ANTEROGRADE MULTI-SYNAPTIC TRANSNEURONAL TRACER

20180371467 ยท 2018-12-27

Assignee

Inventors

Cpc classification

International classification

Abstract

A recombinant Herpes Simplex Virus type 1 (HSV-1) strain H129-derived anterograde multi-synaptic transneuronal viral tracer for multi-synaptic neural circuit mapping comprises two or more fluorescence expression cassettes being integrated into the H129 genome at different locations; wherein each fluorescence expression cassette contains at least two copies of fluorescent protein-encoding sequence that are arranged in tandem, and at least one linker-encoding sequence, where at least one linker-encoding sequence is disposed between two fluorescent protein-encoding sequences, allowing transcription of fluorescent protein-encoding sequences and linker-encoding sequence as a single transcript; and wherein the linker-encoding sequence encodes a linker peptide containing at least two adjacent amino acids that are highly inefficient in forming a peptide bond between them; thereby, when the single transcript is translated, at least two fluorescent proteins are stoichiometrically generated due to the impedence of peptide bond formation by the linker peptide.

Claims

1. A recombinant Herpes Simplex Virus type 1 (HSV-1) strain H129-derived anterograde multi-synaptic transneuronal viral tracer for multi-synaptic neural circuit mapping, comprising: two or more fluorescence expression cassettes being integrated into the H129 genome at different locations; wherein each fluorescence expression cassette contains at least two copies of fluorescent protein-encoding sequences that are arranged in tandem, and at least one linker-encoding sequence, where at least one linker-encoding sequence is disposed between two fluorescent protein-encoding sequences, allowing transcription of fluorescent protein-encoding sequences and linker-encoding sequence as a single transcript; and wherein the linker-encoding sequence encodes a linker peptide containing at least two adjacent amino acids that are highly inefficient in forming a peptide bond between them; thereby, when the single transcript is translated, at least two fluorescent proteins are stoichiometrically generated due to the impedence of peptide bond formation by the linker peptide.

2. The recombinant H129-derived anterograde multi-synaptic transneuronal viral tracer of claim 1, wherein the fluorescence expression cassette further comprises a promoter, wherein the promoter controls transcription of the fluorescent protein-encoding constructs and linker-encoding sequence.

3. The recombinant H129-derived anterograde multi-synaptic transneuronal viral tracer of claim 2, wherein the promoter is operable in neuronal cells and selected from the group consisting of CMV promoter, SV40 promoter, CAG promoter, EF1a promoter, TH promoter, and Syn1 promoter.

4. The recombinant H129-derived anterograde multi-synaptic transneuronal viral tracer of claim 1, wherein the fluorescent protein-encoding sequences in one fluorescence expression cassette encode the same or different fluorescent proteins.

5. The recombinant H129-derived anterograde multi-synaptic transneuronal viral tracer of claim 1, wherein the fluorescent protein-encoding sequence encodes a green fluorescence protein (GFP) represented by an amino acid sequence (SEQ ID NO 2) or a variant thereof.

6. The recombinant H129-derived anterograde multi-synaptic transneuronal viral tracer of claim 1, wherein the fluorescent protein-encoding sequence encodes a membrane-bound green fluorescence protein (mGFP) represented by an amino acid sequence (SEQ ID NO 4) or a variant thereof.

7. The recombinant H129-derived anterograde multi-synaptic transneuronal viral tracer of claim 1, wherein the at least two adjacent amino acids of the linker peptide are glycine and proline.

8. The recombinant H129-derived anterograde multi-synaptic transneuronal viral tracer of claim 1, wherein the linker-encoding sequence encodes a linker peptide represented by an amino acid sequence (SEQ ID NO 6) or a variant thereof.

9. The recombinant H129-derived anterograde multi-synaptic transneuronal viral tracer of claim 1, wherein the fluorescent protein-encoding sequence and linker-encoding sequence encode a peptide represented by an amino acid sequence (SEQ ID NO 8) or variant thereof.

10. The recombinant H129-derived anterograde multi-synaptic transneuronal viral tracer of claim 1, further comprises a BAC sequence.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Preferred embodiments according to the present invention will now be described with reference to the Figures, in which like reference numerals denote like elements.

[0017] FIG. 1 shows the schematic diagrams of (a) the genome structure of H129-wt, (b) the genome structure of H129-G1, (c) the genome structure of H129-G3, (d) the genome structure of H129-G4, (e) construction of pUS-F6, and (f) construction of H129-BAC (i.e. H129-G1).

[0018] FIG. 2 presents: (a) identification results of H129-G1 monoclones by PCR; (b) GFP signal from the expression of GFP accompanying virus replication and resulted cytopathic effects; (c) viral proteins by Western blot; (d) the growth curves of H129-wt and H129-G1; (e) the growth curves of H129-wt, H129-G1, H129-G3 and H129-G4 in VERO cells.

[0019] FIG. 3 presents (a) images and (b) a graph showing the fluorescence intensities of H129-G1, H129-G3 and H129-G4 in vitro.

[0020] FIG. 4 shows a schematic structure diagram of the microfluidic system.

[0021] FIG. 5 shows the anterograde transmissions of H129-G4 in cultured neurons. (a-b) Soma entry and anterograde labeling of H129-G4; (c-d) Anterograde transneuronal labeling of H129-G4.

[0022] FIG. 6 shows the tracing time course of VPM-S1 circuit using H129-G3.

[0023] FIG. 7 shows the mapping of the M1 projection output using H129-G4.

[0024] FIG. 8 shows the mapping of the M1 projection output in tree shrew using H129-G4.

[0025] FIG. 9 shows the tracing the visual pathway using H129-G4.

[0026] FIG. 10 shows the tracing the olfactory pathway using H129-G4.

DETAILED DESCRIPTION OF THE INVENTION

[0027] The present invention may be understood more readily by reference to the following detailed description of certain embodiments of the invention.

[0028] Throughout this application, where publications are referenced, the disclosures of these publications are hereby incorporated by reference, in their entireties, into this application in order to more fully describe the state of art to which this invention pertains.

[0029] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art. Such techniques are explained fully in the literature, for example, Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989); Current Protocols in Molecular Biology (F. M. Ausubel et al., eds., 1987).

[0030] Herpes Simplex Virus type 1 (HSV-1) is a ubiquitous and opportunistic pathogen. The naturally neuronal tropism and transneuronal transmitting capacity make this virus a potential neuronal circuit tracer.

[0031] HSV-1 strain McIntyre-B spreads retrogradely, whereas HSV-1 strain H129 prefers anterograde transneuronal transport [6-8]. Multiple studies have applied this virus in various pathways and different animal models [6, 9-12]. In particular, the development of genetically modified fluorescent protein (FP)-expressing H129 prompted the investigations of this virus strain in anterograde neuronal circuit tracing [3, 13]. However, due to limited labeling intensity, those H129-derived tracers allow neither the visualization of projecting paths, nor the display of neuron morphology in detail [5, 14].

[0032] The present invention provides a H129-derived anterograde multi-synaptic transneuronal viral tracer for mapping multi-synaptic neural circuits, where the H129-derived anterograde multi-synaptic transneuronal viral tracer has high labeling intensity sufficient for visualizing fine neuronal structures including axonal fibers and dendritic spines and is also compatible with fluorescence Micro-Optical Sectioning Tomography (fMOST). Briefly, the H129-derived anterograde multi-synaptic transneuronal viral tracer is a recombinant Herpes Simplex Virus type 1 (HSV-1) strain H129 that comprises two or more fluorescence expression cassettes being integrated into the H129 genome at different locations, wherein each fluorescence expression cassette contains at least two copies of fluorescent protein-encoding sequence that are arranged in tandem, and at least one linker-encoding sequence, where at least one linker-encoding sequence is disposed between two fluorescent protein-encoding sequences, allowing transcription of fluorescent protein-encoding sequences and linker-encoding sequence as a single transcript; and wherein the linker-encoding sequence encodes a linker peptide containing at least two adjacent amino acids that are highly inefficient in forming a peptide bond between them; thereby, when the single transcript is translated, at least two fluorescent proteins are stoichiometrically generated due to the impedence of peptide bond formation by the linker peptide. For example, when two fluorescent protein-encoding sequences coupled by the linker-encoding sequence are translated, two fluorescence proteins (not as one fused protein) are stoichiometrically produced.

[0033] In certain embodiments, Herpes Simplex Virus type 1 (HSV-1) strain H129 has a large genome (GenBank GU734772.1). As shown in FIG. 1(a), H129-wt has a typical HSV-1 structural architecture. The HSV-1 genome can be viewed as consisting of two covalently linked components, designated as unique long (L) and unique short (S). Each component consists of unique sequences bracketed by inverted repeats. The L and S components of HSV-1 are found inverted relative to one another, to yield four linear isomers.

