Compositions and methods for detecting a neoplasia

10167513 ยท 2019-01-01

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention provides compositions and methods for detecting a neoplasia (e.g., pancreatic cancer, lung cancer, colon cancer) in a subject sample (e.g., serum, blood, plasma, tissue). In particular embodiments, the invention provides methods for detecting BNC1 and ADAMTS1 promoter methylation in circulating DNA in serum.

Claims

1. A method of identifying and treating a subject, the method comprising: (a) obtaining a biological sample from the subject; (b) isolating genomic DNA from the biological sample; (c) bisulfite treating the genomic DNA; (d) PCR amplifying the bisulfite-treated genomic DNA to obtain one or more PCR products; (e) hybridizing the one or more PCR products to a fluorescently labeled oligonucleotide comprising SEQ ID NOS: 19 or 20 for detection of methylated nucleotides of the BNC1 gene promoter or exon 1, thereby forming a first PCR product-fluorescently labeled oligonucleotide probe complex; (f) hybridizing the one or more PCR products to a fluorescently labeled oligonucleotide comprising SEQ ID NOS: 9 or 10 for detection of methylated nucleotides of the ADAMTS1 gene promoter or exon 1, thereby forming a second PCR product-fluorescently labeled oligonucleotide probe complex; and (g) detecting an elevated level of the first PCR product fluorescently labeled oligonucleotide complex as compared to a first reference level obtained in a sample previously obtained from the subject and detecting an elevated level of the second PCR product-fluorescently labeled oligonucleotide complex relative to a second reference level obtained in a sample previously obtained from the subject, and (h) administering an epigenetic therapy or resecting the pancreas of the subject having an elevated level of the first and second PCR products detected in step (g), wherein the epigenetic therapy is selected from the group consisting of entinostat, SAHA (suberovlanilide hvdroxamic acid), depsipeptide, azocvtidine, and deazocytidine.

2. The method of claim 1, further comprising detecting an alteration in the sequence or expression level of a Brca1, Brca2, p16, K-ras, APC, EGFR, and/or EML-ALK4 gene or polypeptide.

3. The method of claim 1, wherein the biologic sample is a tissue or biologic fluid sample.

4. The method of claim 1, wherein the biologic sample is selected from the group consisting of blood, serum, plasma, urine, pancreatic juice, pancreatic cyst fluid, or lung lavage.

5. The method of claim 1, wherein the methylation levels of the BNC1 and ADAMTS1 promoters are quantified.

6. The method of claim 1, wherein the subject is a smoker, has a Brca1 or Brca2 mutation, pancreatic cyst, chronic pancreatitis, presence of colon polyps or adenomas, or a family history of cancer.

7. A method for diagnosing and treating pancreatic cancer in a subject comprising: a) detecting methylated nucleotides of the BNC1 gene promoter or exon 1 using an oligonucleotide comprising SEQ ID NO: 19; b) detecting methylated nucleotides of the ADAMTS1 gene promoter or exon 1 using an oligonucleotide comprising SEQ ID NO: 9; c) detecting an elevated level of methylated nucleotides in both BNC1 and ADAMTS1 gene promoters or exon 1 nucleotides as compared to a reference level; d) diagnosing the subject as having pancreatic cancer; and e) administering an epigenetic therapy or resecting the pancreas of the patient diagnosed as having pancreatic cancer.

8. The method of claim 7, wherein the epigenetic therapy comprises an therapeutically effective amount of histone deacetylase or methylation inhibitors.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1A, 1B, and 1C show a schematic diagram, a gel, and a bar graph, respectively. FIG. 1A depicts a schematic that is a step-wise representation of the screening method used to identify epigenetic biomarkers. FIG. 1B depicts the results of methylation analysis of 8 cancer-specific genes in pancreatic cancer cell lines. M=methylation signal; U=unmethylated signal. IVD=in vitro methylated DNA. ddH.sub.2O=water control adding no DNA. FIG. 1C is a bar graph that displays the methylation frequencies of the 8 genes in a series of pancreatic cancer patients from JHU (stage 1-4; n=143), along with a series of normal pancreas from non cancerous patients (n=4), and a series of pancreatic intraductal neoplasia (PanIN) (n=20 ranging from PanIN 1-3).

(2) FIGS. 2A, 2B, and 2C depict promoter methylation gels and corresponding bar graphs, a CpG methylation diagram, and a schematic depicting methylation-on-bead (MOB) technology, respectively. FIG. 2A shows silencing of BNC1 and ADAMTS1 genes in pancreatic cancer cell lines by a methylation specific PCR (MSP) analysis of BNC1 and ADAMTS1 gene promoter regions (upper panel depicting gel bands), and the correlation of promoter methylation with gene expression by quantitative RT-PCR) in pancreatic cancer cell lines (lower panel showing data in bar graph format. M=methylation signal; U=unmethylated signal. IVD=in vitro methylated DNA. Real-time RT-PCR expression is shown as fold changeSE relative to mock-treated cells during 5 uM 5-Aza-deoxycitidine (DAC) and 300 nM Trichostatin A (TSA) treatments. FIG. 2B shows the results of bisulfite sequencing analysis of CpG islands in the BNC1 gene promoter region. The BNC1 promoter regions is depicted as a line, with CpG regions designated as vertical slashes. TIS indicates the transcriptional start site. Location of CpG sites (bisulfite priners (BST): upstream region from 331 to +36 relative to transcriptional start site). Bisulfite sequencing analysis of the BNC1 gene in Panc1 (pancreatic cancer cell line), normal pancreas tissue, pancreatic primary tumors and HCT116 (DNMT1/3b/) as a negative control. Open and filled circles represent unmethylated and methylated CpG sites, respectively, and each row represents a single clone. FIG. 2C shows step-wise illustration of the nanoas say used to detect methylation in serum. DNA extraction and bisulfite conversion are carried out using methylation-on-beads (MOB). DNA is eluted using PCR buffer, and amplified using MSP modified primers and fluorophore-labeled NTPs. Samples are analyzed using MS-qFRET or gel electrophoresis.

(3) FIG. 3 depicts plots showing the results of quantitative MSP (qMSP) analysis of BNC1 and ADAMTS1 using real-time PCR. FIG. 3 shows a statistically increased frequency of methylation when normal pancreas tissue is compared to invasive cancers. FIG. 3 also shows that BNC1 methylation could be detected at the earliest stages of pancreatic carcinogenesis (e.g. PanIN's) as compared to ADAMTS1 methylation. Normal pancreas (n=4 normal tissues, n=10 surrounding normal tissues) and Pancreatitis samples (n=30), PanIN (n=20), and tumor (stage 2; n=12), respectively. Real-time MSP is shown as fold change for Methylated signal relative to Unmethylated signal. In MSP analysis, signals for unmethylated (U) and methylated (M) DNA are shown for each sample. Horizontal bar indicates mean.

