GENETIC LOCI ASSOCIATED WITH HEAD SMUT RESISTANCE IN MAIZE

20180362997 ยท 2018-12-20

Assignee

Inventors

Cpc classification

International classification

Abstract

Head smut is one of the most devastating diseases in maize, causing severe yield loss worldwide. The present invention describes the fine-mapping of a major QTL conferring resistance to head smut. Markers useful for breeding, and methods for conferring head smut resistance are described. Nucleic acid sequence from the genetic locus conferring head smut resistance is disclosed. Genes encoding proteins conferring head smut resistance are disclosed.

Claims

1. A recombinant DNA construct comprising an isolated polynucleotide operably linked to at least one regulatory sequence, wherein said isolated polynucleotide comprises: a. a nucleotide sequence encoding a polypeptide conferring or improving resistance to head smut, wherein the polypeptide has an amino acid sequence of at least 90% sequence identity to SEQ ID NO:32; b. a nucleotide sequence capable of encoding a polypeptide conferring or enhancing resistance to head smut, wherein said nucleotide sequence is at least 90% identical to SEQ ID NO:31; or c. a complement of the nucleotide sequence of part (a) or (b), wherein the complement and the nucleotide sequence consist of the same number of nucleotides and are 100% complementary.

2. A maize cell comprising the recombinant DNA construct of claim 1.

3. A method for producing a maize plant, said method comprising: a. transforming a plant cell with the recombinant DNA construct of claim 1; and b. regenerating a plant from the transformed plant cell.

4. A maize plant comprising the recombinant DNA construct of claim 1.

5. A maize seed comprising the recombinant DNA construct of claim 1.

6. A method of conferring or improving resistance to head smut, said method comprising transforming a plant with the recombinant DNA construct of claim 1, thereby conferring or improving resistance to head smut.

7. A method of altering the level of expression of a protein capable of conferring resistance to head smut in a maize cell, said method comprising: a. transforming a maize cell with the recombinant DNA construct of claim 1; and b. growing the transformed maize cell under conditions that are suitable for expression of the recombinant DNA construct wherein expression of the recombinant DNA construct results in production of altered levels of a protein capable of conferring resistance to head smut in the transformed maize cell when compared to levels of expression in a wild-type maize plant having resistance to head smut.

8. A method of altering the level of expression of a protein capable of conferring resistance to head smut in a maize plant, said method comprising: a. transforming a maize plant cell with the recombinant DNA construct of claim 1; b. regenerating a transformed maize plant from the transformed maize plant cell; and c. growing the transformed maize plant under conditions that are suitable for expression of the recombinant DNA construct wherein expression of the recombinant DNA construct results in production of altered levels of a protein capable of conferring resistance to head smut in the transformed maize plant when compared to levels of expression in a wild-type maize plant having resistance to head smut.

Description

BRIEF DESCRIPTION OF FIGURES AND SEQUENCE LISTINGS

[0063] The invention can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing which form a part of this application. The Sequence Listing contains the one letter code for nucleotide sequence characters and the three letter codes for amino acids as defined in conformity with the IUPAC-IUBMB standards described in Nucleic Acids Research 13:3021-3030 (1985) and in the Biochemical Journal 219 (No. 2): 345-373 (1984), which are herein incorporated by reference in their entirety. The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. 1.822.

[0064] FIG. 1. Development of a SNP marker (SNP140313) for AZM4_140313 (assembled Zea mays sequence from TIGR) and its application in genotyping BC populations.

[0065] FIG. 2. Genetic-mapping of the newly-developed markers in the bin 2.09 region.

[0066] FIG. 3. Alignment of the xylanase inhibitor gene from Mo17 and B73. The Mo17 sequence is found in qHSR1, the locus that confers head smut resistance in maize. B73 is a head smut sensitive variety of maize.

[0067] FIG. 4. A comparative drawing of Mo17, B73, and Huangzhao genomic structure in the qHSR region. B73 and Huangzhao both have deletions in the region when compared to Mo17. The markers mentioned in the current invention are shown at the top. Six genes of interest are noted, a hydrolase gene that is unique to Mo17; Gene 1, and ankyrin-repeat protein, is found in all three lines; Gene 2 a cell wall-associated kinase, is found in Mo17 and B73; Gene 3 and Gene 4 are related LRR-Xa21-like kinases that are unique to Mo17; and Gene 5 is a third LRR-Xa21D-like kinase wholly or partly found in all three lines. Mo17 is 172 kb in length in this region, and Huangzhao is 56 kb in length.

[0068] The sequence descriptions and Sequence Listing attached hereto comply with the rules governing nucleotide and/or amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. 1.821-1.825. The Sequence Listing contains the one letter code for nucleotide sequence characters and the three letter codes for amino acids as defined in conformity with the IUPAC-IUBMB standards described in Nucleic Acids Res. 13:3021-3030 (1985) and in the Biochemical J. 219 (2):345-373 (1984) which are herein incorporated by reference. The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. 1.822.

[0069] SEQ ID NO:1 is amplification primer CAPS25082-L.

[0070] SEQ ID NO:2 is amplification primer CAPS25082-R.

[0071] SEQ ID NO:3 is amplification primer SNP140313-L.

[0072] SEQ ID NO:4 is amplification primer SNP140313-R.

[0073] SEQ ID NO:5 is amplification primer SNP140313-snpL.

[0074] SEQ ID NO:6 is amplification primer SNP140313-snpR.

[0075] SEQ ID NO:7 is amplification primer SNP661-L.

[0076] SEQ ID NO:8 is amplification primer SNP661-R.

[0077] SEQ ID NO:9 is amplification primer SNP661-snpL.

[0078] SEQ ID NO:10 is amplification primer SNP661-snpR.

[0079] SEQ ID NO:11 is amplification primer STS1944-L.

[0080] SEQ ID NO:12 is amplification primer STS1944-R.

[0081] SEQ ID NO:13 is amplification primer STS171-L.

[0082] SEQ ID NO:14 is amplification primer STS171-R.

[0083] SEQ ID NO:15 is amplification primer SSR148152-L.

[0084] SEQ ID NO:16 is amplification primer SSR148152-R.

[0085] SEQ ID NO:17 is amplification primer STSrga3195-L.

[0086] SEQ ID NO:18 is amplification primer STSrga3195-R.

[0087] SEQ ID NO:19 is amplification primer STSrga840810-L.

[0088] SEQ ID NO:20 is amplification primer STSrga840810-R.

[0089] SEQ ID NO:21 is amplification primer STSsyn1-L.

[0090] SEQ ID NO:22 is amplification primer STSsyn1-R.

[0091] SEQ ID NO:23 is MZA6393 marker (from bacm.pk071.j12.f) that defines one end of the BAC contig covering the qHSR1 locus. The Huangzhao and B73 versions of this marker region are found in SEQ ID NOs:47 and 48 respectively.

[0092] SEQ ID NO:24 is ST148 the marker from the Mo17 version of ZMMBBc0478L09f that defines one end of the BAC contig covering the qHSR1 locus. The Huangzhao version of this marker region can be found in SEQ ID NOs:49.

[0093] SEQ ID NO:25 is the BAC contig comprised of overlapping clones bacm.pk071.j12, bacm.pk007.18, and bacm2.pk166.h1 that cover the qHSR1 locus.

[0094] SEQ ID NO:26 is the nucleic acid sequence from Mo17 representing the gene coding region for a xylanase inhibitor gene contained within the qHRS1 locus.

[0095] SEQ ID NO:27 is the translation product of SEQ ID NO:26.

[0096] SEQ ID NO:28 is the nucleic acid sequence from B73 representing the gene coding region for a xylanase inhibitor gene contained within the region of the B73 genome that is syntenic to the qHRS1 locus.

[0097] SEQ ID NO:29 is the translation product of SEQ ID NO:28.

[0098] SEQ ID NO:30 is the genomic DNA region from Mo17 encoding the xylanase inhibitor of SEQ ID NO:26/27 and 3 kb upstream of the coding region.

[0099] SEQ ID NO:31 is the nucleic acid sequence from Mo17 representing the gene coding region for a cell wall associated protein kinase gene contained within the qHRS1 locus.

[0100] SEQ ID NO:32 is the translation product of SEQ ID NO:31.

[0101] SEQ ID NO:33 is the genomic DNA region from Mo17 encoding the cell wall associated protein kinase of SEQ ID NO:31/32 and 2.4 kb upstream of the coding region.

[0102] SEQ ID NO:34 is the nucleic acid sequence from Mo17 representing the gene coding region for a HAT family dimerization protein gene (PCO0662117) contained within the qHRS1 locus.

[0103] SEQ ID NO:35 is the translation product of SEQ ID NO:34.

[0104] SEQ ID NO:36 is the genomic DNA region from Mo17 encoding the HAT family dimerization protein gene of SEQ ID NO:34/35 and 2.4 kb upstream of the coding region.

[0105] SEQ ID NO:37 is the nucleic acid sequence from Mo17 representing the gene coding region for a HAT family dimerization protein gene (PCO066 2162/PCO548849/PCO523172) contained within the qHRS1 locus.

[0106] SEQ ID NO:38 is the translation product of SEQ ID NO:37.

[0107] SEQ ID NO:39 is the genomic DNA region from Mo17 encoding the HAT family dimerization protein gene of SEQ ID NO:37/38 and 2.4 kb upstream of the coding region.

[0108] SEQ ID NO:40 is the nucleic acid sequence from Mo17 representing the gene coding region for an uncharacterized protein gene (PCO0648231) contained within the qHRS1 locus.

[0109] SEQ ID NO:41 is the translation product of SEQ ID NO:40.

[0110] SEQ ID NO:42 is the genomic DNA region from Mo17 encoding the uncharacterized protein gene of SEQ ID NO:40/41 and 2.4 kb upstream of the coding region.

[0111] SEQ ID NO:43 is the nucleic acid sequence from Mo17 representing the gene coding region for an uncharacterized protein gene (61_24) contained within the qHRS1 locus.

[0112] SEQ ID NO:44 is the translation product of SEQ ID NO:43.

[0113] SEQ ID NO:45 is the genomic DNA region from Mo17 encoding the uncharacterized protein gene of SEQ ID NO:43/44 and 2.4 kb upstream of the coding region.

[0114] SEQ ID NO:46 is nucleic acid sequence encoding a single EST sequence from Mo17 contained within the qHRS1 locus.

[0115] SEQ ID NO:47 is MZA6393 marker covering the qHSR1 locus from Huangzhao.

[0116] SEQ ID NO:48 is MZA6393 marker covering the qHSR1 locus from B73.

[0117] SEQ ID NO:49 is ST148 marker from Huangzhao.

[0118] SEQ ID NO:47 is MZA6393 marker from Huangzhao4.

[0119] SEQ ID NO:48 is MZA6393 marker from B73.

[0120] SEQ ID NO:49 is STS148-1 marker from Huangzhao4.

[0121] SEQ ID NO:50 is amplification primer MZA6393L.

[0122] SEQ ID NO:51 is amplification primer MZA6393R.

[0123] SEQ ID NO:52 is amplification primer 1M2-9L.

[0124] SEQ ID NO:53 is amplification primer 1M2-9R.

[0125] SEQ ID NO:54 is 1M2-9 marker from Mo17.

[0126] SEQ ID NO:55 is 1M2-9 marker from Huangzhao4.

[0127] SEQ ID NO:56 is amplification primer E6765-3L.

[0128] SEQ ID NO:57 is amplification primer E6765-3R.

[0129] SEQ ID NO:58 is E6765-3 marker from Mo17.

[0130] SEQ ID NO:59 is amplification primer 2M4-1L.

[0131] SEQ ID NO:60 is amplification primer 2M4-1R.

[0132] SEQ ID NO:61 is 2M4-1 marker from Mo17.

[0133] SEQ ID NO:62 is amplification primer 2M10-5L.

[0134] SEQ ID NO:63 is amplification primer 2M10-5R.

[0135] SEQ ID NO:64 is 2M10-5 marker from Mo17.

[0136] SEQ ID NO:65 is amplification primer 2M11-3L.

[0137] SEQ ID NO:66 is amplification primer 2M11-3R.

[0138] SEQ ID NO:67 is 2M11-3 marker from Mo17.

[0139] SEQ ID NO:68 is amplification primer 3M1-25L.

[0140] SEQ ID NO:69 is amplification primer 3M1-25R.

[0141] SEQ ID NO:70 is 3M1-25 marker from Mo17.

[0142] SEQ ID NO:71 is 3M1-25 marker from Huangzhao4

[0143] SEQ ID NO:72 is amplification primer STS148-1L.

[0144] SEQ ID NO:73 is amplification primer STS148-1R.

[0145] SEQ ID NO:74 is amplification primer MZA15839-4-L.

[0146] SEQ ID NO:75 is amplification primer MZA15839-4-R.

[0147] SEQ ID NO:76 is amplification primer MZA18530-16-L.

[0148] SEQ ID NO:77 is amplification primer MZA18530-16-R.

[0149] SEQ ID NO:78 is amplification primer MZA5473-801-L.

[0150] SEQ ID NO:79 is amplification primer MZA5473-801-R.

[0151] SEQ ID NO:80 is amplification primer MZA16870-15-L.

[0152] SEQ ID NO:81 is amplification primer MZA16870-15-R.

[0153] SEQ ID NO:82 is amplification primer MZA4087-19-L.

[0154] SEQ ID NO:83 is amplification primer MZA4087-19-R.

[0155] SEQ ID NO:84 is amplification primer MZA158-30-L.

[0156] SEQ ID NO:85 is amplification primer MZA158-30-R.

[0157] SEQ ID NO:86 is amplification primer MZA15493-15-L.

[0158] SEQ ID NO:87 is amplification primer MZA15493-15-R.

[0159] SEQ ID NO:88 is amplification primer MZA9967-11-L.

[0160] SEQ ID NO:89 is amplification primer MZA9967-11-R.

[0161] SEQ ID NO:90 is amplification primer MZA1556-23-L.

[0162] SEQ ID NO:91 is amplification primer MZA1556-23-R.

[0163] SEQ ID NO:92 is amplification primer MZA1556-801-L.

[0164] SEQ ID NO:93 is amplification primer MZA1556-801-R.

[0165] SEQ ID NO:94 is amplification primer MZA17365-10-L.

[0166] SEQ ID NO:95 is amplification primer MZA17365-10-R.

[0167] SEQ ID NO:96 is amplification primer MZA17365-801-L.

[0168] SEQ ID NO:97 is amplification primer MZA17365-801-R.

[0169] SEQ ID NO:98 is amplification primer MZA14192-8-L.

[0170] SEQ ID NO:99 is amplification primer MZA14192-8-R.

[0171] SEQ ID NO:100 is amplification primer MZA15554-13-L.

[0172] SEQ ID NO:101 is amplification primer MZA15554-13-R.

[0173] SEQ ID NO:102 is amplification primer MZA4454-14-L.

[0174] SEQ ID NO:103 is amplification primer MZA4454-14-R.

[0175] SEQ ID NO:104 is the nucleic acid sequence from Mo17 representing the gene coding region for ankyrin-repeat protein (Gene 1 FIG. 4).

[0176] SEQ ID NO:105 is the translation product of SEQ ID NO:104.

[0177] SEQ ID NO:106 is the genomic DNA region from Mo17 encoding ankyrin repeat protein.

[0178] SEQ ID NO:107 is the nucleic acid sequence from Mo17 representing the gene coding region for hydrolase.

[0179] SEQ ID NO:108 is the translation product of SEQ ID NO:107.

[0180] SEQ ID NO:109 is the genomic DNA region from Mo17 encoding hydrolase.

[0181] SEQ ID NO: 110 is the nucleic acid sequence from Mo17 representing the gene coding region for LRR-Xa21-like kinase (Gene 3, FIG. 4) coding region

[0182] SEQ ID NO:111 is the translation product of SEQ ID NO:110.

[0183] SEQ ID NO: 112 is the nucleic acid sequence from Mo17 representing the gene coding region for LRR-Xa21-like kinase (Gene 4, FIG. 4) coding region

[0184] SEQ ID NO:113 is the translation product of SEQ ID NO:112.

[0185] SEQ ID NO:114 is the genomic DNA region from Mo17 encoding LRR-Xa21-like kinase (Gene 4, FIG. 4).

[0186] SEQ ID NO: 115 is the nucleic acid sequence from Mo17 representing the gene coding region for LRR-Xa21 D-like kinase (Gene 5, FIG. 4).

[0187] SEQ ID NO:116 is the translation product of SEQ ID NO:115.

[0188] SEQ ID NO:117 is the genomic DNA region from Mo17 encoding LRR-Xa21 D-like kinase (Gene 5, FIG. 4).

DETAILED DESCRIPTION

[0189] The present invention provides allelic compositions in maize and methods for identifying and for selecting maize plants with increased head smut resistance. Also within the scope of this invention are allelic compositions and methods used to identify and to counter-select maize plants that have decreased head smut resistance. The following definitions are provided as an aid to understand this invention.

[0190] The mapping of the head smut resistance locus is outlined in a manuscript Identification and fine-mapping of a major QTL conferring resistance against head smut in maize by Yongsheng Chen, Qing Chao, Guoqing Tan, Jing Zhao, Meijing Zhang, Qing Ji, and Mingliang Xu. The manuscript is attached as an appendix to the specification.

[0191] The term allele refers to one of two or more different nucleotide sequences that occur at a specific locus. A favorable allele is the allele at a particular locus that confers, or contributes to, an agronomically desirable phenotype, e.g., increased head smut resistance, or alternatively, is an allele that allows the identification of plants with decreased head smut resistance that can be removed from a breeding program or planting (counterselection). A favorable allele of a marker is a marker allele that segregates with the favorable phenotype, or alternatively, segregates with the unfavorable plant phenotype, therefore providing the benefit of identifying plants. A favorable allelic form of a chromosome segment is a chromosome segment that includes a nucleotide sequence that contributes to superior agronomic performance at one or more genetic loci physically located on the chromosome segment. Allele frequency refers to the frequency (proportion or percentage) at which an allele is present at a locus within an individual, within a line, or within a population of lines. For example, for allele A, diploid individuals of genotype AA, Aa, or aa have allele frequencies of 1.0, 0.5, or 0.0, respectively. One can estimate the allele frequency within a line by averaging the allele frequencies of a sample of individuals from that line. Similarly, one can calculate the allele frequency within a population of lines by averaging the allele frequencies of lines that make up the population. For a population with a finite number of individuals or lines, an allele frequency can be expressed as a count of individuals or lines (or any other specified grouping) containing the allele.

