FELINE CALICIVIRUS VACCINE

20180371026 ยท 2018-12-27

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a new feline capsid protein, to live attenuated feline calicivirus comprising that capsid protein, to live recombinant carrier viruses and live attenuated hybrid feline calicivirus comprising that capsid protein, to vaccines comprising such live attenuated feline caliciviruses, live recombinant carrier viruses and live attenuated hybrid feline calicivirus, and to methods for the preparation of such viruses.

Claims

1. (canceled)

2. (canceled)

3. (canceled)

4. (canceled)

5. (canceled)

6. (canceled)

7. (canceled)

8. (canceled)

9. (canceled)

10. (canceled)

11. (canceled)

12. (canceled)

13. (canceled)

14. (canceled)

15. (canceled)

16. A feline calicivirus (FCV) capsid protein comprising a sequence identity of at least 90% with the amino acid sequence of SEQ ID NO: 34.

17. A feline calicivirus (FCV) capsid protein comprising at least one of the following amino acids K89, M90, M100, I317, L390, A391, V392, Q396, S397, K398, N404, T426, T431, S438, S437, D440, E445, K447, L448, E451, N452, G484, G489, I491, N516, S517, E518, I524, S545, S634, F635, P636, wherein the numbering is according to SEQ ID NO: 34.

18. A live attenuated FCV comprising a capsid protein comprising a sequence identity of at least 90% with the amino acid sequence of SEQ ID NO: 34.

19. A live attenuated feline calicivirus (FCV) comprising a capsid protein wherein the capsid protein comprises at least one of the following amino acids K89, M90, M100, I317, L390, A391, V392, Q396, S397, K398, N404, T426, T431, S438, S437, D440, E445, K447, L448, E451, N452, G484, G489, I491, N516, S517, E518, I524, S545, S634, F635, P636.

20. A DNA fragment wherein said DNA fragment comprises a region encoding said capsid protein of claim 16.

21. A DNA fragment of claim 20, wherein said region encoding said capsid protein is placed under the control of a suitable promoter.

22. A live attenuated recombinant carrier virus (LARCV), wherein said LARCV comprises a region encoding a feline calicivirus (FCV) capsid protein of claim 16, under the control of a suitable promoter.

23. A live attenuated recombinant carrier virus according to claim 22, wherein said LARCV is a myxomavirus or a Feline Herpesvirus.

24. A method of protecting felines against FCV comprising administering a live attenuated recombinant carrier virus of claim 22.

25. A live attenuated hybrid FCV, wherein said FCV comprises an open reading frame 2 (ORF2) encoding a capsid protein comprising a sequence identity of at least 90% with the amino acid sequence of SEQ ID NO: 34, or said DNA fragment of claim 20, and comprises an open reading frame 1 (ORF1) from an attenuated FCV.

26. A live attenuated hybrid FCV of claim 25, wherein said FCV comprises an ORF1 from FCV strain F9.

27. A method of protecting felines against FCV comprising administering a live attenuated hybrid FCV of claim 25.

28. A cell culture comprising a live attenuated FCV of claim 18.

29. A cell culture comprising a LARCV of claims 22.

30. A cell culture comprising a live attenuated hybrid FCV of claim 25.

31. A vaccine for the protection of felines against FCV, wherein said vaccine comprises a live attenuated FCV comprising a capsid protein comprising a sequence identity of at least 90% with the amino acid sequence of SEQ ID NO: 34, or a live recombinant carrier virus of claim (LARCV), wherein said LARCV comprises a region encoding a feline calicivirus (FCV) capsid protein comprising a sequence identity of at least 90% with the amino acid sequence of SEQ ID NO: 34, under the control of a suitable promoter, or a live attenuated hybrid FCV of claim 25, and a pharmaceutically acceptable carrier.

32. A vaccine of claim 31, wherein said vaccine comprises at least one other feline-pathogenic microorganism or feline-pathogenic virus and/or at least one other immunogenic component and/or genetic material encoding said other immunogenic component of said feline-pathogenic microorganism or feline-pathogenic virus.

33. A vaccine of claim 32, wherein said other feline-pathogenic microorganism or feline-pathogenic virus is selected from the group consisting of feline panleucopenia virus, Chlamydia psittaci, Bordetella bronchiseptica, feline parvovirus, rabies virus and feline herpes virus.

34. A method for obtaining a live attenuated hybrid FCV of claim 25 comprising: a. preparation of a first FCV amplicon comprising the full ORF1 region and an adjacent 5-part of the ORF2 region of an attenuated FCV, b. preparation of a second FCV amplicon comprising a 3-part of the ORF1 region and the full adjacent ORF2//ORF3 region wherein the ORF2 is an ORF2 encoding an FCV capsid protein comprising a sequence identity of at least 90% with the amino acid sequence of SEQ ID NO: 34, c. assembly of the first and second amplicon using overlap extension, d. generation of infectious FCV, e. infection of susceptible cells with the infectious FCV, and f. recovery of infectious progeny FCV.

Description

LEGEND TO THE FIGURES

[0102] FIG. 1: amplicons covering 5349 bp from the 5 end of the FCV genome, or 2422 and 2416 bp from the 3 end of the FCV F9 and Kalem Crouch genomes respectively were amplified with PCR from FCV cDNA

[0103] FIG. 2: full-length overlap extension assemblies of FCV F9 (SEQ ID NO: 60), Kalem Crouch (SEQ ID NO: 59), FK (SEQ ID NO: 62) and KF (SEQ ID NO: 61) were generated and resolved on a 1% agarose gel. FCV F9 and Kalem Crouch were made from their respective 5 and 3 amplicons as controls to demonstrate correct design of overlap

[0104] FIG. 3: full-length recombinant FK and KF FCV DNA was amplified with PCR and resolved on a 1% agarose gel.