[0034] In certain embodiments, the fluorescence expression cassette comprises a promoter, at least two copies of fluorescent protein-encoding sequence that are arranged in tandem, and at least one linker-encoding sequence, where at least one linker-encoding sequence is disposed between two fluorescent protein-encoding sequences so that the fluorescent protein-encoding sequences and linker-encoding sequences are transcribed as a single transcript.

[0035] In certain embodiments, the promoter can be any promoter operable in neuronal cells. In certain embodiments, the promoter includes CMV promoter, SV40 promoter, CAG promoter, EF1a promoter, TH promoter, and Syn1 promoter.

[0036] In certain embodiments, the fluorescent protein-encoding sequence suitable for the present invention can be any fluorescence genes available in the field in the present and future. The fluorescence genes can be wild-type or recombinant derivatives as long as they have no less fluorescent intensity. For example, the fluorescent protein-encoding genes include GFP (green fluorescent protein), eGFP (enhanced green fluorescent protein), mGFP (membrane bound form of EGFP), sfGFP (superfolder green fluorescent protein), EYFP (enhanced yellow fluorescent protein), ECFP (enhanced cyan fluorescent protein), EBFP2 (enhanced blue fluorescent protein 2), tdTomato, MRFP (monomer red fluorescent protein, mCherry, Ypet, mKO, mkate, etc. In certain embodiments, the at least two fluorescent protein-encoding sequence in one expression cassette can be the same or different. In certain embodiments, the fluorescent protein-encoding sequence is represented by a nucleotide sequence (SEQ ID NO 1) encoding a green fluorescence protein (GFP) represented by an amino acid sequence (SEQ ID NO 2). In certain embodiments, the fluorescent-encoding construct is represented by a nucleotide sequence (SEQ ID NO 3) encoding a membrane-bound green fluorescence protein (mGFP) represented by an amino acid sequence (SEQ ID NO 4). In certain embodiments, their variants can be used; where the variant is defined as a protein that shares at least 90%, preferably 95%, more preferably 98% or even more preferably 99% identity with an amino acid sequence represented by a SEQ ID NO number as long as the changes in the variant do not interfere its function.

[0037] In certain embodiments, the linker-encoding sequence encodes a linker peptide, where the linker peptide contains at least two adjacent amino acids that are highly inefficient in forming a peptide bond between them. In certain embodiments, the at least two adjacent amino acids are glycine and proline. In certain embodiments, the linker-encoding sequence represented by a nucleotide sequence (SEQ ID NO 5) encodes a linker peptide represented by an amino acid sequence (SEQ ID NO 6). In certain embodiments, their variants can be used; where the variant is defined as a protein that shares at least 90%, preferably 95%, more preferably 98% or even more preferably 99% identity with an amino acid sequence represented by a SEQ ID NO number as long as the changes in the variant do not interfere its function.

[0038] In certain embodiments, the at least two copies of fluorescent protein-encoding sequence and at least one linker sequence are represented by a nucleotide sequence (SEQ ID NO 7) encoding a polypeptide represented by an amino acid sequence (SEQ ID NO 8). In certain embodiments, their variants can be used; where the variant is defined as a polypeptide that shares at least 90%, preferably 95%, more preferably 98% or even more preferably 99% identity with an amino acid sequence represented by a SEQ ID NO number as long as the changes in the variant do not interfere its function.

[0039] In certain embodiments, the fluorescence expression cassettes are inserted into any site of H129 genome as long as the insertion does not interfere with viral replication. In certain embodiments, the insertion site is located at the noncoding region of any two adjacent genes. In certain embodiments, the insertion site of BAC is 46616-46617, and in H129-G3, mGFP was inserted at 24671-24672.

[0040] In certain embodiments, the recombinant H129 genome contains a bacterial artificial chromosome (BAC) sequence; thereby the recombinant H129 genome can be manipulated in bacteria. The BAC sequence can be inserted into any appropriate site of H129 genome; for example, the BAC sequence is inserted at 46616-46617 of the viral genome. The large viral genome can be maintained in the BAC, facilitating genetical manipulation, such as insertion or deletion of one or more genes by homologous recombination, and subsequent transfection into eukaryotic cells to rescue infectious virus with the target gene deleted or added [18, 19].

[0041] The following examples are provided for the purpose of illustrating the application of the principles of the present invention; they are by no means intended to be the coverage of the present invention.

Examples

[0042] (1) Cells and Cell Culture

[0043] VERO-E6 cells (VERO, ATCC#CRL-1586) were cultured in Dulbecco's modified Eagle medium (DMEM) containing 10% fetal bovine serum (FBS) and penicillin-streptomycin (100 U/ml of penicillin and 100 g/ml of streptomycin, Gibco/Life Technology).

[0044] Fetal mouse hippocampal neurons were isolated and cultured following the established protocol [20, 21]. Briefly, hippocampi were dissected from C57BL/6 mouse pups at embryonic day 18.5 (E18.5), sliced and further dissociated with trypsin/DNase I for 15 min at 37 C. Isolated neurons were washed with sterile Hank's Balance Salt Solution (HBSS), resuspended and cultured in neurobasal medium supplemented with 2% B27, GlutaMAX (25 M) and penicillin-streptomycin (100 U/ml and 100 g/ml). Medium was changed every other day.

[0045] (2) Construction of H129-G1

[0046] H129-BAC (i.e. H129-G1) was constructed by cloning the genome of H129 (GenBank GU734772.1) into a BAC containing a GFP. FIGS. 1e and 1f show the process of constructing H129-G1.

[0047] (2.1) Preparation of H129-wt Viral Genomic DNA

[0048] Wild type H129 virus [22] was used to infect VERO cells at an MOI of 1. At 12 h post-infection, cells were scraped and collected by centrifugation. The collected cells were washed once with solution I (10 mM Tris, 10 mM EDTA, pH 8.0), then resuspended in 0.5 ml solution I containing 0.25 mg of proteinase K/ml (Roche), 0.6% sodium dodecyl sulfate (SDS) (Sinopharm Group, China), and 1 M sodium chloride, and incubated at 50 C. for 2 hours, then added RNase I (TaKaRa, Japan) to a final concentration of 10 mg/ml and incubated at 37 C. for 1 hour, and finally extracted the cells using phenol chloroform (1:1) to obtain DNA precipitation. The DNA precipitation was dried, and then resuspended in sterile de-ionized water (100 l). This dissolved DNA solution contains a large amount of H129-wt genomic DNA.

[0049] (2.2) PCR Amplification of Left and Right Homologous Arms Respectively

[0050] H129-wt virus genome was used as template for PCR amplification of left and right homologous arms. The left arm (L-arm) consisted of 1606 bp corresponding to genome sequence of No. 45011-46616 in HSV-1-H129 genome (GenBank accession number: GU734772.1); the right arm (R-arm) consisted of 1954 bp corresponding to genome sequence of No. 46617-48570. The total volume of the PCR reaction system (Primestar DNA polymerase, Takara) was 50 l, consisting of 10 l 5 buffer, 4 l dNTP, 1.5 l forward primer, 1.5 l reverse primer, 0.5 l Primestar enzyme, 1 l template, and 31.5 l H.sub.2O. Left arm forward primer sequence was 5-cgggatccagactgacacattaaaaaacac-3 (SEQ ID NO 9), left arm reverse primer sequence was 5-cccaagcttataacttcgtataatgtatgctatagacgttataacggaaggagacaataccg-3 (SEQ ID NO 10), right arm forward primer sequence was 5-cccaagcttataacttcgtataatgtatgctatacgaagttattcagttagcctcccccatctc-3 (SEQ ID NO 11), and right arm reverse primer sequence was 5-cgggatcccttcggacctcgcgggggccgc-3 (SEQ ID NO 12). The amplification conditions were as follows: 1) 94 C. 2 min; 2) 98 C. 15 s; 3) 55 C. 15 s; 4) 72 C. 2 min; 5) 72 C. 10 min; 6) 16 C. 10 min; where steps 2-4 were cycled 30 times. Then the PCR product was run on 1% agarose gel electrophoresis (Biowest, Spain), and left and right arms for homologous recombination were purified following the instructions from the kit (Omega, US).