[0192] An allele is positively associated with a trait when it is linked to it and when the presence of the allele is an indicator that the desired trait or trait form will occur in a plant comprising the allele. An allele is negatively associated with a trait when it is linked to it and when the presence of the allele is an indicator that a desired trait or trait form will not occur in a plant comprising the allele.

[0193] An individual is homozygous at a locus if the individual has only one type of allele at that locus (e.g., a diploid organism has a copy of the same allele at a locus for each of two homologous chromosomes). An organism is heterozygous at a locus if more than one allele type is present at that locus (e.g., a diploid individual with one copy each of two different alleles). The term homogeneity indicates that members of a group have the same genotype at one or more specific loci. In contrast, the term heterogeneity is used to indicate that individuals within the group differ in genotype at one or more specific loci.

[0194] As used herein, the terms chromosome interval or chromosome segment designate a contiguous linear span of genomic DNA that resides in planta on a single chromosome. The genetic elements or genes located on a single chromosome interval are physically linked. The size of a chromosome interval is not particularly limited. In some aspects, the genetic elements located within a single chromosome interval are genetically linked, typically with a genetic recombination distance of, for example, less than or equal to 20 cM, or alternatively, less than or equal to 10 cM. That is, two genetic elements within a single chromosome interval undergo recombination at a frequency of less than or equal to 20% or 10%.

[0195] The term crossed or cross means the fusion of gametes via pollination to produce progeny (e.g., cells, seeds or plants). The term encompasses both sexual crosses (the pollination of one plant by another) and selfing (self-pollination, e.g., when the pollen and ovule are from the same plant). A topcross test is a progeny test derived by crossing each parent with the same tester, usually a homozygous line. The parent being tested can be an open-pollinated variety, a cross, or an inbred line.

[0196] A genetic map is a description of genetic linkage relationships among loci on one or more chromosomes (or linkage groups) within a given species, generally depicted in a diagrammatic or tabular form. Genetic mapping is the process of defining the linkage relationships of loci through the use of genetic markers, populations segregating for the markers, and standard genetic principles of recombination frequency. A genetic map location is a location on a genetic map relative to surrounding genetic markers on the same linkage group where a specified marker can be found within a given species. If two different markers have the same genetic map location, the two markers are in such close proximity to each other that recombination occurs between them with such low frequency that it is undetectable.

[0197] The order and genetic distances between genetic markers can differ from one genetic map to another. This is because each genetic map is a product of the mapping population, types of markers used, and the polymorphic potential of each marker between different populations. For example, 10 cM on the internally derived genetic map (also referred to herein as PHB for Pioneer Hi-Bred) is roughly equivalent to 25-30 cM on the IBM2 2005 neighbors frame public map (a high resolution map available on maizeGDB). However, information can be correlated from one map to another using a general framework of common markers. One of ordinary skill in the art can use the framework of common markers to identify the positions of genetic markers and QTLs on each individual genetic map. A comparison of marker positions between the internally derived genetic map and the IBM2 neighbors genetic map can be seen in Table 3.

[0198] Genetic recombination frequency is the frequency of a crossing over event (recombination) between two genetic loci. Recombination frequency can be observed by following the segregation of markers and/or traits following meiosis. A genetic recombination frequency can be expressed in centimorgans (cM), where one cM is the distance between two genetic markers that show a 1% recombination frequency (i.e., a crossing-over event occurs between those two markers once in every 100 cell divisions).

[0199] The term genotype is the genetic constitution of an individual (or group of individuals) at one or more genetic loci, as contrasted with the observable trait (the phenotype). Genotype is defined by the allele(s) of one or more known loci that the individual has inherited from its parents. The term genotype can be used to refer to an individual's genetic constitution at a single locus, at multiple loci, or, more generally, the term genotype can be used to refer to an individual's genetic make-up for all the genes in its genome.

[0200] Germplasm refers to genetic material of or from an individual (e.g., a plant), a group of individuals (e.g., a plant line, variety or family), or a clone derived from a line, variety, species, or culture. The germplasm can be part of an organism or cell, or can be separate from the organism or cell. In general, germplasm provides genetic material with a specific molecular makeup that provides a physical foundation for some or all of the hereditary qualities of an organism or cell culture. As used herein, germplasm includes cells, seed or tissues from which new plants may be grown, or plant parts, such as leafs, stems, pollen, or cells that can be cultured into a whole plant.

[0201] A haplotype is the genotype of an individual at a plurality of genetic loci, i.e. a combination of alleles. Typically, the genetic loci described by a haplotype are physically and genetically linked, i.e., on the same chromosome segment.

[0202] Hybridization or nucleic acid hybridization refers to the pairing of complementary RNA and DNA strands as well as the pairing of complementary DNA single strands. Stringency refers to the conditions with regard to temperature, ionic strength, and the presence of certain organic solvents, such as formamide, under which nucleic acid hybridizations are carried out. Under high stringency conditions (high temperature and low salt), two nucleic acid fragments will pair, or hybridize, only if there is a high frequency of complementary base sequences between them.

[0203] The term introgression refers to the transmission of a desired allele of a genetic locus from one genetic background to another. For example, introgression of a desired allele at a specified locus can be transmitted to at least one progeny via a sexual cross between two parents of the same species, where at least one of the parents has the desired allele in its genome. Alternatively, for example, transmission of an allele can occur by recombination between two donor genomes, e.g., in a fused protoplast, where at least one of the donor protoplasts has the desired allele in its genome. The desired allele can be, e.g., a selected allele of a marker, a QTL, a transgene, or the like. In any case, offspring comprising the desired allele can be repeatedly backcrossed to a line having a desired genetic background and selected for the desired allele, to result in the allele becoming fixed in a selected genetic background.

[0204] A line or strain is a group of individuals of identical parentage that are generally inbred to some degree and that are generally homozygous and homogeneous at most loci (isogenic or near isogenic). A subline refers to an inbred subset of descendents that are genetically distinct from other similarly inbred subsets descended from the same progenitor.

[0205] An ancestral line is a parent line used as a source of genes e.g., for the development of elite lines. An ancestral population is a group of ancestors that have contributed the bulk of the genetic variation that was used to develop elite lines. Descendants are the progeny of ancestors, and may be separated from their ancestors by many generations of breeding. For example, elite lines are the descendants of their ancestors. A pedigree structure defines the relationship between a descendant and each ancestor that gave rise to that descendant. A pedigree structure can span one or more generations, describing relationships between the descendant and it's parents, grand parents, great-grand parents, etc.

[0206] An elite line or elite strain is an agronomically superior line that has resulted from many cycles of breeding and selection for superior agronomic performance. Numerous elite lines are available and known to those of skill in the art of maize breeding. An elite population is an assortment of elite individuals or lines that can be used to represent the state of the art in terms of agronomically superior genotypes of a given crop species, such as maize. Similarly, an elite germplasm or elite strain of germplasm is an agronomically superior germplasm, typically derived from and/or capable of giving rise to a plant with superior agronomic performance, such as an existing or newly developed elite line of maize.

[0207] A public IBM genetic map refers to any of following maps: IBM, IBM2, IBM2 neighbors, IBM2 FPC0507, IBM2 2004 neighbors, IBM2 2005 neighbors, or IBM2 2005 neighbors frame. All of the IBM genetic maps are based on a B73Mo17 population in which the progeny from the initial cross were random-mated for multiple generations prior to constructing recombinant inbred lines for mapping. Newer versions reflect the addition of genetic and BAC mapped loci as well as enhanced map refinement due to the incorporation of information obtained from other genetic maps.

[0208] In contrast, an exotic maize strain or an exotic maize germplasm is a strain or germplasm derived from a maize not belonging to an available elite maize line or strain of germplasm. In the context of a cross between two maize plants or strains of germplasm, an exotic germplasm is not closely related by descent to the elite germplasm with which it is crossed. Most commonly, the exotic germplasm is not derived from any known elite line of maize, but rather is selected to introduce novel genetic elements (typically novel alleles) into a breeding program.

[0209] As used herein, the term linkage is used to describe the degree with which one marker locus is associated with another marker locus or some other locus (for example, a head smut resistance locus). The linkage relationship between a molecular marker and a phenotype is given as a probability or adjusted probability. The probability value (also known as p-value) is the statistical likelihood that the particular combination of a phenotype and the presence or absence of a particular marker allele is random. Thus, the lower the probability score, the greater the likelihood that a phenotype and a particular marker will co-segregate. In some aspects, the probability score is considered significant or nonsignificant. In some embodiments, a probability score of 0.05 (p=0.05, or a 5% probability) of random assortment is considered a significant indication of co-segregation. However, an acceptable probability can be any probability of less than 50% (p=0.5). For example, a significant probability can be less than 0.25, less than 0.20, less than 0.15, less than 0.1, less than 0.05, less than 0.01, or less than 0.001.

[0210] In interval mapping, linkage between two marker loci can be calculated using odds ratios (i.e. the ratio of linkage versus no linkage). This ratio is more conveniently expressed as the logarithm of the ratios and is called a logarithm of odds (LOD) value or LOD score (Risch, Science 255:803-804 (1992)). A LOD value of 3 between two markers indicates that linkage is 1000 times more likely than no linkage. Lower LOD values, such as 2.0 or 2.5, may be used to detect a greater level of linkage.

[0211] Linked loci are located in close proximity such that meiotic recombination between homologous chromosome pairs does not occur with high frequency (frequency of equal to or less than 10%) between the two loci, e.g., linked loci co-segregate at least about 90% of the time, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.75%, or more of the time. Marker loci are especially useful when they demonstrate a significant probability of co-segregation (linkage) with a desired trait (e.g., increased head smut resistance). For example, in some aspects, these markers can be termed linked QTL markers.

[0212] Linkage can be expressed as a desired limit or range. For example, in some embodiments, any marker is linked (genetically and physically) to any other marker when the markers are separated by less than 50, 40, 30, 25, 20, or 15 map units (or cM). Further linkage can be described by separations of 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, 1 map units (or cM). In some aspects, it is advantageous to define a bracketed range of linkage, for example, between 10 and 20 cM, between 10 and 30 cM, or between 10 and 40 cM.

[0213] The more closely a marker is linked to a second locus, the better an indicator for the second locus that marker becomes. Thus, closely linked loci such as a marker locus and a second locus display an inter-locus recombination frequency of 10% or less, or about 9% or less, or about 8% or less, or about 7% or less, or about 6% or less, or about 5% or less, or about 4% or less, or about 3% or less, and or about 2% or less. In other embodiments, the relevant loci display a recombination frequency of about 1% or less, e.g., about 0.75% or less, or about 0.5% or less, or about 0.25% or less. Two loci that are localized to the same chromosome, and at such a distance that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, or less) are also said to be proximal to each other. Since one cM is the distance between two genetic markers that show a 1% recombination frequency, any marker is closely linked (genetically and physically) to any other marker that is in close proximity, e.g., at or less than 10 cM distant. Two closely linked markers on the same chromosome can be positioned 9, 8, 7, 6, 5, 4, 3, 2, 1, 0.75, 0.5, 0.25, 0.1, 0.075, 0.05, 0.025, or 0.01 cM or less from each other.

[0214] When referring to the relationship between two genetic elements, such as a genetic element contributing to increased head smut resistance and a proximal marker, coupling phase linkage indicates the state where the favorable allele at the stalk strength locus is physically associated on the same chromosome strand as the favorable allele of the respective linked marker locus. In coupling phase, both favorable alleles are inherited together by progeny that inherit that chromosome strand. In repulsion phase linkage, the favorable allele at the locus of interest is physically linked with an unfavorable allele at the proximal marker locus, and the two favorable alleles are not inherited together (i.e., the two loci are out of phase with each other).

[0215] The term linkage disequilibrium refers to a non-random segregation of genetic loci or traits (or both). In either case, linkage disequilibrium implies that the relevant loci are within sufficient physical proximity along a length of a chromosome so that they segregate together with greater than random (i.e., non-random) frequency (in the case of co-segregating traits, the loci that underlie the traits are in sufficient proximity to each other). Markers that show linkage disequilibrium are considered linked. Linked loci co-segregate more than 50% of the time, e.g., from about 51% to about 100% of the time. In other words, two markers that co-segregate have a recombination frequency of less than 50% (and by definition, are separated by less than 50 cM on the same linkage group.) As used herein, linkage can be between two markers, or alternatively between a marker and a phenotype. A marker locus can be associated with (linked to) a trait, e.g., head smut resistance. The degree of linkage of a molecular marker to a phenotypic trait is measured, e.g., as a statistical probability of co-segregation of that molecular marker with the phenotype.

[0216] Linkage disequilibrium is most commonly assessed using the measure r.sup.2 which is calculated using the formula described by Hill, W. G. and Robertson, A, Theor. Appl. Genet. 38:226-231 (1968). When r.sup.2=1, complete LD exists between the two marker loci, meaning that the markers have not been separated by recombination and have the same allele frequency. Values for r.sup.2 above indicate sufficiently strong LD to be useful for mapping (Ardlie et al., Nature Reviews Genetics 3:299-309 (2002)). Hence, alleles are in linkage disequilibrium when r.sup.2 values between pairwise marker loci are greater than or equal to 0.33, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, or 1.0.

[0217] As used herein, linkage equilibrium describes a situation where two markers independently segregate, i.e., sort among progeny randomly. Markers that show linkage equilibrium are considered unlinked (whether or not they lie on the same chromosome).

[0218] A locus is a chromosomal region where a gene or marker is located. For example, a gene locus is a specific chromosome location in the genome of a species where a specific gene can be found.

[0219] Maize and corn are used interchangeably herein.

[0220] The terms marker, molecular marker, marker nucleic acid, and marker locus refer to a nucleotide sequence or encoded product thereof (e.g., a protein) used as a point of reference when identifying a linked locus. A marker can be derived from genomic nucleotide sequence or from expressed nucleotide sequences (e.g., from a spliced RNA or a cDNA), or from an encoded polypeptide. The term also refers to nucleic acid sequences complementary to or flanking the marker sequences, such as nucleic acids used as probes or primer pairs capable of amplifying the marker sequence.

[0221] A marker probe is a nucleic acid sequence or molecule that can be used to identify the presence of a marker locus, e.g., a nucleic acid probe that is complementary to a marker locus sequence, through nucleic acid hybridization. Marker probes comprising 30 or more contiguous nucleotides of the marker locus (all or a portion of the marker locus sequence) may be used for nucleic acid hybridization. Alternatively, in some aspects, a marker probe refers to a probe of any type that is able to distinguish (i.e., genotype) the particular allele that is present at a marker locus. Nucleic acids are complementary when they specifically hybridize, or pair, in solution, e.g., according to Watson-Crick base pairing rules.

[0222] The markers with the designation PHM represent a set of primers that amplify a specific piece of DNA, herein referred to as an amplicon. The nucleotide sequences of the amplicons from multiple maize lines are compared, and polymorphisms, or variations, are identified. The polymorphisms include single nucleotide polymorphisms (SNPs), simple sequence repeats (SSRs), insertion/deletions (indels), etc.

[0223] A marker allele, alternatively an allele of a marker locus, can refer to one of a plurality of polymorphic nucleotide sequences found at a marker locus in a population that is polymorphic for the marker locus. Alternatively, marker alleles designated with a number represent the specific combination of alleles, also referred to as a haplotype, at informative polymorphic sites of that specific marker locus. In some aspects, marker loci correlating with head smut resistance in maize are provided.

[0224] A marker locus is a locus that can be used to track the presence of a second linked locus, e.g., a linked locus that encodes or contributes to expression of a phenotypic trait. For example, a marker locus can be used to monitor segregation of alleles at a locus, such as a QTL, that are genetically or physically linked to the marker locus.

[0225] Genetic markers are nucleic acids that are polymorphic in a population, and the marker alleles can be detected and distinguished by one or more analytic methods, e.g., RFLP, AFLP, isozyme, SNP, SSR, and the like. The term also refers to nucleic acid sequences complementary to the genomic sequences, such as nucleic acids used as probes.

[0226] Markers corresponding to genetic polymorphisms between members of a population can be detected by methods well-established in the art. These include, e.g., DNA sequencing, PCR-based sequence specific amplification methods, detection of restriction fragment length polymorphisms (RFLP), detection of isozyme markers, detection of polynucleotide polymorphisms by allele specific hybridization (ASH), detection of amplified variable sequences of the plant genome, detection of self-sustained sequence replication, detection of simple sequence repeats (SSRs), detection of single nucleotide polymorphisms (SNPs), or detection of amplified fragment length polymorphisms (AFLPs). Well established methods are also known for the detection of expressed sequence tags (ESTs) and SSR markers derived from EST sequences and randomly amplified polymorphic DNA (RAPD).

[0227] Head smut resistance refers to the ability of a maize plant to withstand infection by the host-specific fungus Sphacelotheca reiliana (Kuhn) Clint. This includes, but is not limited to, reduced sori production, improved plant vigor, improved tassel function, and improved corn yield when compared to maize plants lacking the resistance locus described herein.

[0228] The nucleic acids and polypeptides of the embodiments find use in methods for conferring or enhancing fungal resistance to a plant. The source of the resistance can be a naturally occurring genetic resistance locus that is introgressed via breeding into a sensitive maize population lacking the resistance locus, or alternatively, the genes conferring the resistance can be ectopically expressed as transgenes which confer resistance when expressed in the sensitive population. Accordingly, the compositions and methods disclosed herein are useful in protecting plants from fungal pathogens. Pathogen resistance, fungal resistance, and disease resistance are intended to mean that the plant avoids the disease symptoms that are the outcome of plant-pathogen interactions. That is, pathogens are prevented from causing plant diseases and the associated disease symptoms, or alternatively, the disease symptoms caused by the pathogen are minimized or lessened, such as, for example, the reduction of stress and associated yield loss. One of skill in the art will appreciate that the compositions and methods disclosed herein can be used with other compositions and methods available in the art for protecting plants from pathogen attack.

[0229] Hence, the methods of the embodiments can be utilized to protect plants from disease, particularly those diseases that are caused by plant fungal pathogens. As used herein, fungal resistance refers to enhanced resistance or tolerance to a fungal pathogen when compared to that of a wild type plant. Effects may vary from a slight increase in tolerance to the effects of the fungal pathogen (e.g., partial inhibition) to total resistance such that the plant is unaffected by the presence of the fungal pathogen. An increased level of resistance against a particular fungal pathogen or against a wider spectrum of fungal pathogens constitutes enhanced or improved fungal resistance. The embodiments of the invention also will enhance or improve fungal plant pathogen resistance, such that the resistance of the plant to a fungal pathogen or pathogens will increase. The term enhance refers to improve, increase, amplify, multiply, elevate, raise, and the like. Herein, plants of the invention are described as being resistant to infection by Sphacelotheca reiliana (Kuhn) Clint or having enhanced resistance to infection by Sphacelotheca reiliana (Kuhn) Clint as a result of the head smut resistance locus of the invention. Accordingly, they typically exhibit increased resistance to the disease when compared to equivalent plants that are susceptible to infection by Sphacelotheca reiliana (Kuhn) Clint because they lack the head smut resistance locus.