(4) FIGS. 4A, 4B, and 4C show colony formation assays, Panc1 charts and bar graphs, and MIA-PaCa2 charts and bar graphs, respectively. FIG. 4A shows colony formation by Panc1 and MIA-PaCa2 cells transfected with pcDNA3.1 or BNC1-pcDNA3.1 and grown for 2 weeks in medium containing G418. Results are plotted as the mean colony numbers relative to pcDNA3.1 transfectants in three independent experiments (Panc1; *p=0.0275, MIA-PaCa2; *p=0.0294). FIG. 4B shows graphs that summarize cell proliferation assay in Panc1 cells, while FIG. 4C shows analogous data for MIA-PaCa cells. FIGS. 4A and 4B are each divided into a right panel, a middle panel, and a left panel, which depict relevant data for Panc1 and MIA-PaCa cells, respectively. Right panel: BNC1 transfected Panc1 cells (BNC1-pcDNA3.1) were compared with control cells transfected with empty vector (pcDNA3.1). Results are plotted as the mean cells number in three different independent experiments (Panc1; *p=0.0469; 72 hrs, **p=0.0086; 96 hrs: MIA-PaCa2, *p=0.0469; 48 hrs, *p=0.0318; 72 hrs, *p=0.0389; 96 hrs). Middle panel: Cell proliferation measured by 3H-thymidine incorporation (Panc1; *p=0.0286, MIA-PaCa2; *p=0.0256). Left panel: Invasion of Panc1 and MIA-PaCa2 cells through matrigel-coated transwells relative to control cells transfected with empty vector in three independent experiments (NS: not statistically significant).

DETAILED DESCRIPTION OF THE INVENTION

(5) The invention features compositions and methods that are useful for identifying a subject as having or having a propensity to develop neoplasia (e.g., pancreatic cancer, colon cancer, lung cancer).

(6) The invention is based, at least in part, on the discovery that detection of BNC1 and ADAMTS1 promoter methylation was useful for identifying with high sensitivity the earliest stages of pancreas cancers. Notably, detection of BNC1 and ADAMTS1 promoter methylation in circulating DNA in serum was useful for the early detection of lung, colon and pancreatic cancer, especially in high risk individuals. Moreover, BNC1 is a tumor suppressor gene in pancreatic cancer that is inactivated by promoter methylation.

(7) A genome-wide transcriptome approach was used to identify new cancer specific DNA methylation alterations in pancreatic carcinoma. Methylation frequencies were analyzed for genes, BNC1 and ADAMTS1, by methylation specific PCR and quantitative methylation specific PCR, as well as expression analysis by real-time PCR and immunohistochemistry. A novel nanoparticle-enabled Methylation On Beads technology was used to detect very early stage pancreatic cancers. The biological role of BNC1 gene was examined by colony formation, cell proliferation, and invasion assays in pancreatic cancer cell lines. This analysis led to the identification of BNC1 (91.8%) and ADAMTS1 (66.7%) as genes that showed a high frequency of methylation in pancreas cancer tissues (n=143). BNC1 was frequently methylated in the earliest stages of pancreas carcinogenesis including carcinoma in situ or pancreatic intraepithelial neoplasia PanIN3 (100%) and Stage 1 invasive cancers (97.4%). Using the ultrasensitive nanoparticle-enabled MOB assay, these alterations were detected in serum samples from patients with pancreas cancer, with a sensitivity for BNC1 of 79% (95% CI: 0.6-0.8) and for ADAMTS1 of 48% (95% CI: 0.3-0.6) (n=42 cancers, Stages 1-4), while specificity was 88% for BNC1 (95% CI: 0.6-0.9) and 92% for ADAMTS1 (95% CI: 0.7-0.9) among 26 individuals without cancer. BNC1 overexpresstion in pancreatic cancer cell lines showed suppressive effect by colony formation, and cell proliferation, but not invasion.

(8) Pancreatic Cancer

(9) Pancreatic cancer is a deadly cancer with an overall 5-year survival rate of less than 5% and no improvements in survival over the last 3 decades. Pancreatic cancer currently ranks as the fourth leading cause of cancer related death in United States with an estimated 42,470 new cases and 35,240 deaths in 2009 and its incidence is rising. One of the major factors attributed to the dismal prognosis of pancreas cancer is the delayed diagnosis of the disease. Only about 10% of cases are amenable to potential curative surgical resection. However, long term 5-year survival is attainable in selected patients with early-stage pancreatic cancer who can undergo curative surgical resection. Early detection of pancreatic cancer is, therefore, thought to be the best modality for improving survival in this lethal disease. However, no screening test is available for detection of pancreatic cancer.

(10) Pancreatic cancer is characterized by multiple genetic and epigenetic changes. In recent years, it has become apparent that pancreatic cancer is as much a disease of mis-regulated epigenetics, as it is a disease of genetic mutation. In particular, changes in DNA promoter methylation patterns likely play a crucial role in tumorigenesis and cancer progression. In order to address the need for both clinical diagnostics as well as therapeutics, many studies have employed DNA methylation of specific genes for application in diagnostics of multiple cancers. Such diagnostic tests can in principle be used for early detection of cancers, for assessing prognosis, and for therapeutics as predictors of response to therapy. Early detection of disease results in an improved clinical outcome for most types of cancer (Jemal A et al. (2011) Cancer Statistics, 2010. CA Cancer J. Clin. March-April; 61(2):133-4). Therefore, much effort has been invested in developing efficient screening technologies for early detection strategies.

(11) Cancer Screening

(12) Ideally, methods for cancer screening should be easy to perform, cost-effective, noninvasive, and provide a benefit to patients. Current methods of screening for pancreatic cancer are inadequate. For example, endoscopic ultrasound has shown promise for identifying high risk patients, but requires access to specialized centers and is an expensive and invasive modality that needs to be repeated at frequent intervals. The present invention provides significant advantages over existing screening technologies for pancreatic and other cancers. Significantly, the invention provides methods for detecting BNC1 and ADAMTS1 methylation. Increased methylation in BNC1 and ADAMTS1 is associated with all stages of pancreatic cancer. BNC1 gene was methylated at 100% frequency in PanIN3, which is felt to be the penultimate step prior to development of invasive carcinoma.

(13) Interestingly, BNC1 showed a potential tumor suppressive role as measured by suppression of colony formation, cell proliferation, and invasion in pancreatic cancer cells. Methylation of BNC1 and ADAMTS1 showed high sensitivity and specificity for detecting pancreatic cancer in sera using nano-enabled methylation based technology termed Methylation-on-Beads (MOB). The results reported herein below indicate that methylation-based screening is useful for identifying subjects at risk of not only pancreatic cancer, but also, lung and colon cancers using a non-invasive inexpensive modality.

(14) While the methods of the invention are suitable for screening the population at large, it is particularly useful for screening subjects identified as at increased risk for having a neoplasia. Subjects identified as having an increased risk of neoplasia (e.g., pancreatic cancer, lung cancer, colon cancer) include but are not limited to smokers and subjects having a Brca1 or Brca2 mutation. Subjects identified as having an increased risk of pancreatic cancer include subjects identified as having pancreatic cysts or pancreatitis, as well as patients that have a family history of pancreatic cancer, particularly in 1 or 2 relatives.

(15) Types of Biological Samples

(16) The level of promoter methylation in each of the genes identified herein (e.g., BNC1 and ADAMTS1) can be measured in different types of biologic samples. In one embodiment, the biologic sample is a blood, plasma, or serum sample. In another embodiment, the sample is a tissue sample that includes cells of a tissue or organ (e.g., pancreatic cells, cells of a pancreatic cyst or pancreas lesion, lung cells, and colon cells). Pancreatic tissue is obtained, for example, from a biopsy of the pancreas. In another embodiment, the biologic sample is a biologic fluid sample (e.g., blood, blood serum, plasma, urine, stool, pancreatic cyst fluid, fluid from the major/minor pancreatic duct (i.e., pancreatic juice) lung lavage, stool, sputum, or any other biological fluid useful in the methods of the invention).

