Angiopoietin-related protein 4 (cAngptl4) as a diagnostic biomarker for acute lung damage

10160803 ยท 2018-12-25

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to the C-terminal fragment of angiopoietin-related protein 4 [cAngptl4] as a diagnostic marker for viral and bacterial pneumonia; anti-angiopoietin-related protein 4 therapeutic antibodies, and the use of anti-angiopoietin-related protein 4 antibodies in the treatment of viral and bacterial pneumonia.

Claims

1. A method to monitor an acute inflammation of the lung in response to a microbial infection in a subject, comprising: i) providing an isolated biological sample from the subject, wherein the sample is a lung tissue sample or bronchial lavage fluid sample; ii) forming a preparation comprising said sample and an antibody that specifically binds an amino acid sequence set forth as SEQ ID NO: 3 or SEQ ID NO: 4 in a carboxyl-terminal fragment of angiopoietin-related protein 4 (cANGPTL4) in a polypeptide in said sample to form an antibody/polypeptide complex; iii) detecting the complex in the sample to determine the level of expression of the polypeptide in said sample; and iv) comparing the level of expression of said polypeptide with a normal matched control; wherein an increase in the level of expression of said polypeptide compared to the control identifies the subject as having acute inflammation of the lung in response to a microbial infection.

2. The method according to claim 1, wherein the antibody comprises a light chain variable region comprising light chain complementarity determining regions including the amino acid sequences KASQSVDYDGDSYLN [SEQ ID NO: 16], TASNLES [SEQ ID NO: 18], and QQSNEDPW [SEQ ID NO: 20] and a heavy chain variable region comprising heavy chain complementarity determining regions including the amino acid sequences TSGMGVG [SEQ ID NO: 22], HIWWDDDKYYNPSLK [SEQ ID NO: 24], and KDYGSSYDY [SEQ ID NO: 26].

3. The method according to claim 2, wherein the heavy chain variable region and the light chain variable region comprise amino acid sequences set forth as SEQ ID NO: 14 and SEQ ID NO: 13, respectively.

4. The method according to claim 1, further comprising: administering a treatment regimen to the subject, wherein said treatment regimen comprises administration of an antibody that specifically binds to an amino acid sequence set forth as SEQ ID NO: 3 or SEQ ID NO: 4 in a cANGPTL4 to the subject to treat the acute inflammation of the lung in response to a microbial infection in the subject, wherein the antibody inhibits activity of cANGPTL4.

5. The method according to claim 4, further comprising monitoring the acute inflammation of the lung in response to the microbial infection in the subject at or near the end of the treatment regimen to determine the effect of said treatment on the acute inflammation of the lung in the subject, wherein a reduction in expression of the polypeptide at or near the end of the treatment regimen indicates a reduction in microbial infection-induced acute lung inflammation.

6. The method of claim 1, wherein the method is repeated at or near the end of a treatment regimen for the microbial infection in the subject to determine the effect of the treatment on the acute inflammation of the lung in the subject, wherein a reduction in expression of the polypeptide at or near the end of the treatment regimen indicates a reduction in microbial infection-induced acute lung inflammation.

7. The method according to claim 1, further comprising administering a treatment regimen to the subject identified as having acute inflammation of the lung, wherein said treatment regimen comprises administration of a pharmaceutical composition comprising an anti-inflammatory agent or antibiotic.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) An embodiment of the invention will now be described by example only and with reference to the following figures;

(2) FIGS. 1A-1G: cAngptl4 Expression During Inflammation-induced Lung Damage. Mice were infected with PR8 virus and lungs were harvested at indicated days post infection. Each time point includes samples from 5 mice. The (FIG. 1A) mRNA and (FIG. 1B) protein expression profile of cAngptl4 in mouse lung tissue during acute lung damage induced by inflammation, as determined by qPCR and immunodetection, respectively. The peak mRNA expression coincided with the commencement of acute lung damage induced by inflammation. Highest cAngptl4 protein expression was observed at day 13 post infection, which coincided with extensive lung damage caused by inflammation in influenza infection. (FIG. 1C) Elevated expression of cAngptl4 was detected in damaged lung tissue, associated with the infiltration of immune cells. Representative whole lung images from 5 mice at each time point. Day 0 samples served as control. (FIG. 1D) Viral replication and spread were detected by immunohistochemistry on lung tissue sections. Viral replication peaks around day 5 post infection, and is eliminated by immune responses around day 9. (FIG. 1E) In alveolar spaces, viral replication mainly takes place in type II alveolar epithelial cells. (FIG. 1F) In responses to viral infection, macrophages and neutrophils infiltrate into alveolar spaces in significant amount at day 7. Lymphocytes were observed in abundance from day 9. These immune cell infiltration further increases tissue damage and causes oedema that peaks at day 13. (FIG. 1G) cANGPTL4 kinetics were summarized for mouse influenza infection. cANGPTL4 protein amount coincides in time scale with oedema. The well-characterized cANGPTL4 kinetics in influenza infection on mice help in the design of cANGPTL4 targeted treatment, and the design of study on the effect of cANGPTL4 in respiratory tract infection;