[0230] In particular aspects, methods for conferring or enhancing fungal resistance in a plant comprise introducing into a plant at least one expression cassette, wherein the expression cassette comprises a nucleotide sequence encoding an antifungal polypeptide of the embodiments operably linked to a promoter that drives expression in the plant. The plant expresses the polypeptide, thereby conferring fungal resistance upon the plant, or improving the plant's inherent level of resistance. In particular embodiments, the gene confers resistance to the fungal pathogen, Sphacelotheca reiliana (Kuhn) Clint.

[0231] Expression of an antifungal polypeptide of the embodiments may be targeted to specific plant tissues where pathogen resistance is particularly important, such as, for example, the leaves, roots, stalks, or vascular tissues. Such tissue-preferred expression may be accomplished by root-preferred, leaf-preferred, vascular tissue-preferred, stalk-preferred, or seed-preferred promoters.

[0232] Nucleotide sequence, polynucleotide, nucleic acid sequence, and nucleic acid fragment are used interchangeably and refer to a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. A nucleotide is a monomeric unit from which DNA or RNA polymers are constructed, and consists of a purine or pyrimidine base, a pentose, and a phosphoric acid group. Nucleotides (usually found in their 5-monophosphate form) are referred to by their single letter designation as follows: A for adenylate or deoxyadenylate (for RNA or DNA, respectively), C for cytidylate or deoxycytidylate, G for guanylate or deoxyguanylate, U for uridylate, T for deoxythymidylate, R for purines (A or G), Y for pyrimidines (C or T), K for G or T, H for A or C or T, I for inosine, and N for any nucleotide.

[0233] The terms polypeptide, peptide, and protein are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residues is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. Polypeptides of the embodiments can be produced either from a nucleic acid disclosed herein, or by the use of standard molecular biology techniques. For example, a truncated protein of the embodiments can be produced by expression of a recombinant nucleic acid of the embodiments in an appropriate host cell, or alternatively by a combination of ex vivo procedures, such as protease digestion and purification.

[0234] As used herein, the terms encoding or encoded when used in the context of a specified nucleic acid mean that the nucleic acid comprises the requisite information to direct translation of the nucleotide sequence into a specified protein. The information by which a protein is encoded is specified by the use of codons. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid or may lack such intervening non-translated sequences (e.g., as in cDNA).

[0235] The embodiments of the invention encompass isolated or substantially purified polynucleotide or protein compositions. An isolated or purified polynucleotide or protein, or biologically active portion thereof, is substantially or essentially free from components that normally accompany or interact with the polynucleotide or protein as found in its naturally occurring environment. Thus, an isolated or purified polynucleotide or protein is substantially free of other cellular material, or culture medium when produced by recombinant techniques (e.g. PCR amplification), or substantially free of chemical precursors or other chemicals when chemically synthesized. Optimally, an isolated polynucleotide is free of sequences (for example, protein encoding sequences) that naturally flank the polynucleotide (i.e., sequences located at the 5 and 3 ends of the polynucleotide) in the genomic DNA of the organism from which the polynucleotide is derived. For example, in various embodiments, the isolated polynucleotide can contain less than about 5 kb, about 4 kb, about 3 kb, about 2 kb, about 1 kb, about 0.5 kb, or about 0.1 kb of nucleotide sequence that naturally flank the polynucleotide in genomic DNA of the cell from which the polynucleotide is derived. A protein that is substantially free of cellular material includes preparations of protein having less than about 30%, about 20%, about 10%, about 5%, or about 1% (by dry weight) of contaminating protein. When the protein of the embodiments, or a biologically active portion thereof, is recombinantly produced, optimally culture medium represents less than about 30%, about 20%, about 10%, about 5%, or about 1% (by dry weight) of chemical precursors or non-protein-of-interest chemicals.

[0236] Fragments and variants of the disclosed nucleotide sequences and proteins encoded thereby are also encompassed by the embodiments. Fragment is intended to mean a portion of the nucleotide sequence or a portion of the amino acid sequence and hence protein encoded thereby. Fragments of a nucleotide sequence may encode protein fragments that retain the biological activity of the native protein and hence have the ability to confer fungal resistance upon a plant. Alternatively, fragments of a nucleotide sequence that are useful as hybridization probes do not necessarily encode fragment proteins retaining biological activity. Thus, fragments of a nucleotide sequence may range from at least about 15 nucleotides, about 50 nucleotides, about 100 nucleotides, and up to the full-length nucleotide sequence encoding the polypeptides of the embodiments.

[0237] A fragment of a nucleotide sequence that encodes a biologically active portion of a polypeptide of the embodiments will encode at least about 15, about 25, about 30, about 40, or about 50 contiguous amino acids, or up to the total number of amino acids present in a full-length polypeptide of the embodiments. Fragments of a nucleotide sequence that are useful as hybridization probes or PCR primers generally need not encode a biologically active portion of a protein.

[0238] As used herein, full-length sequence, in reference to a specified polynucleotide, means having the entire nucleic acid sequence of a native sequence. Native sequence is intended to mean an endogenous sequence, i.e., a non-engineered sequence found in an organism's genome.

[0239] Thus, a fragment of a nucleotide sequence of the embodiments may encode a biologically active portion of a polypeptide, or it may be a fragment that can be used as a hybridization probe or PCR primer using methods disclosed below. A biologically active portion of an antipathogenic polypeptide can be prepared by isolating a portion of one of the nucleotide sequences of the embodiments, expressing the encoded portion of the protein and assessing the ability of the encoded portion of the protein to confer or enhance fungal resistance in a plant. Nucleic acid molecules that are fragments of a nucleotide sequence of the embodiments comprise at least about 15, about 20, about 50, about 75, about 100, or about 150 nucleotides, or up to the number of nucleotides present in a full-length nucleotide sequence disclosed herein.

[0240] Variants is intended to mean substantially similar sequences. For polynucleotides, a variant comprises a deletion and/or addition of one or more nucleotides at one or more internal sites within the native polynucleotide and/or a substitution of one or more nucleotides at one or more sites in the native polynucleotide. As used herein, a native polynucleotide or polypeptide comprises a naturally occurring nucleotide sequence or amino acid sequence, respectively. One of skill in the art will recognize that variants of the nucleic acids of the embodiments will be constructed such that the open reading frame is maintained. For polynucleotides, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the polypeptides of the embodiments. Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques as outlined below. Variant polynucleotides also include synthetically derived polynucleotides, such as those generated, for example, by using site-directed mutagenesis but which still encode a protein of the embodiments. Generally, variants of a particular polynucleotide of the embodiments will have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to that particular polynucleotide as determined by sequence alignment programs and parameters described elsewhere herein.

[0241] Variants of a particular polynucleotide of the embodiments (i.e., the reference polynucleotide) can also be evaluated by comparison of the percent sequence identity between the polypeptide encoded by a variant polynucleotide and the polypeptide encoded by the reference polynucleotide. Thus, for example, isolated polynucleotides that encode a polypeptide with a given percent sequence identity to the polypeptide of SEQ ID NO: 3 are disclosed. Percent sequence identity between any two polypeptides can be calculated using sequence alignment programs and parameters described elsewhere herein. Where any given pair of polynucleotides of the embodiments is evaluated by comparison of the percent sequence identity shared by the two polypeptides they encode, the percent sequence identity between the two encoded polypeptides is at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity.

[0242] Variant protein is intended to mean a protein derived from the native protein by deletion or addition of one or more amino acids at one or more internal sites in the native protein and/or substitution of one or more amino acids at one or more sites in the native protein. Variant proteins encompassed by the embodiments are biologically active, that is they continue to possess the desired biological activity of the native protein, that is, the ability to confer or enhance plant fungal pathogen resistance as described herein. Such variants may result, for example, from genetic polymorphism or from human manipulation. Biologically active variants of a native protein of the embodiments will have at least about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or more sequence identity to the amino acid sequence for the native protein as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of a protein of the embodiments may differ from that protein by as few as about 1-15 amino acid residues, as few as about 1-10, such as about 6-10, as few as about 5, as few as 4, 3, 2, or even 1 amino acid residue.

[0243] The proteins of the embodiments may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants and fragments of the antipathogenic proteins can be prepared by mutations in the DNA. Methods for mutagenesis and polynucleotide alterations are well known in the art. See, for example, Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488-492; Kunkel et al. (1987) Methods in Enzymol. 154:367-382; U.S. Pat. No. 4,873,192; Walker and Gaastra, eds. (1983) Techniques in Molecular Biology (MacMillan Publishing Company, New York) and the references cited therein. Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1978) Atlas of Protein Sequence and Structure (Natl. Biomed. Res. Found., Washington, D.C.), herein incorporated by reference. Conservative substitutions, such as exchanging one amino acid with another having similar properties, may be optimal.

[0244] Thus, the genes and polynucleotides of the embodiments include both naturally occurring sequences as well as mutant forms. Likewise, the proteins of the embodiments encompass both naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired ability to confer or enhance plant fungal pathogen resistance. Obviously, the mutations that will be made in the DNA encoding the variant must not place the sequence out of reading frame and optimally will not create complementary regions that could produce secondary mRNA structure. See, EP Patent No. 0075444.

[0245] The deletions, insertions, and substitutions of the protein sequences encompassed herein are not expected to produce radical changes in the characteristics of the protein. However, when it is difficult to predict the exact effect of the substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by screening transgenic plants which have been transformed with the variant protein to ascertain the effect on the ability of the plant to resist fungal pathogenic attack.

[0246] Variant polynucleotides and proteins also encompass sequences and proteins derived from mutagenic or recombinogenic procedures, including and not limited to procedures such as DNA shuffling. One of skill in the art could envision modifications that would alter the range of pathogens to which the protein responds. With such a procedure, one or more different protein coding sequences can be manipulated to create a new protein possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. For example, using this approach, sequence motifs encoding a domain of interest may be shuffled between the protein gene of the embodiments and other known protein genes to obtain a new gene coding for a protein with an improved property of interest, such as increased ability to confer or enhance plant fungal pathogen resistance. Strategies for such DNA shuffling are known in the art. See, for example, Stemmer (1994) Proc. Natl. Acad. Sci. USA 91:10747-10751; Stemmer (1994) Nature 370:389-391; Crameri et al. (1997) Nature Biotech. 15:436-438; Moore et al. (1997) J. Mol. Biol. 272:336-347; Zhang et al. (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509; Crameri et al. (1998) Nature 391:288-291; and U.S. Pat. Nos. 5,605,793 and 5,837,458.

[0247] The polynucleotides of the embodiments can be used to isolate corresponding sequences from other organisms, particularly other plants. In this manner, methods such as PCR, hybridization, and the like can be used to identify such sequences based on their sequence homology to the sequences set forth herein. Sequences isolated based on their sequence identity to the entire sequences set forth herein or to variants and fragments thereof are encompassed by the embodiments. Such sequences include sequences that are orthologs of the disclosed sequences. Orthologs is intended to mean genes derived from a common ancestral gene and which are found in different species as a result of speciation. Genes found in different species are considered orthologs when their nucleotide sequences and/or their encoded protein sequences share at least about 60%, about 70%, about 75%, about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or greater sequence identity. Functions of orthologs are often highly conserved among species. Thus, isolated polynucleotides that encode for a protein that confers or enhances fungal plant pathogen resistance and that hybridize under stringent conditions to the sequences disclosed herein, or to variants or fragments thereof, are encompassed by the embodiments.

[0248] In a PCR approach, oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any organism of interest. Methods for designing PCR primers and PCR cloning are generally known in the art and are disclosed in Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Plainview, N.Y.). See also Innis et al., eds. (1990) PCR Protocols: A Guide to Methods and Applications (Academic Press, New York); Innis and Gelfand, eds. (1995) PCR Strategies (Academic Press, New York); and Innis and Gelfand, eds. (1999) PCR Methods Manual (Academic Press, New York). Known methods of PCR include, and are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially-mismatched primers, and the like.

[0249] In hybridization techniques, all or part of a known polynucleotide is used as a probe that selectively hybridizes to other corresponding polynucleotides present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism. The hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as .sup.32P, or any other detectable marker. Thus, for example, probes for hybridization can be made by labeling synthetic oligonucleotides based on the polynucleotides of the embodiments. Methods for preparation of probes for hybridization and for construction of cDNA and genomic libraries are generally known in the art and are disclosed in Sambrook et al. (1989) supra.

[0250] For example, an entire polynucleotide disclosed herein, or one or more portions thereof, may be used as a probe capable of specifically hybridizing to corresponding polynucleotides and messenger RNAs. To achieve specific hybridization under a variety of conditions, such probes include sequences that are unique and are optimally at least about 10 nucleotides in length, at least about 15 nucleotides in length, or at least about 20 nucleotides in length. Such probes may be used to amplify corresponding polynucleotides from a chosen organism by PCR. This technique may be used to isolate additional coding sequences from a desired organism or as a diagnostic assay to determine the presence of coding sequences in an organism. Hybridization techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, for example, Sambrook et al. (1989) supra.

[0251] Hybridization of such sequences may be carried out under stringent conditions. By stringent conditions or stringent hybridization conditions is intended conditions under which a probe will hybridize to its target sequence to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optimally less than 500 nucleotides in length. Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30 C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60 C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37 C., and a wash in 1 to 2SSC (20SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55 C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37 C., and a wash in 0.5 to 1SSC at 55 to 60 C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37 C., and a final wash in 0.1SSC at 60 to 65 C. for at least 30 minutes. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. The duration of the wash time will be at least a length of time sufficient to reach equilibrium.

[0252] Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the thermal melting point (T.sub.m) can be approximated from the equation of Meinkoth and Wahl (1984) Anal. Biochem. 138:267-284: T.sub.m=81.5 C.+16.6 (log M)+0.41 (% GC)0.61 (% form)500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The T.sub.m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T.sub.m is reduced by about 1 C. for each 1% of mismatching; thus, T.sub.m, hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with 90% identity are sought, the T.sub.m can be decreased 10 C. Generally, stringent conditions are selected to be about 5 C. lower than the T.sub.m for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4 C. lower than the T.sub.m; moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10 C. lower than the T.sub.m; low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20 C. lower than the T.sub.m. Using the equation, hybridization and wash compositions, and desired T.sub.m, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T.sub.m of less than 45 C. (aqueous solution) or 32 C. (formamide solution), it is optimal to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular BiologyHybridization with Nucleic Acid Probes, Part I, Chapter 2 (Elsevier, New York); and Ausubel et al., eds. (1995) Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, New York). See Sambrook et al. (1989) supra.

[0253] Various procedures can be used to check for the presence or absence of a particular sequence of DNA, RNA, or a protein. These include, for example, Southern blots, northern blots, western blots, and ELISA analysis. Techniques such as these are well known to those of skill in the art and many references exist which provide detailed protocols. Such references include Sambrook et al. (1989) supra, and Crowther, J. R. (2001), The ELISA Guidebook, Humana Press, Totowa, N.J., USA.

[0254] The following terms are used to describe the sequence relationships between two or more polynucleotides or polypeptides: (a) reference sequence, (b) comparison window, (c) sequence identity, and, (d) percentage of sequence identity.

[0255] (a) As used herein, reference sequence is a defined sequence used as a basis for sequence comparison. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.

[0256] (b) As used herein, comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two polynucleotides. Generally, the comparison window is at least about 20 contiguous nucleotides in length, and optionally can be about 30, about 40, about 50, about 100, or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide sequence a gap penalty is typically introduced and is subtracted from the number of matches.

[0257] Methods of alignment of sequences for comparison are well known in the art. Thus, the determination of percent sequence identity between any two sequences can be accomplished using a mathematical algorithm. Non-limiting examples of such mathematical algorithms are the algorithm of Myers and Miller (1988) CABIOS 4:11-17; the local alignment algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the global alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453; the search-for-local alignment method of Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85:2444-2448; the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 872264, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877.

[0258] Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, and are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, Calif.); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the GCG Wisconsin Genetics Software Package, Version 10 (available from Accelrys Inc., 9685 Scranton Road, San Diego, Calif., USA). Alignments using these programs can be performed using the default parameters. The CLUSTAL program is well described by Higgins et al. (1988) Gene 73:237-244 (1988); Higgins et al. (1989) CABIOS 5:151-153; Corpet et al. (1988) Nucleic Acids Res. 16:10881-90; Huang et al. (1992) CABIOS 8:155-65; and Pearson et al. (1994) Meth. Mol. Biol. 24:307-331. The ALIGN program is based on the algorithm of Myers and Miller (1988) supra. A PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used with the ALIGN program when comparing amino acid sequences. The BLAST programs of Altschul et al (1990) J. Mol. Biol. 215:403 are based on the algorithm of Karlin and Altschul (1990) supra. BLAST nucleotide searches can be performed with the BLASTN program, score=100, wordlength=12, to obtain nucleotide sequences homologous to a nucleotide sequence encoding a protein of the embodiments. BLAST protein searches can be performed with the BLASTX program, score=50, wordlength=3, to obtain amino acid sequences homologous to a protein or polypeptide of the embodiments. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) can be utilized as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389. Alternatively, PSI-BLAST (in BLAST 2.0) can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al. (1997) supra. When utilizing BLAST, Gapped BLAST, PSI-BLAST, the default parameters of the respective programs (e.g., BLASTN for nucleotide sequences, BLASTX for proteins) can be used. See www.ncbi.nlm.nih.gov. Alignment may also be performed manually by inspection.

[0259] Unless otherwise stated, sequence identity/similarity values provided herein refer to the value obtained using GAP Version 10 using the following parameters: % identity and % similarity for a nucleotide sequence using Gap Weight of 50 and Length Weight of 3, and the nwsgapdna.cmp scoring matrix; % identity and % similarity for an amino acid sequence using Gap Weight of 8 and Length Weight of 2, and the BLOSUM62 scoring matrix; or any equivalent program thereof. By equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by GAP Version 10.