(17) Methylation-On-Beads

(18) In brief, Methylation-on-Beads is a single-tube method for polynucleotide extraction and bisulfite conversion that provides a rapid and highly efficient method for DNA extraction, bisulfite treatment and detection of DNA methylation using silica superparamagnetic particles (SSP). All steps are implemented without centrifugation or air drying that provides superior yields relative to conventional methods for DNA extraction and bisulfite conversion. SSP serve as solid substrate for DNA binding throughout the multiple stages of each process. Specifically, SSP are first used to capture genomic DNA from raw biological samples, processed biological samples or cultured cells. Sodium bisulfite treatment is then carried out in the presence of SSP without tube transfers. Finally, the bisulfite treated DNA is analyzed to determine the methylation status. DNA extraction yield was found to be 5-20 times the yield from conventional extraction. 90% of the input DNA was recovered after bisulfite treatment. In addition, Methylation-on-Beads total process time was completed in less than 6 hours when compared to 3 days for conventional methods. Hence, Methylation-on-Beads allows for convenient, efficient and contamination-resistant methylation detection in a single tube or other reaction platform. Methods for carrying out methylation-on-beads are known in the art, and described, for example, in PCT/US2009/000039, which is incorporated herein in its entirety.

(19) Methylation-Specific Quantum Dot FRET

(20) If desired, methods of the invention may be advantageously combined with methylation-specific quantum dot fluorescence resonance energy transfer (MS-qFRET). See, for example, PCT/US2009/000039, which is incorporated herein in its entirety. MS-qFRET provides for the qualitative and quantitative detection of methylated DNA, as well as for the detection of low-abundance methylated DNA. In this technique, quantum dots are used to capture methylation-specific PCR (MSP) amplicons and to determine the methylation status via fluorescence resonance energy transfer (FRET). Desirably, MS-qFRET has low intrinsic background noise, high resolution and high sensitivity. MS-qFRET detects as little as 15 pg of methylated DNA in the presence of a 10.000-fold excess of unmethylated alleles, enables reduced use of PCR (8 cycles), and allows for multiplexed analyses.

(21) More specifically, bisulfite-treated DNA is amplified through PCR, wherein the forward primer is biotinylated and the reverse primer is labeled with an organic fluorophore. Next, streptavidin-conjugated quantum dots (QDs) are introduced to capture the labeled PCR products via streptavidin-biotin binding, bringing the QDs (serving as donors) and fluorophores (serving as acceptors) in close proximity allowing FRET to occur. Finally, PCR products are detected by emissions of fluorophores accompanied by quenching of QDs. Spectral information is processed to determine the level of DNA methylation. Fluorescence responses are measured using a fluorospectrometer.

(22) PCR with labeled primers is run. Products are then subject to PCR purification (Qiagen Corporation) in order to recover PCR product that is free of primers, primer-dimers, Taq and dNTPs. For conjugating with quantum dots (Invitrogen Corporation), 1 L of 100 mM NaCl is mixed with 7 L PCR mix. 1 L of deionized (DI) H.sub.2O is added to this mix. Finally, 1 L of 1 nM QD is added and the mixture is left undisturbed for 15 minutes.

(23) Mixtures of defined methylation levels ranging from 100%, 75%, 50%, 25%, and 1% of the total 150 ng input DNA are obtained. To quantify the level of methylation, a q-score: a score that is based on the normalized FRET efficiencies of acceptor and donor emission in MS-qFRET is defined. In any FRET process, as the level of the acceptor emission increases, the decay of donor emission increases as well. The FRET efficiency can then be calculated based on the proximity ratio formalism,

(24) E = I A I A + I D
(I.sub.D and I.sub.A corresponding to donor and acceptor intensity). Further, the q-score was determined by normalizing the calculated E for the DNA mixture to an appropriate concentration of IVD only as a methylated control (q-score=1) and NL only and as an unmethylated control (q-score=0). By including positive and negative controls in every assay a standard curve is created in order to quantify and compare methylation levels of unknown samples using low-amplification cycles.
Diagnostic Assays

(25) The present invention provides a number of diagnostic assays that are useful for the identification or characterization of a neoplasia (e.g., pancreatic cancer, lung cancer, colon cancer). In one embodiment, a neoplasia is characterized by quantifying or determining the methylation level of one or more of the following promoters: BNC1 and ADAMTS1 in the neoplasia. In one embodiment, methylation levels are determined using quantitative methylation specific PCR (QMSP) to detect CpG methylation in genomic DNA. QMSP uses sodium bisulfate to convert unmethylated cytosine to uracil. A comparison of sodium bisulfate treated and untreated DNA provides for the detection of methylated cytosines.

(26) While the examples provided below describe methods of detecting methylation levels using QMSP, the skilled artisan appreciates that the invention is not limited to such methods. Methylation levels are quantifiable by any standard method, such methods include, but are not limited to real-time PCR, Southern blot, bisulfite genomic DNA sequencing, restriction enzyme-PCR, MSP (methylation-specific PCR), methylation-sensitive single nucleotide primer extension (MS-SNuPE) (see, for example, Kuppuswamy et al., Proc. Natl Acad. Sci. USA, 88, 1143-1147, 1991), DNA microarray based on fluorescence or isotope labeling (see, for example, Adorjan Nucleic Acids Res., 30: e21 and Hou Clin. Biochem., 36:197-202, 2003), mass spectroscopy, methyl accepting capacity assays, and methylation specific antibody binding. See also U.S. Pat. Nos. 5,786,146, 6,017,704, 6,300,756, and 6,265,171.

(27) The primers used in the invention for amplification of the CpG-containing nucleic acid in the specimen, after bisulfite modification, specifically distinguish between untreated or unmodified DNA, methylated, and non-methylated DNA. Methylation specific primers for the non-methylated DNA preferably have a T in the 3 CG pair to distinguish it from the C retained in methylated DNA, and the compliment is designed for the antisense primer. Methylation specific primers usually contain relatively few Cs or Gs in the sequence since the Cs will be absent in the sense primer and the Gs absent in the antisense primer (C becomes modified to U(uracil) which is amplified as T(thymidine) in the amplification product).

(28) The primers of the invention embrace oligonucleotides of sufficient length and appropriate sequence so as to provide specific initiation of polymerization on a significant number of nucleic acids in the polymorphic locus. Specifically, the term primer as used herein refers to a sequence comprising two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and most preferably more than 8, which sequence is capable of initiating synthesis of a primer extension product, which is substantially complementary to a polymorphic locus strand. The primer must be sufficiently long to prime the synthesis of extension products in the presence of the inducing agent for polymerization. The exact length of primer will depend on many factors, including temperature, buffer, and nucleotide composition. The oligonucleotide primer typically contains between 12 and 27 or more nucleotides, although it may contain fewer nucleotides. Primers of the invention are designed to be substantially complementary to each strand of the genomic locus to be amplified and include the appropriate G or C nucleotides as discussed above. This means that the primers must be sufficiently complementary to hybridize with their respective strands under conditions that allow the agent for polymerization to perform. In other words, the primers should have sufficient complementarity with the 5 and 3 flanking sequences to hybridize therewith and permit amplification of the genomic locus. While exemplary primers are provided herein, it is understood that any primer that hybridizes with the target sequences of the invention are useful in the method of the invention for detecting methylated nucleic acid.