[0051] (2.3) Ligation of Left and Right Homologous Arms

[0052] The purified left and right arms were digested respectively by restriction endonuclease BamHI (TaKaRa); the total volume of enzyme reaction was 50 l, and DNA was 2 g; incubation was about 4 hours at 37 C. in water bath; digested DNAs were purified by 1% agarose gel electrophoresis. The purified left and right homologous arms were directly ligated, where the reaction volume of ligation was 10 l, consisting of 1 l T4 DNA Ligase (TaKaRa), 1 l 10 buffer, 8 l left and right arm DNAs (concentration ratio 1:1). After incubation of 4 hours at 16 C., the full length of left and right arms (L+R) was amplified by PCR, where the total volume of PCR amplification was 50 l, consisting of 10 l 5 buffer, 4 l dNTP, 1.5 l left arm forward primer (5-cgggatccagactgacacattaaaaaacac-3 (SEQ ID NO 13), 1.5 l right arm reverse primer (5-cgggatcccttcggacctcgcgggggccgc-3 (SEQ ID NO 14), 0.5 l PrimeStar enzyme, 1 l template, 31.5 l H.sub.2O. The amplification conditions were as follows: 1) 94 C. 2 min; 2) 98 C. 15 s; 3) 55 C. 15 s; 4) 72 C. 2 min; 5) 72 C. 10 min; 6) 16 C. 10 min; steps 2-4 cycled 30 times. Full length (L+R) DNA fragment of homologous recombination arm was purified by 1% agarose gel electrophoresis.

[0053] (2.4) Construction of pUS-F6

[0054] Cyclic pUS-F5 vector (SEQ ID NO 59) and above purified L+R DNA fragments were digested by HindIII (TaKaRa), respectively. The total volume of enzyme digestion was 50 l containing 2 g DNA; after incubated at 37 C. in water bath for about 4 hours, they were purified by 1% agarose gel electrophoresis respectively. The purified linear pUS-F5 vector and L+R DNA fragments were ligated in ligation reaction. The total volume of ligation reaction was 10 l, consisting of 1 l T4 DNA Ligase (TaKaRa), 1 l 10 buffer, 4l l L+R DNA fragments and 4 l linear pUS-F5 vector. After incubation at 16 C. for about 4 hours, the reaction mixture was directly transfected into activated E. coli DH5 cells; cultured at 37 C. overnight; by PCR verification and sequencing, the pUS-F5 plasmid containing the left and right arm homologous sequence was designated as pUS-F6.

[0055] (2.5) Linearization of pUS-F6

[0056] pUS-F6 plasmid was extracted using Plasmid Extraction Kit (Promega, US); the extracted cyclic pUS-F6 plasmid was digested with BamHI, where the total volume of enzyme reaction was 50 l containing 2 g DNA; setting up 4 parallel digestion tubes; after incubation at 37 C. in water bath for 4 hours, directly added into each tube 2 times of anhydrous alcohol and 20 l sodium acetate (3M); after mixing, incubated at 80 C. for about 10 minutes; resuspended DNA precipitate in a small amount of sterile de-ionized water (20 l), and the concentration was finally determined using NanoDrop 2000 (Thermo Scientific).

[0057] (2.6) Transfection of Linearized pUS-F6 Plasmids into 293T Cells

[0058] Cells were plated in 6-well plate the day before transfection and incubated overnight; cell confluence reached 50-80% at the day of transfection. 2 g linear pUS-F6 plasmid DNA was mixed with DMEM medium containing no serum and antibiotics (GIBCO, US), then added 10 l transfection reagent (SuperFect Transfection Reagent, Qiagen GmbH), and incubated at room temperature for 10-15 minutes; then added the transfection mixture into 6-well plate, and cultured for 3 to 4 hours; then washed once with PBS, added complete DMEM medium (GIBCO), and cultured in CO.sub.2 incubator at 37 C.

[0059] (2.7) Infection of H129-wt Virus

[0060] 5-6 hours after the plasmid transfection in above step of (2.6), 293T cells were infected with H129-wt virus at multiplicity of infection (MOI) of 1-3 (MOI=1-3), and immediately put into 5% CO.sub.2 incubator (Thermo Scientific) and cultured at 37 C.

[0061] (2.8) Cell Sorting by FACS

[0062] 24 hours after the virus infection in the above step (2.7), the expression of green fluorescent protein was observed under an inverted fluorescence microscope (Nikon, Japan). If the positive rate is higher than 1%, they are ready for cell sorting 293T cells were first treated by trypsin (GIBCO) and washed by PBS once; then cell suspensions were filtered by 300 mesh membrane treated with sterilization, sorting the 293T cells passing through the 300 mesh membrane by FACS. GFP expression positive 293T cells were individually sorted out, and co-cultured with prior plated VERO cells.

[0063] (2.9) Preparation of H129-G1 Recombination Viral Genomic DNA

[0064] After the sorted GFP positive 293T cells and VERO cells were co-cultured in above step (2.8) for about 48 hours, the expression of green fluorescent protein (GFP) was observed. If the GFP positive rate is more than 20%, H129-G1 recombination viral genomic DNA could be prepared by the same method as described in above step (2.1).

[0065] (2.10) Preliminary Screening and Verification of Individual H129-G1 Infectious Clones

[0066] H129-G1 recombinant viral genomic DNA prepared in the above step (2.9) was electroporated (1.6 KV, 25 uF and 200 , 1 mm) into activated DH10B cells (Invitrogen, US); DH10B cells were coated onto LB plates containing chloramphenicol (Kermel), and incubated at 37 C. culture for 36-48 hours. Monoclones were verified by PCR as described in the above steps (2.2). The verification sequences are H129-wt genes, including UL3, UL14, UL26, UL37, UL38, UL50, US3, US8 and US12. The following primers are included: UL3-F:TCGGTTTGAAAGGCATCG (SEQ ID NO 15), UL3-R: GACAAGGTCGCCATCTGCT (SEQ ID NO 16); UL14-F: GGGCACGCGAGACTATCAGAG (SEQ ID NO 17), UL14-R: TCATTCGCCATCGGGATAGTC (SEQ ID NO 18); UL26-F: ATGGAGGAGCCCCTACCAGA (SEQ ID NO 19), UL26-R: TACCAAAGACCGGGGCGAAT (SEQ ID NO 20); UL37-F: TGGTAACTAGTTAACGGCAAGTCCG (SEQ ID NO 21), UL37-R: ATGCCGGGACTTAAGTGGCCGTATA (SEQ ID NO 22); UL38-F: ATGAAGACCAATCCGCTACCCGCA (SEQ ID NO 23), UL38-R: AACACTCGCGTTTCGGGTTTCAGT (SEQ ID NO 24); UL50-F: ATGAGTGGGGGATCCGG (SEQ ID NO 25). UL50-R: CCCGGAACGAACCCCAAGCT (SEQ ID NO 26); US3-F: GCCAACGACCACATCCCT (SEQ ID NO 27), US3 R: CAGCGGCAAACAAAGCAG (SEQ ID NO 28); US8-F: GGGGTITCTTCTCGGTGTTTG (SEQ ID NO 29), US8-R: GCGGTGCTGATGOTAATGTG (SEQ ID NO 30); US12-F: AAATGCCCTAGCACAGGGG (SEQ ID NO 31), US12-R: GGTCTCTCCGGCGCACATAA (SEQ ID NO 32). Using H129-wt as positive control, the verification results are shown in FIG. 2(a).

[0067] (2.11) Rescue Infectious Virus from H129-G1

[0068] The day before transfection, VERO cells were seeded onto 6-well plates until about 100% confluence. VERO cells were transfected with H129-G1 DNA obtained from the above step (2.10). Transfection mixtures were prepared as follows: 2 g cyclic H129-G1 DNA, 10 l SuperFect Transfection Reagent, and serum- and antibiotic-free DMEM culture media were mixed into 100 l mixture, placed at room temperature for 5-10 minutes, then diluted with 600 l serum- and antibiotics-free DMEM diluted to form the transfection mixture. The cell culture medium was removed; the cells were washed with pre-warmed PBS, then added the transfection mixture, and cultured in incubator. After 2-3 hours, the transfection mixture was sucked off; cells were washed once with PBS, and finally added DMEM medium for further culture. Cytopathic effects appeared about 48 hours after transfection with H129-G1 DNA. When observed under inverted microscope, cytopathic effects were observed, demonstrating that infectious virus was successfully rescued from H129-G1 DNA, as shown in FIG. 2(b). And then continuing the culture until all cells were cytopathic, the supernatant from the culture was collected, that contains H129-G1 recombinant virus, adding 1% of the DMSO for storage at 80 C.

