/min) Injector Split ratio 1:10 Temperature 150 C. Detector Source Temperature 230 C. Quad Temperature 150 C. Interface 260 C. Gain 2 Scan Range m/z 28-200 Threshold 150 Scan Speed 4 2{circumflex over ()}2(A/D samples) Sampling Rate 2{circumflex over ()}n = 2{circumflex over ()}2 Mode SCAN and SIM Solvent delay * 1.83 min Oven Temperature Initial T: 40 C. 3.1 min Oven Temperature Initial T: 40 C. 3.1 min Oven Ramp 120 C./min to 260 C. for 5 min Injection volume 500 l from the Head Space Gas saver On after 2 min Range 0.1 ppm-5.0 ppm GC Column DB-624 30 m 250 m 1.4 m
TABLE-US-00007 TABLE 6B GCMS CONDITIONS (7890B-5977A) MPS Gerstel PARAMETER VALUE Carrier Gas Helium at constant flow (2.0 ml/min) Injector Split ratio Splitless Temperature 250 C. Detector Source Temperature 230 C. Quad Temperature 150 C. Interface 260 C. Gain 2 Scan Range m/z 28-200 Threshold 150 Scan Speed 4 2{circumflex over ()}2(A/D samples) Sampling Rate 2{circumflex over ()}n = 2{circumflex over ()}2 Mode SCAN and SIM Solvent delay * 5.50 min Oven Temperature Initial T: 40 C. 7.5 min Oven Ramp 120 C./min to 260 C. for 5 min Injection volume 500 l from the Head Space Gas saver On after 2 min Range 0.1-5.0 ppm GC Column DB-624 60 m 250 m 1.4 m
TABLE-US-00008 TABLE 6C Ions monitored in Compound SIM Mode (m/z) Isoprene 39, 53, 67 Ions monitored for Isoprene on SIM mode