(29) In one embodiment, methylation specific primers amplify a desired genomic target using the polymerase chain reaction (PCR). The amplified product is then detected using standard methods known in the art. In one embodiment, a PCR product (i.e., amplicon) or real-time PCR product is detected by probe binding. In one embodiment, probe binding generates a fluorescent signal, for example, by coupling a fluorogenic dye molecule and a quencher moiety to the same or different oligonucleotide substrates (e.g., TaqMan (Applied Biosystems, Foster City, Calif., USA), Molecular Beacons (see, for example, Tyagi et al., Nature Biotechnology 14(3):303-8, 1996), Scorpions (Molecular Probes Inc., Eugene, Oreg., USA)). In another example, a PCR product is detected by the binding of a fluorogenic dye that emits a fluorescent signal upon binding (e.g., SYBR Green (Molecular Probes)). Such detection methods are useful for the detection of a methylation specific PCR product.

(30) The methylation level of BNC1 and/or ADAMTS1 promoters described herein defines the methylation profile of a neoplasia. The level of methylation present at any particular promoter is compared to a reference. In one embodiment, the reference is the level of methylation present in a control sample obtained from a patient that does not have a neoplasia. In another embodiment, the reference is a baseline level of methylation present in a biologic sample derived from a patient prior to, during, or after treatment for a neoplasia. In yet another embodiment, the reference is a standardized curve.

(31) The methylation level of any one or more of the promoters described herein (e.g., BNC1 and ADAMTS1) is used, alone or in combination with other standard methods, to characterize the neoplasia. For example, methods for detecting BNC1 or ADAMTS1 promoter methylation may be carried out prior to or concurrently with testing for alterations in other biomarkers, such as BRCA1, p16, K-ras, APC, PalB2, DPC4, EGFR, EML-ALK4 gene or polypeptide. In one embodiment, the alteration in a Brca1, p16, K-ras, APC, PalB2, DPC4, EGFR, EML-ALK4 gene is a mutation in the sequence of the gene relative to a reference. In other embodiments, the alteration is in the level of expression or activity of the Brca1, p16, K-ras, APC, PalB2, DPC4, EGFR, or EML-ALK4 gene or polypeptide. Once a subject is identified as having increased BNC1 or ADAMTS1 promoter methylation, further diagnostic testing may be carried out to localize the pathology to a particular organ or organ system. Typically, after the subject has been identified as having increased promoter methylation in BNC1 and ADAMTS1, imaging studies are carried out. Such studies include, but are not limited to, endoscopic ultrasound, MRI, CT scan, and PET scan.

(32) If desired, diagnostic methods of the invention can be combined with conventional diagnostic methods used to determine the stage or grade of a neoplasia. Grading is used to describe how abnormal or aggressive the neoplastic cells appear, while staging is used to describe the extent of the neoplasia. The grade and stage of the neoplasia is indicative of the patient's long-term prognosis (i.e., probable response to treatment and survival). Thus, the methods of the invention are useful for predicting a patient's prognosis, and for selecting a course of treatment.

(33) In conventional diagnostic methods, a pathologist will view a tissue sample from the tumor and determine the grade based on the degree of pathology observed. Typically, pancreatic tumors are graded from 1-4. For a grade I tumor, cells present in the sample are most similar to normal pancreatic cells. Grade 4 samples contain cells that are most dissimilar to normal pancreatic cells. High-grade neoplasias are the most deadly because they are most aggressive and fast growing. High-grade neoplasias typically move rapidly into surrounding tissues, such as lymph nodes and bones.

(34) Stage refers to the extent of a cancer. In pancreatic cancer, for example, one staging method divides the cancer into four categories, stage I pancreatic cancer is found only in the pancreas itself or has started to spread to the tissues next to the pancreas (such as the small intestine, the stomach, or the bile duct). Stage II pancreatic cancer has spread to nearby organs such as the stomach, spleen, or colon, but has not entered the lymph nodes. Stage III pancreatic cancer has spread to the lymph nodes near the pancreas. Cancer may have spread to nearby organs. Stage 1V pancreatic cancer has spread to organs near the pancreas (stage IVA) or to organs far away from the pancreas (stage IVB). Stage IVA pancreatic cancer has spread to organs that are near the pancreas (such as the stomach, spleen, or colon) but has not spread to distant organs (such as the liver or lungs). Stage IVB pancreatic cancer has spread to distant organs (such as the liver or lungs).

(35) Selection of a Treatment Method

(36) Identifying the presence of increased promoter methylation in BNC1 and ADAMTS1, indicates that the subject likely has an invasive cancer or a pre-cancerous lesion (e.g., cancer-in-situ). Further diagnostic testing may be carried out to localize the pathology to a particular organ or organ system. For example, endoscopic ultrasound, MRI, CT scan, PET scan, bronchoscopy, colonoscopy, esophagogastroduodenoscopy, laparoscopic surgery to localize a lesion or any other modality known in the art may be used to characterize the neoplasia or pre-cancerous lesion (e.g. PanIN's, or precursor lung conditions such as dysplasia, carcinoma in situ, atypical adenomatous hyperplasia or precursor colonic lesions such as adenomas). Pre-cancerous lesions are likely to be susceptible to conservative treatment methods. Conservative treatment methods include, for example, cancer surveillance, which involves periodic patient monitoring using diagnostic assays of the invention, alone or in combination, with diagnostic imaging or chemoprevention.

(37) More aggressive neoplasias are less susceptible to conservative treatment methods. For aggressive neoplasias, an aggressive method of treatment should be selected. Aggressive therapeutic regimens typically include one or more of the following therapies: surgical resection, radiation therapy, and chemotherapy. After a subject is diagnosed as having a neoplasia (e.g., prostate cancer, lung cancer, colon cancer) a method of treatment is selected. Where the methods of the invention identify a subject as having a neoplasia associated with increased promoter methylation in BNC1 and ADAMTS1, therapy to reduce this promoter methylation may be selected. For example, epigenetic therapy may be selected to relieve promoter methylation in BNC1 and ADAMTS1. Such epigenetic therapy may involve the use of histone deacetylase inhibitors or methylation inhibitors. Exemplary agents include, but are not limited to, entinostat, SAHA (suberoylanilide hydroxamic acid), depsipeptide (Fujisawa Pharmaceuticals), azocytidine, deazocytidine, romidepsin (Istodax), Vorinostat, polyamine analogues, zebularine and other novel emerging drugs targeting methylation, histone changes or the entire polycomb complex. Epigenetic therapy may be combined with more conventional therapies.

(38) Patient Monitoring

(39) The diagnostic methods of the invention are also useful for monitoring the course of a pre-cancerous lesion in a patient or for assessing the efficacy of a therapeutic regimen. In one embodiment, the diagnostic methods of the invention are used periodically to monitor the methylation levels of BNC1 and/or ADAMTS1. In one example, the neoplasia is characterized using a diagnostic assay of the invention prior to administering therapy. This assay provides a baseline that describes the methylation level of one or more promoters or the methylation profile of the neoplasia prior to treatment. Additional diagnostic assays are administered during the course of therapy to monitor the efficacy of a selected therapeutic regimen. A therapy is identified as efficacious when a diagnostic assay of the invention detects a decrease in methylation levels at one or more promoters relative to the baseline level of methylation.

