METHOD FOR PRODUCING NATURAL RUBBER BY USING RECOMBINANT MICROORGANISM

20180371501 ยท 2018-12-27

Assignee

Inventors

Cpc classification

International classification

Abstract

A method for producing natural rubber by using a recombinant microorganism is disclosed, the method comprising: (a) manufacturing an expression vector capable of expressing a gene encoding a cis-prenyltransferase, which is a guayule-derived natural rubber synthetase represented by the amino acid sequence of SEQ ID NO: 2 or a Hevea brasiliensis-derived natural rubber synthetase represented by the amino acid sequence of SEQ ID NO: 6, and an expression vector capable of expressing a gene coding for a natural rubber precursor synthetase; (b) transforming a host microorganism with the expression vector; (c) culturing the transformed host microorganism; and (d) separating natural rubber from the cultured transformed host microorganism. The natural rubber obtained by the method has a white powder form identical to that of natural rubber, and shows an FT-IR spectrum pattern extremely similar to that of natural rubber.

Claims

1. A method for producing natural rubber by using a recombinant microorganism, comprising the steps of: (a) constructing an expression vector capable of expressing a gene coding for cis-prenyltransferase, which is a guayule-derived natural rubber synthase having the amino acid sequence of SEQ ID NO: 2 or a Hevea brasiliensis-derived natural rubber synthase having the amino acid sequence of SEQ ID NO: 6, and an expression vector capable of expressing a gene coding for an E. coli-derived UDP pyrophosphate synthase having the amino acid sequence of SEQ ID NO: 4; (b) transforming the expression vectors into a host microorganism; (c) culturing the transformed host microorganism; and (d) isolating natural rubber from a culture of the transformed host microorganism.

2. The method of claim 1, wherein the step (a) further comprises constructing an expression vector capable of expressing a gene coding for an E. coli-derived isopentenyl diphosphate isomerase having the amino acid sequence of SEQ ID NO: 8, and the step (b) further comprises co-transforming the expression vector capable of expressing isopentenyl diphosphate isomerase into the host microorganism.

3. The method of claim 1, wherein the expression vector is one of a plasmid, a cosmid, a phagemid, a phage, and a virus.

4. The method of claim 1, wherein the expression vector is a plasmid.

5. The method of claim 1, wherein the expression vector includes regulatory sequences operatively linked to the genes.

6. The method of claim 1, wherein the genes are under control of a promoter selected from the group consisting of T7A1, T7A2, T7A3, pL, pR, lac, lacUV5, trp, tac, trc, phoA, rrnB, and 1PL.

7. The method of claim 1, wherein the expression vector further includes a selection marker gene.

8. The method of claim 1, wherein the host microorganism is a prokaryote selected from the group consisting of Escherichia spp., Salmonella spp., Shigella spp., Enterobacter spp., Serratia spp., Erwinia spp., Serratia spp., Pseudomonas spp., Caulobacter spp., Synechocystis spp., Synechococcus spp., Bacillus spp., Lactococcus spp., Streptomyces spp., Rhodococcus spp., Corynebacterium spp., and Mycobacterium spp.

9. The method of claim 1, wherein the microorganism is E. coli.

10. A method for producing natural rubber by using a recombinant microorganism, comprising the steps of: (a) constructing an expression vector capable of expressing a gene coding for cis-prenyltransferase, which is a guayule-derived natural rubber synthase having the amino acid sequence of SEQ ID NO: 2 or a Hevea brasiliensis-derived natural rubber synthase having the amino acid sequence of SEQ ID NO: 6, and a gene coding for an E. coli-derived UDP pyrophosphate synthase having the amino acid sequence of SEQ ID NO: 4; (b) transforming the expression vector into a host microorganism; (c) culturing the transformed host microorganism; and (d) isolating natural rubber from a culture of the transformed host microorganism.

11. The method of claim 10, wherein the expression vector is capable of further expressing a gene coding for E. coli-derived isopentenyl diphosphate isomerase having the amino acid sequence of SEQ ID NO: 8.