[0069] (2.12) Detection of Protein Expressions of Recombinant Viruses

[0070] VERO cells were cultured in 100 mm culture dish at 37 C., 5% CO.sub.2. After completely attached, the cells were infected at an MOI=1 by H129-wt and H129-G1, respectively. After adsorption at 37 C., 5% CO.sub.2 culture incubator for 2 h, the inoculation solutions were replaced by MEM culture media containing 2% fetal bovine serum. After infection for 24 hours, cells were treated by trypsin, and collected by 1000 rmp centrifugation for 5 minutes. The cells were washed with pre-cooling PBS, and the supernatant was removed by centrifugation. The cells were collected and deposited in liquid nitrogen for 10 seconds, and were used as a sample for Western blot analysis.

[0071] Western blot was performed as follows: cell precipitates were added with 50 l lysis buffer, and then sonicated. The protein contents were measured; then 5 sample buffer was added; same amount of protein samples (20 g) were separated by SDS-polyacrylamide gel electrophoresis (PAGE). Subsequently membrane transfer was performed; first the nylon membrane was treated by methanol for 2 minutes, then immersed in the transfer buffer for 15 minutes, and proteins from PAGE were transferred to the membrane. Transfer conditions were constant current 200 mA, 90 minutes (Bio-Red, US). After the transfer was completed, the membrane was immediately washed with TBST solution for 3 minutes, then blocked with 5% milk/TBST for 1 hour, washed three times with TBST, and incubated with gD- and gB-specific monoclonal antibodies (Abcam) respectively. After washing, the membrane was incubated secondary antibodies and then washed again. Finally, the membrane was developed with chemical luminescence (Alpha Company, US); the results are shown in FIG. 2(c).

[0072] (2.13) Comparison of Growth Between H129-wt Virus and Recombinant H129-G1 Virus

[0073] VERO cells were passaged to 6-well plate (CORNING, US) with 60-80% confluence. When cells were completely attached, the cells were infected by H129-wt or H129-G1 respectively at 0.1 MOI (designated as 0 hour post-infection). The culture media were replaced after 2 hours. DMEM was used to culture the cells after infection, and then at 2, 6, 12, 24, 36, and 48 h samples were collected and stored at 80 C. When all virus samples were collected the virus titers of each sample were determined according to the following steps.

[0074] Virus titer was determined as follows: VERO cells were passaged to 12-well plate until they were 100% confluence. H129-wt and H129-G1 virus were serially diluted by culture media, and each concentration had three repeats. Culture media was siphoned off and cells were washed once with PBS. Each well was added 200 l virus solution. After incubation for 1.5 hours, the virus inoculum was siphoned off, and the cells were washed three times with PBS. Each well was added 2 ml complete media containing 2% FBS, and the cells were cultured for 24 to 48 hours, and closely monitored until the plaque number at the minimum concentration no longer increased. The culture media were discarded, and each well was added with 300 l of staining agent. After incubation, washed with double distilled water repeatedly, then counted plaque numbers and calculated the virus titers; the results are shown in FIG. 2(d).

[0075] (3) Construction of H129-G3

[0076] H129-G3 was derived from H129-G1 by homologous recombination. FIG. 1(c) shows structural architecture of H129-G3.

[0077] (3.1) Cassette Construction

[0078] By PCR, enzyme digestion, ligation and transformation, zeo.sup.R was cloned into the vector pRK-GFP (SEQ ID NO 60), and a cassette CMV promoter-GFP-ZeoR was constructed, where forward primer F: CGGGATCCCAAGTTTCGAGGTCGAGTGTC (SEQ ID NO 33), reverse primer R: GCGAATTCGGAACGGACCGTGTTGACAA (SEQ ID NO 34). Using the same method, the mGFP was cloned into the vector pRK-kan, and a cassette CMV promoter-mGFP-kan.sup.R was constructed, where forward primer F: GCGTCGACATGCTGTGCTGTATGAGAAG (SEQ ID NO 35), reverse primer R: CGGGATCCTTACTTGTACAGCTCGTCC (SEQ ID NO 36).

[0079] (3.2) Preparation of E. coli Competent Cells Containing H129-G1

[0080] (i) E. coli DY380 containing H129-G1 cells were streaked on solid LB plate containing the corresponding resistance, cultured at 32 C. overnight;

[0081] (ii) Monoclones were picked up and cultured in 5 ml LB media, on a shaker at 32 C. overnight;

[0082] (iii) with a scale of 1:100 the culture media from (ii) was transferred to 100 ml culture medium, on a shaker, cultured at 32 C. about 3 hours till OD600 value is about 0.4-0.6 (0.55-0.6 for the best);

[0083] (iv) treated in water bath at 42 C. for 15 minutes;

[0084] (v) cooled the bacterial suspension on ice for about 10 minutes;

[0085] (vi) centrifuged at 4000 rpm at 4 C. for 10 minutes to remove supernatant;

[0086] (vii) resuspended bacteria precipitation in ultra pure water, and centrifuged at 4000 rpm at 4 C. for 10 minutes to remove supernatant;

[0087] (viii) resuspended bacteria precipitation with 10% glycerol, and centrifuged at 4000 rpm at 4 C. for 10 minutes to remove supernatant;

[0088] (x) repeat step (viii) once;

[0089] (x) resuspended bacteria precipitation in 800 l pure water containing 10% of glycerol, aliquot 80 l per tube, snap freezing in liquid nitrogen, stored at 80 C.

[0090] (3.3) PCR Amplification of Cassettes

[0091] Polymerase chain reaction (PCR) reaction (Primestar DNA polymerase, Takara) had a total volume of 50 l, consisting of 10 l 5 buffer, 4 l dNTP, 1.5 l forward primer, 1.5 l reverse primer, 0.5 l Primestar enzyme, 1 l template, and 31.5 l H.sub.2O. Primer sequences are shown in Table 1 below. The amplification conditions were: 1) 94 C. 2 min, 2) 98 C. 15 s, 3) 55 C. 15 s, 4) 72 C. 3 min, 5) 72 C. 10 min, 6) 16 C. 10 min, where steps 2-4 cycled 30 times. Then the PCR products were separated on 1% agarose (Biowest, Spain) gel electrophoresis; the purification was performed completely in accordance with the instruction of purification kit (Omega), and finally the DNA fragments were eluted with de-ionized water.

TABLE-US-00001 TABLE1 Forwardandreverseprimersequencesfor amplificationofthecassettesbyPCR Cassettes Primersequences F:caaagaatggatgggaggagttcaggaagccgggga gagggcccgcggcgacattgattattgactagttattaa tag(SEQIDNO37) R:ccgcaccaacccgccagaagagccaaagtcaacaca acaacgccttaaatgaggcggccgcactagtgatagatc t(SEQIDNO38) F:cgaccgtggtgtatgtctggtgtgtggcgtccgatc ccgttactatcaccacattgattattgactagttattaa tag(SEQIDNO39) R:cgtgtcgtttttaaaaaacccacaatcgccggggtt gaggggggggggacgttcaggtggcacttttcggggaaa tg(SEQIDNO40)

[0092] (3.4) Construction of H129-G2 by Electroporation of Cassette pRK-CMV-GFP-Zeo and Homologous Recombination

[0093] 300 ng cassette DNA (about 5-15 l) was added into and with H129-G1 containing Escherichia coli competent cells prepared in step (2); electroporation conditions were 1.6/1.8 kv, 25 uF and 200, 1 mm; after electroporation, quickly added media and uniformly mixed, transferred to 1.5 ml EP tubes and cultured at 32 C. for 1-2 hours. The bacteria were evenly coated on LB plate containing the corresponding screening resistance, cultured at 32 C. for 36-48 h; colonies were selected and verified by PCR.

[0094] (3.5) Preparation of E. coli Competent Cells Containing H129-G2

[0095] E. coli competent cells containing H129-G2 were prepared using the same method as described in step (3.2).

[0096] (3.6) Construction of H129-G3 by Electroporation of Cassette pRK-CMV-mGFP-Kan and Homologous Recombination

[0097] Construction of H129-G3 by electroporation of cassette pRK-CMV-mGFP-kan and homologous recombination was performed using the similar procedures as described in step (3.4) except for use of H129-G2 E. coli competent cells prepared in step (3.5).