[0105] FIG. 4: an example of the typical CPE (cytopathic effect) of FCV in CrFK cells infected with FCV Kalem Crouch.

[0106] FIG. 5: Alignment of FCV Kalem Crouch (SEQ ID NO: 34) and F9 (SEQ ID NO: 35) capsid protein sequence to published FCV sequences (SEQ ID NO: 36-58). Numbering of the amino acids is on nucleotide level.

[0107] FIG. 6: Sequence alignment of the FCV F9 (SEQ ID NO: 59) and Kalem Crouch strains (SEQ ID NO: 60) to recombinant FCV FK (SEQ ID NO: 61) and KF strains. (SEQ ID NO: 62).

[0108] FIG. 7: Alignment of FCV Kalem Crouch (SEQ ID NO: 34) and F9 (SEQ ID NO: 35) capsid protein sequence to published FCV sequences (SEQ ID NO: 36-58). Numbering of the amino acids is on amino acid level.

[0109] FIG. 8: Map of the p22m-GFP plasmid with the mutation in the Ncol site of the MCS indicated.

[0110] FIG. 9: Comparison of the p22m-GFP and p22m-4a constructs derived from p22-GFP plasmid.

[0111] FIG. 10: A diagram of the whole MR24-Kalem Crouch clone genome with a highlighted pMCPK insert.

EXAMPLES

Example 1

[0112] Hyper-immune sera raised in cats to strains FCV F9 and Kalem Crouch were used to determine the neutralisation index of the several FCV strains. The experiment is performed as described in section 8 below. The data is shown in table 1. It becomes clear from the table that serum raised against Kalem Crouch has a broad cross protection against many other FCV strains. For serum against Kalem Crouch a significant Log.sub.10 reduction (i.e. >1.5) is seen against 16 out of 31 FCV strains. Table 1 also shows that the cross-protection of the normally used F9 strain is much less. Serum raised against F9 shows a significant Log.sub.10 reduction (i.e. >1.5) for 3 out of 22 FCV strains. It should be noted that the 2 FCV strains that are neutralized or at least significantly reduced by the F9 serum, 3809, 6420, CV-21, are F9-like viruses. Thus not only provides

[0113] Kalem Crouch cross-protection for many more FCV strains than F9 does, it also provides cross-protection for non-F9 strains.

Example 2

Construction of Hybrid FCV-Clones

1. Cell Culture

[0114] All cell lines were maintained in tissue culture flasks at 37 C., 5% CO.sub.2.

[0115] Crandell-Rees Feline kidney (CrFK) cells were grown in medium M6B8 supplemented with 5% Foetal Bovine Serum, 0.15% Sodium bicarbonate, 2 mM L-Glutamine, 100 U/ml of Penicillin, 10 g/ml of Streptomycin and 2 g/ml of Fungizone.

[0116] BsRT7 cells were maintained in medium DMEM supplemented with 5% Foetal Bovine Serum, 2 mM L-Glutamine, 1 mM Sodium Pyruvate and 1 mg/ml Geneticin (G418). Geneticin was removed at cell seeding prior to transfection.

2. Virus Isolation

[0117] Oro-pharyngeal/nasal swabs were collected from cats and transported in medium M6B8. The swabs were vortexed briefly and the virus suspension inoculated onto confluent CrFK cells and incubated at 37 C. with 5% CO.sub.2 until CPE specific to FCV was observed. Infected flasks were freeze thawed to lyse cells, clarified to remove cellular debris and stored as aliquots at 70 C.

3. Growth of FCV

[0118] An appropriate dilution of virus was adsorbed to infect a confluent CrFK monolayer. Cells were incubated at 37 C., 5% CO.sub.2 until CPE specific to FCV was observed. Infected flasks were freeze thawed to lyse cells, clarified to remove cellular debris and stored as aliquots at 70 C.

4. RNA Isolation

[0119] Clarified viral suspension was centrifuged at 131500g, 4 C. using a SW28 rotor for approximately 16 hours. RNA was extracted from the resulting pellet using an RNeasy Miniprep Kit (Qiagen, Hilden, Germany). RNA was eluted in 50 1 RNase free water, aliquoted and stored at 70 C. until use.

5. cDNA Synthesis

[0120] FCV RNA was used as a template for cDNA synthesis. cDNA was synthesised using an INVITROGEN Superscript II kit (Carlsbad, Calif.) and primers Fr2F (SEQ ID NO: 32) and Fr4R (SEQ ID NO: 33).

6. Virus Titration

[0121] Serial tenfold dilution of the virus (100 L/ well, 5 wells per dilution) in growth medium was used to infect a confluent monolayer of CrFK cells in 96 well plates. Infected CrFK cells were incubated at 37C, 5% CO.sub.2 for up to 5 days and examined for CPE specific for FCV. The number of wells in which CPE was present was recorded and titres were calculated using Reed Muench method. Titres were expressed as TCID.sub.50/ml.

7. Preparation of FCV Antibodies

[0122] Antibodies to FCV strains were raised in cats. Each treatment group consisted of 3 cats housed separately. Cats were either infected by the oro-pharyngeal route or by subcutaneous injections. Cats were hyperimmunized with a second dose of the virus by the oro-phryngeal route. Plasma was collected from cats three weeks post second inoculation.