(3) FIGS. 2A-2C: cAngptl4 Expression Coincides and Co localizes with Inflammation-induced Lung Damage in Influenza Infection on Mice. Mice were infected with PR8 virus and lungs were harvested at day 0 (used as control), day 5 and day 13 post infection. Each picture is the representative of 5 whole lung staining. FIG. 2A refers to alveolar Space, FIG. 2B to blood vessel and FIG. 2C to bronchiole. H&E staining was used to show the tissue structure, and cAngptl4 was stained using anti-cAngptl4 antibody (green). In control mice, no inflamed region and little cAngptl4 expression can be detected in alveolar spaces. The expression of cAngptl4 was restricted to the well-defined blood vessel structure. For infected mice, dense staining in H&E marked lung regions that were heavily infiltrated by immune cells at day 5 and 13 post infection, which is a typical event in inflammation and caused local lung damage. In contrast to control mice, the expression of cAngptl4 is not limited to endothelium, but was extensively detected in the lung regions of massive infiltration of immune cells. Bronchioles consistently express cANGPTL4 throughout the entire disease progression;

(4) FIG. 3: Identification of the Source for cANGPTL4 Production during Influenza Infection (a) Consistent staining of cANGPTL4 on Clara cells; (b) Significantly increased anti-cANGPTL4 staining on tunical media at day 5 post infection; (c) Infected type II alveolar epithelial cells produce cANGPTL4;

(5) FIG. 4: cANGPTL4 Detection in Various Forms of Samples. (a) cANGPTL4 is a secreted protein and is expected to be detected from samples in various forms of body fluids and airway secretions including but not limited to serum, sputum and Bronchial Lavage Fluid [BALF], allowing convenient diagnosis using protein detection methods such as western blot or ELISA for cANGPTL4; (b) cANGPTL4 was detected in BALF protein by western blot using anti-cANGPTL4 antibody. The BALF was collected from PR8 influenza-infected mice at different time point post infection. Day 11 and Day 13 samples have significantly more cANGPTL4 than Day 0 protein, showing cANGPTL4 can be conveniently detected from airway secretions. (FIG. 4C) Secondary infection following flu infection increases cANGPTL4 expression in mouse model. For mice mock infected with heat-inactivate influenza virus and S. Pneumoniae, cANGPTL4 signal was only detected at bronchioles but not in other regions such as alveolar space. For mice infected with 1000 CFU S. Pneumoniae only, similar cANGPTL4 signal was observed as those with mock infection. For mice infected with influenza only, at day 9 post infection a large portion of the lung was infiltrated and showed high level of cANGPTL4 protein. For mice with secondary S. Pneumoniae infection following influenza infection, the alveolar spaces were more infiltrated than the influenza infected mice, resulting in more cANGPTL4 protein stained; (FIG. 4D) In clinical human lung biopsies, acute infection and inflammation give the most cANGPTL4 protein expression and can distinguish from chronic infection and inflammation;

(6) FIG. 5: Clinical Sample Analysis (with Bacterial Pneumonia) Reveals Similar cANGPTL4 Upregulation Pattern as in Influenza Pneumonia. Actinomyces infected lung tissues were infiltrated and showed stronger cANGPTL4 staining than normal healthy lung tissues. Blood vessels also showed more cANGPTL4 staining together with the surrounding tissues.

(7) FIG. 6: Anti-cANGPTL4 Antibody Treatment Shows Significant Effect in Reducing Blood Vessel Permeability and Pneumonia Severity. In vivo imaging showing reduced blood vessel leakage for infected mice with antibody treatment. The PEG contrast agent will accumulate inside the organ where the blood vessel leaks. The signal strength indicates the blood vessel leakage. For mock infected mice, minimum signal was detected inside the lung, showing minimal blood vessel leakage under healthy condition of the lung. Infected mice with only control IgG injection showed high level of signal, indicating significantly increased blood vessel leakage with influenza infection and inflammation. For mice infected with influenza and treated with anti-cANGPTL4 antibody, the significantly decreased signal indicates significant reduction in blood vessel leakage with the anti-cANGPTL4 antibody treatment. Scale bars represent 1.5 cm length.