[0098] (3.7) Rescue H129-G3 Virus

[0099] The monoclone bacteria cells verified for containing H129-G3 were inoculated into 200 ml LB media, and cultured at 32 C. overnight; then extracted DNA using kit (MN Company) according to its instructions; and finally the extracted DNA was dissolved in de-ionized water. The day before transfection, VERO cells were seeded onto 6-well plates until about 80% confluence. VERO cells were transfected with the above extracted H129-G3 DNA. Transfection mixtures were prepared as follows: 2 g cyclic H129-G3 DNA, 10 l SuperFect Transfection Reagent, and serum- and antibiotic-free DMEM culture media were mixed into 100 l mixture, placed at room temperature for 5-10 minutes, then diluted with 600 l serum- and antibiotics-free DMEM diluted to form the transfection mixture. The medium was removed, cells were washed with pre-warmed PBS, the transfection mixture was added, and cultured in incubator. After 2-3 hours, the transfection mixture was sucked off; cells were washed once with PBS, and finally added with DMEM medium for culture. Cytopathic effects began about 48 hours after transfection with H129-G3 DNA. When observed under inverted fluorescence microscope, green fluorescence was observed at the pathological lesions, demonstrating that it was a success for rescuing infectious virus clone. And then continuing the culture until all cells were cytopathic, supernatant was collected, that contains H129-G3 recombinant virus, adding 1% of the DMSO for storage at 80 C.

[0100] (4) Construction of H129-G4

[0101] H129-G4 was constructed based on H129-G1.

[0102] (4.1) Knock-Out Loxp Sequence from the Left End of the BAC Sequence

[0103] (4.1.1) Cassette Kan (i.e. kan.sup.R gene) was amplified by PCR, where the template was derived from plasmid pGBK-T7 (Clonetech, K1612-1). The amplified cassette Kan was used for replacing the loxP and cam.sup.R gene located at the left end of BAC sequence; forward primer (F): tttattgccgtcatagcgcgggttccttccggtattgtctccttccgtgttcgctcagaagaactgtcaagaaggc (SEQ ID NO 41); reverse primer (R): cgggcgtattttttgagttatcgagattttcaggagctaaggaagctaaaatgattgaacaagatggattgcacgc (SEQ ID NO 42). PCR reaction (Primestar DNA polymerase, Takara) had a total volume of 50 l, consisting of 10 l 5 buffer, 4 l dNTP, 1.5 l forward primer, 1.5 l reverse primer, 0.5 l Primestar enzyme, 1 l template, and 31.5 l H.sub.2O. The amplification conditions were: 1) 94 C. 2 min, 2) 98 C. 15 s, 3) 55 C. 15 s, 4) 72 C. 1 min, 5) 72 C. 10 min, 6) 16 C. 10 min, where steps 2-4 cycled 30 times. Then the PCR products were separated on 1% agarose (Biowest, Spain) gel electrophoresis; the purification was performed completely in accordance with the instruction of purification kit (Omega), and finally the DNA fragments were eluted with 30 l de-ionized water.

[0104] (4.1.2) Preparation of E. coli Competent Cells Containing H129-G1

[0105] E. coli competent cells containing H129-G1 were prepared using the same method as described in step (3.2).

[0106] (4.1.3) Construction of H129-BAC-DLloxp by Electroporation of Cassette Kan and Homologous Recombination

[0107] Construction of H129-BAC-DLloxp by electroporation of cassette kan and homologous recombination was performed using the similar procedures as described in step (3.4) except for use H129-BAC E. coli competent cells prepared in step (4.1.2). For PCR verification, forward primer (F): caacacccgtgcgttttattc (SEQ ID NO 43), and reverse primer (R): gtaagaggttccaactttcacc (SEQ ID NO 44) were used.

[0108] (4.2) Construction of H129-BAC-mGFP-2A-GFP, and Knock-Out Loxp Sequence from the Right End of BAC Sequence

[0109] (4.2.1) Construction of Cassette CMV-Promoter-mGFP-2A-GFP-Zeo.sup.R for Replacing the Loxp Sequence and SV40-Promoter-GFP at the Right End of BAC

[0110] Construction of vector pRK-OFP-zeo: inserted resistance gene zeocin into vector pRK-GFP between BamH I and EcoR I; zeocin has an independent EM7 promoter; forward primer (F): cgggatcccaagtttcgaggtcgagtgtc (SEQ ID NO 45); reverse primer (R): gcgaattcggaacggaccgtgttgacaa (SEQ ID NO 46). Construction of vector pRK-mGFP-2A-GFP-zeo: inserted mGFP-2A sequence into vector pRK-GFP-zeo between Hind III and Sal I (removed the mGFP termination codon); forward primer (F): cccaagcttatgctgtgctgtatgagaag (SEQ ID NO 47); reverse primer (R): cggtcgactgggccaggattctcctcgacgtcaccgatgagcagatcctctgccctccttgtacagctcgtcc (SEQ ID NO 48).

[0111] (4.2.2) PCR Amplification of Cassette CMV-Promoter-mGFP-2A-GFP-Zeo.sup.R

[0112] The template was vector pRK-mGFP-2A-GFP-zeo, where forward primer (F): aggtaccttctgaggcggaaagaaccagtggaatgtgtgtcagttagacattgattattgactagttattaatag (SEQ ID NO 49); reverse primer (R): tctgcgacctggcgcgcacgtttgcccgggagatgggggaggctaactgaggaacggaccgtgttgacaattaatc (SEQ ID NO 50); and the steps of PCR reaction and purification of DNA product were similar to the step (4.1.1).

[0113] (4.2.3) Preparation of E. coli Competent Cells Containing H129-BAC-DLloxp

[0114] E. coli competent cells containing H129-BAC-DLloxp were prepared using the same method as described in step (3.2).

[0115] (4.2.4) Construction of H129-BAC-mGFP-2A-GFP by Electroporation and Homologous Recombination

[0116] Construction of H129-BAC-mGFP-2A-GFP by electroporation of cassette CMV-promoter-mGFP-2A-GFP-Zeo.sup.R and homologous recombination was performed using the similar procedures as described in step (3.4). For PCR verification, forward primer (F): acctctgaaagaggaacttgg (SEQ ID NO 51), and reverse primer (R): gatggtccagacccacgtcac (SEQ ID NO 52).

[0117] (4.3) Construction of H129-mGFP-2A-GFP-BAC-mGFP-2A-GFP (i.e. H129-G4)

[0118] (4.3.1) Construction of Cassette CMV-Promoter-mGFP-2A-GFP-Cam

[0119] Inserted into vector pRK-mGFP-2A-GFP-Zeo resistance gene cam downstream of BamH I, cam has an independent cat promoter; forward primer (F): cgggatcctgatcggcacgtaagaggttc (SEQ ID NO 53), reverse primer (R): cgggatccttacgccccgccctgccactcat (SEQ ID NO 54).

[0120] (4.3.2) PCR Amplification of Cassette CMV Promoter-mGFP-2A-GFP-Cam.sup.R

[0121] The template was plasmid pRK-mGFP-2A-GFP-cam, where forward primer (F): caagaatggatggagattcaggaagccgggagagggcccgggacattgattattgactagttataatag (SEQ ID NO 55); reverse primer (R): ccgcaaacccgccagaagagccaaagtcaacacaacaacgccttaaatgtgatggcacgtaagaggttcaac (SEQ ID NO 56); and the steps of PCR reaction and purification of DNA product were similar to the step (4.1.1).

[0122] (4.3.3) Preparation of E. coli Competent Cells Containing H129-BAC-mGFP-2A-GFP

[0123] E. coli competent cells containing H129-BAC-mGFP-2A-GFP were prepared using the same method as described in step (3.2).

[0124] (4.3.4) Construction of H129-G4 by Electroporation and Homologous Recombination

[0125] Construction of H129-G4 by electroporation of cassette CMV promoter-mGFP-2A-GFP-cam.sup.R and homologous recombination was performed using the similar procedures as described in step (3.4). For PCR verification, forward primer (F): cggaaaccaaagaaggaagc (SEQ ID NO 57), and reverse primer (R): gggagcccaacaaacagcac (SEQ ID NO 58).

[0126] (4.3.5) Rescue H129-G4 Virus

[0127] H129-G4 virus was rescued following the similar protocol of step (3.7).

[0128] (4.3.6) Growth Comparison Between H129-wt Virus and Recombinant Viruses

[0129] Growth curve comparison was performed following the step (2.13). Referring now to FIG. 2(e), there is provided a graph showing the growth curves of H129-wt, H129-G1, H129-G3 and H129-G4 in VERO cells. VERO cells were infected with H129-wt, -G1, -G3 or -G4 at an MOI of 3, and the progeny virus in the supernatant at the indicated times were determined by standard plaque forming assay. Shown is the meanSD (standard deviation) from 3 independent experiments. As shown in FIG. 2(e), the replication kinetics of H129-wt, -G1, -G3 and -G4 were similar, demonstrating that the insertion location within H129 genome is flexible.