8. Virus Neutralisation Assay

[0123] Serial dilution of the viruses were mixed with an equal volume of a constant amount of plasma dilution or growth medium and incubated for 1 hour at 37 C. The virus or virus serum mixture was inoculated on confluent CrFK cells (5 wells per dilution) in a 96 well plate. Plates were incubated at 37 C., 5% CO.sub.2 for 5 days. The neutralisation index was determined by calculating the difference in the titer observed.

9. Design of Primers to Generate Overlapping DNA Amplicons from FCV cDNA

[0124] The PCR reactions to generate an amplicon covering 5349 bp from the 5 of the FCV genome were performed using the Phusion polymerase (NEB, Ipswich, Mass.) with oligonucleotide primer pair FKP1F (SEQ ID NO: 5) and FKP1R (SEQ ID NO: 6), and the PCR conditions described in Table 4. Similarly, PCR reactions to generate an amplicon covering the 2422 bp from the 3 end of FCV F9 and 2416 bp from the 3 end of FCV Kalem Crouch were also performed using the Phusion polymerase (NEB, Ipswich, Mass.) with oligonucleotide primer pair FKP2F (SEQ ID NO: 7) and FKP2R (SEQ ID NO: 8) using the Phusion polymerase (NEB, Ipswich, Mass.), and the PCR conditions described in Table 5.

10. Purification of DNA from PCR Reactions

[0125] All amplified DNA was purified using QlAquick PCR Purification Kit (Qiagen, Hilden, Germany) using two column washes. The concentration and purity of eluted DNA was determined using a Nanodrop instrument (Thermo Scientific, Waltham, Mass.).

11. Combining of FCV Amplicons to Generate Full Length FCV

[0126] An equimolar mix was made with 0.1, 0.25, or 0.5 pmol of each FCV amplicons generated as described in methods section 9, and purified as described in methods section 10. A sufficient amount of such a mix, typically 5 L, was used as template for the overlap extension PCR described in Table 6, using the Phusion polymerase (NEB, Ipswich, Mass.).

12. Generation of Full Length Infectious FCV DNA

[0127] A sufficient amount of cDNA reaction, prepared as described in section 5 above, or overlap extension PCR reaction, prepared as described in section 11, typically between 1 and 5 L, was used as template to generate full length infectious FCV DNA. Th Phusion polymerase (NEB, Ipswich, Mass.) was used together with oligonucleotide primer pairs MBL 446 (SEQ

[0128] ID NO: 1) and MBL 447 (SEQ ID NO: 2) or FCVT7f (SEQ ID NO: 3) and FCVpAr (SEQ ID NO: 4), and the PCR conditions described in Tables 7 and 8 respectively.

13. Transfection of Full Length Infectious FCV DNA into BsRT7 Cells

[0129] BsRT7 cells, cultured as described in section 1 to approximately 50-70% confluence in 24 well plates, were transfected with full length infectious FCV DNA generated as described in section 12 using the INVITROGEN Lipofectamine 3000. Typically 3 ,g of DNA was used per well. Cells were incubated with the DNA-lipofectamine complex for up to 72 hours.

14. Infection of CrFK Cells with Lysate from Transfected BsRT7 Cells

[0130] Transfected BsRT7 cells were lysed by freeze-thawing. The cell-lysate was used to infect a confluent monolayer of CrFK cells.

15. Immunofluorescence Staining of FCV

[0131] CrFK cells infected with FCV were fixed with methanol and washed with PBS. Fixed cells were incubated sequentially with a polyclonal anti FCV serum and anti-Cat FITC antibody conjugate or a mouse monoclonal antibody NCL-1G9 (Leica Microsystems, UK) and anti-mouse FITC antibody conjugate. Fluorescence was observed using a DM1L microscope (Leica Microsystems, UK) with the 13 filter.

16. Sequence Analysis of FCV

[0132] Full length FCV DNA was made from cDNA using the oligonucleotide primers MBL 446 (SEQ ID NO: 1) and MBL 447 (SEQ ID NO: 2) together with the Phusion polymerase (NEB, Ipswich, Mass.) and PCR conditions described in Table 4. The resulting full length FCV DNA was purified as described in methods section 11 and sequenced using any combination of oligonucleotide primers from Table 3. DNA samples were sequenced by GATC-biotech, UK. 30-100 ng/l of plasmid or 10-50 ng/l of PCR product were sent with 10 pmol/l of sequencing primer.

TABLE-US-00001 TABLE1 PCRprimerstogeneratefulllengthinfectious FCVDNA. Name Legacy Sequence5 to3 SEQID1 MBL446 CATGGTACCTAATACGACTCACTATAGGGTA AAAGAAATTTGAGACAATG SEQID2 MBL447 TCGACCACCGGTGATTAATTTTTTTTTTTTT TTTTTTTTTTTCCCTGGG SEQID3 FCVT7f TACCTAATACGACTCACTATAGGGTAAAAGA AATTTGAGACAATGTCTCAAACTCTGAGCTT CGTGC SEQID4 FCVT7r TTTTTTTTTTTTTTTTTTTTTTTTCCCTGGG GTTAGGCGCAGGTGCGG