12. The method of claim 10, wherein the host microorganism is E. coli.

13. A recombinant microorganism, transformed with (i) a gene coding for cis-prenyltransferase, which is a guayule-derived natural rubber synthase having the amino acid sequence of SEQ ID NO: 2 or a Hevea brasiliensis-derived natural rubber synthase having the amino acid sequence of SEQ ID NO: 6, and a gene coding for UDP pyrophosphate synthase, which is an E. coli-derived natural rubber precursor synthase having the amino acid sequence of SEQ ID NO: 4 and capable of expressing the cis-prenyltransferase gene and the UDP pyrophosphate synthase gene.

14. The method of claim 13, wherein the recombinant microorganism is further transformed with a gene coding for E. coli-derived isopentenyl diphosphate isomerase having the amino acid sequence of SEQ ID NO: 8 so as to express the gene.

15. The method of claim 13, wherein the microorganism is E. coli.

16. The method of claim 8, wherein the Synechocystis spp. is Synechocystis species PCC 6803 or Synechocystis species PCC 6301, the Bacillus spp. is Bacillus brevis, Bacillus subtilis, or Bacillus thuringienesis, the Lactococcus spp. is Lactococcus lactis, the Streptomyces spp. is Streptomyces lividans, Streptomyces ambofaciens, Streptomyces fradiae, or Streptomyces griseofuscus, the Rhodococcus spp. is Rhodococcus erythropolis, the Corynebacterium spp. is Corynebacterium gluamicum, and the Mycobacterium spp. is Mycobacterium smegmatis.

Description

DESCRIPTION OF DRAWINGS

[0062] FIG. 1 shows schematic diagrams of vectors used for the production of natural rubber in the recombinant microorganism of the present invention.

[0063] FIG. 2 shows photographic images of the natural rubber obtained from the recombinant microorganism of the present invention and the control natural rubber (polyisoprene).

[0064] FIG. 3 shows FT-IR spectra of the natural rubber obtained from the recombinant microorganism of the present invention and the control natural rubber (polyisoprene).

[0065] FIG. 4 is an NMR spectrum of the natural rubber obtained from the recombinant microorganism of the present invention.

[0066] FIG. 5 is a GPC chromatogram of the natural rubber obtained from the recombinant microorganism of the present invention.

[0067] FIG. 6 is an SEM image of the recombinant microorganism E. coli of the present invention.

[0068] FIG. 7 shows SEM images of the natural rubber obtained from the recombinant microorganism of the present invention.

[0069] FIGS. 8 and 9 are TEM images of the recombinant microorganism E. coli of the present invention which is being cultured.

[0070] FIG. 10 is a photographic image of the natural rubber obtained according to another embodiment of the present invention.

[0071] FIGS. 11 and 12 show photographic images of the natural rubber obtained according to another embodiment of the present invention, and a GPC chromatogram of the natural rubber, respectively.

[0072] FIGS. 13 and 14 show photographic images of the natural rubber obtained according to another embodiment of the present invention, and a GPC chromatogram of the natural rubber, respectively.

BEST MODE TO CARRY OUT THE PRESENT INVENTION

[0073] A detailed description will be given of the present invention with reference to Examples. The following Examples are given only to illustrate the present invention, but should not be construed to limit the present invention.

<EXAMPLES> PRODUCTION OF NATURAL RUBBER USING RECOMBINANT STRAIN

<Example 1> Production of Natural Rubber Using Recombinant Strain Having Guayule-Derived Natural Rubber Synthase Gene and E. coli-Derived Natural Rubber Precursor Synthase Gene Introduced Thereinto

<Example 1-1> Preparation and Cultivation of Recombinant Strain and Production of Natural Rubber