[0260] GAP uses the algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443-453, to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty. Default gap creation penalty values and gap extension penalty values in Version 10 of the GCG Wisconsin Genetics Software Package for protein sequences are 8 and 2, respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 200. Thus, for example, the gap creation and gap extension penalties can be 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65 or greater.

[0261] GAP presents one member of the family of best alignments. There may be many members of this family, and no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity, and Similarity. The Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the GCG Wisconsin Genetics Software Package is BLOSUM62 (see Henikoff and Henikoff (1989) Proc. Natl. Acad. Sci. USA 89:10915).

[0262] (c) As used herein, sequence identity or identity in the context of two polynucleotides or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. When sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences that differ by such conservative substitutions are said to have sequence similarity or similarity. Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif.).

[0263] (d) As used herein, percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.

[0264] The use of the term polynucleotide is not intended to limit the embodiments to polynucleotides comprising DNA. Those of ordinary skill in the art will recognize that polynucleotides can comprise ribonucleotides and combinations of ribonucleotides and deoxyribonucleotides. Such deoxyribonucleotides and ribonucleotides include both naturally occurring molecules and synthetic analogues. The polynucleotides of the embodiments also encompass all forms of sequences including, and not limited to, single-stranded forms, double-stranded forms, and the like.

[0265] Isolated polynucleotides of the embodiments can be incorporated into recombinant DNA constructs capable of introduction into and replication in a host cell. A vector may be such a construct that includes a replication system and sequences that are capable of transcription and translation of a polypeptide-encoding sequence in a given host cell. A number of vectors suitable for stable transfection of plant cells or for the establishment of transgenic plants have been described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp. 1987; Weissbach and Weissbach, Methods for Plant Molecular Biology, Academic Press, 1989; and Flevin et al., Plant Molecular Biology Manual, Kluwer Academic Publishers, 1990. Typically, plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5 and 3 regulatory sequences and a dominant selectable marker. Such plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.

[0266] The terms recombinant construct, expression cassette, expression construct, chimeric construct, construct, recombinant DNA construct and recombinant DNA fragment are used interchangeably herein and are nucleic acid fragments. A recombinant construct comprises an artificial combination of nucleic acid fragments, including, and not limited to, regulatory and coding sequences that are not found together in nature. For example, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source and arranged in a manner different than that found in nature. Such construct may be used by itself or may be used in conjunction with a vector. If a vector is used then the choice of vector is dependent upon the method that will be used to transform host cells as is well known to those skilled in the art. For example, a plasmid vector can be used. The skilled artisan is well aware of the genetic elements that must be present on the vector in order to successfully transform, select and propagate host cells comprising any of the isolated nucleic acid fragments of the embodiments. Screening to obtain lines displaying the desired expression level and pattern of the polynucleotides or of the Rcg1 locus may be accomplished by amplification, Southern analysis of DNA, northern analysis of mRNA expression, immunoblotting analysis of protein expression, phenotypic analysis, and the like.

[0267] The term recombinant DNA construct refers to a DNA construct assembled from nucleic acid fragments obtained from different sources. The types and origins of the nucleic acid fragments may be very diverse.

[0268] In some embodiments, expression cassettes comprising a promoter operably linked to a heterologous nucleotide sequence of the embodiments are further provided. The expression cassettes of the embodiments find use in generating transformed plants, plant cells, and microorganisms and in practicing the methods for inducing plant fungal pathogen resistance disclosed herein. The expression cassette will include 5 and 3 regulatory sequences operably linked to a polynucleotide of the embodiments. Operably linked is intended to mean a functional linkage between two or more elements. Regulatory sequences refer to nucleotides located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which may influence the transcription, RNA processing, stability, or translation of the associated coding sequence. Regulatory sequences may include, and are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences. For example, an operable linkage between a polynucleotide of interest and a regulatory sequence (a promoter, for example) is functional link that allows for expression of the polynucleotide of interest. Operably linked elements may be contiguous or non-contiguous. When used to refer to the joining of two protein coding regions, by operably linked is intended that the coding regions are in the same reading frame. The cassette may additionally contain at least one additional gene to be cotransformed into the organism. Alternatively, the additional gene(s) can be provided on multiple expression cassettes. Such an expression cassette is provided with a plurality of restriction sites and/or recombination sites for insertion of the polynucleotide that encodes an antipathogenic polypeptide to be under the transcriptional regulation of the regulatory regions. The expression cassette may additionally contain selectable marker genes.

[0269] The expression cassette will include in the 5-3 direction of transcription, a transcriptional initiation region (i.e., a promoter), translational initiation region, a polynucleotide of the embodiments, a translational termination region and, optionally, a transcriptional termination region functional in the host organism. The regulatory regions (i.e., promoters, transcriptional regulatory regions, and translational termination regions) and/or the polynucleotide of the embodiments may be native/analogous to the host cell or to each other. Alternatively, the regulatory regions and/or the polynucleotide of the embodiments may be heterologous to the host cell or to each other. As used herein, heterologous in reference to a sequence is a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention. For example, a promoter operably linked to a heterologous polynucleotide is from a species different from the species from which the polynucleotide was derived, or, if from the same/analogous species, one or both are substantially modified from their original form and/or genomic locus, or the promoter is not the native promoter for the operably linked polynucleotide.

[0270] The optionally included termination region may be native with the transcriptional initiation region, may be native with the operably linked polynucleotide of interest, may be native with the plant host, or may be derived from another source (i.e., foreign or heterologous) to the promoter, the polynucleotide of interest, the host, or any combination thereof. Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions. See also Guerineau et al. (1991) Mol. Gen. Genet. 262:141-144; Proudfoot (1991) Cell 64:671-674; Sanfacon et al. (1991) Genes Dev. 5:141-149; Mogen et al. (1990) Plant Cell 2:1261-1272; Munroe et al. (1990) Gene 91:151-158; Ballas et al. (1989) Nucleic Acids Res. 17:7891-7903; and Joshi et al. (1987) Nucleic Acids Res. 15:9627-9639. In particular embodiments, the potato protease inhibitor II gene (PinII) terminator is used. See, for example, Keil et al. (1986) Nucl. Acids Res. 14:5641-5650; and An et al. (1989) Plant Cell 1:115-122, herein incorporated by reference in their entirety.

[0271] A number of promoters can be used in the practice of the embodiments, including the native promoter of the polynucleotide sequence of interest. The promoters can be selected based on the desired outcome. A wide range of plant promoters are discussed in the recent review of Potenza et al. (2004) In Vitro Cell Dev Biol-Plant 40:1-22, herein incorporated by reference. For example, the nucleic acids can be combined with constitutive, tissue-preferred, pathogen-inducible, or other promoters for expression in plants. Such constitutive promoters include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter (Odell et al. (1985) Nature 313:810-812); rice actin (McElroy et al. (1990) Plant Cell 2:163-171); ubiquitin (Christensen et al. (1989) Plant Mol. Biol. 12:619-632 and Christensen et al. (1992) Plant Mol. Biol. 18:675-689); pEMU (Last et al. (1991) Theor. Appl. Genet. 81:581-588); MAS (Velten et al. (1984) EMBO J. 3:2723-2730); ALS promoter (U.S. Pat. No. 5,659,026), and the like. Other constitutive promoters include, for example, U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.

[0272] It may sometimes be beneficial to express the gene from an inducible promoter, particularly from a pathogen-inducible promoter. Such promoters include those from pathogenesis-related proteins (PR proteins), which are induced following infection by a pathogen; e.g., PR proteins, SAR proteins, beta-1,3-glucanase, chitinase, etc. See, for example, Redolfi et al. (1983) Neth. J. Plant Pathol. 89:245-254; Uknes et al. (1992) Plant Cell 4:645-656; and Van Loon (1985) Plant Mol. Virol. 4:111-116. See also WO 99/43819, herein incorporated by reference.

[0273] Of interest are promoters that result in expression of a protein locally at or near the site of pathogen infection. See, for example, Marineau et al. (1987) Plant Mol. Biol. 9:335-342; Matton et al. (1989) Molecular Plant-Microbe Interactions 2:325-331; Somsisch et al. (1986) Proc. Natl. Acad. Sci. USA 83:2427-2430; Somsisch et al. (1988) Mol. Gen. Genet. 2:93-98; and Yang (1996) Proc. Natl. Acad. Sci. USA 93:14972-14977. See also, Chen et al. (1996) Plant J. 10:955-966; Zhang et al. (1994) Proc. Natl. Acad. Sci. USA 91:2507-2511; Warner et al. (1993) Plant J. 3:191-201; Siebertz et al. (1989) Plant Cell 1:961-968; U.S. Pat. No. 5,750,386 (nematode-inducible); and the references cited therein. Of particular interest is the inducible promoter for the maize PRms gene, whose expression is induced by the pathogen Fusarium moniliforme (see, for example, Cordero et al. (1992) Physiol. Mol. Plant Path. 41:189-200).

[0274] Additionally, as pathogens find entry into plants through wounds or insect damage, a wound-inducible promoter may be used in the constructions of the embodiments. Such wound-inducible promoters include potato proteinase inhibitor (pin II) gene (Ryan (1990) Ann. Rev. Phytopath. 28:425-449; Duan et al. (1996) Nature Biotechnology 14:494-498); wun1 and wun2, U.S. Pat. No. 5,428,148; win1 and win2 (Stanford et al. (1989) Mol. Gen. Genet. 215:200-208); systemin (McGurl et al. (1992) Science 225:1570-1573); WIP1 (Rohmeier et al. (1993) Plant Mol. Biol. 22:783-792; Eckelkamp et al. (1993) FEBS Letters 323:73-76); MPI gene (Corderok et al. (1994) Plant J. 6(2):141-150); and the like, herein incorporated by reference.

[0275] Chemical-regulated promoters can be used to modulate the expression of a gene in a plant through the application of an exogenous chemical regulator. Depending upon the objective, the promoter may be a chemical-inducible promoter, where application of the chemical induces gene expression, or a chemical-repressible promoter, where application of the chemical represses gene expression. Chemical-inducible promoters are known in the art and include, and are not limited to, the maize In2-2 promoter, which is activated by benzenesulfonamide herbicide safeners, the maize GST promoter, which is activated by hydrophobic electrophilic compounds that are used as pre-emergent herbicides, and the tobacco PR-la promoter, which is activated by salicylic acid. Other chemical-regulated promoters of interest include steroid-responsive promoters (see, for example, the glucocorticoid-inducible promoter in Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:10421-10425 and McNellis et al. (1998) Plant J. 14(2):247-257) and tetracycline-inducible and tetracycline-repressible promoters (see, for example, Gatz et al. (1991) Mol. Gen. Genet. 227:229-237, and U.S. Pat. Nos. 5,814,618 and 5,789,156), herein incorporated by reference.

[0276] Tissue-preferred promoters can be utilized to target enhanced expression of the polypeptides of the embodiments within a particular plant tissue. For example, a tissue-preferred promoter may be used to express a polypeptide in a plant tissue where disease resistance is particularly important, such as, for example, the roots, the stalk or the leaves. Tissue-preferred promoters include Yamamoto et al. (1997) Plant J. 12(2):255-265; Kawamata et al. (1997) Plant Cell Physiol. 38(7):792-803; Hansen et al. (1997) Mol. Gen Genet. 254(3):337-343; Russell et al. (1997) Transgenic Res. 6(2): 157-168; Rinehart et al. (1996) Plant Physiol. 112(3): 1331-1341; Van Camp et al. (1996) Plant Physiol. 112(2):525-535; Canevascini et al. (1996) Plant Physiol. 112(2):513-524; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Lam (1994) Results Probl. Cell Differ. 20:181-196; Orozco et al. (1993) Plant Mol Biol. 23(6): 1129-1138; Matsuoka et al. (1993) Proc Natl. Acad. Sci. USA 90(20):9586-9590; and Guevara-Garcia et al. (1993) Plant J. 4(3):495-505. Such promoters can be modified, if necessary, for weak expression.

[0277] Vascular tissue-preferred promoters are known in the art and include those promoters that selectively drive protein expression in, for example, xylem and phloem tissue. Vascular tissue-preferred promoters include, and are not limited to, the Prunus serotina prunasin hydrolase gene promoter (see, e.g., International Publication No. WO 03/006651), and also those found in U.S. patent application Ser. No. 10/109,488.

[0278] Stalk-preferred promoters may be used to drive expression of a polypeptide of the embodiments. Exemplary stalk-preferred promoters include the maize MS8-15 gene promoter (see, for example, U.S. Pat. No. 5,986,174 and International Publication No. WO 98/00533), and those found in Graham et al. (1997) Plant Mol Biol 33(4): 729-735.

[0279] Leaf-preferred promoters are known in the art. See, for example, Yamamoto et al. (1997) Plant J. 12(2):255-265; Kwon et al. (1994) Plant Physiol. 105:357-67; Yamamoto et al. (1994) Plant Cell Physiol. 35(5):773-778; Gotor et al. (1993) Plant J. 3:509-18; Orozco et al. (1993) Plant Mol. Biol. 23(6):1129-1138; and Matsuoka et al. (1993) Proc. Natl. Acad. Sci. USA 90(20):9586-9590.

[0280] Root-preferred promoters are known and can be selected from the many available from the literature or isolated de novo from various compatible species. See, for example, Hire et al. (1992) Plant Mol. Biol. 20(2):207-218 (soybean root-specific glutamine synthetase gene); Keller and Baumgartner (1991) Plant Cell 3(10): 1051-1061 (root-specific control element in the GRP 1.8 gene of French bean); Sanger et al. (1990) Plant Mol. Biol. 14(3):433-443 (root-specific promoter of the mannopine synthase (MAS) gene of Agrobacterium tumefaciens); and Miao et al. (1991) Plant Cell 3(1): 11-22 (full-length cDNA clone encoding cytosolic glutamine synthetase (GS), which is expressed in roots and root nodules of soybean). See also Bogusz et al. (1990) Plant Cell 2(7):633-641, where two root-specific promoters isolated from hemoglobin genes from the nitrogen-fixing nonlegume Parasponia andersonii and the related non-nitrogen-fixing nonlegume Trema tomentosa are described. The promoters of these genes were linked to a -glucuronidase reporter gene and introduced into both the nonlegume Nicotiana tabacum and the legume Lotus corniculatus, and in both instances root-specific promoter activity was preserved. Leach and Aoyagi (1991) describe their analysis of the promoters of the highly expressed rolC and rolD root-inducing genes of Agrobacterium rhizogenes (see Plant Science (Limerick) 79(1):69-76). They concluded that enhancer and tissue-preferred DNA determinants are dissociated in those promoters. Teeri et al. (1989) used gene fusion to lacZ to show that the Agrobacterium T-DNA gene encoding octopine synthase is especially active in the epidermis of the root tip and that the TR2 gene is root specific in the intact plant and stimulated by wounding in leaf tissue, an especially desirable combination of characteristics for use with an insecticidal or larvicidal gene (see EMBO J. 8(2):343-350). The TR1 gene, fused to nptII (neomycin phosphotransferase II) showed similar characteristics. Additional root-preferred promoters include the VfENOD-GRP3 gene promoter (Kuster et al. (1995) Plant Mol. Biol. 29(4):759-772); and rolB promoter (Capana et al. (1994) Plant Mol. Biol. 25(4):681-691. See also U.S. Pat. Nos. 5,837,876; 5,750,386; 5,633,363; 5,459,252; 5,401,836; 5,110,732; and U.S. Pat. No. 5,023,179.

[0281] Seed-preferred promoters include both seed-specific promoters (those promoters active during seed development such as promoters of seed storage proteins) as well as seed-germinating promoters (those promoters active during seed germination). See Thompson et al. (1989) BioEssays 10:108, herein incorporated by reference. Such seed-preferred promoters include, and are not limited to, Cim1 (cytokinin-induced message); cZ19B1 (maize 19 kDa zein); milps (myo-inositol-1-phosphate synthase) (see WO 00/11177 and U.S. Pat. No. 6,225,529; herein incorporated by reference). Gamma-zein is a preferred endosperm-specific promoter. Glob-1 is a preferred embryo-specific promoter. For dicots, seed-specific promoters include, and are not limited to, bean -phaseolin, napin, -conglycinin, soybean lectin, cruciferin, and the like. For monocots, seed-specific promoters include, and are not limited to, maize 15 kDa zein, 22 kDa zein, 27 kDa zein, g-zein, waxy, shrunken 1, shrunken 2, globulin 1, etc. See also WO 00/12733, where seed-preferred promoters from end1 and end2 genes are disclosed; herein incorporated by reference.

[0282] Additional sequence modifications are known to enhance gene expression in a cellular host. These include elimination of sequences encoding spurious polyadenylation signals, exon-intron splice site signals, transposon-like repeats, and other such well-characterized sequences that may be deleterious to gene expression. The G-C content of the sequence may be adjusted to levels average for a given cellular host, as calculated by reference to known genes expressed in the host cell. When possible, the sequence is modified to avoid predicted hairpin secondary mRNA structures.

[0283] Expression cassettes may additionally contain 5 leader sequences. Such leader sequences can act to enhance translation. Translation leaders are known in the art and include: picornavirus leaders, for example, EMCV leader (Encephalomyocarditis 5 noncoding region) (Elroy-Stein et al. (1989) Proc. Natl. Acad. Sci. USA 86:6126-6130); potyvirus leaders, for example, TEV leader (Tobacco Etch Virus) (Gallie et al. (1995) Gene 165(2):233-238), MDMV leader (Maize Dwarf Mosaic Virus), and human immunoglobulin heavy-chain binding protein (BiP) (Macejak et al. (1991) Nature 353:90-94); untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4) (Jobling et al. (1987) Nature 325:622-625); tobacco mosaic virus leader (TMV) (Gallie et al. (1989) in Molecular Biology of RNA, ed. Cech (Liss, New York), pp. 237-256); and maize chlorotic mottle virus leader (MCMV) (Lommel et al. (1991) Virology 81:382-385). See also, Della-Cioppa et al. (1987) Plant Physiol. 84:965-968. Other methods known to enhance translation can also be utilized, for example, introns, and the like.

[0284] In preparing the expression cassette, the various DNA fragments may be manipulated, so as to provide for the DNA sequences in the proper orientation and, as appropriate, in the proper reading frame. Toward this end, adapters or linkers may be employed to join the DNA fragments or other manipulations may be involved to provide for convenient restriction sites, removal of superfluous DNA, removal of restriction sites, or the like. For this purpose, in vitro mutagenesis, primer repair, restriction, annealing, resubstitutions, e.g., transitions and transversions, may be involved.