TABLE-US-00002 TABLE2 PCRprimersusedtogenerateFCVamplicons. Name Legacy Sequence SEQID5 FKP1F GTAAAAGAAATTTGAGACAATGTCTCAAACTCT GAGCTTCGTGC SEQID6 FKP1R ATAGTATTTAAGCACGTTAGCGCAGGTTGAGCA CATGCTCAAACTTCGAACAC SEQID7 FKP2F GAGTGGCATGACCGCCCTACACTGTGATGTGTT CGAAGTTTGAGCATGTGCT SEQID8 FKP2R TTTTTTTTTTTTCCCTGGGGTTAGGCGCAGGTG CGG

TABLE-US-00003 TABLE3 PCRprimersforsequencingthefulllengthofthe recombinantFCVgenome. Name Legacy Sequence SEQID9 Seg2F CTTGGTACCGAGCTGTAAAAGAAATTTGAGA CAATG SEQID10 SCJ1R TGAGCTGTTCTTTGCACA SEQID11 MBL228 CTCCTTGAAAGAGTTGGTGTG SEQID12 MBL234 CTATGGTGCATTCGGTGATG SEQID13 MBL230 GCGACAACTCTTGTATCAGG SEQID14 MBL233 GACATGCTTGAGAACAAGGG SEQID15 Seg3F GAACTACCCGCCAATC SEQID16 Seg2R GAGCCCAGGCCAAAT SEQID17 MBL344 GATCGGTCGACGAGCTCTTCTCTCTCTTAGG SEQID18 MBL220 GTATGACGTAACAAAGCCTG SEQID19 MBL221 GGAAATTGGCAACCCAAGGC SEQID20 MBL222 GCTGTAAAAGTGTCCTCTGG SEQID21 Seg4F CACTGTGATGTGTTCGAAG SEQID22 Seg3R TATTTAAGCACGTTAGCG SEQID23 SCJ7F CATCTTATGTCAGATACTGA SEQID24 SCJ8F TTTTCTTTTGTTGGTGTCTC SEQID25 Seg4R CGAGCGGCCGCCACTGTGCCCTGGGGTTAGG CGC SEQID26 SCJ2F GGGAGATGAGAAGCTTCG SEQID27 SCJ3F GCCCAAACTATGAAACAAG SEQID28 SCJ4F AACGCCATTGGATCTGTAAC SEQID29 SCJ6F ATTGAACCAATCGATCCTGA SEQID30 SCJ5R TCAGGATCGATTGGTTCAAT SEQID31 MBL341 TTCCAGGTACCTCCGGAAGGAGTTCTGGGTA G SEQID32 Fr2F AGAGCTCTCTGGCTAACGTAAAAGAAATTTG AGACAATGTCTCAAACTCTGAG SEQID33 Fr4R GGCAACTAGAAGGCACAGCCCTGGGGTTAGG CGC

TABLE-US-00004 TABLE 4 PCR conditions to generate an amplicon of FCV covering 5349 bp from the 5 end. PCR mix PCR program Mix Volumes Temperature components (L) Step Time ( C.) NF water 31.0 Initial 30 sec 98.0 5X PCR buffer 10.0 denaturation dNTP mix (10 mM) 1.0 Number of cycles: 35 F primer, SEQ ID 9 (10 M) 1.0 Start of cycle R primer, SEQ ID 10 (10 M) 1.0 Denaturation 10 sec 98.0 DMSO (final conc. 9%) 4.5 Annealing 10 sec 69.0 Polymerase 0.5 Extension 1 min 30 sec 72.0 Template (cDNA) 1.0 End of cycle Final extension 5 min 72.0 Final volume 50.0 Storage indefinitely 4.0

TABLE-US-00005 TABLE 5 PCR conditions to generate an amplicon of FCV covering up to 2422 bp from the 3 end. PCR mix PCR program Volumes Temperature Mix components (L) Step Time ( C.) NF water 31.0 Initial 30 sec 98.0 5X PCR buffer 10.0 denaturation dNTP mix (10 mM) 1.0 Number of cycles: 35 F primer, SEQ ID 11 (10 M) 1.0 Start of cycle R primer, SEQ ID 12 (10 M) 1.0 Denaturation 10 sec 98.0 DMSO (final conc. 9%) 4.5 Annealing 10 sec 69.0 Polymerase 0.5 Extension 45 sec 72.0 Template (cDNA) 1.0 End of cycle Final extension 5 min 72.0 Final volume 50.0 Storage indefinitely 4.0

TABLE-US-00006 TABLE 6 PCR conditions to carry out an overlap extension PCR that combines FCV amplicons to generate full length FCV DNA template. PCR mix PCR program Volumes Temperature Mix components (L) Step Time ( C.) NF water 29.0 Initial 30 sec 98.0 5X PCR buffer 10.0 denaturation dNTP mix (10 mM) 1.0 Number of cycles: 35 F primer (none) Start of cycle R primer (none) Denaturation 10 sec 98.0 DMSO (final conc. 9%) 4.5 Annealing Polymerase 0.5 Extension 3 min 72.0 Template (cDNA) 5.0 End of cycle Final extension 5 min 72.0 Final volume 50.0 Storage indefinitely 4.0