[0074] For the production of natural rubber, first, the chemical synthesis of both a guayule-derived gene (GenBank accession no. AF541942.1, SEQ ID NO: 1) encoding guayule cis-prenyltransferase (GenBank accession no. AAQ11374, SEQ ID NO: 2), which is a natural rubber synthase, and an E. coli-derived gene (GenBank accession no. NC_000913 (REGION: 194906 . . . 195664), SEQ ID NO: 3) encoding UDP pyrophosphate synthase (GenBank accession no. WP_032359110, SEQ ID NO: 4), which is an E. coli natural rubber was entrusted to COSMO Genetech (Seoul, Korea). Then, the two synthesized genes were cloned into respective pUCM expression vectors to construct pUCM-guauly and pUCM-UPS, which were both under the control of the constitutive lac promoter (FIG. 1). Since the use of two respective different expression vectors is advantageous for the simultaneous expression of two genes, the guayule cis-prenyltransferase gene in pUCM-guauly was transferred to a pSTVM vector to construct pSTVM-guauly (FIG. 1). In this regard, the lac promotor and the terminator of pUCM-guauly were also cloned into the pSTVM vector having an inducible promoter so as to constitutively express the guayule cis-prenyltransferase gene. pUCM-UPS and pSTVM-guauly were introduced into E. coli to produce natural rubber. For example, the pSTVM was in-house constructed by removing the lac promoter from pSTV28 vector (Lot No. 3331, TAKARA, Japan).

[0075] Concrete processes are as follows.

[0076] For use in cloning an E. coli-derived gene coding for UDP pyrophosphate synthase, a forward primer GCCGTCTAGAAGGAGGATTACAAAATG (SEQ ID NO: 9) and a reverse primer GGAATTCTCAGGTGTTTCA (SEQ ID NO: 10) which have an XbaI and an EcoRI restriction enzyme site, respectively (underlined in the sequences), were synthesized. Likewise, an XbaI and an EcoRI restriction enzyme site were respectively introduced into a forward primer TCTAGAAGGAGGATTACAAAATGGCCGAACCTGAATC (SEQ ID NO: 11) and a reverse primer GAATTCCTAACCACTTTGACCAACCG (SEQ ID NO: 12) (underlined in the sequences) for cloning a guayule-derived gene coding for cis-prenyltransferase. PCR was performed with the primers to amplify the corresponding genes. The PCR products were cloned into respective pUCM vectors using the restriction enzymes to construct pUCM-guauly and pUCM-UPS. Subsequently, a forward primer CCCAAGCTTCCGACTGGAAAGCG (SEQ ID NO: 13) and a reverse primer CGGGATCCCGGTGTGAAATACCG (SEQ ID NO: 14) were synthesized from pUCM-guauly to contain a HindIII and a BamHI restriction site (underlined in the sequences), respectively, for use in constructing pSTVM-guauly. Together with the gene, a lac promoter, which is a constitutive expression promoter of pUCM-guauly, and a terminator were amplified by PCR using the primers, and the PCR product thus obtained was cloned into a PSTVM vector using the restriction enzymes to construct pSTVM-guauly. The expression vectors were together introduced into Escherichia coli XL1-blue strain by electroporation, followed by selecting the transformed E. coli with the aid of antibiotics ampicillin (100 g/L) and chloramphenicol (100 g/L). In this regard, the transformants were spread on LB agar plates and selection was made of growing strains. The selected E. coli was inoculated into a TB medium containing tryptone 12 g/L, yeast extract 24 g/L, and glycerol 1 g/L, and cultured at 30 C. and 250 rpm for 24 hrs.

[0077] After culturing, a PHB extraction method (Alejandro et al., Micro Ecol, 56, 112-120 (2008)) was used to extract rubber from the recombinant E. coli. In detail, the cultured cells were separated from the medium by centrifugation and transferred into a 50-ml conical tube which was then filled with 400 ml of absolute ethanol (100%). The cells were lysed by sonication (pulse 40%, time 30 min, pulse-on 5 s, pulse-off 15 s). Following cell lysis, centrifugation separated cell debris from ethanol. Only the cell debris was obtained, mixed with 50 ml of acetone, and incubated for 15 min to remove impurities such as fatty acids. After removal of the impurities, the remaining cell debris was harvested and pooled. The pooled cell debris was mixed with 50 ml of toluene and left for 12 hrs to extract rubber.

[0078] After extraction of rubber from the transformed E. coli, the powder dried by removal of the extraction solvent was photographed. The image of dried powder was given, together an image of the control natural rubber polyisoprene (molecular weight >38000, Sigma-Aldrich, USA) (upper: dried powder extract from transformed E. coli, lower: polyisoprene isolated from the rubber tree). The dried powder extracted from the transformed E. coli was seen white as in the control polyisoprene.