[0130] (5). Fluorescence Intensity of H129-G1, H129-G3 and H129-G4 in VERO Cells

[0131] Referring now to FIG. 3, there are provided with (a) images and (b) a graph showing the fluorescence intensities of H129-G1, H129-G3 and H129-G4 In vitro. VERO cells were infected with H129-G1, H129-G3 and H129-G4 at an MOI of 1, respectively, and the GFP signal was observed at 24 hpi. Images were taken under the same condition. Scale bar=50 m. As shown in FIG. 3(b), H129-G4 is about 5.3 times higher than H129-G1 while H129-G3 is about 2.3 times higher than H129-G1; it implies that the fluorescence intensity is not a simple addition of the fluorescence genes.

[0132] (6). Microfluidic Device

[0133] Referring now to FIG. 4, there is provided a schematic structure diagram of the microfluidic device. As shown in FIG. 4, the microfluidic device comprises two isolated culture chambers that are connected by multiple microchannels, where the multiple microchannels only allow the axons grow-through but completely impede the dendrites. Microfluidic device was fabricated following the protocol described previously [21, 23, 24].

[0134] (7). Culture of Neurons in Microfluidic Device

[0135] To culture neurons in the microfluidic device, freshly isolated fetal mouse hippocampal neurons (2.510.sup.6, in 500 l media) were plated into one chamber (blue chamber in FIGS. 5(a) and (b)) (Day 1). For bi-chamber culture, a new batch of neurons (6.2510.sup.5 neurons in 250 l) was added into the opposite chamber (red chamber in FIGS. 5(c) and (d)) at Day 5 when the axons of first plated neurons grew into the microchannels. Medium was refreshed every day, and the volume in the efferent and afferent end chamber was always maintained at 500 l and 250 l, respectively. To guide the directional growth of axons in the microchannels, the higher hydrostatic pressure is generated by the larger medium volume in the efferent chamber; to prevent the reversed axonal growth, less number of neurons are plated at 4 days later (Day 5). For infection, H129-G4 was added into either chamber as in FIGS. 5(a) and (c) to reach a final concentration of 110.sup.7 pfu/ml at the indicated time point. To avoid virus diffusion to the opposite chamber, the medium volume in the infection chamber was maintained half less than the opposite one. Images were taken at 24 hours post infection (hpi).

[0136] (8). Intracerebral Virus Injection

[0137] Intracerebral virus injection was performed using a stereotaxic system in a BSL-2 animal facility following the approved SOP on adult wild-type C57BL/6, DAT-Cre mice, PV-Cre mice, and tree shrews. DAT-Cre transgenic mice specifically express Cre recombinase in dopaminergic (DA) neurons under the control of the dopamine transporter (DAT) promoter; PV-Cre transgenic mice express Cre recombinase in parvalbumin (PV) interneurons. Both are of C57BL/6 background. The anesthetized animals received intracerebral virus injection with a motorized stereotaxic injector (Stoelting Co.). The exact location of the mouse nuclei was determined according to the Mouse Brain Atlas by the mediolateral (ML), anteroposterior (AP) and dorsoventral (DV) distances to Bregma [25], and the coordinates for tree shrew nuclei were determined according to the Tree Shrew Brain Atlas [26]. When indicated, Alexa Fluor 594 conjugated-cholera toxin B subunit (CTB) (Invitrogen) was injected along with the virus. The injection details are listed in Table 1.

TABLE-US-00002 TABLE 1 Injection sites and H129-derived tracers Coordinates (mm) Animal Virus Nucleus ML AP DV Dose (pfu) Volume (l) Animal number Tree shrew H129-G3 VPM +1.40 1.82 3.62 1 10.sup.6 0.3 8 H129-G4 M1 +2.00 +2.10 1.88 1 10.sup.6 0.2 8 H129-G4 GCL +1.15 +3.92 2.00 1 10.sup.6 0.2 3 H129-G4 subretina NA NA NA 1 10.sup.6 1.0 3 H129-G4 M1 2.60 .sup.+1.85 * +2.10 2 10.sup.6 0.3 5 * interaural instead of AP

[0138] For intracerebral virus injection, 8-10 week-old male mice or adult male tree shrew were applied without randomization or blinding. Animals were monitored daily after the virus injection, and experiment would be terminated and animal would be excluded if severe sickness was observed.

[0139] (9). Two-Photon Fluorescence Micro-Optical Sectioning Tomography (fMOST)

[0140] Specimen for fMOST imaging was embedded with Technovit 9100 Methyl Methacrylate (MMA, Electron Microscopy Sciences) as described previously[27]. Briefly, PFA fixed animal brain was rinsed in 0.01M PBS for 12 h, and completely dehydrated in a series of alcohol (50%, 75%, 95%, 100% and 100% ethanol, 2 h for each) followed by immersion in xylene twice (2 h for each) for transparentization. Then the specimen was infiltrated, transferred into gelatin capsule and immersed in polymerization solution. Finally, the capsule with the specimen was closed and kept in a dry chamber at 4 C. in dark for 72 h. After complete polymerization, the whole brain was imaged using fMOST system with a data acquisition rate at 0.5 m0.5 m1 m pixel size[28]. Lastly, the image stack of the acquired data set was transformed into Large Data Access using the Amira software (Visage Software, USA) for 3D image reconstruction [29].

[0141] (10). Anterograde Transmissions of H129-G4 in Cultured Neurons

[0142] Referring now to FIG. 5, there are shown the anterograde transmissions of H129-G4 in cultured neurons. (a-b) Soma entry and anterograde labeling of H129-G4. Freshly isolated fetal mouse hippocampal neurons were seeded into one chamber of the microfluidic device, and termed the first 24 h as Day 1, and H129-G4 was added at Day 8 into the chamber of either somal (blue) or axonal terminal chamber (red) to a final concentration of 10.sup.7 pfu/ml (a). The representative results of somal- and axonal terminal-side infection are presented in the left and right panel, respectively. Images of GFP signal (upper panel) and phase contrast (lower panel) were obtained at 24 hour post infection (hpi). The dotted lines indicate the borders between chambers and the microchannels. Scale bar, 100 m (b). (c-d) Anterograde transneuronal labeling of H129-G4. Neurons were sequentially plated into both chambers at Day 1 and Day 5 respectively, then H129-G4 was added at Day 12 into either the efferent (blue) or afferent chamber (red) to a final concentration of 10.sup.7 pfu/ml (c). The representative results of efferent- and afferent-side infection are presented in the left and right panel, respectively. Images of GFP signal (upper panel) and phase contrast (lower panel) were obtained at 24 hpi. The dotted lines indicate the borders between chambers and the microchannel. Scale bar, 100 m (d).

[0143] When H129-G4 was added to the soma side (FIG. 5(a)), neurons and their axons were labeled with GFP by 24 hours post infection (hpi) (FIG. 5(b)). However, no GFP labeled neuron was observed when the virus was added into the axonal terminal side (FIG. 5(b), right panels). These data indicate that H129-G4 barely infects neuron through their terminals at the indicated virus dose and at the indicated observation time post infection.

[0144] When H129-G4 was added to the efferent neurons, H129-G4 was capable of spreading through the axons in the microchannels and labeling the afferent neurons in the opposite chamber with GFP (FIG. 5(d), left panel). However, when H129-G4 was added to the afferent chamber, GFP positive neurons were only observed in the same chamber, and no neuron was labeled in the efferent chamber (FIG. 5(d), right panels). These data indicate that H129-G4 transmits between the cultured neurons in the microfluidic device in a strict anterograde transsynaptic manner at the indicated virus dose and at the indicated observation time.

[0145] (11). Tracing Time Course of VPM-S1 Circuit Using H129-G3

[0146] Referring now to FIG. 6, there is provided the tracing time course of VPM-S1 circuit using H129-G3. (a) Schema of the VPM-S1 circuit. VPM, ventral posteromedial thalamic nucleus; nRT, nucleus of reticular thalamus; S1, primary somatosensory cortex; L4 and L6, layer IV and VI of the cortex. (c-g) Representative tracing results of H129-G3 in VPM-S1 circuit. H129-G3 (110.sup.6 pfu in 300 nl) was injected into the VPM of wild-type C57BL/6 mice together with Alexa Fluor 594-conjugated CTB (CTB, red). The tracing results at 2 (c), 3 (d), 4 (e), and 5 (f) days post injection (dpi) (g) are shown. The boxed areas are magnified and presented in the right panel. The scattered GFP-positive neurons in c1 are indicated with white arrows. (h) A representative GFP-labeled single neuron. A pyramidal neuron was labeled with complete dendritic trees in S1 at 4 dpi. Magnified images of the segments of the apical (h1 and h2) and the basal dendrite (h3) are shown.