TABLE-US-00007 TABLE 7 PCR conditions to amplify full length FCV DNA from cDNA and add a 5 T7 promoter and 3 polyA tract. PCR mix PCR program Volumes Temperature Mix components (L) Step Time ( C.) NF water 34.0 Initial 30 sec 98.0 5X PCR buffer 10.0 denaturation dNTP mix (10 mM) 1.0 Number of cycles: 35 F primer, SEQ ID 1 (10 M) 1.0 Start of cycle R primer, SEQ ID 2 (10 M) 1.0 Denaturation 10 sec 98.0 DMSO (final conc. 3%) 1.5 Annealing 30 sec 51.0 Polymerase 0.5 Extension 4 min 72.0 Template (cDNA) 1.0 End of cycle Final extension 5 min 72.0 Final volume 50.0 Storage indefinitely 4.0

TABLE-US-00008 TABLE 8 PCR conditions to amplify full length FCV DNA from overlap extension PCR template material and add a 5 T7 promoter and 3 polyA tract. PCR mix PCR program Volumes Temperature Mix components (L) Step Time ( C.) NF water 31.0 Initial 30 sec 98.0 5X PCR buffer 10.0 denaturation dNTP mix (10 mM) 1.0 Number of cycles: 35 F primer, SEQ ID 3 (10 M) 1.0 Start of cycle R primer, SEQ ID 4 (10 M) 1.0 Denaturation 10 sec 98.0 DMSO (final conc. 9%) 4.5 Annealing Polymerase 0.5 Extension 3 min 72.0 Template (cDNA) 1.0 End of cycle Final extension 5 min 72.0 Final volume 50.0 Storage indefinitely 4.0

2. Preparation of Myxo-Kalem Crouch Construct

[0133] The pMCPK (processed portion of the major capsid protein of the Kalem Crouch FCV isolate) was cloned using the BamHI and Xhol sites on the p22m-GFP (a derivative of p22-GFP) plasmid MCS (multiple cloning site). See FIG. 8.

[0134] To avoid adding extra C-terminal AAs (amino acids) to pMCPK, translation from the start codon in the Ncol site of the MCS in p22-GFP was removed by introducing a point mutation (CCATGG->CCATCG, FIG. 1). Site directed mutagenesis was used to mutate the p22-GFP plasmid using the following primers:

TABLE-US-00009 p22sdmF: SEQIDNO:63 5-CATCGATCGATGTCGACGGATCCA-3 p22sdmR: SEQIDNO:64 5-GTGCATCCGTCGACATCGATCGATG-3

[0135] PCR program: 30@98 C., 20x[10@98 C., 10@58.3 C., 2@72 C.], 5@72 C., 4 C., and the Phusion polymerase (NEB, cat: M0530L).

[0136] Template p22-GFP plasmid was removed from the reaction with Dpnl digestion prior to transformation into XL10 gold E. coli (cat: 200315). Several of the resulting E. Coli colonies were picked to set up miniprep cultures that were screened by digesting the extracted plasmid DNA (QiaPrep Spin Miniprep kit, cat: 27104) with Ncol. On a 1% agarose gel, a unique band corresponding to linearized plasmid indicated successful mutation (as the only remaining Ncol site in the p22m-GFP plasmid is present upstream of the GFP gene). A 342bp fragment, in addition to linearized plasmid after digestion, indicated the presence of two Ncol sites and therefore intact p22-GFP plasmid. Sequencing was subsequently used to confirm the mutation.

[0137] Insert pMCPK was made using PCR, with primers:

TABLE-US-00010 (KApBamHIF: SEQIDNO:65 5TCGAGGATCCGCCcustom-character GATGATGGATCGGTGACAACCCC- 3, KpXhoInR: SEQIDNO:66 5-TCGACTCGAGTCATAATTTAGTCATAGAACTCCTAATATTAGAGGC- 3,

[0138] which include a start codon in a Kozac sequence at the 5 end of pMCPK. The PCR program used was: 30@98 C., 35x[10@98 C., 10@55 C., 40@72 C.], 5@72 C., @4 C., while the template was cDNA prepared from total RNA isolated from CRFK cells infected with Kalem Crouch FCV. After confirming correct amplicon size on a 1% agarose gel, the insert DNA in the PCR reaction was purified (Qiagen PCR clean-up kit) and digested with BamHI and XhoI parallel with the p22m-GFP plasmid. Upon ligation, this procedure results in the replacement of the GFP insert and 5 and 3 RHDV repeat flanks with pMCPK (FIG. 2). The digested insert and plasmid DNA were loaded on a 1% agarose gel and bands of 1664bp (insert) and 4031bp (plasmid backbone) were excised and purified using the StrataPrep DNA Gel extraction kit (cat: 400766). The backbone and insert were ligated overnight at 4 C., and 2 uL of this ligation was subsequently transformed into XL10 gold E. coli (cat: 200315). Miniprep cultures were set up and the extracted DNA was screened by digesting with both BamHI and XhoI. The identity of the insert was confirmed using the same PCR reaction that generated the pMCPK insert (see above), and subsequently sequencing. Construct p22m-4a was chosen for use in subsequent steps.

[0139] 50 uL of MR24 material diluted in 1 mL M6B8+5% FBS media was applied to a 6 cm dish with 80% confluent RK13 cells over 5 h prior to washing away all unabsorbed MR-24 virus, supplementing with an additional 3 mL of the same media, and transfecting with 4.5 ug of p22m-4a plasmid using Lipofectamine 3000. After 17 h, part of the cells were harvested by gentle scraping and saved together with the media. The remaining half of cells on the plate were fixed (100% EtOH), and stained for immunofluoresence with FCV-antisera followed by with FITC-labelled anti-cat antibody, to confirm expression of pMCPK. Stained cells indicated enhanced pMCPK expression and the possible recombination between p22m-4a and MR-24 to give MR-24-Kalem Crouch, since control cells transfected with p22m-4a alone, or infected with MR-24 alone, did not stain (see FIG. 10 for a diagram of the recombinant MR24-Kalem Crouch virus).