(40) Kits

(41) The invention also provides kits for the diagnosis or monitoring of a neoplasia in a biological sample obtained from a subject. In various embodiments, the kit includes at least one primer or probe whose binding distinguishes between a methylated and an unmethylated BNC1 and ADAMTS1 promoter sequence, together with instructions for using the primer or probe to identify a neoplasia. In another embodiment, the kit further comprises a pair of primers suitable for use in a polymerase chain reaction (PCR). In yet another embodiment, the kit further comprises a detectable probe. In yet another embodiment, the kit further comprises a pair of primers capable of binding to and amplifying a reference sequence. In yet other embodiments, the kit comprises a sterile container which contains the primer or probe; such containers can be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister-packs, or other suitable container form known in the art. Such containers can be made of plastic, glass, laminated paper, metal foil, or other materials suitable for holding nucleic acids. The instructions will generally include information about the use of the primers or probes described herein and their use in diagnosing a neoplasia. Preferably, the kit further comprises any one or more of the reagents described in the diagnostic assays described herein. In other embodiments, the instructions include at least one of the following: description of the primer or probe; methods for using the enclosed materials for the diagnosis of a neoplasia; precautions; warnings; indications; clinical or research studies; and/or references. The instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate sheet, pamphlet, card, or folder supplied in or with the container.

(42) The following examples are offered by way of illustration, not by way of limitation. While specific examples have been provided, the above description is illustrative and not restrictive. Any one or more of the features of the previously described embodiments can be combined in any manner with one or more features of any other embodiments in the present invention. Furthermore, many variations of the invention will become apparent to those skilled in the art upon review of the specification. The scope of the invention should, therefore, be determined not with reference to the above description, but instead should be determined with reference to the appended claims along with their full scope of equivalents.

(43) It should be appreciated that the invention should not be construed to be limited to the examples that are now described; rather, the invention should be construed to include any and all applications provided herein and all equivalent variations within the skill of the ordinary artisan.

(44) The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook, 1989); Oligonucleotide Synthesis (Gait, 1984); Animal Cell Culture (Freshney, 1987); Methods in Enzymology Handbook of Experimental Immunology (Weir, 1996); Gene Transfer Vectors for Mammalian Cells (Miller and Calos, 1987); Current Protocols in Molecular Biology (Ausubel, 1987); PCR: The Polymerase Chain Reaction, (Mullis, 1994); Current Protocols in Immunology (Coligan, 1991). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.

(45) The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the assay, screening, and therapeutic methods of the invention, and are not intended to limit the scope of what the inventors regard as their invention.

EXAMPLES

Example 1: Identification of Cancer-Specific Promoter Methylation Candidate Genes in Pancreas Hypermethylome

(46) In order to identify new DNA methylation biomarkers for pancreatic cancer, previously established whole human transcriptome microarray screening was used to identify genes silenced by promoter hypermethylation. To identify global hypermethylation-dependent gene expression changes in pancreatic cancer, a genome-wide expression array-based approach was performed in four different human pancreatic cancer cell lines (PL45, MIA-PaCa2, Panc1, and Capan1) with a pharmacologic strategy using 5-aza-deoxycycytidine and Trichostatin A (TSA) using standard array-based methodology (e.g. Agilent Technologies 44K). As seen in FIG. 1A, a total of 1,427 unique genes were initially identified in four cell lines, which met the criteria for candidate hypermethylated genes in the pancreatic cancer cell lines.

(47) In order to identify genes that only showed cancer specific methylation, the following experimental validation criteria was used: 1) the gene was expressed in normal pancreas tissue, 2) the gene displayed no/low methylation in normal pancreatic tissues (cancer-free tissues), and 3) the gene was frequently methylated in pancreas cancer cell lines, and methylation was also seen in primary tumors. Based on these criteria, 8 genes (TFPI2, ASCL2, BNC1, TWIST1, BNIP3, ADAMTS1, PNMT, and EVL) were identified that displayed cancer-specific methylation in pancreatic cancers.

Example 2: BNC1 and ADAMTS1DNA Methylation Biomarkers for Early Detection of Pancreatic Cancer

(48) Next, the methylation status of these 8 genes (TFPI2, ASCL2, BNC1, TWIST1, BNIP3, ADAMTS1, PNMT, and EVL) was examined in a large series of primary pancreatic tumor samples (n=143; Stages 1-4) using methylation specific PCR (see Table 1).

(49) TABLE-US-00005 TABLE 1 Clinical information of pancreas cancer patient primary tumor samples in this study Pancreas Primary tumors Normal PanINs Stage 1 Stage 2 Stage 3 Stage 4 (n = 4) (N = 20) (N = 38) (N = 78) (N = 5) (N = 2) Median Survival Not Met 43.0 18.0 14.1 19.6 (months) Gender Male 3(75%) 9 (45%) 9 (23.7%) 44 (57%) 1 (20%) 2 (100%) Femal 1925%) 11 (55%) 29 (76.3%) 34 (43%) 4 (80%) 0.0% Grade Well- 9 (45%) 3 (7.9%) .sup.4 (5.1%) 1 (20%) 0 (0%) Moderately 8 (40%) 23 (60.5%) 41 (52%) 4 (40%) 1 (50%) Poorly 3 (15%) 12 (31.6%) .sup.33 (42.9%) 4 (40%) 1 (50%)

(50) As shown in FIG. 1B, the most frequently methylated gene was BNC1 (90.5%), followed by ADAMTS1 (66.7%), TWIST1 (66.7%), ASCL2 (53.79%), BNIP3 (49%), TFPI2 (53.7%,) EVL (46.3%), and PNMT (26.5%). Interestingly, two of the genes that demonstrated frequent methylation in this cohort of primary pancreatic cancer samples, BNC1 (90.5%) and ADAMTS1 (66.7%), also showed frequent methylation in the precursor lesions of pancreatic cancer, pancreatic intraepithelial neoplasia (PanIN) lesion. Specifically, BNC1 methylation frequency was 70% (n=14/20) and ADAMTS1 methylation frequency was 25% (n=5/20).

(51) The ability to identify high grade precursor lesions such as PanIN3 (or pancreatic carcinoma in situ) represents one of the best means for achieving early detection of pancreatic cancer, and facilitating the implementation of chemoprevention strategies (see FIG. 1C). BNC1 was methylated in PanIN 1 (56%), PanIN 2 (75%), and PanIN 3 (100%) during PanIN progression. This data indicated that DNA methylation of BNC1 gene is an early event in pancreatic carcinogenesis and that the prevalence of methylation increases with pancreatic cancer progression.

(52) This genome-wide DNA hypermethylome screening is based on a pharmacological approach using 5-deoxy-azacytidineand TSA, which has shown an excellent correlation between promoter DNA methylation and inhibition of gene expression and re-expression after treatment with a DNA demethylating drug, such as 5-deoxy-azacytidine, in prior studies on breast and colorectal cancer. Here, promoter methylation of BNC1 and ADAMTS1 was tested, and correlated with a lack of gene expression in pancreatic cancer cell lines (Panc1, MIA-PaCa2, Capan1, and PL45) using quantitative RT-PCR (qRT-PCR) (FIG. 2A, upper panel). Both genes showed virtually undetectable (or no/low) endogenous gene expression, and significant re-expression after 5-deoxy-azacytidine treatment. As shown in FIG. 2A, lower panel, treatment with a histone deacetylase inhibitor, such as TSA, resulted in minimal re-expression, except in the case of PL45, which may be regulated both by promoter DNA methylation and histone modifications. Promoter-associated CpG island methylation in the BNC1 promoter was detected by bisulfite sequencing analysis in pancreatic cancer cell line (Panc1), a primary pancreas cancer sample (stage 2), and normal pancreatic tissue. As shown in FIG. 2B, bisulfite sequencing analysis showed dense methylation in the pancreatic cancer cell line and the primary pancreatic cancer and minimal/no methylation in normal pancreas samples consistent with the methylation specific PCR analysis.