<Example 1-2> FT-IR Spectroscopy Analysis

[0079] FR-IR spectra were obtained from dried powder extracted from the E. coli and the control polyisoprene, using an infrared spectrophotometer (Thermo, Nicolet 6700), and are depicted in FIG. 3. In detail, a specimen was dissolved in acetone, and aliquoted at an amount of 50 l into quartz cells. After drying at room temperature for 2-3 min, a spectrum was obtained by use of a FT-IR spectrophotometer. As a control, polyisoprene purchased from Sigma Aldrich was dissolved in acetone and used in a comparative test.

[0080] With reference to FIG. 3, the dried powder extracted from the E. coli was observed to show spectral patterns very similar to those of the control polyisoprene (upper: polyisoprene of natural rubber purchased from Sigma Aldrich, lower: natural rubber produced by E. coli).

<Example 1-3> NMR Spectral Analysis

[0081] NMR spectra of the dried powder extracted from the E. coli were recorded on Varian Mercury Plus 400 (FIG. 4). In brief, 1 ml of a specimen in benzene was loaded to a glass tube and measured for NMR at 400 MHz using an NMR spectrometer (Varian, USA). Through the measurement, H elements were analyzed to read the presence of double bonds and alkanes. The dried powder extracted from the E. coli was analyzed for the presence of natural rubber through peaks at retention times on NMR data. Double bond and alkane peaks identified the synthesis of natural rubber in the E. coli.

<Example 1-4> GPC Analysis

[0082] The dried powder extracted from the E. coli was analyzed by gel permeation chromatography (Waters HPLC isocratic 1515, detector Refractive Index 2414 USA). The dried powder extracted from the E. coli was dissolved in THF before analysis (FIG. 5). Analysis was performed at a flow rate of 1 ml/min, with THF serving as a mobile phase. Refractive indices thus obtained indicated the presence of a wide spectrum of polymers with an average molecular weight of 500,000. Molecular weights were determined on the basis of results identified through analysis of polymers which had a molecular weight of 10,000, 50,000, 100,000, 500,000, and 1,000,000 as reference values. For polymer analysis through GPC, a wide range of retention time was detected. The GPC analysis resulted in identifying the synthesis of a polymer having an average molecular weight of 500,000.

<Example 1-5> SEM Analysis of Natural Rubber-Producing E. coli

[0083] After being cultured for 48 hrs in 4 ml of a TB medium, the natural rubber-producing E. coli was morphologically analyzed under a scanning electron microscope (SEM: Model JSM 5410LV, JEOL) with magnifications for 200 nm, 1 m, and 10 m levels. As a result, the E. coli was observed to have a carved scar (indicated by an arrow in FIG. 6), which is morphologically different from typical E. coli. Generally, E. coli is rod-shaped, without indentations carved thereon. Thus, the natural rubber-producing E. coli developed in the present invention was understood to discharge natural rubber extracellularly. A plausible evidence of the extracellular discharge of natural rubber in the natural rubber-producing E. coli was a morphologically peculiar structure observed in the natural rubber-producing E. coli (FIG. 7). Magnification of the structure showed both two superficial types: one having streaks resulting from dryness; and the other in the form of honey before dryness.

<Example 1-6> TEM Analysis of Natural Rubber-Producing E. coli

[0084] After being cultured for 48 hrs in 4 ml of a TB medium, the natural rubber-producing E. coli strain was observed under a transmission electron microscope (TEM: Model JEM 1010, JEOL) to analyze the intracellular structure thereof. As a result, solid structures were detected inside and outside the natural rubber-producing E. coli (indicated by circles in FIG. 8), but not in typical E. coli. In addition, the natural rubber-producing E. coli was observed to be extracellularly discharging natural rubber (indicated by circles in FIG. 9). Thus, the natural rubber-producing E. coli developed in the present invention was identified to extracellularly discharge natural rubber as well as containing natural rubber therein.