(8) FIG. 7: Treatment using cAngptl4 Antibody Improves Lung Tissue Recovery after Influenza Infection. Mice were either 1) mock infected with PBS, injected with control IgG that does not bind to any specific antigen, 2) infected with PR8, injected with control IgG, or 3) infected with PR8, injected with monoclonal anti-cAngptl4 antibody. All the injection was carried out daily during day 13 to 17 post infection and lung were harvested at day 18. Each picture is representative of 5 mice for each experimental group. H&E staining showed the extent of tissue damage. Infected mice (group 3) that received anti-cAngptl4 antibody showed less tissue damage when compared to mice in group 1 and 2. The alveolar space of the treated group 3 also shows improvement than the non-treated group 2. The recovered structure is indistinguishable from non-infected mice (group 1). The cAngptl4 antibody treatment (group 3) also greatly reduced the bleeding in influenza-infected mice; and

(9) FIG. 8: Microarray data showing antibody treatment reduces inflammatory responses and extracellular matrix activities.

(10) Microarray data showed reduction of inflammatory responses, cytokine stimulus, hormone stimulus and peptide hormone stimulus by the antibody treatment, which reflects the effect following the neutralization of cANGPTL4 with antibody injection. Moreover, inhibition on extracellular matrix related activities was also observed, indicating a reduced risk for lung fibrosis with antibody treatment.

(11) FIGS. 9A-9C: Tissue differentiation and regeneration were enhanced in anti-cANGPTL4 antibody treated mouse lung samples following influenza infection (FIG. 9A) Staining with CC10 (Clara cell marker) and SPC (Type II alveolar epithelial cell marker) shows that in anti-cANGPTL4 antibody treated influenza infected mouse lung samples there is increased Clara cells differentiation into SPC positive cells compared with control IgG treated influenza infected mouse lung samples, which was shown as an important process that repairs damaged alveolar spaces [Zheng D, et al 2012]. (FIG. 9B) A significant increase effect in this differentiation process in anti-cANGPTL4 antibody treated influenza infected mouse sample was shown compared with control IgG treated influenza infected mouse sample by calculating the amount of differentiated bronchioles in each lung section from all the five mouse samples in each experimental group. (FIG. 9C) Lung sections with anti-cANGPTL4 treatment and influenza infection also showed better PDPN regeneration in infiltrated lung regions than control IgG-treated influenza infected lung sections, indicating better tissue regeneration in anti-cANGPTL4 treated mice following influenza infection.

SEQUENCE LISTING

(12) The Sequence Listing is submitted as an Annex C/St.25 text file, named Sequence.txt, created on Jul. 16, 2015, 16 kb, which is incorporated by reference herein.

Definitions

Pharmaceutical Compositions

(13) The compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers and supplementary anti-bacterial, anti-viral agents or anti-fungal agents.

(14) The compositions of the invention can be administered by any conventional route, including injection or by gradual infusion over time. The administration may, for example, be oral, nasal, intravenous, intraperitoneal, intramuscular, intracavity, subcutaneous, transdermal, trans-epithelial.

(15) The compositions of the invention are administered in effective amounts. An effective amount is that amount of a composition that alone, or together with further doses, produces the desired response. In the case of treating a particular disease, such as an inflammatory lung disease, the desired response is inhibiting the progression of the disease. This may involve only slowing the progression of the disease temporarily, although more preferably, it involves halting the progression of the disease permanently. This can be monitored by routine methods or by using the diagnostic assay according to the invention.

(16) Such amounts will depend, of course, on the particular condition being treated, the severity of the condition, the individual patient parameters including age, physical condition, size and weight, the duration of the treatment, the nature of concurrent therapy (if any), the specific route of administration and like factors within the knowledge and expertise of the health practitioner. These factors are well known to those of ordinary skill in the art and can be addressed with no more than routine experimentation. It is generally preferred that a maximum dose of the individual components or combinations thereof be used, that is, the highest safe dose according to sound medical judgment. It will be understood by those of ordinary skill in the art, however, that a patient may insist upon a lower dose or tolerable dose for medical reasons, psychological reasons or for virtually any other reasons.

(17) The pharmaceutical compositions used in the foregoing methods preferably are sterile and contain an effective amount of an agent according to the invention for producing the desired response in a unit of weight or volume suitable for administration to a patient.

(18) The doses of the ligand/antibody according to the invention administered to a subject can be chosen in accordance with different parameters, in particular in accordance with the mode of administration used and the state of the subject. Other factors include the desired period of treatment. In the event that a response in a subject is insufficient at the initial doses applied, higher doses (or effectively higher doses by a different, more localized delivery route) may be employed to the extent that patient tolerance permits. Other protocols for the administration of compositions will be known to one of ordinary skill in the art, in which the dose amount, schedule of injections, sites of injections, mode of administration and the like vary from the foregoing. The administration of compositions to mammals other than humans, (e.g. for testing purposes or veterinary therapeutic purposes), is carried out under substantially the same conditions as described above. A subject, as used herein, is a mammal, preferably a human, and including a non-human primate, cow, horse, pig, sheep, goat, dog, cat or rodent.