Example 3: Detection of DNA Methylation in Pancreatic Cancer Patient Sera Using Methylation on Beads Technology

(53) Early detection of disease results in an improved clinical outcome for most types of cancer. This is particularly relevant for pancreatic cancer, which is poorly accessible and difficult to diagnose. Consequently, 90% of patients with pancreatic cancer present with metastatic or advanced regional disease. Based on the methylation studies, BNC1 and ADAMTS1 have emerged as important biomarkers for the early detection of pancreatic cancer. To determine whether BNC1 and ADMTS1 promoter DNA methylation could be detected in pancreatic cancer patient sera, a highly-sensitive nanoenabled assay, termed methylation on Beads was used, which was developed to improve sensitivity of methylation detection (see, e.g., FIG. 2C). To test the utility of methylation on beads as a tool for early detection of pancreatic cancers, serum samples from a series of pancreatic cancer patients (n=42; stages 1-4), as well as a panel of normal healthy serum samples (n=26) was tested. Sensitivity was determined based on the assumption that all patients with cancer would be methylated for both genes, while all healthy normal volunteers would be unmethylated for both genes. Methylation was analyzed in 42 serum samples from pancreatic cancer patients and 26 normal volunteers. 33 of the 42 pancreatic cancer patients showed methylation for BNC1, while 20 of the 42 showed methylation for ADAMTS1 (see Table 2).

(54) Overall, for all stages included, the sensitivity for BNC1 and ADAMTS1 was determined to be 78.6% and 47.6%, respectively. Sensitivity of detection of stage I pancreatic cancers was 90% for both genes. Amongst the 26 normal serum samples, 3 of the normal volunteers showed methylation for BNC1 while 2 showed methylation for ADAMTS1. Specificity of detection was determined to be 88.4% for BNC1 and 92.4% for ADAMTS1. Computed results have been presented using a 95% confidence interval and are presented in detail in Table 2. Results in the corresponding tumor were higher for both genes, with 100% sensitivity and specificity for BNC1 and 79.2% sensitivity and 100% specificity for ADAMTS1.

(55) Additionally, the sensitivity and specificity of BNC1 and ADAMTS1 was also tested in other types of cancer, including both colon cancer and lung cancer (Table 2). This data showed that BNC1 was also a useful biomarker for the detection of early stages of colon cancer. For example, BNC1 showed a sensitivity of 84.6% (n=11/13) for stage 1 colon cancers and advanced adenomas. Similarly, BNC1 also showed good sensitivity for the detection of early stage lung cancer as stage 1 lung cancer was detected with a sensitivity of 75% (n=12/16).

(56) TABLE-US-00006 TABLE 2 Sensitivity and specificity of BNC1 and ADAMTS1 genes in various cancer patient sera samples BNC1 ADAMTS1 Sensitivity(%) Cancer Types: Estimated Value 95% CI Estimated Value 95% CI Pancreatic Cancer Stage N I 10 90.0% (9/10) 90.0% (9/10) II-IV 32 75.0% (24/32) 34.4% (11/32) Total 42 78.6% (33/42) 60-90% 47.6% (20/42) 40-70% Colon Cancer Stage Adenomas, stage I 13 84.6% (11/13) 61.5% (8/13) II-III 15 66.7% (10/15) 73.3% (11/15) Other cancer* 2 100.0% (2/2) 50.0% (1/2) Total 30 76.7% (23/30) 70-90% 66.7% (20/30) 40-70% Lung Cancer Stage I 16 75.0% (12/16) 62.5% (10/16) II-III 4 100.0% (4/4) 100.0% (4/4) Total 20 80.0% (16/20) 60-90% 70.0% (14/20) 50-90% Normal Specificity 26 88.4% 70-90% 92.4% 70-90% CI: Confidential Interval. *other colorectal malignancies.

(57) A subset of tissue samples from patients diagnosed with non-cancerous pancreatic diseases, such as pancreatitis, was collected and analyzed. Patients with chronic pancreatitis maybe at increased risk for pancreatic cancer and amongst patients with pancreatic cancer, 5% or more of patients have underlying chronic pancreatitis. Chronic inflammatory conditions likely increases the frequency of methylation as a field defect which may then increase risk of subsequent malignancy. The methylation of BNC1 and ADMATS1 DNA was compared between different conditions (normal, pancreatitis, PanIN, and invasive cancers) using quantitative methylation specific PCR analysis. As shown in FIG. 3, BNC1 and ADAMTS1 showed statistically increased frequency of methylation when comparing normal pancreas tissues and invasive cancers (p<0.0001; both BNC1 and ADAMTS1), as well as chronic pancreatitis and invasive cancers (p<0.0001, both BNC1 and ADAMTS1). There was a low frequency of BNC1 and ADAMTS1 methylation present in non-cancerous disease, such as pancreatitis. More interestingly, there was a significant quantitative difference between PanINs and invasive cancers on both genes (p<0.001 both BNC1 and ADAMTS1). However, BNC1 methylation could be detected in the earliest stages of pancreatic carcinogenesis such as PanIN's, compared to ADAMTS1 methylation (see FIG. 3), indicating that BNC1 methylation is a very early event, and that ADMATS1 methylation is a later event during pancreas cancer development.

Example 4: Tumor Suppressive Effects of BNC1 Gene Over-Expression in Pancreatic Cancer Cells

(58) According to the methylation data in pancreatic cancer patients, BNC1 is a useful DNA methylation biomarker in pancreatic cancer patients. To determine whether BNC1 played a role as a tumor suppressor in pancreatic cancer cells, in vitro colony formation assays were performed to determine the effects of full-length BNC1 transfected into Panc1 and MIA-PaCa2 cells lacking BNC1 expression. Compared with control cells transfected with empty vector, over-expression of a full-length BNC1 gene induced a nearly 2.2-fold (Panc1) and 9-fold (MIA-PaCa2) reduction of G418-resistant colonies (see FIG. 4A). In addition, there was a 75% (Panc1) and 81% (MIA-PaCa2) decrease in cell proliferation as measured by [.sup.3H] thymidine activity (FIGS. 4B and 4C; left and middle panel). However, overexpression of BNC1 gene had no effect on Panc1 and MIA-PaCa2 cells migration and invasion through matrigel-coated transwell membranes compared with control cells transfected with empty vector (FIGS. 4B and 4C; right panel). Taken together, these data indicated that BNC1 gene has tumor-suppressive effects in human pancreatic cancer cells.