<Example 2> Production of Natural Rubber Using Recombinant Strain Having Rubber Tree-Derived Natural Rubber Synthase Gene and E. coli-Derived Natural Rubber Precursor Synthase Gene Introduced Thereinto

[0085] The chemical synthesis of a rubber tree (Hevea brasiliensis)-derived gene (Genbank accession no. AY124466, SEQ ID NO: 5) encoding cis-prenyltransferase (Genbank accession no. AAM92882, SEQ ID NO: 6)), which is a natural rubber synthase of Hevea brasiliensis, was entrusted to COSMO Genetech (Seoul, Korea). Then, the synthesized gene was cloned into a pUCM expression vector to construct pUCM-hevea, which was under the control of the constitutive lac promoter (FIG. 1). From pUCM-hevea, the gene was amplified, together with the constitutive lac promoter and a terminator, and cloned into a pSTVM vector to construct pSTVM-hevea (FIG. 1). pSTVM-hevea was introduced, together with the pUCM-UPS carrying an E. coli-derived gene coding for UDP pyrophosphate synthase, constructed in Example 1-1, into E. coli which was then allowed to produce natural rubber.

[0086] In brief, a forward primer TCTAGAAGGAGGATTACAAAATGGAAATATATACGGG (SEQ ID NO: 15) and a reverse primer GAATTCTTATTTTAAATATTCCTTA (SEQ ID NO: 16) which have an XbaI and an EcoRI restriction enzyme site, respectively (underlined in the sequences), were synthesized for use in cloning a Hevea brasiliensis-derived gene coding for the natural rubber synthase UDP pyrophosphate synthase. PCR was performed with the primers, and the PCR product was cloned into a pUCM vector using the restriction enzymes to construct pUCM-hevea. Subsequently, the forward and the reverse primer, constructed in Example 1-1 to respectively contain a HindIII and a BamHI restriction site, were used in PCR for amplifying the gene as well as the constitutive lac gene and a terminator. The PCR product thus obtained was cloned into a PSTVM vector using the restriction enzymes to construct pSTVM-hevea. Together with pUCM-UPS constructed in Example 1-1, pSTVM-hevea was introduced into Escherichia coli XL1-blue strain by electroporation. The transformed E. coli was spread on an LB agar plate containing antibiotics ampicillin (100 g/L) and chloramphenicol (100 g/L) and selection was made only of growing strains resistant to the antibiotics. The selected E. coli was inoculated into a TB medium containing tryptone 12 g/L, yeast extract 24 g/L, and glycerol 1 g/L and cultured at 30 C. and 250 rpm, as in Example 1, for 24 hrs and 48 hrs. Natural rubber was extracted using a PHB extraction method, and an image taken of the dried powder by removal of the extraction solvent is given in FIG. 10. As in FIG. 2, white powder was obtained.

<Example 3> Production of Natural Rubber According to Additional Introduction of E. coli-Derived Isopentenyl Isomerase

<Example 3-1> Use of Guayule-Derived Natural Rubber Synthase

[0087] An E. coli-derived gene (GenBank accession no. NC_000913.3 (REGION: 3033065 . . . 3033613), SEQ ID NO: 7) coding for E. coli isopentenyl diphosphate isomerase (GenBank accession no. NP_417365.1, SEQ ID NO: 8) was isolated from E. coli. For use in cloning the gene, a forward primer GCTCTAGAAGGAGGATTACAAAATGCAAACGGAACACGT (SEQ ID NO: 17) and a reverse primer GGAATTCTTATTTAAGCTGGGTAAATGCA (SEQ ID NO: 18) which have an XbaI and an EcoRI restriction enzyme site, respectively (underlined in the sequences), were synthesized, and the gene was amplified by PCR using the primers. The PCR product was cloned into a pBBR expression vector to construct pBBR-idi (FIG. 1).

[0088] Together with pSTVM-guauly and pUCM-UPS, both constructed in Example 1-1, pBBR-idi was introduced into Escherichia coli XL1-blue strain by electroporation, followed by selecting the transformed E. coli on an LB agar plate containing antibiotics ampicillin (100 g/L) and chloramphenicol (100 g/L). In this regard, the transformants were spread on LB agar plates and selection was made of growing strains. The selected E. coli was inoculated into a TB medium and cultured before extraction of natural rubber by a PHB extraction method. Images of the extracted natural rubber were taken and are given in FIG. 11. The extracted natural rubber was subjected to GPC analysis in the same manner as in Example 1-4, and the results are depicted in FIG. 12.