(19) When administered, the pharmaceutical preparations of the invention are applied in pharmaceutically-acceptable amounts and in pharmaceutically-acceptable compositions. The term pharmaceutically acceptable means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. Such preparations may routinely contain salts, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents' (e.g. anti-inflammatory agents such as steroids, non-steroidal anti-inflammatory agents or antibiotics). When used in medicine, the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically-acceptable salts thereof and are not excluded from the scope of the invention. Such pharmacologically and pharmaceutically-acceptable salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, formic, malonic, succinic, and the like. Also, pharmaceutically-acceptable salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts.

(20) Compositions may be combined, if desired, with a pharmaceutically-acceptable carrier. The term pharmaceutically-acceptable carrier as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances which are suitable for administration into a human. The term carrier in this context denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application, (e.g. liposome or immuno-liposome). The components of the pharmaceutical compositions also are capable of being co-mingled with the ligands of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficacy.

(21) The pharmaceutical compositions may contain suitable buffering agents, including: acetic acid in a salt; citric acid in a salt; boric acid in a salt; and phosphoric acid in a salt. The pharmaceutical compositions also may contain, optionally, suitable preservatives, such as: benzalkonium chloride, chlorobutanol, parabens and thimerosal. The pharmaceutical compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product.

(22) Compositions suitable for oral administration may be presented as discrete units, such as capsules, tablets, lozenges, each containing a predetermined amount of the active compound. Other compositions include suspensions in aqueous liquids or non-aqueous liquids such as syrup, elixir or an emulsion or as a gel.

(23) Compositions may be administered as aerosols and inhaled.

(24) Compositions suitable for parenteral administration conveniently comprise a sterile aqueous or non-aqueous preparation of agent, which is preferably isotonic with the blood of the recipient. This preparation may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation also may be a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butane diol. Among the acceptable solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil may be employed including synthetic mono- or di-glycerides. In addition, fatty acids such as oleic acid may be used in the preparation of injectables. Carrier formulation suitable for oral, subcutaneous, intravenous, intramuscular, etc. administrations can be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa.

(25) Antibodies and Antibody Fragments

(26) Antibodies include polyclonal and monoclonal antibodies, prepared according to conventional methodology. The production of monoclonal antibodies using hybridoma cells is well-known in the art. The methods used to produce monoclonal antibodies are disclosed by Kohler and Milstein in Nature 256, 495-497 (1975) and also by Donillard and Hoffman, Basic Facts about Hybridomas in Compendium of Immunology V.II ed. by Schwartz, 1981.

(27) Chimeric antibodies are recombinant antibodies in which all of the V-regions of a mouse or rat antibody are combined with human antibody C-regions. Humanised antibodies are recombinant hybrid antibodies which fuse the complementarity determining regions from a rodent antibody V-region with the framework regions from the human antibody V-regions. The C-regions from the human antibody are also used. The complementarity determining regions (CDRs) are the regions within the N-terminal domain of both the heavy and light chain of the antibody to where the majority of the variation of the V-region is restricted. These regions form loops at the surface of the antibody molecule. These loops provide the binding surface between the antibody and antigen.

(28) Antibodies from non-human animals provoke an immune response to the foreign antibody and its removal from the circulation. Both chimeric and humanised antibodies have reduced antigenicity when injected to a human subject because there is a reduced amount of rodent (i.e. foreign) antibody within the recombinant hybrid antibody, while the human antibody regions do not elicit an immune response. This results in a weaker immune response and a decrease in the clearance of the antibody. This is clearly desirable when using therapeutic antibodies in the treatment of human diseases. Humanised antibodies are designed to have less foreign antibody regions and are therefore thought to be less immunogenic than chimeric antibodies.