(59) In this study, genome-wide gene expression profiling using a pharmacological approach (5-deoxy-azacytidine and TSA) was used in pancreatic cancer cell lines, a platform which has been used to identify an early detection marker for colorectal cancer. Defining the DNA hypermethylome has been useful as it has allowed the identification of not only novel DNA methylation biomarker candidates, but also of tumor suppressor gene candidates in many types of cancers (colon, breast, ovarian, etc). The identified DNA methylation biomarkers will facilitate diagnostics, and also contribute to therapeutics as predictors of response to therapy.

(60) The poor accessibility of the pancreas along with the late presentation of symptoms has thwarted attempts at timely detection of malignancy, and contributed to the high mortality rates of pancreatic cancer, which is the fourth leading cause of cancer death in both men and women. Therefore, the development of cancer biomarkers of pancreatic cancer is the best hope for early detection.

(61) As reported herein above, the promoter methylation of BNC1 and ADAMTS1 is an excellent early detection biomarker for pancreatic cancer. BNC1 and ADAMTS1 have not been described as a DNA methylation biomarker in pancreatic cancers, although they have been reported methylated in lung cancers.

(62) Screening with a nanobased high sensitive technology allowed the sensitive and specific detection of pancreatic cancer in its earliest stages. Using BNC1 and ADAMTS1, provided for the detection of very early stages of pancreatic carcinoma, with an overall sensitivity of 83.7% (95% CI; 74.2-90.3%) and a specificity of 84.6% (95% CI; 64.3-95.0%). Significantly, the sensitivity achieved in this study is higher than previously reported for serum hypermethylation markers. The present invention provides a cost-effective approach for screening individuals identified as having risk factors for pancreatic cancer in the general population. Additionally, the nano-based methylation on beads detection method significantly reduced the quantity of serum necessary for analysis. The invention provides a paradigm for widespread screening for pancreatic cancers using a simple blood test.

(63) In conclusion, this is the first study to describe the utility of BNC1 and ADAMTS1 promoter methylation as biomarkers in pancreatic cancer patient serum using nanoparticle-enabled technology. In addition, this is the first report to demonstrate a tumor suppressor role for BNC1 in pancreatic cancer. These data indicate that BNC1 promoter methylation is useful as a sensitive and specific noninvasive pre-selection modality for diagnosing subjects as having cancer and identifying individuals at risk for pancreatic cancer.

(64) The results presented hereinabove were carried out using the following methods and materials.

(65) Gene Expression Microarray Analysis

(66) Total RNA was harvested from log phase cells using standard methods (e.g. with TRIzol (Invitrogen) and the RNeasy kit (Qiagen) according to the manufacturer's instructions), including a DNase digestion step. RNA was quantified using a spectrophotometer (e.g. the NanoDrop ND-100 (http://www.nanodrop.com/)) followed by quality assessment with a microfluidics analysis platform (e.g. the Agilent 2100 Bioanalyzer (Agilent Technologies, http://www.agilent.com/). RNA concentrations for individual samples were greater than 200 ng/ll, with 28S/18S ratios greater than 2.2 and RNA integrity of 10 (10 scored as the highest). Sample amplification and labeling procedures were carried out using standard methods (e.g. Low RNA Input Fluorescent Linear Amplification Kit (Agilent Technologies) according to the manufacturer's instructions). The labeled cRNA was purified using spin columns (e.g. the RNeasy mini kit (Qiagen)) and quantified. RNA spike-in controls (Agilent Technologies) were added to RNA samples before amplification. Samples (0.75 lg) labeled with Cy3 or Cy5 were mixed with control targets (Agilent Technologies), assembled on Oligo Microarray, hybridized, and processed according to the Agilent microarray protocol. Scanning was performed with a microarray scanner (Agilent G2565BA, using recommended settings). Data analysis was conducted as previously reported (Schuebel K, Chen W, Cope L, Glckner S C, Suzuki H, et al., Comparing the DNA hypermethylome with gene mutations in human colorectal cancer. 2007, PLOS Genetics, 3(9):1709-1723.

(67) Patient Samples and Study Population

(68) Patient samples were prepared from formalin-fixed, paraffin-embedded (FFPE) tissue samples from patients with pancreatic cancer procured from the pathology archives of the Johns Hopkins Hospital in accordance with all rules and regulations of the Institutional Review Board (IRB) and as per HIPAA compliance. A total of 167 patients were analyzed in the current study. The Johns Hopkins cohort consisted of 143 tissue samples from pancreatic cancer patients with stage 1 through stage 4 disease who underwent primary surgery and other treatment for pancreatic cancer at the JHH from 1998 to 2009 (Median follow up of 6.4 years). Patients in this cohort were similar by stage with respect to gender, proportion of cases with lymphovascular invasion, and pathologic grade (Table 1). An additional 20 FFPE tissue samples were obtained from patients who had undergone surgical resection but diagnosed with precancerous lesions, pancreatic intraepithelial neoplasias (PanINs). Finally, 4 FFPE tissue samples were obtained from pathology archives from patients who had undergone pancreatic resection with no abnormality noted on gross or microscopic examination.

(69) Pancreatic Cancer Patient Serum Samples

(70) Patient serum samples were obtained from individuals with pancreatic cancer prior to undergoing surgical treatment at the JHH after obtaining informed consent from 2007 to 2009. Matching tumor samples were drawn from the pathology archives of the Johns Hopkins Hospital in accordance with all rules and regulations of the Institutional Review Board (IRB) and as per HIPAA compliance. A total of 36 serum samples were tested, 23 of which had matching FFPE tissue available. Patient serum samples were also obtained from individuals with pancreas (42 samples, Stages 1-4), colon (30 samples, Stages 1-3 and adenomas) and lung cancers (20 samples, Stages 1-3) prior to undergoing surgical treatment at the JHH after obtaining informed consent. Additionally, 26 serum samples were obtained from normal, healthy volunteers to serve as controls.

(71) Cell Culture and Treatment

(72) Cancer cell lines (Pancreas cancer cell lines; Panc1, MIA-PaCa2, PL45, Capan1, Bxpc3, Capan2, PK9, Aspc 1, PK8, and PL3) were obtained from ATCC and cultured in appropriate media and under conditions described by ATCC, with media obtained from InVitrogen supplemented with 10% fetal bovine serum (Gemini Bio-Products) and 1% penicillin/streptomycin (InVitrogen). DKO cells (HCT116 colon cancer cells with genetic disruption of DNMT1 and DNMT3b) were cultured as described previously (Rhee et al., 2002, Nature).

(73) DNA Methylation Analyses and RT-PCR for Expression Analysis

(74) Primer pairs were preferentially designed near the putative transcriptional start site (TSS) in the 5 CpG islands of the genes. Primer sequences for methylation specific PCR analysis were designed using MSPPrimer (http://www.mspprimer.org). All primer sequences are listed in Table 3. For expression studies using RT-PCR, primers were designed using the open access program Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3 www.cgi).