[0089] With reference to FIG. 11, white powder (left panel in FIG. 11) was identified, and observed to be significantly greater in quantity than that obtained from E. coli into which only pSTVM-guauly and pUCM-UPS were introduced (right panel in FIG. 11, obtained in Example 1-1). The white powder was found to have a molecular weight of 60,000 Da, as measured by GPC analysis.

<Example 3-2> Use of Hevea brasiliensis-Derived Natural Rubber Synthase Gene

[0090] An E. coli natural rubber precursor synthase gene (GenBank accession no. NC_000913 (REGION: 194906 . . . 195664), SEQ ID NO: 2), a Hevea brasiliensis natural rubber precursor synthase gene (Genbank accession no. AY124466, SEQ ID NO: 5), and an E. coli isopentenyl isomerase gene (GenBank accession no. NC_000913.3 (REGION: 3033065 . . . 3033613), SEQ ID NO: 7) were introduced into E. coli to produce natural rubber.

[0091] In brief, pUCM-UPS, pSTVM-hevea, and pBBR-idi, which were constructed in Examples 1-1, 2, and 3-1, respectively, were introduced together into Escherichia coli XL1-blue strain by electroporation, followed by selection on an LB agar plate containing antibiotics ampicillin (100 g/L), chloramphenicol (100 g/L) and kanamycin (100 g/L). In the same manner as in Example 1-1, the selected E. coli was inoculated into a TB medium, cultured, and used to extract natural rubber by use of PHB extraction.

[0092] An image was taken of the extracted natural rubber and is depicted in FIG. 13. The extracted natural rubber was subjected to GPC analysis in the same manner as in Example 1-4, and the result is shown in FIG. 14. With reference to FIG. 13, white powder (left panel in FIG. 13) was identified, and observed to be significantly greater in quantity than that obtained from E. coli into which only pSTVM-guauly and pUCM-UPS were introduced (right panel in FIG. 13, obtained in Example 2). The white powder was found to have a molecular weight of 55,300 Da, as measured by GPC analysis.

<COMPARATIVE EXAMPLES> PRODUCTION OF NATURAL RUBBER USING RECOMBINANT STRAIN HAVING ONLY GUAYULE-DERIVED NATURAL RUBBER SYNTHASE GENE AND RUBBER TREE-DERIVED NATURAL RUBBER SYNTHASE GENE INTRODUCED THEREINTO

<Comparative Example 1> Use of Guayule-Derived Natural Rubber Synthase Gene

[0093] pSTVM-guauly or pUCM-guauly into which a guayule-derived natural rubber synthase gene was cloned in Example 1-1 was introduced into Escherichia coli XL1-blue strain by electroporation, followed by selection on an LB agar plate containing the antibiotic chloramphenicol (100 g/L) or ampicillin (100 g/L). In the same manner as in Example 1-1, the selected E. coli was inoculated into a TB medium, cultured, and used to extract natural rubber by use of a PHB extraction method. In this case, no white powder was identified, and GPC analysis indicated the absence of a polymer compound.

<Comparative Example 2> Use of Rubber Tree-Derived Natural Rubber Synthase Gene

[0094] pSTVM-hevea or pUCM-hevea into which a rubber tree-derived natural rubber synthase gene was cloned in Example 2 was introduced into Escherichia coli XL1-blue stain by electroporation, followed by selection on an LB agar plate containing the antibiotic chloramphenicol (100 g/L) or ampicillin (100 g/L). In the same manner as in Example 1-1, the selected E. coli was inoculated into a TB medium, cultured, and used to extract natural rubber by use of a PHB extraction method. In this case, no white powder was identified, and GPC analysis indicated the absence of a polymer compound.

[0095] Sequence List Electronic File Attachment

(A:\KIPONET\KEditor\Data\custom-charactercustom-character.app)