[0285] The expression cassette can also comprise a selectable marker gene for the selection of transformed cells. Selectable marker genes are utilized for the selection of transformed cells or tissues. Marker genes include genes encoding antibiotic resistance, such as those encoding neomycin phosphotransferase II (NEO) and hygromycin phosphotransferase (HPT), as well as genes conferring resistance to herbicidal compounds, such as glufosinate ammonium, bromoxynil, imidazolinones, and 2,4-dichlorophenoxyacetate (2,4-D). Additional selectable markers include phenotypic markers such as -galactosidase and fluorescent proteins such as green fluorescent protein (GFP) (Su et al. (2004) Biotechnol Bioeng 85:610-9 and Fetter et al. (2004) Plant Cell 16:215-28), cyan florescent protein (CYP) (Bolte et al. (2004) J. Cell Science 117:943-54 and Kato et al. (2002) Plant Physiol 129:913-42), and yellow florescent protein (PhiYFP from Evrogen, see, Bolte et al. (2004) J. Cell Science 117:943-54). For additional selectable markers, see generally, Yarranton (1992) Curr. Opin. Biotech. 3:506-511; Christopherson et al. (1992) Proc. Natl. Acad. Sci. USA 89:6314-6318; Yao et al. (1992) Cell 71:63-72; Reznikoff (1992) Mol. Microbiol. 6:2419-2422; Barkley et al. (1980) in The Operon, pp. 177-220; Hu et al. (1987) Cell 48:555-566; Brown et al. (1987) Cell 49:603-612; Figge et al. (1988) Cell 52:713-722; Deuschle et al. (1989) Proc. Natl. Acad. Aci. USA 86:5400-5404; Fuerst et al. (1989) Proc. Natl. Acad. Sci. USA 86:2549-2553; Deuschle et al. (1990) Science 248:480-483; Gossen (1993) Ph.D. Thesis, University of Heidelberg; Reines et al. (1993) Proc. Natl. Acad. Sci. USA 90:1917-1921; Labow et al. (1990) Mol. Cell. Biol. 10:3343-3356; Zambretti et al. (1992) Proc. Natl. Acad. Sci. USA 89:3952-3956; Baim et al. (1991) Proc. Natl. Acad. Sci. USA 88:5072-5076; Wyborski et al. (1991) Nucleic Acids Res. 19:4647-4653; Hillenand-Wissman (1989) Topics Mol. Struc. Biol. 10:143-162; Degenkolb et al. (1991) Antimicrob. Agents Chemother. 35:1591-1595; Kleinschnidt et al. (1988) Biochemistry 27:1094-1104; Bonin (1993) Ph.D. Thesis, University of Heidelberg; Gossen et al. (1992) Proc. Natl. Acad. Sci. USA 89:5547-5551; Oliva et al. (1992) Antimicrob. Agents Chemother. 36:913-919; Hlavka et al. (1985) Handbook of Experimental Pharmacology, Vol. 78 (Springer-Verlag, Berlin); Gill et al. (1988) Nature 334:721-724. Such disclosures are herein incorporated by reference.

[0286] The above list of selectable marker genes is not meant to be limiting. Any selectable marker gene can be used in the embodiments.

[0287] In certain embodiments the nucleic acid sequences of the embodiments can be stacked with any combination of polynucleotide sequences of interest in order to create plants with a desired phenotype. This stacking may be accomplished by a combination of genes within the DNA construct, or by crossing Rcg1 with another line that comprises the combination. For example, the polynucleotides of the embodiments may be stacked with any other polynucleotides of the embodiments, or with other genes. The combinations generated can also include multiple copies of any one of the polynucleotides of interest. The polynucleotides of the embodiments can also be stacked with any other gene or combination of genes to produce plants with a variety of desired trait combinations including and not limited to traits desirable for animal feed such as high oil genes (e.g., U.S. Pat. No. 6,232,529); balanced amino acids (e.g. hordothionins (U.S. Pat. Nos. 5,990,389; 5,885,801; 5,885,802; and 5,703,409); barley high lysine (Williamson et al. (1987) Eur. J. Biochem. 165:99-106; and WO 98/20122); and high methionine proteins (Pedersen et al. (1986) J. Biol. Chem. 261:6279; Kirihara et al. (1988) Gene 71:359; and Musumura et al. (1989) Plant Mol. Biol. 12: 123)); increased digestibility (e.g., modified storage proteins (U.S. application Ser. No. 10/053,410, filed Nov. 7, 2001); and thioredoxins (U.S. application Ser. No. 10/005,429, filed Dec. 3, 2001)), the disclosures of which are herein incorporated by reference. The polynucleotides of the embodiments can also be stacked with traits desirable for insect, disease or herbicide resistance (e.g., Bacillus thuringiensis toxic proteins (U.S. Pat. Nos. 5,366,892; 5,747,450; 5,737,514; 5,723,756; 5,593,881; Geiser et al (1986) Gene 48:109); lectins (Van Damme et al. (1994) Plant Mol. Biol. 24:825); fumonisin detoxification genes (U.S. Pat. No. 5,792,931); avirulence and disease resistance genes (Jones et al. (1994) Science 266:789; Martin et al. (1993) Science 262:1432; Mindrinos et al. (1994) Cell 78:1089); acetolactate synthase (ALS) mutants that lead to herbicide resistance such as the S4 and/or Hra mutations; inhibitors of glutamine synthase such as phosphinothricin or basta (e.g., bar gene); and glyphosate resistance (EPSPS genes, GAT genes such as those disclosed in U.S. Patent Application Publication US2004/0082770, also WO02/36782 and WO03/092360)); and traits desirable for processing or process products such as high oil (e.g., U.S. Pat. No. 6,232,529); modified oils (e.g., fatty acid desaturase genes (U.S. Pat. No. 5,952,544; WO 94/11516)); modified starches (e.g., ADPG pyrophosphorylases (AGPase), starch synthases (SS), starch branching enzymes (SBE) and starch debranching enzymes (SDBE)); and polymers or bioplastics (e.g., U.S. Pat. No. 5,602,321; beta-ketothiolase, polyhydroxybutyrate synthase, and acetoacetyl-CoA reductase (Schubert et al. (1988) J. Bacteriol. 170:5837-5847) facilitate expression of polyhydroxyalkanoates (PHAs)), the disclosures of which are herein incorporated by reference. One could also combine the polynucleotides of the embodiments with polynucleotides providing agronomic traits such as male sterility (e.g., see U.S. Pat. No. 5,583,210), stalk strength, flowering time, or transformation technology traits such as cell cycle regulation or gene targeting (e.g. WO 99/61619; WO 00/17364; WO 99/25821), the disclosures of which are herein incorporated by reference.

[0288] These stacked combinations can be created by any method including and not limited to cross breeding plants by any conventional or TopCross methodology, or genetic transformation. If the traits are stacked by genetically transforming the plants, the polynucleotide sequences of interest can be combined at any time and in any order. For example, a transgenic plant comprising one or more desired traits can be used as the target to introduce further traits by subsequent transformation. The traits can be introduced simultaneously in a co-transformation protocol with the polynucleotides of interest provided by any combination of transformation cassettes. For example, if two sequences will be introduced, the two sequences can be contained in separate transformation cassettes (trans) or contained on the same transformation cassette (cis). Expression of the sequences can be driven by the same promoter or by different promoters. In certain cases, it may be desirable to introduce a transformation cassette that will suppress the expression of the polynucleotide of interest. This may be combined with any combination of other suppression cassettes or overexpression cassettes to generate the desired combination of traits in the plant.

[0289] The methods of the embodiments may involve, and are not limited to, introducing a polypeptide or polynucleotide into a plant. Introducing is intended to mean presenting to the plant the polynucleotide. In some embodiments, the polynucleotide will be presented in such a manner that the sequence gains access to the interior of a cell of the plant, including its potential insertion into the genome of a plant. The methods of the embodiments do not depend on a particular method for introducing a sequence into a plant, only that the polynucleotide gains access to the interior of at least one cell of the plant. Methods for introducing polynucleotides into plants are known in the art including, and not limited to, stable transformation methods, transient transformation methods, and virus-mediated methods.

[0290] Transformation refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as transgenic organisms. Host cell refers the cell into which transformation of the recombinant DNA construct takes place and may include a yeast cell, a bacterial cell, and a plant cell. Examples of methods of plant transformation include Agrobacterium-mediated transformation (De Blaere et al., 1987, Meth. Enzymol. 143:277) and particle-accelerated or gene gun transformation technology (Klein et al., 1987, Nature (London) 327:70-73; U.S. Pat. No. 4,945,050), among others.

[0291] Stable transformation is intended to mean that the nucleotide construct introduced into a plant integrates into the genome of the plant and is capable of being inherited by the progeny thereof. Transient transformation or transient expression is intended to mean that a polynucleotide is introduced into the plant and does not integrate into the genome of the plant or a polypeptide is introduced into a plant.

[0292] Transformation protocols as well as protocols for introducing polypeptides or polynucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing polypeptides and polynucleotides into plant cells include microinjection (Crossway et al. (1986) Biotechniques 4:320-334), electroporation (Riggs et al. (1986) Proc. Natl. Acad. Sci. USA 83:5602-5606, Agrobacterium-mediated transformation (U.S. Pat. Nos. 5,563,055-and 5,981,840), direct gene transfer (Paszkowski et al. (1984) EMBO J. 3:2717-2722), and ballistic particle acceleration (see, for example, Sanford et al., U.S. Pat. Nos. 4,945,050; 5,879,918; 5,886,244; and U.S. Pat. No. 5,932,782; Tomes et al. (1995) in Plant Cell, Tissue, and Organ Culture: Fundamental Methods, ed. Gamborg and Phillips (Springer-Verlag, Berlin); McCabe et al. (1988) Biotechnology 6:923-926); and Lec1 transformation (WO 00/28058). Also see, Weissinger et al. (1988) Ann. Rev. Genet. 22:421-477; Sanford et al. (1987) Particulate Science and Technology 5:27-37 (onion); Christou et al. (1988) Plant Physiol. 87:671-674 (soybean); McCabe et al. (1988) Bio/Technology 6:923-926 (soybean); Finer and McMullen (1991) In Vitro Cell Dev. Biol. 27P:175-182 (soybean); Singh et al. (1998) Theor. Appl. Genet. 96:319-324 (soybean); Datta et al. (1990) Biotechnology 8:736-740 (rice); Klein et al. (1988) Proc. Natl. Acad. Sci. USA 85:4305-4309 (maize); Klein et al. (1988) Biotechnology 6:559-563 (maize); U.S. Pat. Nos. 5,240,855; 5,322,783 and 5,324,646; Klein et al. (1988) Plant Physiol. 91:440-444 (maize); Fromm et al. (1990) Biotechnology 8:833-839 (maize); Hooykaas-Van Slogteren et al. (1984) Nature (London) 311:763-764; U.S. Pat. No. 5,736,369 (cereals); Bytebier et al. (1987) Proc. Natl. Acad. Sci. USA 84:5345-5349 (Liliaceae); De Wet et al. (1985) in The Experimental Manipulation of Ovule Tissues, ed. Chapman et al. (Longman, New York), pp. 197-209 (pollen); Kaeppler et al. (1990) Plant Cell Reports 9:415-418 and Kaeppler et al. (1992) Theor. Appl. Genet. 84:560-566 (whisker-mediated transformation); D'Halluin et al. (1992) Plant Cell 4:1495-1505 (electroporation); Li et al. (1993) Plant Cell Reports 12:250-255 and Christou and Ford (1995) Annals of Botany 75:407-413 (rice); Osjoda et al. (1996) Nature Biotechnology 14:745-750 (maize via Agrobacterium tumefaciens); all of which are herein incorporated by reference.

[0293] Methods are known in the art for the targeted insertion of a polynucleotide at a specific location in the plant genome. In one embodiment, the insertion of the polynucleotide at a desired genomic location is achieved using a site-specific recombination system. See, for example, WO99/25821, WO99/25854, WO99/25840, WO99/25855, and WO99/25853, all of which are herein incorporated by reference. Briefly, the polynucleotide of the embodiments can be contained in transfer cassette flanked by two non-identical recombination sites. The transfer cassette is introduced into a plant have stably incorporated into its genome a target site which is flanked by two non-identical recombination sites that correspond to the sites of the transfer cassette. An appropriate recombinase is provided and the transfer cassette is integrated at the target site. The polynucleotide of interest is thereby integrated at a specific chromosomal position in the plant genome.

[0294] The cells that have been transformed may be grown into plants in accordance with conventional ways. See, for example, McCormick et al. (1986) Plant Cell Reports 5:81-84. These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting progeny having constitutive expression of the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that expression of the desired phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure expression of the desired phenotypic characteristic has been achieved. In this manner, the embodiments provides transformed seed (also referred to as transgenic seed) having a nucleotide construct of the embodiments, for example, an expression cassette of the embodiments, stably incorporated into their genome.

[0295] As used herein, the term plant can be a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Thus, the term plant can refer to any of: whole plants, plant components or organs (including but not limited to embryos, pollen, ovules, seeds, leaves, flowers, branches, fruit, kernels, ears, cobs, husks, stalks, roots, root tips, anthers, and the like), plant tissues, plant cells, plant protoplasts, plant cell tissue cultures from which maize plant can be regenerated, plant calli, plant clumps, and plant seeds. A plant cell is a cell of a plant, either taken directly from a seed or plant, or derived through culture from a cell taken from a plant. Grain is intended to mean the mature seed produced by commercial growers for purposes other than growing or reproducing the species. Progeny, variants, and mutants of the regenerated plants are also included within the scope of the embodiments, provided that these parts comprise the introduced polynucleotides.

[0296] The embodiments of the invention may be used to confer or enhance fungal plant pathogen resistance or protect from fungal pathogen attack in plants, especially corn (Zea mays). It will protect different parts of the plant from attack by pathogens, including and not limited to stalks, ears, leaves, roots and tassels. Other plant species may also be of interest in practicing the embodiments of the invention, including, and not limited to,

[0297] The terms phenotype, or phenotypic trait or trait refers to one or more trait of an organism. The phenotype can be observable to the naked eye, or by any other means of evaluation known in the art, e.g., microscopy, biochemical analysis, or an electromechanical assay. In some cases, a phenotype is directly controlled by a single gene or genetic locus, i.e., a single gene trait. In other cases, a phenotype is the result of several genes.

[0298] A physical map of the genome is a map showing the linear order of identifiable landmarks (including genes, markers, etc.) on chromosome DNA. However, in contrast to genetic maps, the distances between landmarks are absolute (for example, measured in base pairs or isolated and overlapping contiguous genetic fragments) and not based on genetic recombination.

[0299] In maize, a number of BACs, or bacterial artificial chromosomes, each containing a large insert of maize genomic DNA, have been assembled into contigs (overlapping contiguous genetic fragments, or contiguous DNA). A BAC can assemble to a contig based on sequence alignment, if the BAC is sequenced, or via the alignment of its BAC fingerprint to the fingerprints of other BACs in a contig. The assemblies are available to the public using the genome Maize Genome Browser, which is publicly available on the internet.

[0300] A plant can be a whole plant, any part thereof, or a cell or tissue culture derived from a plant. Thus, the term plant can refer to any of: whole plants, plant components or organs (e.g., leaves, stems, roots, etc.), plant tissues, seeds, plant cells, and/or progeny of the same. A plant cell is a cell of a plant, taken from a plant, or derived through culture from a cell taken from a plant. Thus, the term maize plant includes whole maize plants, maize plant cells, maize plant protoplast, maize plant cell or maize tissue culture from which maize plants can be regenerated, maize plant calli, and maize plant cells that are intact in maize plants or parts of maize plants, such as maize seeds, maize cobs, maize flowers, maize cotyledons, maize leaves, maize stems, maize buds, maize roots, maize root tips and the like.

[0301] The term quantitative trait locus or QTL refers to a region of DNA that is associated with the differential expression of a phenotypic trait in at least one genetic background, e.g., in at least one breeding population. QTLs are closely linked to the gene or genes that underlie the trait in question.

[0302] Before describing the present invention in detail, it should be understood that this invention is not limited to particular embodiments. It also should be understood that the terminology used herein is for the purpose of describing particular embodiments, and is not intended to be limiting. As used herein and in the appended claims, terms in the singular and the singular forms a, an and the, for example, include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to plant, the plant or a plant also includes a plurality of plants. Depending on the context, use of the term plant can also include genetically similar or identical progeny of that plant. The use of the term a nucleic acid optionally includes many copies of that nucleic acid molecule.

[0303] Methods for identifying maize plants with increased head smut resistance through the genotyping of associated marker loci are provided. Head smut resistance in maize is an agronomically important trait, as head smut infection lowers yield.

[0304] It has been recognized for quite some time that specific chromosomal loci (or intervals) can be mapped in an organism's genome that correlate with particular quantitative phenotypes, such as head smut resistance. Such loci are termed quantitative trait loci, or QTL. The plant breeder can advantageously use molecular markers to identify desired individuals by identifying marker alleles that show a statistically significant probability of co-segregation with a desired phenotype, manifested as linkage disequilibrium. By identifying a molecular marker or clusters of molecular markers that co-segregate with a quantitative trait, the breeder is thus identifying a QTL. By identifying and selecting a marker allele (or desired alleles from multiple markers) that associates with the desired phenotype, the plant breeder is able to rapidly select a desired phenotype by selecting for the proper molecular marker allele (a process called marker-assisted selection, or MAS).

[0305] A variety of methods well known in the art are available for detecting molecular markers or clusters of molecular markers that co-segregate with a quantitative trait such as head smut resistance. The basic idea underlying all of these methods is the detection of markers, for which alternative genotypes (or alleles) have significantly different average phenotypes. Thus, one makes a comparison among marker loci of the magnitude of difference among alternative genotypes (or alleles) or the level of significance of that difference. Trait genes are inferred to be located nearest the marker(s) that have the greatest associated genotypic difference.

[0306] Two such methods used to detect QTLs are: 1) Population-based structured association analysis and 2) Pedigree-based association analysis. In a population-based structured association analysis, lines are obtained from pre-existing populations with multiple founders, e.g. elite breeding lines. Population-based association analyses rely on the decay of linkage disequilibrium (LD) and the idea that in an unstructured population, only correlations between QTL and markers closely linked to the QTL will remain after so many generations of random mating. In reality, most pre-existing populations have population substructure. Thus, the use of a structured association approach helps to control population structure by allocating individuals to populations using data obtained from markers randomly distributed across the genome, thereby minimizing disequilibrium due to population structure within the individual populations (also called subpopulations). The phenotypic values are compared to the genotypes (alleles) at each marker locus for each line in the subpopulation. A significant marker-trait association indicates the close proximity between the marker locus and one or more genetic loci that are involved in the expression of that trait. In pedigree-based association analyses, LD is generated by creating a population from a small number of founders. For example, in an interval mapping approach (Lander and Botstein, Genetics 121:185-199 (1989), each of many positions along the genetic map (say at 1 cM intervals) is tested for the likelihood that a QTL is located at that position. The genotype/phenotype data are used to calculate for each test position a LOD score (log of likelihood ratio). When the LOD score exceeds a critical threshold value (herein equal to 2.5), there is significant evidence for the location of a QTL at that position on the genetic map (which will fall between two particular marker loci).