(75) TABLE-US-00007 TABLE3 PrimersusedforMSP,RT-PCR,Bisulfitesequencinganalyses SEQ SEQ ID ID Genes Primers S(5-3) NO AS(5-3) NO ADAMTS1 Unmeth tTATTGtAAAGttAGGGTGtGtTAttGGAtG 7 aaaaCTaAaaCAACaCaaAaATTaaTaCCTaaCa 8 Meth ttAGGGTGCGtTAtCGGAC 9 TaAaaCAACGCGaAaATTaaTaCCTaaCG 10 RT tcgaagtgaaacagcggaac 11 gccgctgtacctcaagacaa 12 ASCL2 Unmeth tGtTAGGGGAtAGtGtGtttAGtttAGTtGtG 13 CaTACaCaTaaCaCaTaaCTCACaaaaAaCATCa 14 Meth GAtAGCGCGtttAGtttAGTCGC 15 TaaCGCGTaaCTCACGaaaAaCATCG 16 BNC1 Unmeth TTtGtttTTUttGGGAGAGGtAAAtAttGAtAtG 17 aaAaACCTCaCCaaCaaCCaaCa 18 Meth GtttTTtttCGGGAGAGGtAAAtAtCGAtAC 19 CCGaCGaCCGaCG 20 RT acaaaagcctggcctcatct 21 tcgccccaaatgatatgaaa 22 Bisulfite AATtATtTttTGAGAAGAGYGttAGAGAAtT 23 CCCAAaCRCCCAaaCTaC 24 Sequenc- ing BNIP3 Unmeth ttAtGttttTGtGtAtGtGtAGGttttAAGTtGtG 25 aCTCCCaaACTaAaCaaAaCCCCa 26 Meth GtACGCGtAGGttttAAGTCGC 27 CCGaACTaAaCGaAaCCCCG 28 EVL Unmeth GTGTGTTTTTTTTTTGAGGATTTGGAGTTGTTTG 29 ACCACCAAAAAATAAAAAAACAAAAAACAAACCA 30 Meth GAGGATTCGGAGTCGTTC 31 CCGAAAAATAAAAAAACGAAAAACGAACCG 32 PNMT Unmeth TGGGGGAtGATTGttGtTGtAGttG 33 CaCCaAaCCaCCCaaaaCCATaTaCa 34 Meth GGGGACGATTGtCGtTGtAGtC 35 AaCCGCCCGaaaCCATaTaCG 36 TFPI2 Unmeth CCCACATAAAACAAACACCCAAACCA 37 TGGTTTGTTGGGTAAGGTGTTTG 38 Meth GTTCGTTGGGTAAGGCGTTC 39 CATAAAACGAACACCCGAACCG 40 TWIST1 Unmeth tAGAtAttTtGtGGGtTtTGtAGtAttGGtAttG 41 aCaaaAaaaaaAaaaaACaaTaTaaATaaCCCCa 42 Meth CGGGtTtTGtAGtAtCGGtAtC 43 CGAaAaaaaaAaaaaACGaTaTaaATaaCCCCG 44

(76) For methylation-specific PCR analysis, DNA was extracted using the standard phenol-chloroform extraction method. Bisulfite modification of genomic DNA was carried out using standard protocols (e.g. with the EZ DNA methylation Kit (Zymo Research)). Methylation analysis of CAN gene (Cancer gene, as defined by Wood L D, Parsons D W, Jones S et al., The genomic landscapes of human breast and colorectal cancers, Science. 2007, 318(5853):1108-1113.) promoters was performed using MSP primer pairs located close to the putative transcriptional start site in the 5 CpG island with 2 l of bisulfite-treated DNA as template and JumpStart Red Taq DNA Polymerase (Sigma) for amplification as previously described (Herman J G, Graff J R, Myhnen S, Nelkin B D, Baylin S B., Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA. 1996 Sep. 3; 93(18):9821-9826).

(77) Total RNA was extracted from cell lines using standard methods (e.g. the RNeasy Mini Kit (Qiagen)), and treated with DNase. For reverse transcription (RT) reaction, 1 g of total RNA was subjected to the first strand cDNA synthesis using standard cDNA synthesis protocols (e.g. Superscript III first strand cDNA synthesis kit (InVitrogen) used according to the manufacturer's instructions). Expression analysis was performed by RT-PCR using 1 l of cDNA as template and standard amplification protocols (e.g. JumpStart Red Taq DNA Polymerase (Sigma)).

(78) Quantitative Methylation-Specific PCR Using Real-Time PCR

(79) Sodium bisulfite modification, which converts unmethylated cytosine residues to uracil residues, was first carried out on 1 ug genomic DNA isolated from the paraffin-embedded tissue sections using standard methylation procedures (e.g. EZ DNA methylation kit (Zymo Research Co) according to the manufacturer's instructions). For quantitative real-time analyses, standard procedures were used. For example, the Power SYBR Green PCR kit (Applied Biosystems) was used and the amplification conditions consisted of an initial 10 minute denaturation step at 95 C., followed by 40 cycles of denaturation at 95 C. for 15 seconds and annealing and extension for 30 seconds and 60 seconds, respectively. An ABI StepOnePlusReal-Time PCR System was used (Applied Biosystems), and for quantification the comparative cycle threshold (Ct) method was used, normalizing the Ct values for the indicated gene to the Ct values of Unmethylated reaction relative to a methylated reaction sample.

(80) Methylation on Beads (MOB) Method

(81) Methods and buffers used for methylation on beads extraction are as described previously (Bailey V J, Zhang Y, Keeley B P, Yin C, Pelosky K L, Brock M, Baylin S B, Herman J G, Wang T H. Single-tube analysis of DNA methylation with silica superparamagnetic beads. Clin Chem. 56(6):1022-1025). Briefly, 50 L of Protease K was added into the bottom of an eppendorf tube, and 200 L methylation on beads Binding Buffer 1 and 100 L Lysing Buffer to 200 L was added to the serum sample. The sample was incubated at 55 C. for 15 minutes (cell lines, whole blood), and 200 L 100% Isopropyl Alcohol was added, and the sample was mixed. 35 L of Magnetic Beads was then added to the sample and mixed. The tube was then placed on the magnetic holder to capture the beads, and the supernatant was discarded. The tube was removed from the magnetic holder, and the beads were washed with 500 L of Wash Buffer 1. The beads were once again captured on the magnetic holder, and then washed a second time in 500 L of Wash buffer 2. This step was then repeated one time, and the beads were again captured, and the supernatant was discarded. 50 L of Elution Buffer was added to the eppendorf tube containing the washed beads. To denature the DNA for bisulfite treatment, 6 L 2M NaOH was added to the tube, mixed, and incubated at 70 C. for 10-15 minutes. 12 L of freshly prepared hydroquinone solution was then added and mixed. 200 L of prepared NaBisulfite solution was added and mixed. The NaBisulfite solution was vortexed to insure that it was fully saturated. The sample was incubated at 65 C. for 4-6 hours, and then 120 L of 10M NaOH was added, mixed, and incubated at 50 C. for an additional 10 minutes. 350 L of methylation on beads Binding Buffer 2, 100 L of IPA was added to the sample and mixed. The beads were then captured and washed once in Wash Buffer 1 and twice in Wash Buffer 2 as described above. The beads were then captured and the supernatant discarded. The DNA was then eluted from the magnetic beads with 100 L of PCR buffer. The sample was then divided as desired for subsequent PCR amplification.

Other Embodiments

(82) From the foregoing description, it will be apparent that variations and modifications may be made to the invention described herein to adopt it to various usages and conditions. Such embodiments are also within the scope of the following claims.

(83) The recitation of a listing of elements in any definition of a variable herein includes definitions of that variable as any single element or combination (or subcombination) of listed elements. The recitation of an embodiment herein includes that embodiment as any single embodiment or in combination with any other embodiments or portions thereof.

(84) All patents and publications mentioned in this specification are herein incorporated by reference to the same extent as if each independent patent and publication was specifically and individually indicated to be incorporated by reference.