[0147] H129-G3 (10.sup.6 pfu in 300 nl) was injected into the VPM together with Alexa Fluor 594 conjugated-cholera toxin B subunit (CTB), which marks the injection site and retrogradely labels the neuronal soma by axon terminal uptake. We evaluated the labeling direction, efficiency, and transsynaptic transmission of H129-G3 as determined by the infection time course. At 2 day post virus inoculation (2 dpi), both CTB (red) and GFP-positive cells were present at the injection site. GFP-positive neurons were also observed in the nearby nRT (FIG. 6(c)). By 3 dpi, in addition to the GFP signal at nRT (FIG. 6(d)), a few GFP-positive neurons were observed in the cortex (FIG. 6(d1)). By 4 dpi, two segregated cell populations in the ipsilateral S1 were clearly labeled: the GFP-positive cell population in L4, and the CTB-labeled cell population in L6. No overlap was observed between the two populations (FIG. 6(e)). These data indicate that H129-G3 anterogradely and transsynaptically label L4 neurons, but does not retrogradely label L6 neurons via their axon terminals in the VPM. A smaller population of GFP-positive cells was also observed in L4 of the secondary somatosensory cortex (S2) (FIG. 6(f)), suggesting a possible direct VPM-S2 projection. By 5 dpi, H129-G3 spread to other cortical layers including L6 (FIG. 6(g)), while CTB-positive cells remained at L6. These results confirmed that H129-G3 transmits transneuronally, multi-synaptically, and strict anterogradely.

[0148] A representative pyramidal neuron with nicely labeled apical and basal dendrites is shown in FIG. 6(h), where individual dendritic spines can be readily detected based on the GFP signal. Notably, while H129-G3 labeling intensity is sufficient for visualizing neuronal structures, it is not enough because the individual axon was not clearly distinguishable.

[0149] (12). Mapping of the M1 Projection Output Using H129-G4

[0150] Referring now to FIG. 7, there is shown the mapping of the M1 projection output using H129-G4. (a) Schema of the M1 projection pathways. M1, primary motor cortex; cont. M1, contralateral M1; S1, primary somatosensory cortex; PRh, perirhinal cortex; STh, subthalamic nucleus; CPu, caudate putamen. (b-c) Representative tracing results of M1 projections. H129-G4 (10.sup.6 pfu in 200 nl) was injected into the M1 of wild-type C57BL/6 mice, and images of coronal brain sections were obtained at 4 dpi. The boxed regions are shown with a higher magnification. (d) A representative H129-G4 labeled single neuron. A representative GFP-labeled neuron in PRh is shown, and the magnified images of the dendritic segments with individual spines (d1 and d2) and the axon (d3) are presented in the right. (e-j) Combination of fMOST and H129-G4 tracing. The brain obtained at 4 dpi was further processed to fMOST imaging. The 3D image of the whole brain was reconstructed (e). Representative brain regions innervated by M1, including the cont. M1 (f), striatum (g) and S1 (h), are shown in details. Representative single neurons in the ipsilateral S1 (i) and the cont. M1 (j) are also presented.

[0151] Primary motor cortex (M1) is the major cortical region that generates and sends motor control signals to downstream targets. The direct projection from M1 has been well defined (FIG. 7(a)). H129-G4 was applied to this pathway for verification of its anterograde tracing capacity and efficiency. Wild-type C57BL/6 mice were intracerebrally injected with H129-G4 (10.sup.6 pfu in 200 nl) at M1, and then examined at 4 dpi. At the injection location in the M1, H129-G4 labeled a massive group of neurons. A substantial group of neurons in the contralateral M1 was also labeled (FIG. 7(b)-(c)). In addition, the fibers connecting the bilateral M1s were clearly visible (FIG. 7(b2)). GFP-labeled neurons were also observed in the ipsilateral S1 (FIG. 7(c2)), reflecting the projection from M1 to S1. Other brain regions innervated by M1 were also labeled, including the thalamus, subthalamic nucleus (STh), perirhinal cortex (PRh), and caudate putamen (CPu) (data not shown). Besides the macroscopic circuit tracing, H129-G4 also revealed the detailed structures of neurons (FIG. 7(d)).

[0152] Fluorescence Micro-Optical Sectioning Tomography (fMOST) is a powerful high-throughput imaging system enabling automated reconstruction of neural circuit in the entire brain with high resolution at submicron levels[30]. So far, H129-G4 is the only anterograde transsynaptic viral tracer whose labeling intensity is high enough for fMOST. The general tracing and labeling patterns of H129 revealed by the reconstructed whole brain fMOST image (FIG. 7(e)) were consistent with those detected by confocal microscopy (FIG. 7(b)-(d)). A large population of neurons in the inoculated M1, the contralateral M1 (FIG. 7(f)), and the ipsilateral S1 (FIG. 7(h)) were labeled. The projecting axonal fibers were also clearly visible (FIG. 7(g)). Even in distant regions, the H129-G4 still sparsely labeled neurons with high fluorescence intensity, which made it possible to obtain detailed structure of single neurons and their projections (FIG. 7(i)-(j)). Therefore, H129-G4 is a potent anterograde transsynaptic viral tracer that can be generally used for mapping projection circuits and projection connectome.

[0153] (13). Mapping of the M1 Projection Output in Tree Shrew Using H129-G4

[0154] Referring now to FIG. 8, there is shown the mapping of the M1 projection output in tree shrew using H129-G4. (a) Comparison of mouse and tree shrew brains. The brains of adult mouse and tree shrew are imaged with top (left) or side view (middle) after perfusion, fixation and dehydration. (b-g) Tracing results of tree threw M1 projection output with H129-G4. H129-G4 (210.sup.6 pfu in 300 nl) were injected into the M1 of tree shrews together with CTB (red), and the brains were obtained at 6 dpi. Representative images of the coronal brain sections are shown, and the boxed regions are displayed with a higher magnification. (h) A representative H129-G4 labeled single neuron in tree threw. A representative GFP-labeled neuron around the injection is shown, and the magnified images of the apical (h1-h3) and basal dendrites (h4) are presented in the right.

[0155] The tree shrew (Tupaia belangeri chinensis), a smaller size prosimian primate, is much closer to the other primates than rodents at behavioral, anatomical, genomic, and evolutionary levels [26]. Its brain structures and neuronal circuits are also more similar to those of other primates than rodents. So far, no viral tracer has been reported to transneuronally map the neuronal circuits in the tree shrew. To test the applicability in tree shrews, H129-G4 was intracerebrally injected to M1 of the tree shrew brain together with CTB. Considering the larger size of the tree shrew brain than the mouse brain (FIG. 8(a)), the injected virus amount was increased to 210.sup.6 pfu in 300 nl. At 6 dpi (FIG. 8(b)), both GFP and CTB labeled the injection site. Similar to the outputs of M1 in mice, GFP labeled cells were also observed in the contralateral M1, S1, CPu (FIG. 8(d)-(e)), and thalamus (FIG. 8(f)-(g)). Interestingly, injection of H129-G4 into the M1 of tree shrew brain resulted in GFP positive cells in the piriform cortex (Pir) (FIG. 8(c)), infraradiata dorsalis (IRd) (FIG. 8(c)-(d)), claustrum (Cl) and primary visual cortex (V1) (FIG. 8(g)), whereas the these brain regions were not labeled in mice. The labeling intensity of H129-G4 was lower in tree shrews than that in mice, but was still high enough to reveal the structure of single neurons (FIG. 8(h)), including the apical and basal dendrites.

[0156] 14. Tracing the Visual Pathway Using H129-G4

[0157] Referring now to FIG. 9, there are shown the tracing the visual pathway using H129-G4; (a) Schema of the mouse visual pathway. LGN, lateral geniculate nucleus; LP, lateral posterior thalamic nucleus; SC, superior colliculus; V1 and V2, primary and secondary visual cortex; (b-d) Representative results of H129-G4 tracing the visual pathway. H129-G4 (10.sup.6 pfu in 1 l) were injected into the subretina of wild-type C57BL/6 mice, and images were obtained at 6 dpi. Representative images at LGN and LP (b) as well as visual cortex (c) are shown, and the boxed regions are magnified correspondingly.

[0158] 15. Tracing the Olfactory Pathway Using H129-G4

[0159] Referring now to FIG. 10, there are shown the tracing the olfactory pathway using H129-G4; (a) Schema of the mouse olfactory pathway. MOB, main olfactory bulb; GCL, granule cell layer; MCL, mitral cell layer; AON, anterior olfactory nucleus; APC, anterior piriform cortex; PPC, posterior piriform cortex; (b-f) Representative results of H129-G4 tracing the olfactory pathway. H129-G4 (10.sup.6 pfu in 200 nl) were injected into the GCL of wild-type C57BL/6 mice, and the images were taken at 4 dpi. The representative images of MOB (b), AON (c), APC (d), PPC (e) and Amy (f) are shown, and the boxed regions are magnified.