[0307] Markers associated with the head smut resistance trait are identified herein, as are marker alleles associated with either increased or decreased head smut resistance. The methods involve detecting the presence of at least one marker allele associated with either the increased or decreased head smut resistance in the germplasm of a maize plant.

[0308] A common measure of linkage is the frequency with which traits cosegregate. This can be expressed as a percentage of cosegregation (recombination frequency) or in centiMorgans (cM). The cM is a unit of measure of genetic recombination frequency. One cM is equal to a 1% chance that a trait at one genetic locus will be separated from a trait at another locus due to crossing over in a single generation (meaning the traits segregate together 99% of the time). Because chromosomal distance is approximately proportional to the frequency of crossing over events between traits, there is an approximate physical distance that correlates with recombination frequency. For example, in maize, 1 cM correlates, on average, to about 2,140,000 base pairs (2.14 Mbp).

[0309] Marker loci are themselves traits and can be assessed according to standard linkage analysis by tracking the marker loci during segregation. Thus, one cM is equal to a 1% chance that a marker locus will be separated from another locus, due to crossing over in a single generation.

[0310] Other markers linked to the QTL markers can be used to predict the state of the head smut resistance in a maize plant. This includes any marker within 50 cM of the genetic locus. The closer a marker is to a QTL marker, the more effective and advantageous that marker is as an indicator for the desired trait. Closely linked loci display an inter-locus cross-over frequency of about 10% or less, preferably about 9% or less, still more preferably about 8% or less, yet more preferably about 7% or less, still more preferably about 6% or less, yet more preferably about 5% or less, still more preferably about 4% or less, yet more preferably about 3% or less, and still more preferably about 2% or less. In highly preferred embodiments, the relevant loci (e.g., a marker locus and a target locus such as a QTL) display a recombination frequency of about 1% or less, e.g., about 0.75% or less, more preferably about 0.5% or less, or yet more preferably about 0.25% or less. Thus, the loci are about 10 cM, 9 cM, 8 cM, 7 cM, 6 cM, 5 cM, 4 cM, 3 cM, 2 cM, 1 cM, 0.75 cM, 0.5 cM, 0.25 cM, 0.1 cM, 0.075 cM, 0.05 cM, 0.025 cM, or 0.01 cM or less apart. Put another way, two loci that are localized to the same chromosome, and at such a distance that recombination between the two loci occurs at a frequency of less than 10% (e.g., about 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.75%, 0.5%, 0.25%, 0.1%, 0.075%, 0.05%, 0.025%, or 0.01% or less) are said to be proximal to each other.

[0311] Although particular marker alleles can show co-segregation with the head smut resistance phenotype, it is important to note that the marker locus is not necessarily part of the QTL locus responsible for the expression of the head smut resistance phenotype. For example, it is not a requirement that the marker polynucleotide sequence be part of a gene that imparts increased head smut resistance (for example, be part of the gene open reading frame). The association between a specific marker allele with either the increased or decreased head smut resistance phenotype is due to the original coupling linkage phase between the marker allele and the QTL allele in the ancestral maize line from which the QTL allele originated. Eventually, with repeated recombination, crossing over events between the marker and QTL locus can change this orientation. For this reason, the favorable marker allele may change depending on the linkage phase that exists within the resistant parent used to create segregating populations. This does not change the fact that the genetic marker can be used to monitor segregation of the phenotype. It only changes which marker allele is considered favorable in a given segregating population.

[0312] A variety of methods well known in the art are available for identifying chromosome intervals. The boundaries of such chromosome intervals are drawn to encompass markers that will be linked to one or more QTL. In other words, the chromosome interval is drawn such that any marker that lies within that interval (including the terminal markers that define the boundaries of the interval) can be used as markers for head smut resistance. Each interval comprises at least one QTL, and furthermore, may indeed comprise more than one QTL. Close proximity of multiple QTL in the same interval may obfuscate the correlation of a particular marker with a particular QTL, as one marker may demonstrate linkage to more than one QTL. Conversely, e.g., if two markers in close proximity show co-segregation with the desired phenotypic trait, it is sometimes unclear if each of those markers identify the same QTL or two different QTL. Regardless, knowledge of how many QTL are in a particular interval is not necessary to make or practice the invention.

[0313] Methods for marker assisted selection (MAS), in which phenotypes are selected based on marker genotypes, are also provided. To perform MAS, a nucleic acid corresponding to the marker nucleic acid allele is detected in a biological sample from a plant to be selected. This detection can take the form of hybridization of a probe nucleic acid to a marker allele or amplicon thereof, e.g., using allele-specific hybridization, Southern analysis, northern analysis, in situ hybridization, hybridization of primers followed by PCR amplification of a region of the marker, DNA sequencing of a PCR amplification product, or the like. The procedures used to detect marker alleles are known to one of ordinary skill in the art. After the presence (or absence) of a particular marker allele in the biological sample is verified, the plant is selected and is crossed to a second plant, preferably a maize plant from an elite line. The progeny plants produced by the cross can be evaluated for that specific marker allele, and only those progeny plants that have the desired marker allele will be chosen.

[0314] Maize plant breeders desire combinations of desired genetic loci, such as those marker alleles associated with increased resistance to head smut, with genes for high yield and other desirable traits to develop improved maize varieties. Screening large numbers of samples by non-molecular methods (e.g., trait evaluation in maize plants) can be expensive, time consuming, and unreliable. Use of the polymorphic markers described herein, when genetically-linked to head smut resistance loci, provide an effective method for selecting varieties with head smut resistance in breeding programs. For example, one advantage of marker-assisted selection over field evaluations for head smut resistance is that MAS can be done at any time of year, regardless of the growing season. Moreover, environmental effects are largely irrelevant to marker-assisted selection.

[0315] Another use of MAS in plant breeding is to assist the recovery of the recurrent parent genotype by backcross breeding. Backcross breeding is the process of crossing a progeny back to one of its parents or parent lines. Backcrossing is usually done for the purpose of introgressing one or a few loci from a donor parent (e.g., a parent comprising desirable head smut resistance marker loci) into an otherwise desirable genetic background from the recurrent parent (e.g., an otherwise high yielding maize line). The more cycles of backcrossing that are done, the greater the genetic contribution of the recurrent parent to the resulting introgressed variety. This is often necessary, because plants may be otherwise undesirable, e.g., due to low yield, low fecundity, or the like. In contrast, strains which are the result of intensive breeding programs may have excellent yield, fecundity or the like, merely being deficient in one desired trait such as head smut resistance.

[0316] One application of MAS is to use the markers to increase the efficiency of an introgression or backcrossing effort aimed at introducing an increased resistance to head smut QTL into a desired (typically high yielding) background. In marker assisted backcrossing of specific markers (and associated QTL) from a donor source, e.g., to an elite or exotic genetic background, one selects among backcross progeny for the donor trait and then uses repeated backcrossing to the elite or exotic line to reconstitute as much of the elite/exotic background's genome as possible.

[0317] The most preferred QTL markers (or marker alleles) for MAS are those that have the strongest association with the head smut resistance trait.

EXAMPLES

[0318] The following examples are offered to illustrate, but not to limit, the appended claims. It is understood that the examples and embodiments described herein are for illustrative purposes only and that persons skilled in the art will recognize various reagents or parameters that can be altered without departing from the spirit of the invention or the scope of the appended claims.

Example 1

Plant Materials

[0319] Two inbred lines, Ji1037 (donor parent) and Huangzhao4 (recurrent parent), which differ wildly in resistance to the host-specific fungus Sphacelotheca reiliana Clint were used as parental lines to develop all mapping populations in this study. All plant materials tested in the present study were artificially inoculated with S. reiliana Clint. Ji1037 shows fully resistant to head smut and no any susceptible individual has ever been observed in the field; while, Huangzhao4, an elite Chinese inbred line, is highly susceptible to head smut with 75% susceptible individuals in the field. In 2004, a BC.sub.1 population consisting of 314 individuals along with two parents was grown in the experimental farm of the Jilin Academy of Agricultural Sciences, Gongzhulin. Each BC.sub.1 individual was evaluated for its resistance against head smut. Resistant BC.sub.1 individuals were backcrossed to Huangzhao4 to generate BC.sub.1:2 families (BC.sub.2 population). In 2005, 20 plants from each BC.sub.1:2 family were grown in a single plot to evaluate their resistances to head smut. Recombinant individuals from BC.sub.2 population were identified and backcrossed to Huangzhao4 to generate BC.sub.2:3 families or self-pollinated to produce BC.sub.2F.sub.2 families. In 2006, approximately 80 individuals from each of the 59 BC.sub.2:3 and nine BC.sub.2F2 families were grown in the experimental farm of the Jilin Academy of Agricultural Sciences for investigating their resistances to head smut.

Example 2

Artificial Inoculation and Resistant Scoring in the Field

[0320] The sori containing teliospores of S. reliana were collected from the field in the previous growing season and stored in cloth bag in a dry and well ventilated environment. Before planting, spores were removed from the sori, filtered, and then mixed with soil at a ratio of 1:1000. The mixture of soil and teliospores were used to cover maize kernels when sowing seeds to conduct artificial inoculation. Plants at maturity stage were scored for the presence/absence of sorus in either ear or tassels as an indicator for susceptibility/resistance.

DNA Extraction

[0321] Leaf tissues from one-month-old plants were harvested and ground to a powder in liquid nitrogen. Genomic DNA was extracted followed the method described by Murray and Thompson (1980).

Genotyping at SSR Markers and Linkage Map Construction

[0322] SSR markers were firstly employed to check their polymorphisms between two parents Ji1037 and Huangzhao4. Only those SSR markers that showed unambiguously polymorphic bands and evenly distributed across ten chromosomes were used to genotype segregating populations. PCR reactions were performed as follows: denaturation at 94 C. for 2 minutes, followed by 35 cycles of denaturation at 94 C. for 30 seconds, annealing at 58 C. for 30 seconds, extension at 72 C. for 30 seconds, and with a final extension step at 72 C. for 10 minutes. The PCR products were subjected to electrophoresis on 6% polyacrylamide gel, followed by sliver-staining for visualization.

[0323] A total of 94 BC.sub.1 individuals were randomly selected from the BC.sub.1 generation and assayed for their genotypes at the 113 polymorphic SSR markers. A PCR band was marked as 2 if it is the same as that of the donor parent, and scored as 1 if it is identical to that of the recurrent parent. The ratio of homozygotes (1/1) to heterozygotes (1/2) in the BC.sub.1 backcross population was analyzed for its consistency of 1:1 at each SSR marker by .sup.2 test. The genetic distances between SSR markers were estimated by MAPMAKER/Exp version 3.0b (Lincoln et al. 1992). By the way, some markers on chromosome 2 were genotyped in different scales of populations, and their genetic positions were adjusted with the integration data in the JoinMap software.

Data Analysis and QTL/Gene Mapping

[0324] Putative QTLs conferring resistance to head smut were identified according to design III of Trait-Based Analysis (Lebowitz et al. 1987). Briefly, BC.sub.1 individuals with the resistance QTL are expected to be more resistant to head smut than those without the resistance QTL. Consequently, a marker allele adjacent to the resistance QTL in coupling would show higher frequency in the resistant group than that in the susceptible group. A tetrad grids .sup.2 test (SAS 8.2 version) was used to test allele frequencies at all markers between the resistant and susceptible groups to scan putative QTL across whole genome. Thereafter, a number of methods were employed to confirm the major QTL region and its effectiveness in resistance to head smut. First, the SSR markers in the putative major QTL region were used to genotype all BC.sub.1 individuals to confirm the presence of the major QTL. Second, infection percentages of BC.sub.1 individuals were estimated based on their BC.sub.1:2 progenies to confirm the putative major QTL by single-factor analysis of variance. Third, putative QTL was identified across the ten chromosomes by the composite interval mapping method (Windows QTL Cartographer Version 2.0 software). Finally, the major QTL was further confirmed by estimating its genetic effect in reducing disease incidence.

Example 3

Development of the Region-Specific Markers

[0325] Sequences available in the major resistance QTL region, including the anchored EST, IDP, RGA, BAC, and BAC-end sequences, were used to develop high-density markers. These sequences were compared to NCBI and MAGI databases via tBLASTn to obtain possible longer sequences. Primer was designed using the PRIMER5.0 software in accordance with the following parameters: 20 nucleotides in length, GC content of 40% to 60%, no secondary structure, and no consecutive tracts of a single nucleotide.

[0326] Primer pairs were used to amplify the corresponding segments from both parents. The cycling parameters were set up the same as those described above except for the annealing temperature that was adjusted according to different primer pairs. Only those amplicons with the same or bigger than predicted were cut down from gel and purified with Gel Extraction Kit (Qiagen GmbH, Hilden, Germany). The purified PCR products were then cloned into the vector pGEM-T (Promega, Madison, USA). Normally, three to five positive clones for each amplicon were selected for sequencing to avoid any contamination or mismatch. The amplicon sequence was firstly compared with the original one from which it was derived to make sure the right one was obtained, and then comparison was conducted to search for sequence divergence between two parents by using DNAMAN software. The InDels were amenable for developing sequence-tagged site (STS) markers; while single nuclear polymorphism (SNP) can be used to develop either SNP marker or CAPS marker (cleaved-amplified polymorphic sequence). A CAPS marker is developed if the SNP is related to a given restriction site. In developing SNP marker, a SNPpicker program of SeqVISTA software was used to see if it was possible to create a specific restriction site by introducing a mismatch base pair into primer to alter a half-site to a full-site for a specific restriction site, following the method described by Niu and Hu (2004).

[0327] The primer pairs were used to amplify the two parents to develop high-density markers. For STS markers, polymorphic PCR bands should appear after electrophoresis on agarose or polyacrylamide gel. For those CAPS and SNP markers, polymorphic bands could be observed on agarose or polyacrylamide gel after digestion with certain restriction endonucleases.

Example 4

Fine Mapping

[0328] Recombinant individuals from the BC.sub.2 population were screened out with the SSR markers in the major QTL region. Due to partial penetrance for head smut resistance, it would be at high risk to judge whether or not a BC.sub.2 recombinant carries the resistance gene based on performance of a single individual. Hence, we adopted a more robust method to judge the presence/absence of the resistance gene for a single BC.sub.2 recombinant based on both genotypes and phenotypes of its progeny. If there is no resistance gene in the donor region for a certain BC.sub.2 recombinant, its progeny with donor regions would show no difference with those without donor regions in resistance to head smut. On the contrary, if the donor region harbors the resistance gene, the progeny with the donor regions would show significantly higher resistant than those without the donor regions. By comparing the insert sizes of the resistant and non-resistant donor regions, we could fix on an interval where the resistance gene resides on. With an application of the newly-developed high-density markers, we could definitely define the donor regions harboring the resistance gene and therefore narrow down the resistance region into a very short interval. In all comparisons, significant differences were estimated on SAS software using .sup.2 test.

Example 5

Construction of the SSR Linkage Map

[0329] A total of 700 SSR markers were checked for their polymorphisms between Ji1037 and Huangzhao4. Among the 347 polymorphic SSR markers, 113 markers evenly distributed across ten chromosomes were selected to genotype the BC.sub.1 mapping population. Of these 113 markers, 33 (29.2%) showed distortion segregation at P<0.05 or at p<0.01. Generally, markers showing genetic distortion had no negative impact on QTL detection. Therefore, a linkage map was constructed using all 113 SSR markers. The map was 1753.4 cM in length with one marker in every 14.6 cM averagely.

Example 6

Mapping Putative QTLs

[0330] According to the Design III of TB analysis (Lebowitz et al. 1987), each of the 113 SSR markers was tested for its frequency at 1/2 (heterozygote) and 1/1 (homozygote) in both the resistant and susceptible groups. The significant biases at frequencies between the resistant and susceptible groups were observed for those markers located on the four chromosomal regions (bins 1.02/3, 2.08/9, 6.07, and 10.03/4), suggesting the presence of four putative QTLs (Table 1). For instance, the markers on bin 2.09 showed no distortion from 1:1 ratios of heterozygote to homozygote in the whole BC.sub.1 population. However, percentages of heterozygote at these markers significantly differ between the resistant and susceptible groups with the P values<0.0001 (Table 1). The result strongly indicated the presence of a major QTL (named as qHSR1) in this region. Markers on both bin 10.03/4 and bin 1.02/3 had the P values<0.01 (Table 1), implying the presence of putative QTLs with less effects in these two regions. Markers on bin 6.07 also showed skew with the P values<0.05 (Table 1), suggesting the presence of a possible minor QTL. In addition, only one marker on bin 4.01 or bin 5.03 was found to show frequency skew between the resistant and susceptible groups (Table 1), it was, therefore, difficult to judge whether or not a QTL was actually present in these two bins.

TABLE-US-00001 TABLE 1 Scanning putative QTL across the whole genome via a tetrad grids 2 test at the 113 SSR markers Percentage of heterozygote (%) P putative bins Markers In R group In S group 2 values QTL 1.02 bnlg1614 48.65 71.43 4.93 0.0265 Yes 1.02 bnlg1083 50.00 72.73 5.00 0.0253 1.03 umc1403 44.74 76.36 9.69 0.0019 2.08 bnlg1141 65.63 36.36 6.95 0.0084 Yes 2.08/09 umc1230 68.57 40.38 6.66 0.0099 2.09 bnlg1520 72.22 36.36 11.19 0.0008 2.09 umc1525 81.08 33.93 19.87 <0.0001 2.09 umc1736 86.11 30.00 26.49 <0.0001 2.09 bnlg1893 91.67 26.00 36.28 <0.0001 2.09 umc1207 91.67 26.53 35.46 <0.0001 2.09 phi427434 91.43 29.63 32.64 <0.0001 2.09 umc2184 94.74 30.19 37.65 <0.0001 2.09 umc2077 94.59 28.85 37.96 <0.0001 2.09 umc2214 92.11 34.55 30.58 <0.0001 4.01 umc1164 60.00 37.21 4.02 0.045 ? 5.03 umc1447 56.76 34.00 4.48 0.0344 ? 6.07 umc1063 34.21 57.14 4.78 0.0289 Yes 6.07 phi299852 33.33 56.36 4.638 0.0314 10.03 umc1938 76.47 34.69 14.038 0.0002 Yes 10.04 phi062 72.97 41.07 9.128 0.0025 SSR markers on each bin are ordered according to their positions on the genetic linkage map of the present study. R group: resistant group; S group: susceptible group; P value: probability of H0 hypothesis that is independent between genotype and trait.