(29) Various fragments of antibodies are known in the art. A Fab fragment is a multimeric protein consisting of the immunologically active portions of an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region, covalently coupled together and capable of specifically binding to an antigen. Fab fragments are generated via proteolytic cleavage (with, for example, papain) of an intact immunoglobulin molecule. A Fab.sub.2 fragment comprises two joined Fab fragments. When these two fragments are joined by the immunoglobulin hinge region, a F(ab).sub.2 fragment results. An Fv fragment is multimeric protein consisting of the immunologically active portions of an immunoglobulin heavy chain variable region and an immunoglobulin light chain variable region covalently coupled together and capable of specifically binding to an antigen. A fragment could also be a single chain polypeptide containing only one light chain variable region, or a fragment thereof that contains the three CDRs of the light chain variable region, without an associated heavy chain variable region, or a fragment thereof containing the three CDRs of the heavy chain variable region, without an associated light chain moiety; and multi specific antibodies formed from antibody fragments, this has for example been described in U.S. Pat. No. 6,248,516. Fv fragments or single region (domain) fragments are typically generated by expression in host cell lines of the relevant identified regions. These and other immunoglobulin or antibody fragments are within the scope of the invention and are described in standard immunology textbooks such as Paul, Fundamental Immunology or Janeway et al. Immunobiology (cited above). Molecular biology now allows direct synthesis (via expression in cells or chemically) of these fragments, as well as synthesis of combinations thereof. A fragment of an antibody or immunoglobulin can also have bispecific function as described above.

(30) Materials and Methods

(31) Mice and Infection.

(32) Female C57BL/6J mice aged 8 to 12 weeks old were purchased from Biological resource centre, Biopolis. H1N1 influenza virus A/PR/8/34 strain (PR8) was purchased from American Type Culture Collection (ATCC). The virus was propagated in embryonated chicken egg. Virus titration was done by plaque assay using infection on Madin-Darby Canine Kidney (MDCK) cells. A sub-lethal dose of PR8 at 30 PFU was used for infection on each mouse. Virus was delivered into the trachea of the mice in 75 l of phosphate buffered saline (pH 7.4). Mouse lung tissues were harvested from euthanized mice at selected time points and fixed for 24 hours in 10% neutral buffered formalin (from Sigma-Aldrich) for immunohistochemistry staining or frozen at 80 C. until RNA and protein extraction. The described animal work was approved by the Institutional Animal Care and Use Committee of National University of Singapore with IACUC Number 050/11.

(33) For mouse study involving S. Pneumoniae infection, 8-12 weeks old, female Balb/c mice were used and the influenza virus used was mouse-adapted influenza A/Aichi/2/68 (H3N2) virus. The original stock of virus from the American Type Culture Collection (Manassas, Va., USA) was adapted in female BALB/c mice through serial lung-to-lung passaging. A sublethal dose of 1500 PFU of the virus was used for infection as described in previous section. All animal protocols were approved by the Institutional Animal Care and Use Committee, National University of Singapore (IACUC Number 050/11) and the Institutional Animal Care and Use Committee, Nanyang Technological University (IACUC number ARF SBS/NIE-A0200AZ).

(34) Mice were either infected with heat-inactivated influenza virus and 1000 CFU heat-inactivated S. Pneumoniae, with 1000 CFU of S. Pneumoniae only, with influenza virus only, or with 1000 CFU S. Pneumoniae at 7 days post influenza infection. Samples were harvested for immunohistochemical staining at day 9 post infection starting from the initial infection with influenza or heat-infected influenza and heat-inactivated S. Pneumoniae.

(35) Bronchial Lavage Fluid collection. Bronchial Lavage Fluid (BALF) was obtained from mice by injecting 0.5 mL lx PBS into the trachea of the mice. The injected PBS was collected back by the syringe and transferred into eppendorf tubes. Each mouse was performed twice and the BALF obtained was combined and stored inside 80 degree freezer.

(36) Antibody Treatment on Mice.

(37) Anti-cANGPTL4 monoclonal antibody was produced in our lab using hybridoma as described in previous publication [Zhu et al, 2011]. Mice were intraperitonally injected with the antibody in 200 L saline every day at a dose of 10 mg/kg body weight on day 6-10 post infection (harvested on day 11) or on day 13 to 17 post infection (harvested on day 18).

(38) Antibody Information.

(39) Anti-cANGPTL4 antibodies were produced in our lab as previously described [Zhu et al, 2011]. Other primary antibodies include influenza NS1 (Santa Cruz, sc130568), Pdpn (R&D Systems, AF3244), SPC (Santa Cruz, sc13979) and CC10 (Santa Cruz, sc9772).

(40) In Vivo Imaging of Mice.

(41) Mice were either mock infected with heat-inactivated influenza virus, infected with influenza virus and injected with control IgG, or infected with influenza virus and treated with anti-cANGPTL4 antibody on day 13 to 17 post infection as described in previous section. At the day of harvesting, mice were injected through tail vein with IRDye 800CW PEG Contrast Agent (Licor 926-50401) following manufacturer's instructions and imaged by in vivo imaging under anesthesia, using Licor MousePOD in vivo Imaging facility. Following the in vivo imaging, the lungs of the mice were harvested and imaged again.

(42) Quantitative Real-Time RT-PCR.