[0160] While the present invention has been described with reference to particular embodiments, it will be understood that the embodiments are illustrative and that the invention scope is not so limited. Alternative embodiments of the present invention will become apparent to those having ordinary skill in the art to which the present invention pertains. Such alternate embodiments are considered to be encompassed within the scope of the present invention. Accordingly, the scope of the present invention is defined by the appended claims and is supported by the foregoing description.

REFERENCES

[0161] 1. Nassi J J, Cepko C L, Born R T, Beier K T. 2015. Neuroanatomy goes viral! Front Neuroanat 9:80. [0162] 2. Beier K T, Saunders A B, Oldenburg I A, Sabatini B L, Cepko C L. 2013. Vesicular stomatitis virus with the rabies virus glycoprotein directs retrograde transsynaptic transport among neurons in vivo. Front Neural Circuits 7:11. [0163] 3. Beier K T, Saunders A, Oldenburg I A, Miyamichi K, Akhtar N, Luo L, Whelan S P, Sabatini B, Cepko C L. 2011. Anterograde or retrograde transsynaptic labeling of CNS neurons with vesicular stomatitis virus vectors. Proc Natl Acad Sci USA 108:15414-15419. [0164] 4. McGovern A E, Driessen A K, Simmoris D G, Powell J, Davis-Poynter N, Farrell M J, Mazzone S B. 2015. Distinct brainstem and forebrain circuits receiving tracheal sensory neuron inputs revealed using a novel conditional anterograde transsynaptic viral tracing system. J Neurosci 35:7041-7055. [0165] 5. Lo L, Anderson D J. 2011. A Cre-dependent, anterograde transsynaptic viral tracer for mapping output pathways of genetically marked neurons. Neuron 72:938-950. [0166] 6. Zemanick M C, Strick P L, Dix R D. 1991. Direction of transneuronal transport of herpes simplex virus 1 in the primate motor system is strain-dependent. Proc Natl Acad Sci USA 88:8048-8051. [0167] 7. LaVail J H, Topp K S, Giblin P A, Garner J A. 1997. Factors that contribute to the transneuronal spread of herpes simplex virus. J Neurosci Res 49:485-496. [0168] 8. Sun N, Cassell M D, Perlman S. 1996. Anterograde, transneuronal transport of herpes simplex virus type 1 strain H129 in the murine visual system. J Virol 70:5405-5413. [0169] 9. Barnett E M, Evans G D, Sun N, Perlman S, Cassell M D. 1995. Anterograde tracing of trigeminal afferent pathways from the murine tooth pulp to cortex using herpes simplex virus type 1. J Neurosci 15:2972-2984. [0170] 10. Rinaman L, Schwartz G. 2004. Anterograde transneuronal viral tracing of central viscerosensory pathways in rats. Journal of Neuroscience 24:2782-2786. [0171] 11. Kelly R M, Strick P L. 2003. Cerebellar loops with motor cortex and prefrontal cortex of a nonhuman primate. J Neurosci 23:8432-8444. [0172] 12. Archin N M, Atherton S S. 2002. Rapid spread of a neurovirulent strain of HSV-1 through the CNS of BALB/c mice following anterior chamber inoculation. J Neurovirol 8:122-135. [0173] 13. Beier K T, Mundell N A, Pan Y A, Cepko C L. 2016. Anterograde or Retrograde Transsynaptic Circuit Tracing in Vertebrates with Vesicular Stomatitis Virus Vectors. Curr Protoc Neurosci 74:1 26 21-21 26 27. [0174] 14. McGovern A E, Davis-Poynter N, Rakoczy J, Phipps S, Simmons D G, Mazzone S B. 2012. Anterograde neuronal circuit tracing using a genetically modified herpes simplex virus expressing EGFP. J Neurosci Methods 209:158-167. [0175] 15. Wadsworth S, Jacob R J, Roizman B. 1975. Anatomy of herpes simplex virus DNA. II. Size, composition, and arrangement of inverted terminal repetitions. J Virol 15:1487-1497. [0176] 16. Delius H, Clements J B. 1976. A partial denaturation map of herpes simplex virus type 1 DNA: evidence for inversions of the unique DNA regions. J Gen Virol 33:125-133. [0177] 17. He B, Chou J, Brandimarti R, Mohr I, Gluzman Y, Roizman B. 1997. Suppression of the phenotype of gamma(1)34.5-herpes simplex virus 1: failure of activated RNA-dependent protein kinase to shut off protein synthesis is associated with a deletion in the domain of the alpha47 gene. J Virol 71:6049-6054. [0178] 18. Wagner M, Jonjic S, Koszinowski U H, Messerle M. 1999. Systematic excision of vector sequences from the BAC-cloned herpesvirus genome during virus reconstitution. J Virol 73:7056-7060. [0179] 19. Messerle M, Crnkovic I, Hammerschmidt W, Ziegler H, Koszinowski U H. 1997. Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome. Proc Natl Acad Sci USA 94:14759-14763. [0180] 20. Seibenhener M L, Wooten M W. 2012. Isolation and culture of hippocampal neurons from prenatal mice. J Vis Exp doi:10.3791/3634. [0181] 21. Park J W, Vahidi B, Taylor A M, Rhee S W, Jeon N L. 2006. Microfluidic culture platform for neuroscience research. Nat Protoc 1:2128-2136. [0182] 22. Szpara M L, Parsons L, Enquist L W. 2010. Sequence variability in clinical and laboratory isolates of herpes simplex virus 1 reveals new mutations. J Virol 84:5303-5313. [0183] 23. Taylor A M, Blurton-Jones M, Rhee S W, Cribbs D H, Cotman C W, Jeon N L. 2005. A microfluidic culture platform for CNS axonal injury, regeneration and transport. Nature Methods 2:599-605. [0184] 24. Harris J, Lee H, Vahidi B, Tu C, Cribbs D, Jeon N L, Cotman C. 2007. Fabrication of a Microfluidic Device for the Compartmentalization of Neuron Soma and Axons. doi:doi:10.3791/261:e261. [0185] 25. Paxinos G, Franklin K B J. 2003. The Mouse Brain in Stereotaxic Coordinates. Academic Press. [0186] 26. Zhou J-N, Ni R-J. 2017. The Tree Shrew (Tupaia belangeri chinensis) Brain in Stereotaxic Coordinates. Springer Singapore. [0187] 27. Xiong H, Zhou Z, Zhu M, Lv X, Li A, Li S, Li L, Yang T, Wang S, Yang Z, Xu T, Luo Q, Gong H, Zeng S. 2014. Chemical reactivation of quenched fluorescent protein molecules enables resin-embedded fluorescence microimaging. Nat Commun 5:3992. [0188] 28. Zheng T, Yang Z, Li A, Lv X, Zhou Z, Wang X, Qi X, Li S, Luo Q, Gong H, Zeng S. 2013. Visualization of brain circuits using two-photon fluorescence micro-optical sectioning tomography. Opt Express 21:9839-9850. [0189] 29. Gong H, Zeng S Q, Yan C, Lv X H, Yang Z Q, Xu T H, Feng Z, Ding W X, Qi X L, Li A A, Wu J P, Luo Q M. 2013. Continuously tracing brain-wide long-distance axonal projections in mice at a one-micron voxel resolution. Neuroimage 74:87-98. [0190] 30. Quan T, Zhou H, Li J, Li S, Li A, Li Y, Lv X, Luo Q, Gong H, Zeng S. 2016. NeuroGPS-Tree: automatic reconstruction of large-scale neuronal populations with dense neurites. Nat Methods 13:51-54. [0191] 31. Fan Y, Huang Z Y, Cao C C, Chen C S, Chen Y X, Fan D D, He J, Hou H L, Hu L, Hu X T, Jiang X T, Lai R, Lang Y S, Liang B, Liao S G, Mu D, Ma Y Y, Niu Y Y, Sun X Q, Xia J Q, Xiao J, Xiong Z Q, Xu L, Yang L, Zhang Y, Zhao W, Zhao X D, Zheng Y T, Zhou J M, Zhu Y B, Zhang O J, Wang J, Yao Y G. 2013. Genome of the Chinese tree shrew. Nat Commun 4:1426. [0192] 32. Li L, Li Z, Wang E, Yang R, Xiao Y, Han H, Lang F, Li X, Xia Y, Gao F, Li Q, Fraser N W, Zhou J. 2015. Herpes Simplex Virus 1 Infection of Tree Shrews Differs from That of Mice in the Severity of Acute Infection and Viral Transcription in the Peripheral Nervous System. J Virol 90:790-804.