[0331] Percentages of heterozygote (1/2) in bin 2.09 and bin 10.03/4 were significant higher in the resistant group than those in the susceptible group, suggesting the resistance alleles were derived from the donor parent Ji1037. On the contrary, heterozygotes (1/2) in bin 1.02/3 and bin 6.07 had lower percentages in the resistant group compared with those in the susceptible group, indicating that the resistance alleles were derived from the susceptible parent Huangzhao 4.

[0332] Comparisons of the four putative QTLs in the present study with those detected by other groups resulted in two common QTLs. The QTL in bin 1.02/3 in this study was also reported by Shi et al. (2005) and Lu and Brewbaker (1999). The major QTL in bin 2.09 in our study was also detected in Shi's study, in which the mapping population was derived from the cross of Huangzhao4Mo17 (Shi et al. 2005). Interestingly, the same susceptible line Huangzhao4 and a closely-related resistant line Ji1037 (Ji1037 was developed from the cross of Mo17/Suwan) were used to prepare the mapping population in the present study. This may explain why the same major QTL with similar genetic effect was detected in bin 2.09 in both studies. The major QTL in bin 2.09 is, therefore, the best choice for the resistance gene cloning and marker-assisted selection to improve maize resistance to head smut.

Example 7

Confirmation of the Major QTL

[0333] To confirm the presence of the major QTL (qHSR1) in bin 2.09 and its genetic effect on resistance to head smut, it is necessary to utilize markers to genotype all BC.sub.1 individuals. The eight SSR markers in bin 2.09, including bnlg1520, umc1736, bnlg1893, umc1207, phi427434, umc2184, umc2077, and umc2214, were used to genotype the 118 resistant and 158 susceptible BC.sub.1 plants. Of the 118 resistant individuals, 107 (90.7%) were heterozygotes/recombinants and only 11 (9.3%) were homozygotes at the eight markers. Of the 158 susceptible individuals, however, only 60 (38%) were heterozygotes/recombinants and as many as 98 (62%) were homozygotes. These results showed that the donor region in bin 2.09 could significantly enhance maize resistance to head smut, strongly supporting the presence of the major QTL in bin 2.09. It should be noted that head smut was very serious in 2004 due to drought during the seedling stage. The susceptible Huangzhao4 had 86% susceptible individuals, compared with 75% in normal year.

[0334] In addition, a total of 97 BC.sub.1:2 families were produced from the resistant BC.sub.1 individuals. These BC.sub.1:2 families ranged from 5.9%-88.3% in disease incidences. Single factor analysis of variance was performed by analyzing both disease incidence and genotype at each of the eight SSR markers on bin 2.09 region. The results showed that these eight SSR markers strongly linked to qHSR1 (Table 2).

TABLE-US-00002 TABLE 2 Single factor analysis of variance of the BC.sub.1:2 families SSR markers b0 b1 LR F (1, n 2) pf (F) umc2214 3.8321 4.5175 18.6152 20.0983 **0.0000 umc2077 3.8506 4.5464 18.7612 20.2716 **0.0000 umc2184 3.8534 4.5509 18.7920 20.3082 **0.0000 phi427434 3.8583 4.5828 19.0426 20.6065 **0.0000 umc1207 3.8574 4.5890 19.0812 20.6525 **0.0000 bnlg1893 3.8566 4.5941 19.1175 20.6959 **0.0000 umc1736 3.8411 4.7083 20.0836 21.8536 **0.0000 bnlg1520 3.7321 4.4259 18.1954 19.6013 **0.0000 y = b0 + b1x + e; LR = 2log (L0/L1); **significant at 0.01% level

[0335] Furthermore, the WinQtlCart 2.0 software (Statistical Genetics, North Carolina State University, USA) was used to scan the putative QTLs across the whole genome with the Composite Interval Mapping (CIM). A major QTL with the LOD value of 11.8 was detected on bin 2.09, bordered by SSR markers umc1736 and umc2184. The QTL could explain 30% of phenotypic variation.

Example 8

Developing New Markers on Bin 2.09 Region

[0336] In our study, a total of 30 primer pairs were designed based on the sequences available in bin 2.09 to amplify parental lines. Three of the 30 primer pairs have been directly developed into polymorphic STS/SSR markers. Two STS markers, STS1944 and STSrga3195, were developed from the IDP1944 and RGA3195 (Zmtuc03-0811.3195), respectively. The SSR marker SSR148152 was developed from the BAC clone AC148152 (Table 3). Of the remaining 27 primer pairs, 20 gave rise to unambiguous amplicons, which were then cloned and sequenced. Sequence alignments between two parental lines revealed varying degrees of nucleotide variations with regard to different amplicons. No polymorphism was found between two parental lines for those amplicons corresponding to two anchored ESTs. Three SNPs were observed for the amplicons corresponding to three maize sequences (a total length of 2,056 bp) retrieved from the TIGR website. Amplicons corresponding to BAC-end sequences revealed higher divergences with a total of 18 SNPs in the cumulative length of 1,251 bp sequence. Sequence alignment for the four RGA-based amplicons resulted in five InDels and 26 SNPs in a cumulated 3,711 bp sequence. Sequence alignment for five IDP-based amplicons revealed one InDel and 15 SNPs in 2,814 bp. The synteny sequence in rice was also used to develop markers and revealed only one InDel in 2,088 bp. Taken together, seven InDels and 62 SNPs were obtained, resulting in about one InDel per 1,800 bp and one SNP per 200 bp in the qHSR1 region. Based on above polymorphisms, additional six markers have been finally developed, including two SNP markers (SNP140313 and SNP661, developed from the AZM4_140313 and IDP661, respectively), one CAPS marker (CAPS25082, developed from IDP25082), and three STS markers (STS171, STSrga840810, and STSsyn1, developed from IDP171, RGA BG840810, and a syntenic rice gene LOC_Os07g07050, respectively) (Table 3 and FIG. 1).

TABLE-US-00003 TABLE3 Thenames,originalsequences,andprimersequencesforninenewly- developedmarkers Markers Originalsequences Types Enzymes Primerpairs(5.fwdarw.3)[SEQIDNO:] CAPS25082 IDP25082 CAPS TaqI L:AAGTCCTTCACGGTCTACCA[1] R:CGGTTAGGACGATGTCAGAA[2] SNP140313 AZM4_140313 SNP HhaI L:CAGAGGCATTGAACAGGAAG[3] fromTIGR R:CTGCTATTCCACGAAGTGCT[4] snpL:CTCTTCCACCGAGAATAGCG[5] snpR:CTGCTATTCCACGAAGTGCT[6] SNP661 IDP661 SNP TaqI L:CTTCTGTTCTGTGCCAGGTA[7] R:CAAGAACGTAGCAACTCAGC[8] snpL:ATTGTCCCTGAGATGATTCG[9] snpR:CAAGAACGTAGCAACTCAGC[10] STS1944 IDP1944 STS L:CATTGGCAACAGGACAAGTG[11] R:GACATCAGCCTCAACATTGG[12] STS171 IDP171 STS L:CCAGAGACTTGCGTGAAGAT[13] R:AACAGACTGGTTGTACGTGC[14] SSR148152 BACcloneAC148152 SSR L:GTAGGAAGACTGCCGGAGAC[15] R:GACGCTAGAATGACTGAACC[16] STSrga3195 ZMTUC03-0811.3195 STS L:CTAGAGGTTCAGGCATATGGCG[17] (RGA) R:AGCTCCACAGGAATTCGTTGAG[18] STSrga840810 BG840810(RGA) STS L:GCGTCAGGCAGTTCAACTTC[19] R:TGTTCTTGCACTCGCACTTG[20] STSsyn1 LOC_Os07g07050 STS L:GGCACATGGACGTACAAGAT[21] fromrice R:GCACAGAGGAAGCTAGGAGA[22] L: left primer; R: right primer. For SNP markers, a pair of L and R primers was firstly used to amplify genomic DNA and then a pair of snpL (mismatch primer) and snpR primers was used to amplify diluted PCR products from the first step to alter a half-site to full-site for a specific restriction site. Polymorphic bands could be observed after digestion of second-round PCR products with a certain enzyme and subjected to electropherosis on polyacrylamide gel.

[0337] Of the nine newly-developed markers, SNP140313 and STSrga3195 were mapped on chr. 1, and STSsyn1 was mapped on chr. 5. The remaining six markers were authentically mapped on bin 2.09 with five markers (SSR148152, CAPS25082, STS171, SNP661, and STS1944) in and one marker (STSrga840810) out of the resistance qHSR1 region. The newly-developed markers would greatly facilitate MAS and fine mapping of the resistance gene (FIG. 2).

Example 9

Phenotypic Evaluation of the BC.SUB.2 .Recombinants and Fine-Mapping of the Major Resistance QTL

[0338] Based on genotypes of parental BC.sub.2 recombinants, we used markers STS171 and/or STS1944 to genotype all progeny of the BC.sub.2 recombinants. The percentage of heterozygote was tested for its difference between the resistant and susceptible groups by .sup.2 test. The Probability value0.05 (here we set up the threshold at p=0.05) indicates the significant correlation between phenotype (resistance) and genotype (heterozygote), and the parental BC.sub.2 recombinant was then deduced to carry the resistant donor region (Table 4). For example, BC2-64 was inferred to harbor qHSR1 due to the low P value (<0.05) at the STS1944 locus. For BC2-50, both STS1944 and STS171 loci showed the very low P values, indicating that the parental BC2-50 must harbor qHSR1. On the contrary, no significant difference (as shown by the high P value) was observed in percentages of heterozygote between the resistant and susceptible groups for BC2-25, indicating the absence of qHSR1 in the donor region. Taken together, 11 BC.sub.2 recombinants (BC2-64, BC2-50, BC2-65, BC2-27, BC2-19, BC2-46, BC2-66, BC2-60, BC2-43, BC2-37, and BC2-69) were inferred to carry qHSR1 and regarded as the resistant BC.sub.2 recombinants; whereas, five BC.sub.2 recombinants (BC2-67, BC2-68, BC2-49, BC2-25, and BC2-45) were inferred to harbor no qHSR1 and considered to be the susceptible BC.sub.2 recombinants (Table 4).

TABLE-US-00004 TABLE 4A Parental BC2 recombinants, their genotypes at the qHSR1 region, .sup.2 test in progenies, and deduced BC2 phenotypes Genotypes at SSR markers for the parental BC2 recombinants Parental BC2 phi427434/ recombinants SSR148152 bnlg1893 STS171 SNP661 STS1944 umc2184 BC2-50 1/2 1/2 1/2 1/2 1/2 1/2 BC2-65 1/1 1/2 1/2 1/2 1/2 1/2 BC2-27 1/1 1/2 1/2 1/2 1/2 1/2 BC2-64 1/1 1/2 1/2 1/2 1/2 1/2 BC2-67 1/1 1/1 1/1 1/2 1/2 1/2 BC2-68 1/1 1/1 1/1 1/2 1/2 1/2 BC2-49 1/1 1/1 1/1 1/2 1/2 1/2 BC2-25 1/1 1/1 1/1 1/1 1/2 1/2 BC2-45 1/1 1/1 1/1 1/1 1/2 1/2 BC2-19 1/2 1/2 1/2 1/2 1/2 1/1 BC2-46 1/2 1/2 1/2 1/2 1/2 1/1 BC2-66 1/1 1/2 1/2 1/2 1/2 1/1 BC2-60 1/2 1/2 1/2 1/2 1/2 1/1 BC2-43 1/2 1/2 1/2 1/2 1/1 1/1 BC2-37 1/2 1/2 1/2 1/1 1/1 / BC2-69 1/2 1/2 1/2 1/1 1/1 1/1

TABLE-US-00005 TABLE 4B Parental BC2 recombinants, their genotypes at the qHSR1 region, .sup.2 test in progenies, and deduced BC2 phenotypes Parental BC2 .sup.2 test in progenies Deduced BC2 recombinants Markers P Values Phenotypes BC2-50 STS171 0.003 Resistant STS1944 0.0002 BC2-65 STS171 0.042 Resistant STS1944 0.051 BC2-27 STS171 0.006 Resistant BC2-64 STS1944 0.022 Resistant BC2-67 STS1944 0.273 Susceptible BC2-68 STS1944 0.384 Susceptible BC2-49 STS1944 0.805 Susceptible BC2-25 STS1944 0.478 Susceptible BC2-45 STS1944 0.730 Susceptible BC2-19 STS171 0.033 Resistant BC2-46 STS171 <0.0001 Resistant STS1944 0.0107 BC2-66 STS1944 0.026 Resistant BC2-60 STS1944 0.020 Resistant BC2-43 STS171 0.033 Resistant BC2-37 STS171 0.018 Resistant BC2-69 STS171 0.004 Resistant

[0339] Based on the deduced phenotypes, the major resistance QTL region could be narrowed down by comparing the donor regions amongst all BC.sub.2 recombinants (Table 4). BC2-50 had a heterogenous genotype in the qHSR1 region and showed high resistance to head smut with the P value<0.01. On the left side, three BC.sub.2 recombinants (BC2-64 and BC2-65, and BC2-27) with their crossover points upstream of bnlg1893 showed resistance to head smut; while, the other five BC.sub.2 recombinants with their crossover points downstream of STS171 (BC2-67, BC2-68, and BC2-49) or SNP 661 (BC2-25 and BC2-45) displayed susceptibility to head smut. On the right side, all seven BC.sub.2 recombinants showed resistance to head smut and they had crossover points downstream of STS1944 (BC2-19, BC2-46, BC2-66, and BC2-60) or SNP661 (BC2-43) or STS171 (BC2-37 and BC2-69). Interestingly, one resistant BC.sub.2 recombinant, BC2-66, had the shortest donor region between SSR148152 and umc2184 and this donor region was assumed to cover qHSR1. It could be concluded from the above analysis that the major resistance QTL (qHSR1) was located in an interval of SSR148152/SNP661, which was estimated to be 2 Mb based on the physical map available at the University of Arizona.

Example 10

Estimation of the Genetic Effect of the Major QTL

[0340] Theoretically, 93.75% of the genetic background in the BC.sub.2:3 progeny was reverted to the recurrent parent Huangzhao4. Due to the low background noise in BC.sub.2:3 progeny, the genetic effect of qHSR1 could be definitely estimated by comparison of disease incidences between two groups with/without qHSR1 within the same BC.sub.2:3 family. A total of 1,524 individuals from 24 BC.sub.2:3 families were checked for the presence/absence of qHSR1 with markers STS171 and STS1944. The disease incidences were estimated for two groups with/without qHSR1 in each BC.sub.2:3 family. As a consequence, the group without qHSR1 showed more susceptible than the group with qHSR1 in each BC.sub.2:3 family with an average difference of 28.6%10.8%. In other word, a single resistance qHSR1 could reduce disease incidence by 28.6%10.8% (FIG. 2).

[0341] Apart from BC.sub.2:3 progeny, BC.sub.2F.sub.2 progeny was also employed to estimate the genetic effect of qHSR1 in the present study. The BC.sub.2 population was firstly genotyped at two markers bnlg1893 and umc2184, resulting in 73 BC.sub.2 plants with qHSR1 and another 31 BC.sub.2 plants without qHSR1. All these BC.sub.2 plants were self-pollinated to produce corresponding BC.sub.2F.sub.2 families. As expected, the BC.sub.2F.sub.2 progeny derived from BC.sub.2 plants with qHSR1 showed more resistant than those derived from BC.sub.2 plants without qHSR1. Of the 529 BC.sub.2F.sub.2 individuals derived from 31 BC.sub.2 plants without qHSR1, 204 (38.7%) were found to be susceptible. Whereas, 262 (19.3%) of 1,358 BC.sub.2F.sub.2 individuals derived from 73 BC.sub.2 plants with qHSR1 were susceptible. In the BC.sub.2F.sub.2 progeny derived from BC.sub.2 plants with qHSR1, segregation occurred at the qHSR1 locus, resulting in one-fourth BC.sub.2F.sub.2 individuals without qHSR1. These BC.sub.2F.sub.2 individuals without qHSR1 are expected to have the same disease incidence as that estimated from the 31 BC.sub.2F.sub.2 families without qHSR1 (38.7%). For the other three-fourth BC.sub.2F.sub.2 individuals with qHSR1 (one-fourth homozygotes and a half heterozygotes), we needed to estimate its disease incidence. Based on above explanations, we could draw an equation as X %+*38.7%=19.3%; here, X represents infection percentage for those BC.sub.2F.sub.2 individuals with qHSR1. The X is calculated to be 12.8%. In summary, the qHSR1 locus could reduce disease incidence by 25.9% in the BC.sub.2F.sub.2 progeny, from 38.7% (individuals without qHSR1) to 12.8% (individuals with qHSR1).

Example 11

Characterization of Genomic Sequence of qHSR1

[0342] In order to isolate the gene responsible for the phenotype conferred by the qHSR1 locus, BACs containing the region between the markers MZA6393 (from bacm.pk071.j12.f SEQ ID NO:23) and marker ST148 the Mo17 version of ZMMBBc0478L09f (SEQ ID NO:24) were isolated from a BAC library prepared from the resistant Mo17 line. This library was prepared using standard techniques for the preparation of genomic DNA (Zhang et al. (1995) Plant Journal 7:175-184) followed by partial digestion with HindIII and ligation of size selected fragments into a modified form of the commercially available vector pCC1BAC (Epicentre, Madison, USA). After transformation into EPI300 E. coli cells following the vendors instructions (Epicentre, Madison, USA), 125,184 recombinant clones were arrayed into 326 384-well microtiter dishes. These clones were then gridded onto nylon filters (Hybond N+, Amersham Biosciences, Piscataway, USA). Three overlapping clones (bacm.pk071.j12, bacm.pk007.18, and bacm2.pk166.h1) were identified and characterized.