(43) Frozen tissues were extracted for total RNA using Qiagen RNeasy mini kit together with Qiagen DNasel enzyme treatment. RNA concentration was measured using ND-1000 spectrophotometer from NanoDrop Technologies. Reverse-transcription was performed using oligo(dT) and iScript reverse transcriptase from Bio-rad. According to the manufacturer's instructions, PCR was performed using Bio-rad Ssofast Evagreen Supermix on Bio-rad CFX-96 real-time system. Primers used for ANGPTL4 detection are: Forward (5 to 3): TCCAACGCCACCCACTTAC (SEQ ID No 9); Reverse (5 to 3): TGAAGTCATCTCACAGTTGACCA (SEQ ID No 10).

(44) Immunoblotting.

(45) For protein extraction, harvested and frozen-preserved mouse lung tissues were treated with 2 Laemmli sample buffer without bromophenol blue. Obtained protein concentration was determined and normalized by adjusting -tubulin. Protein samples were separated by SDS-PAGE and transferred to nitrocellulose membranes (Bio-rad).

(46) Immuno Histochemistry Staining.

(47) Formalin-fixed lung tissues were processed and embedded in paraffin using Leica tissue processor and embedding station. Lung tissue sections were cut at 5 m thickness and mounted onto poly-L-lysine coated slides from Thermal Fisher Scientific. Slides were de-waxed and rehydrated before staining. Antigen retrieval was done by digestion for 25 minutes at 37 C. in proteinase K solution from Sigma Aldrich (20 g/ml proteinase K in 50 mM Tris-HCl, with 1 mM EDTA, pH 8.0). Primary antibody incubation was done overnight at 4 C., and fluorescence secondary antibody incubation was done for 1 h at room temperature. Anti-fade reagent with DAPI from Invitrogen was used for slide mounting. The slides were either scanned by Carl Zeiss MIRAX MIDI system or taken picture by fluorescence microscope Carl Zeiss Observer Z1 for immunohistology details.

(48) Microarray Analysis.

(49) Mice were infected with influenza virus and treated with either control IgG or anti-cANGPTL4 antibody on day 13 to 17 post infection as described in previous section. Lungs were harvested at Day 12 (for mice with only infection), Day 14 (for mice with infection and treated with either control IgG or anti-cANGPTL4 antibody), and Day 18 post infection (for mice with infection and treated with either control IgG or anti-cANGPTL4 antibody). RNA was extracted from the lungs with Trizol following manufacturer's protocol. Further sample processing of the RNA was done using Applause WT-Amp ST System from NuGEN, and microarray experiment was done on GeneChip Mouse Gene 1.0 ST Arrays according to manufactuer's instructions.

(50) Clinical Samples.

(51) Paraffin blocks from patients with normal non-inflamed lungs and patients with pneumonia were obtained from the Department of Pathology, National University Hospital (NUH). Approval from Institutional Review Board (IRB) has been obtained for this experiment design (2012/00661 Investigation of cANGPTL4 as a biomarker for inflammation-induced acute lung damage). All the slides were immunostained for cANGPTL4 under the same condition as described above.

Example 1

cAngptl4 Expression During Inflammation-Induced Lung Damage (FIG. 1)

(52) Mice were infected with PR8 virus and lungs were harvested at indicated days post infection. Each time point includes samples from 5 mice. The (a) mRNA and (b) protein expression profile of cAngptl4 in mouse lung tissue during acute lung damage induced by inflammation, as determined by qPCR and immunodetection, respectively. The peak mRNA expression coincided with the commencement of acute lung damage induced by inflammation. The upregulation of ANGPTL4 mRNA expression also follows closely with the increase of viral replication. Highest cAngptl4 protein expression was observed at day 13 post infection, which coincided with extensive lung damage caused by inflammation in influenza infection. (c) Elevated expression of cAngptl4 was detected in damaged lung tissue, associated with the infiltration of immune cells. Representative whole lung images from 5 mice at each time point. Day 0 samples served as control. (d) Viral replication and spread were detected by immunohistochemistry on lung tissue sections. Viral replication peaks around day 5 post infection, and is eliminated by immune responses around day 9. (e) In alveolar spaces, viral replication mainly takes place in type II alveolar epithelial cells. (f) In responses to viral infection, macrophages and neutrophils infiltrate into alveolar spaces in significant amount at day 7. Lymphocytes were observed in abundance from day 9. These immune cell infiltration further increases tissue damage and causes oedema that peaks at day 13. (g) cANGPTL4 kinetics were summarized for mouse influenza infection. cANGPTL4 protein amount coincides in time scale with oedema. The well-characterized cANGPTL4 kinetics in influenza infection on mice help in the design of cANGPTL4 targeted treatment, and the design of study on the effect of cANGPTL4 in respiratory tract infection.