[0140] Enrichment of MR-24-Kalem Crouch recombinant myxoma virus was carried out through successive rounds of titration, immunofluoresence detection of expressed pMCPK, and dilution of enriched samples. Briefly, a series of 96-well tissue culture dishes seeded with RK-13 cells were infected with virus from the infection/transfection at a range of dilutions. After 3 days, all the 96-well dishes were frozen and retained as the first round stocks. A second series of RK-13 seeded 96-well dishes were then infected with material from the first round stocks (5-10 l from each well). After 2-3 days these duplicate dishes were fixed with ice cold methanol and stained first with a cat anti-FCV polyclonal antiserum and then a goat anti-feline IgG FITC labelled second antibody. Wells containing fluorescing foci of infection were identified and the corresponding wells on the first round stock dishes taken, then diluted and used to infect a second series of 96-well dishes, which became the second round stocks. This procedure was repeated until virus stocks contained majority recombinant virus. The final purification was achieved by three rounds of single focus isolation. The three best staining clones (i.e. B8, A9, and A10) were expanded, and clone A9 was used to in further experiments to determine clonal purity (i.e. lack of wild-type MR24 growing in the background) and insert (i.e. pMCPK) sequence stability. MR24-Kalem Crouch was passed 5 times in RK13 cells by inoculating each time at 0.001 MOI.

[0141] To determine the stability of the pMCPK insert, MR24-Kalem Crouch DNA from pass 1 and MR24-Kalem Crouch DNA from pass 5 were compared. No mutations were detected in either p22m-4a vs MR24-Kalem Crouch-pass1, or MR24-Kalem Crouch-pass1 vs MR-24-Kalem Crouch-pass5, indicating that the pMCPK in p22m-4a recombined successfully with MR24 and remained stable over 5 passages of the virus.

[0142] Taken together, these experiments show that the processed major capsid protein of FCV Kalem Crouch (pMCPK) has been inserted into, and is expressed from, the MGF site of the MR24-Kalem Crouch clone A9.

Results

1. Isolation and Growth of FCV Kalem Crouch

[0143] Feline Calicivirus (FCV) strain Kalem Crouch was isolated from a swab taken during an FCV outbreak in Jersey in December 2010. The swab originated from a neutered male, 2 years 6 months, named Kalem Crouch and was collected by New Era Veterinary Surgery, St Saviour, Jersey. The swab was vortexed briefly and the virus suspension inoculated onto confluent CrFK cells and incubated at 37 C. with 5% CO.sub.2 until CPE specific to FCV was observed. The infected flask was freeze thawed to lyse cells, clarified to remove cellular debris and stored at 70 C. The titer of the virus was 10.sup.6.91 TCID.sub.50/ml.

[0144] The nucleotide sequence of the isolate was determined. The sequence is annotated in SEQ ID NO: 60.

[0145] The amino acid sequence of the capsid protein was aligned with other FCV sequences available in the public domain. The sequence alignment is annotated in FIGS. 5 and 7.

2. Generating Recombinant FCV Virus

2.1. Preparation of FCV Amplicons

[0146] FCV F9 or Kalem Crouch cDNA, made as described in methods section 5, was used as template in PCR reactions with the Phusion polymerase (NEB, Ipswich, Mass.), oligonucleotide primer pair FKP1F (SEQ ID NO: 9) and FKP1R (SEQ ID NO: 10), and the conditions described in Table 4 to generate an amplicon covering 5349 bp from the 5 end of FCV genome. Similarly, the oligonucleotide primer pair FKP2F (SEQ ID NO: 11) and FKP2R (SEQ ID NO: 12) and the PCR conditions described in Table 5 were used to generate amplicons covering 2422 bp from the 3 end of FCV F9 and 2416 bp from the 3 end of FCV Kalem Crouch. These amplicons and 5 L of GeneRuler 1 kb Plus DNA ladder (Thermo Scientific, Waltham, Mass.) were resolved by carrying out electrophoresis in 1TBE buffer (Sigma-Aldrich, St. Louis, Mo.) at 120V over 1 h. Bands of the expected size are shown in FIG. 1.

2.2. Assembly of FCV Amplicons Using Overlap Extension PCR

[0147] The FCV amplicons generated in results section 2 were purified using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany). These amplicons were used to make hybrid viruses: Hybrid virus FK comprises the Kalem Crouch capsid in the F9 background and hybrid virus KF comprises the F9 capsid in the Kalem Crouch background.

[0148] To make FCV FK and KF template DNA, equimolar mixtures containing between 0.1 and 0.5 pmol of each amplicon were made with either FCV F9 5 end and FCV Kalem Crouch 3 end amplicons, or FCV Kalem Crouch 5 end and FCV F9 3 end amplicons. These mixtures were used as templates in overlap extension PCR reactions with conditions described in Table 6. The expected sizes of the assembled FK and KF DNA amplicons were 7685 and 7702 bp respectively. The assembled DNA in these samples and 5 L of GeneRuler 1 kb Plus DNA ladder (Thermo Scientific, Waltham, Mass.) were resolved by carrying out electrophoresis in 1TBE buffer (Sigma-Aldrich, St. Louis, Mo.) at 120V over 1 h. The resulting assembled DNA of F9, Kalem Crouch, FK, and KF is shown in FIG. 2.