Example 2

cAngptl4 Expression Coincides and Co Localizes with Inflammation-Induced Lung Damage in Influenza Infection on Mice (FIG. 2)

(53) Mice were infected with PR8 virus and lungs were harvested at day 0 (used as control), day 5 and day 13 post infection. In control mice, no inflamed region and little cAngptl4 expression can be detected in alveolar spaces. The expression of cAngptl4 was restricted to the well-defined blood vessel structure. For infected mice, dense staining in H&E marked lung regions that were heavily infiltrated by immune cells at day 5 and 13 post infection, which is a typical event in inflammation and caused local lung damage. In contrast to control mice, the expression of cAngptl4 is not limited to blood vessels, but was extensively detected in the lung regions of massive infiltration of immune cells. Bronchioles consistently express cANGPTL4 throughout the entire disease progression.

Example 3

Identification of the Source for cANGPTL4 Production During Influenza Infection (FIG. 3)

(54) The lung tissue sections were further analyzed to identify the main sources for cANGPTL4. (a) Dual immunohistochemistry staining was performed using major cell markers and cANGPTL4. Clara cells (CC10 positive) were shown to be consistently stained with anti-cANGPTL4 antibody throughout the disease progression. (b) Tunica media of the blood vessels was also shown to be stained with anti-cANGPTL4 antibody for the entire disease progression, while day 13 inflammation makes the staining of cANGPTL4 on tunica media less distinguishable from the surrounding tissues that are also stained with cANGPTL4. Tunica media at day 5 showed much higher staining of cANGPTL4 than the other time points, indicating active production of ANGPTL4. (c) Infected type II alveolar epithelial cells produces cANGPTL4 while non-infected type II alveolar epithelial cells do not.

Example 4

cANGPTL4 Detection in Various Forms of Samples. (FIG. 4)

(55) (a) cANGPTL4 is a secreted protein and is expected to be detected from samples in various forms including serum, sputum and BALF, allowing convenient diagnosis using methods such as western blot or size-filtered protein ELISA for cANGPTL4; (b) cANGPTL4 was detected in BALF protein by western blot using anti-cANGPTL4 antibody. The BALF was collected from PR8 influenza-infected mice at different time point post infection. Day 11 and Day 13 samples have significantly more cANGPTL4 than Day 0 protein, showing cANGPTL4 can be conveniently detected from airway secretions. (c) Secondary infection following flu infection increases cANGPTL4 expression in mouse model. For mice mock infected with heat-inactivate influenza virus and S. Pneumoniae, cANGPTL4 signal was only detected at bronchioles but not in other regions such as alveolar space. For mice infected with 1000 CFU S. Pneumoniae only, similar cANGPTL4 signal was observed as those with mock infection. For mice infected with influenza only, at day 9 post infection a large portion of the lung was infiltrated and showed high level of cANGPTL4 protein. For mice with secondary S. Pneumoniae infection following influenza infection, the alveolar spaces were more infiltreated than the influenza infected mice, resulting in more cANGPTL4 protein stained; (d) In clinical human lung biopsies, patient samples with acute infection and inflammation were observed for the most cANGPTL4 protein expression. Patient samples with chronic infection and inflammation were observed for much less cANGPTL4 protein expression. Patient samples with non-infection pneumonia give least cANGPTL4 protein staining, similar as that of lung samples with no pneumonia.

Example 5

Clinical Sample Analysis (with Bacterial Pneumonia) Reveals Similar cAngptl4 Upregulation Pattern as in Influenza Pneumonia (FIG. 5)

(56) Clinical samples were collected from patients. The lung tissues were identified by pathologist as either healthy lung tissue or pneumonia lung tissue. The source of pneumonia has been identified by clinicians. Formalin-fixed-paraffin-embedded clinical samples for both normal healthy lung tissue and bacterial infected lung tissue with pneumonia were sectioned and stained for cAngptl4 detection. In normal healthy lung tissue, cAngptl4 staining detected minimum cAngptl4 expression in the alveolar space, and the cAngptl4 expression was mainly found on endothelium. In contrast, in actinomyces infected lung tissue, cAngptl4 staining detected much up-regulated cAngptl4 expression in alveolar space, and the expression of cAngptl4 is not limited to endothelium, confirming the pattern found in animal model with influenza infection.

Example 6

Anti-cANGPTL4 Antibody Treatment Shows Significant Effect in Reducing Blood Vessel Permeability and Pneumonia Severity. (FIG. 6)

(57) In vivo imaging showing reduced blood vessel leakage for infected mice with antibody treatment. The PEG contrast agent will accumulate inside the organ where the blood vessel leaks. The signal strength indicates the blood vessel leakage. For mock infected mice, minimum signal was detected inside the lung, showing minimal blood vessel leakage under healthy condition of the lung. Infected mice with only control IgG injection showed high level of signal, indicating significantly increased blood vessel leakage with influenza infection and inflammation. For mice infected with influenza and treated with anti-cANGPTL4 antibody, the significantly decreased signal indicates significant reduction in blood vessel leakage with the anti-cANGPTL4 antibody treatment.

Example 7

(58) Treatment using cAngptl4 Antibody Improves Lung Tissue Recovery after Influenza Infection (FIG. 7)

(59) Mice were either 1) mock infected with PBS, injected with control IgG that does not bind to any specific antigen, 2) infected with PR8, injected with control IgG, or 3) infected with PR8, injected with monoclonal anti-cAngptl4 antibody. All the injection was carried out daily during day 13 to 17 post infection and lung were harvested at day 18. Infected mice (group 3) that received anti-cAngptl4 antibody showed less tissue damage when compared to mice in group 1 and 2. The alveolar space of the treated group 3 also shows improvement when compared to the non-treated group 2. The recovered structure is indistinguishable from non-infected mice (group 1). The cAngptl4 antibody treatment (group 3) also greatly reduced the bleeding in influenza-infected mice. The better tissue integrity as a result of cAngptl4 antibody treatment after influenza infection indicates better lung function for the experimental animals.

Example 8

Microarray Data Showing Antibody Treatment Reduces Inflammatory Responses and Extracellular Matrix Activities. (FIG. 8)

(60) Microarray data showed reduction of inflammatory responses, cytokine stimulus, hormone stimulus and peptide hormone stimulus by the antibody treatment, which reflects the effect following the neutralization of cANGPTL4 with antibody injection. Moreover, inhibition on extracellular matrix related activities was also observed, indicating a reduced risk for lung fibrosis with antibody treatment.

Example 9

Tissue Differentiation and Regeneration were Enhanced in Anti-cANGPTL4 Antibody Treated Mouse Lung Samples Following Influenza Infection (FIG. 9)

(61) (a) Staining with CC10 (Clara cell marker) and SPC (Type II alveolar epithelial cell marker) shows that in anti-cANGPTL4 antibody treated influenza infected mouse lung samples there is increased Clara cells differentiation into SPC positive cells compared with control IgG treated influenza infected mouse lung samples, which was shown as an important process that repairs damaged alveolar spaces [Zheng D, et al 2012]. (b) A significant increase effect in this differentiation process in anti-cANGPTL4 antibody treated influenza infected mouse sample was shown compared with control IgG treated influenza infected mouse sample by calculating the amount of differentiated bronchioles in each lung section from all the five mouse samples in each experimental group. (c) Lung sections with anti-cANGPTL4 treatment and influenza infection also showed better PDPN regeneration in infiltrated lung regions than control IgG-treated influenza infected lung sections, indicating better tissue regeneration in anti-cANGPTL4 treated mice following influenza infection.

REFERENCES

(62) Regeneration of Alveolar Type I and II Cells from Scgblal-Expressing Cells following Severe Pulmonary Damage Induced by Bleomycin and Influenza. Zheng D, Limmon G V, Yin L, Leung N H N, Yu H, et al. (2012) PLoS ONE 7(10): e48451. doi: 10. 1371/journal. pone.0048451); Angiopoietin-like 4: a decade of research. Zhu P, Goh Y Y, Chin H F A, Kersten S and Tan N S. Biosci. Rep. 32/211-219, 2012. Angptl4 protects against severe pro-inflammatory effects of dietary saturated fat by inhibiting fatty acid uptake into mesenteric lymph node macrophages. Lichtenstein, L., Mattijssen, F., de Wit N.J., Georgiadi, A., Hooiveld, G. J., can der Meer, R., He, Y., Qi, L., Koster, A., Tamsma, J. T., Tan, N. S., Mller, M. and Kersten, S. Cell Metabolism. 12(6): 580-592, 2010. Angiopoietin-like 4 Protein Elevates the Prosurvival Intracellular O2-:H2O2 Ratio and Confers Anoikis Resistance to Tumors. Zhu P, et al. Cancer Cell 19, 401-415, Mar. 15, 2011. Pathogenesis of influenza virus-induced pneumoniaInvolvement of both nitric oxide and oxygen radicals. Akaike T, Noguchi Y, Ijiri S, Setguchi K, Suga M, Zheng Y M, Dietzschold B, Maeda H. Proc Natl Acad Sci USA 93:2448-2453, 1996. Time-Dependent Airway Epithelial and Inflammatory Cell Responses Induced by Influenza Virus A/PR/8/34 in C57BL/6 Mice. Buchweitz J P, Harkema J R, and Kaminski N E. Toxicologic Pathology, 35:424-435, 2007.