2.3. Generation of Infectious FCV Virus

[0149] Infectious FCV FK or KF DNA was made using the Phusion polymerase (NEB, Ipswich, Mass.) and the oligonucleotide primer pair FCVT7f (SEQ ID NO: 3) and FCVpAr (SEQ ID NO: 4) with the PCR conditions described in Table 8. The expected sizes of infectious FCV FK and KF DNA are 7728 and 7737 bp respectively. The infectious FCV DNA in these samples and 5 L of GeneRuler 1 kb Plus DNA ladder (Thermo Scientific, Waltham, Mass.) were resolved by carrying out electrophoresis in 1TBE buffer (Sigma-Aldrich, St. Louis, Mo.) at 120V over 1 h. The full length infectious DNA of FK and KF is shown in FIG. 3 parts A and B respectively.

2.4. Recovery of Infectious FCV Virus

[0150] Infectious FCV FK and KF DNA was purified from full-length the full length PCR reactions using the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany), and transfected onto 50-90% confluent BsRT7 cells growing on a 24-well plate using the Invitrogen Lipofectamine 3000 Reagent (Carlsbad, Calif.) as described in methods section 13. Transfected BsRT7 cells were incubated with transfection complexes under normal growth conditions for 24-72 h prior to lysis by freeze-thawing. BsRT7 lysate from each well was then applied to a well growing CrFK cells to confluency between 50 and 100%. CrFK cells grown in the presence of BsRT7 cell lysate were incubated under normal growth conditions, as described in methods section 1. The presence of a virus was typically detected by the formation of plaques in the monolayer of CrFK cells, similar to those shown in FIG. 4.

2.5. Sequence of FCV FK and KF Viruses

[0151] The recombinant FCV viruses were sequenced.

[0152] These sequences have been compared with the sequences of FCV F9 and Kalem Crouch in FIG. 6. The recombinant FK virus is denoted SEQ ID NO: 61 and comprises the Kalem Crouch capsid. The recombinant KF virus is denoted SEQ ID NO: 62 and comprises the F9 capsid.

2.6 Efficacy of Myxo-Kalem Crouch Construct in Cats

Experimental Design

[0153] Fifteen domestic short hair cats between 8-11 weeks of age were divided into two groups. A group of 10 cats vaccinated subcutaneously, twice, three weeks apart with recombinant Myxo-Kalem Crouch construct described above (pass 5) (10.sup.6.23 TCID.sub.50 per dose) and a group of 5 control cats. Four weeks post second vaccination, cats were swabbed and two of the control unvaccinated cats were challenged intra-nasally with virulent FCV strain Kalem Crouch (10.sup.4.0 TCID.sub.50 per cat) and mixed with the rest of the cats for contact challenge. All cats were swabbed daily from day 1 post challenge to day 17 post challenge. Clinical observations, including body weights and temperatures were recorded. The clinical findings were scored as below, see table 8. (An anti-pyretic was administered to alleviate the pyrexia and suffering. In a previous experiment, it was proved that administration of an antipyretic had no effect on virus excretion)

TABLE-US-00011 TABLE 8 Overview of scoring of clinical sign Clinical sign Score Mild malaise (MA+) 1 Pronounced malaise (Ma++) 2 Ulcers present (regardless of number or size) 1 Lameness/limping (regardless of number of affected litext missing or illegible when filed 2 Virus shedding 1 Pyrexia (temperature above 39.5 C.) 1 Antipyretic administered to alleviate pyrexia and suffer 10 (administered when temperature is above 40 C.) (per administration) Weight loss compared to previous day 1 text missing or illegible when filed indicates data missing or illegible when filed

Results

[0154] Cats were devoid of antibodies prior to vaccination (Day-1). A strong sero-conversion was not observed in cats post vaccination (Day 48). A strong sero-conversion was observed in cats post challenge (Day 66).

TABLE-US-00012 TABLE 9 Titer of antibodies F9-specific virus Kalem Crouch-specific neutralising antibodies virus neutralising antibodies Cat Id Group Day -1 Day 48 Day 66 Day -1 Day 48 Day 66 6346 1 4 4 170 4 4 256 7229 1 4 4 102 4 4 386 4297 1 4 13 323 4 4 406 5530 1 4 16 412 4 4 4871 8817 1 5 6 1176 4 4 256 9449 1 4 4 61 4 4 406 6644 1 4 4 82 4 4 215 0498 1 5 4 128 4 4 724 0566 1 4 4 395 4 4 304 6622 1 4 4 64 4 4 64 2987 2 4 4 62 4 4 4096 6446 2 4 4 181 4 4 329 3854 2 4 4 1080 4 4 5270 8741 2 5 4 304 4 4 724 5139 2 5 4 512 4 4 1337

[0155] Virus could not be isolated from the cats at the beginning of the experiment or on the day prior to challenge. Virus could be isolated from all cats of groups 1 and 2, clinical signs associated with FCV were observed in cats belonging to both groups indicating a substantial challenge.

TABLE-US-00013 TABLE 10 Clinical scores Anti- Days Cat Group/ Pyrexia pyretic Clinical Body virus Identity Treatment score score score weight excreted Total 9449 1 1 0 16 6 8 31 8817 Vaccinated 0 0 10 6 15 31 0498 6 10 17 4 13 50 4297 0 0 11 6 14 31 6346 0 0 10 5 13 28 0566 3 0 11 6 14 34 6644 1 0 12 4 14 31 5530 10 20 13 6 12 61 6622 1 0 12 2 16 31 7229 0 0 9 4 10 23 2987 2 8 10 10 6 13 47 6446 Challenge 5 10 16 4 14 49 3854 control 11 20 19 7 10 67 5139 4 10 14 3 10 41 8741 7 0 14 5 16 42

TABLE-US-00014 TABLE 11 clinical signs per group: Pyrexia score Antipyretic score Clinical score Group Mean Median Mean Median Mean Median 1 2.20 1.00 3.00 0.00 12.10 11.50 2 7.0 7.0 10.00 10.00 14.60 14.00 Body weight Days virus excreted Total score Mean Median Mean Median Mean Median 1 4.90 5.50 12.90 13.50 35.10 31.00 2 5.00 5.00 12.6 13.0 49.20 47.00

[0156] A Kruskal-Wallis non parametric test on the data showed statistically significant difference between the vaccinated cats and control cats for total score (P=0.037) and pyrexia score (P=0.020) indicating that the Myxo-Kalem Crouch construct was able to induce immunity against FCV challenge infection (reduction in the clinical scores in cats post challenge).

Experimental Design 2.7 Study to raise hyperimmune serum to FK and KF hybrid viruses of FCV.

[0157] The study comprised six domestic short haired cats between 229 and 432 days of age. These were split into two groups of 3 cats with a relatively even split of toms between groups. Each group was housed separately. After acclimatization, cats belonging to group 1 were inoculated subcutaneously with 10.sup.4.6 TCID.sub.50/dose of FCV strain FK. Cats belonging to group 2 were inoculated subcutaneously with 10.sup.4.6 TCID.sub.50/dose of FCV strain KF.

[0158] All cats then received a second dose of the same virus at 10.sup.5 TCID.sub.50/dose intranasally two weeks later (day 14). Serum was collected three weeks post second inoculation.

[0159] Serum was heat inactivated and a virus neutralisation test carried out. Virus neutralisation was assessed by a reduction of virus-induced cytopathic effect (CPE) on CrFK cells. Five-fold replicates of 32-316 TCID.sub.50 of virus were mixed with an equal volume of serial dilutions of sera (commencing at 1:4). Virus/sera mixtures were then incubated for at least 60 min at 37 C. 100 l of the virus-serum mixtures were then added to 96-well tissue culture dishes seeded with CrFK cells in 100 l growth medium. Incubation was continued for 5 days. The VN titer is expressed as the inverse of the highest serum dilution at which virus-induced CPE was completely absent.

Results

[0160]

TABLE-US-00015 TABLE 12 VN titers post first inoculation (s.c.) Cat Anti Anti Kalem Anti Anti Vaccine number F9 Crouch KF FK FK 8086 39 >64 NT >64 7978 16 >64 NT >64 5466 6 6 NT 6 KF 2274 23 6 >64 NT 9915 46 6 >64 NT 8394 23 6 >64 NT NT: Not Tested

TABLE-US-00016 TABLE 13 VN titers post second inoculation (i.n.) Cat Anti Anti Kalem Anti Anti vaccine number F9 Crouch KF FK FK 8086 56 724 2896 16394 7978 21 215 334 2580 5466 64 645 1625 19484 KF 2274 54 6 1505 5 9915 1024 6 50935 73 8394 512 6 50935 40

[0161] The data shows that recombinant viruses FK and KF are immunogenic in cats. The antibodies developed in the cats were functional (neutralizing). The cross reactivity of the antibodies showed a hierarchy similar to the hierarchy observed between FCV strain F9 and FCV strain Kalem Crouch such that inoculation of cats with hybrid strain KF (F9 capsid) induced virus neutralising antibodies against strains F9 but not against strain Kalem Crouch whilst inoculation with hybrid strain FK (Kalem Crouch capsid) resulted in the induction of virus neutralising antibodies against both strains F9 and Kalem Crouch.

2.8 Neutralisation Index

[0162] Hyper-immune sera raised in cats to strains FCV F9 and Kalem Crouch were used to determine the neutralisation index of the recombinant FCV strains FK and KF. The data is shown in table 7.

[0163] It becomes clear from the table that FCV strain FK is indeed neutralized strongly by anti-FCV Kalem Crouch hyperimmune serum whereas FCV strain KF is indeed neutralized strongly by anti-FCV F9 hyperimmune serum.

TABLE-US-00017 TABLE 14 Neutralising Index of the FCV F9 and Kalem Crouch anti-sera to recombinant FCV FK and KF. Neutralising Neutralising ability ability of anti- of anti-FCV Kalem FCV F9 hyper- Crouch hyper- Virus titre FCV sample immune serum immune serum (log.sub.10/ml) FCV FK hybrid 0.34 6.67 6.67 FCV KF hybrid 3.33 2.67 7 FCV F9 X + 2 3.17 1.83 7.5 FCV Kalem Crouch 1 5.5 5.5 #4063

[0164] Table 14 and the data obtained from sera generated from FK and KF inoculated cats (Table 13) demonstrate that there is a one way hierarchy to virus neutralisation. F9 and KF (F9 capsid) antisera do not neutralise Kalem Crouch or FK (Kalem Crouch capsid) viruses efficiently while the serum from cats vaccinated with Kalem Crouch and FK (Calem Crouch capsid) neutralise self and also neutralise F9 and KF (F9 capsid) viruses significantly.