[0343] The library was probed with overlapping oligonucleotide probes (overgo probes; Ross et al. (1999) Screening large-insert libraries by hybridization, p. 5.6.1-5.6.52, In A. Boyl, ed. Current Protocols in Human Genetics. Wiley, New York) designed on the basis of sequences found in the BAC sequences. BLAST search analyses were done to screen out repeated sequences and identify unique sequences for probe design. The position and interspacing of the probes along the contig was verified by PCR. For each probe two 24-mer oligos self-complementary over 8 bp were designed. Their annealing resulted in a 40 bp overgo, whose two 16 bp overhangs were filled in. The exact sequences are different as they were to be used as overgo probes rather than just PCR primers. Probes for hybridization were prepared as described (Ross et al. (1999) supra), and the filters prepared by the gridding of the BAC library were hybridized and washed as described by (Ross et al. (1999) supra). Phosphorimager analysis was used for detection of hybridization signals. Thereafter, the membranes were stripped of probes by placing them in a just-boiled solution of 0.1SSC and 0.1% SDS and allowing them to cool to room temperature in the solution overnight.

[0344] BACs that gave a positive signal were isolated from the plates. Restriction mapping, PCR experiments with primers corresponding to the markers previously used and sequences obtained from the ends of each BAC were used to determine the order of the BACs covering the region of interest. Three BACs that spanned the entire region (bacm.pk071.j12, bacm.pk007.18, and bacm2.pk166.h1) were selected for sequencing. These BACs were sequenced using standard shotgun sequencing techniques and the sequences assembled using the Phred/Phrap/Consed software package (Ewing et al. (1998) Genome Research, 8:175-185). The assembled sequence of the BAC clones is shown in SEQ ID NO:25.

[0345] After assembly, the sequences thought to be in the region closest to the locus on the basis of the mapping data were annotated, meaning that possible gene-encoding regions and regions representing repetitive elements were deduced. Gene encoding (genic) regions were sought using the fGenesH software package (Softberry, Mount Kisco, N.Y., USA). fGenesH predicted a portion of a protein, that when BLASTed (BLASTx/nr), displayed partial homology at the amino acid level to a portion of a rice protein that was annotated as encoding for a protein that confers disease resistance in rice. The portion of the maize sequence that displayed homology to this protein fell at the end of a contiguous stretch of BAC consensus sequence and appeared to be truncated. In order to obtain the full representation of the gene in the maize BAC, the rice amino acid sequence was used in a tBLASTn analysis against all other consensus sequences from the same maize BAC clone. This resulted in the identification of a consensus sequence representing the 3 end of the maize gene. However, the center portion of the gene was not represented in the sequences so obtained. PCR primers were designed based on the 5 and 3 regions of the putative gene and used in a PCR experiment with DNA from the original maize BAC as a template. The sequence of the resulting PCR product contained sequence bridging the 5 and 3 fragments previously isolated.

[0346] Several open reading frames were detected in SEQ ID NO:25 including a xylanase inhibitor gene (SEQ ID NO:26/27), a cell wall associated protein kinase (SEQ ID NO:31/32), two HAT family protein dimerization genes (SEQ ID NO:34/35 and SEQ ID NO:37/38), and two uncharacterized proteins (SEQ ID NO:40/41 and SEQ ID NO:43/44). The xylanase inhibitor gene shows a polymorphic difference when compared to the ortholog found in B73. The Mo17 gene is 97.8% identical, by Clustal V alignment, to the B73 gene, and contains two deletions of 2 and 10 amino acids (see FIG. 3.) The genomic DNA region including 2.4 kb upstream of the ORFs from SEQ ID NOs:43/44 is shown in SEQ ID NO:45. The nucleic acid sequence encoding an additional EST fragment from the qHSR region is shown in SEQ ID NO:46.

[0347] Any one, any combination, or all, of these genes may confer, or contribute to, head smut resistance at the qHSR1 locus. It is expected that polymorphisms associated with Mo17, which is resistant to head smut, will be diagnostic of sequences that define qHSR1.

Example 12

Backcrossing of the qHSR1 Locus into Susceptible Lines

[0348] A qHSR1 locus introgression of inbred lines are made to confirm that the qHSR1 locus could be successfully backcrossed into inbreds, and that hybrids produced with the inbred lines with the qHSR1 locus would have enhanced or conferred head smut resistance.

[0349] MO17 is an inbred line with strong resistance to head smut, but its weak agronomic characteristics make it a poor donor parent in the absence of the use of the marker assisted breeding methods described herein. To demonstrate the phenotypic value of the qHSR1 locus, the locus is introgressed into 10 elite inbred lines, with an additional 25 inbreds added in the second through to the BC3 stage as follows. The F1 population derived from the cross between MO17 and the elite inbred lines are backcrossed once more to the recurrent parents (the elite inbreds), resulting in a BC1 population. Seedlings are planted out, genotyped with markers across the genome, selected (with the qHSR1 locus and minimal MO17 background) and backcrossed again to recurrent inbred lines to develop a BC2 population. BC2 families are genotyping and selected again for the presence of the MO17 qHSR1 region. Positive plants are backcrossed to recurrent parental inbreds once more to develop BC3 populations. Seeds from these BC3 populations are planted and plants are genotyped. BC3 plants with or without the region of interest are selfed to make BC3S1 families. These families were used for phenotypic comparison (BC3S1 with or without the region of interest).

[0350] In order to observe the performance of the qHSR1 gene in a heterozygous situation such as would be found in a commercial hybrid, appropriate testcrosses are made. Specifically, individual BC3S1 plants homozygous for the qHSR1 gene as well as plants homozygous for the susceptible allele are used to make testcrosses with selected inbreds.

[0351] In the case of both the BC3S1 lines and the hybrids, the expected phenotypic differences indicate significant improvement for head smut resistance in lines and hybrids containing the region carrying qHSR1. The data clearly demonstrate that using crossing techniques to move the gene of the embodiments into other lines genetically competent to use the gene result in enhanced resistance to head smut.

[0352] As a result of fine mapping the location of the qHSR1 gene, one may utilize any two flanking markers that are genetically linked with the qHSR1 gene to select for a small chromosomal region with crossovers both north and south of the qHSR1 gene. This has the benefit of reducing linkage drag, which can be a confounding factor when trying to introgress a specific gene from non-adapted germplasm, such as MO17, into elite germplasm. It is advantageous to have closely linked flanking markers for selection of a gene, and highly advantageous to have markers within the gene itself. This is an improvement over the use of a single marker or distant flanking markers, since with a single marker or with distant flanking markers the linkage associated with qHSR1 may be broken, and by selecting for such markers one is more likely to inadvertently select for plants without the qHSR1 gene. Since marker assisted selection is often used instead of phenotypic selection once the marker-trait association has been confirmed, the unfortunate result of such a mistake would be to select plants that are not resistant to head smut and to discard plants that are resistant to head smut. In this regard, markers within the qHSR1 gene are particularly useful, since they will, by definition, remain linked with resistance to head smut as enhanced or conferred by the gene. Further, markers within the qHSR1 locus are just as useful for a similar reason. Due to their very close proximity to the qHSR1 gene they are highly likely to remain linked with the qHSR1 gene. Once introgressed with the qHSR1 gene, such elite inbreds may be used both for hybrid seed production and as a donor source for further introgression of the qHSR1 gene into other inbred lines.

[0353] Thus, the data shows that inbred progeny converted by using MO17 as a donor source retain the truncated MO17 chromosomal interval. The inbreds comprising the truncated MO17 chromosomal interval are very useful as donor sources themselves, and there is no need to revert to MO17 as a donor source. By using marker assisted breeding as described herein, the truncated MO17 chromosomal interval can be further reduced in size as necessary without concern for losing the linkage between the markers and the qHSR1 gene.

Example 13

Use of qHSR1 as a Transgene to Create Resistant Corn Plants

[0354] The qHSR1 gene can be expressed as a transgene as well, allowing modulation of its expression in different circumstances. The following examples show how the qHSR1 gene could be expressed in different ways to combat different diseases or protect different portions of the plant, or simply to move the qHSR1 gene into different corn lines as a transgene, as an alternative to the method described in Example 12.

Example 13a

[0355] In this example, the qHSR1 candidate gene (xylanase inhibitor and other annotated genes in the QTL interval, as defined in Example 11) is expressed using its own promoter.

[0356] In order to transform the complete qHSR1 genes, including the promoter and protein encoding regions, DNA fragments containing the complete coding region and approximately 2 kb upstream region are amplified by PCR using the BAC clone as template DNA. To enable cloning using the Gateway Technology (Invitrogen, Carlsbad, USA), attB sites are incorporated into the PCR primers, and the amplified product is cloned into pDONR221 vector by Gateway BP recombination reaction. The resulting fragment, flanked by attL sites, is moved by the Gateway LR recombination reaction into a binary vector. The construct DNA is then used for corn transformation as described in Example 14.

Example 13b

[0357] In order to express the qHSR1 genes (xylanase inhibitor and other annotated genes in the QTL interval, as defined in Example 11) throughout the plant at a low level, the coding region of the genes and their terminators are placed behind the promoters of either a rice actin gene (U.S. Pat. No. 5,641,876 and No. 5,684,239) or the F3.7 gene (U.S. Pat. No. 5,850,018). To enable cloning using the Gateway Technology (Invitrogen, Carlsbad, USA), attB sites are incorporated into PCR primers that are used to amplify the qHSR1 genes starting 35 bp upstream from its initiation codon. A NotI site is added to the attB1 primer. The amplified qHSR1 product is cloned into pDONR221 vector by Gateway BP recombination reaction (Invitrogen, Carlsbad, USA). After cloning, the resulting qHSR1 gene is flanked by attL sites and has a unique NotI site at 35 bp upstream the initiation codon. Thereafter, promoter fragments are PCR amplified using primers that contain NotI sites. Each promoter is fused to the NotI site of qHSR1. In the final step, the chimeric gene construct is moved by Gateway LR recombination reaction (Invitrogen, Carlsbad, USA) into the binary vector PHP20622. This is used for corn transformation as described in Example 14.

Example 13c

[0358] In order to express the qHSR1 genes (xylanase inhibitor and other annotated genes in the QTL interval, as defined in Example 11) throughout the plant at a high level, the coding region of the genes and their terminators are placed behind the promoter, 5 untranslated region and an intron of a maize ubiquitin gene (Christensen et al. (1989) Plant Mol. Biol. 12:619-632; Christensen et al. (1992) Plant Mol. Biol. 18:675-689). To enable cloning using the Gateway Technology (Invitrogen, Carlsbad, USA), attB sites are incorporated into PCR primers that are used to amplify the qHSR1 gene starting at 142 bp upstream of the initiation codon. The amplified product is cloned into pDONR221 (Invitrogen, Carlsbad, USA) using a Gateway BP recombination reaction (Invitrogen, Carlsbad, USA). After cloning, the resulting qHSR1 gene is flanked by attL sites. In the final step, the qHSR1 clone is moved by Gateway LR recombination reaction (Invitrogen, Carlsbad, USA) into a vector which contained the maize ubiquitin promoter, 5 untranslated region and first intron of the ubiquitin gene as described by Christensen et al. (supra) followed by Gateway ATTR1 and R2 sites for insertion of the qHSR1 gene, behind the ubiquitin expression cassette. The vector also contained a marker gene suitable for corn transformation, so the resulting plasmid, carrying the chimeric gene (maize ubiquitin promoter-ubiquitin 5 untranslated region-ubiquitin intron 1-qHSR1), is suitable for corn transformation as described in Example 14.

Example 13d

[0359] In order to express the qHSR1 genes (xylanase inhibitor and other annotated genes in the QTL interval, as defined in Example 11) at a root-preferred, low level of expression, the coding region of the genes and their terminators are placed behind a root preferred promoter such as but not limited to, maize NAS2 promoter, the maize Cyclo promoter (US 2006/0156439, published Jul. 13, 2006), the maize ROOTMET2 promoter (WO05063998, published Jul. 14, 2005), the CR1BIO promoter (WO06055487, published May 26, 2006), the CRWAQ81 (WO05035770, published Apr. 21, 2005) and the maize ZRP2.47 promoter (NCBI accession number: U38790; GI No. 1063664). The fragment described in Example 13b containing the qHSR1 coding region flanked by attL sites and containing a unique NotI site 35 bp upstream of the qHSR1 initiation codon is used to enable cloning using the Gateway Technology (Invitrogen, Carlsbad, USA). Promoter fragment is PCR amplified using primers that contain NotI sites. Each promoter is fused to the NotI site of qHSR1. In the final step, the chimeric gene construct is moved by Gateway LR recombination reaction (Invitrogen, Carlsbad, USA) into the binary vector PHP20622. This is used for corn transformation as described in Example 14.

Example 14

Agrobacterium-Mediated Transformation of Maize and Regeneration of Transgenic Plants

[0360] The recombinant DNA constructs prepared in Example 6a-6d were used to prepare transgenic maize plants as follows.

[0361] Maize is transformed with selected polynucleotide constructs described in Example 13a and 13c using the method of Zhao (U.S. Pat. No. 5,981,840, and PCT patent publication WO98/32326). Briefly, immature embryos were isolated from maize and the embryos contacted with a suspension of Agrobacterium, where the bacteria were capable of transferring the polynucleotide construct to at least one cell of at least one of the immature embryos (step 1: the infection step). In this step the immature embryos were immersed in an Agrobacterium suspension for the initiation of inoculation. The embryos were co-cultured for a time with the Agrobacterium (step 2: the co-cultivation step). The immature embryos were cultured on solid medium following the infection step. Following this co-cultivation period an optional resting step is performed. In this resting step, the embryos were incubated in the presence of at least one antibiotic known to inhibit the growth of Agrobacterium without the addition of a selective agent for plant transformants (step 3: resting step). The immature embryos were cultured on solid medium with antibiotic, but without a selecting agent, for elimination of Agrobacterium and for a resting phase for the infected cells. Next, inoculated embryos were cultured on medium containing a selective agent, and growing transformed callus is recovered (step 4: the selection step). The callus is then regenerated into plants (step 5: the regeneration step), and calli grown on selective medium were cultured on solid medium to regenerate the plants.

Example 15

Transgenic Plant Evaluation

[0362] Transgenic plants are made as described in Example 14 using the constructs described in Examples 13a to 13d, respectively. They are evaluated with protocols described in Example 9 for improvement in head smut resistance.

Example 16

Analysis of qHSR1 Gene Distribution Across Germplasm and Identification of qHSR1 Sequence Variants

[0363] Following the identification, sequencing and fine mapping of qHSR1, other lines are screened for the qHSR1 gene. To determine the presence of the qHSR1 gene in other maize germplasm, gene specific primers combinations are used to amplify genomic DNA from a diverse panel of maize inbred lines by polymerase chain reaction. Inbred lines with qHSR1 (MO17 allele) are identified. Thus, in addition to using MO17 as the donor source, other sources containing the qHSR1 gene can also be used as a donor source.

[0364] Variants of the qHSR1 gene are also identified and analyzed for single nucleotide polymorphisms (SNPs). Not all of the allelic variants of the qHSR1 gene indicated a resistant phenotype. Inbred lines with distinct haplotypes or alleles are evaluated for their head smut resistance, and putative resistant allelic variants are identified. Their efficacy in head smut resistance is validated in segregating populations (e.g. F2 population). The SNPs can be used as markers to precisely identify and track the qHSR1 sequence in a plant breeding program, and to distinguish between resistant and susceptible allelic variants. Further, these SNPs indicate that there are variant sequences that show a resistant phenotype and can be used in the methods and products disclosed herein.

Example 17

Further Analysis of qHSR1 Gene Distribution Across Germplasm and Identification of qHSR1 Sequence Variants

[0365] The qHSR1 region has been further defined as an 172-kb interval in the resistant parental line Ji1037 and a 56-kb interval in the susceptible parental line Huangzhao4. The size discrepancy is due to a deletion (116 kb) in Huangzhao4 compared with Ji1037. The key recombinants which were used for fine-mapping have been repeatedly investigated for their resistances to head smut in Gongzhuling in Jilin Province and in the winter nursery on Hainan Island, and show consistent resistance to head smut.

[0366] Positive Mo17 BAC clones have been selected based on the characterization of the qHSR1 region. In addition, markers in the qHSR1 region were used to screen a Huangzhao4 BAC library. The minimal tiling positive BAC clones were subjected to sequencing to get a broad view in the qHSR1 region. The comparative view among the Mo17, B73, and Huangzhao4 inbred lines is shown in the FIG. 4. A total of six additional putative genes have been identified, an ankyrin-repeat protein (SEQ ID NO:104-106, the coding sequence, protein translation, and genomic DNA, respectively) is found in all three inbred lines, a gene coding a Wall-associated kinase protein (SEQ ID NOs:31-33) is missing in Huangzhao4, a gene coding hydrolase (SEQ ID NO:107-109) is missing in B73 and Huangzhao4, two of the three Xa21-like kinase proteins (SEQ ID NOs: 110-115) are missing in Huangzhao 4, and the third Xa21-like kinase protein (SEQ ID NOs:115-117) is present in at least Mo17 and Huangzhao4.

Example 18

Characterization of Candidate Resistance Genes in the qHSR1 Region

[0367] Three approaches are being taken to validate the candidate resistance genes: 1) a complementarity test, since both Mo17 and B73 show some resistance to head smut, the three shared genes (Ankyrin-repeat protein, Wall-associated kinase protein, and Xa21D kinase), are likely to be candidate genes contributing to the phenotype, all these three genes are sub-cloned from the positive BAC clones into an expression vector, followed by transformation into susceptible inbred lines; 2) RNAi technique, RNAi vectors are constructed for all six putative genes in the 172-kb region and then are transformed into Mo17 to knock out putative genes one by one, this allows for the identification of those genes involved in resistance to head smut; 3) overexpression of candidate genes in susceptible lines, overexpression constructs with each of the six individual candidate genes linked to strong promoters are constructed and introduced into susceptible lines to determine if any of the individual candidate genes in the qHSR1 region is sufficient to confer resistance to head smut.

Example 19

Development of Markers in the qHSR1 Region Useful for Marker-Assisted Selection

[0368] The BAC sequences, especially those coding sequences were further used to develop high-density markers. In total, eight markers have been developed in the 172-kb region (Ji1037 qHSR1 which is equivalent to Mo17) (Table 5). These markers were used to integrate the resistance qHSR1 into other susceptible inbred lines via marker-assisted selection.

TABLE-US-00006 TABLE5 Markersinthe172kbintervalcoveringtheqHSR1region PCRproducts Marker Sequence (Ji1037/Huangzhao4) position name primer [SEQIDNO:] [SEQIDNO:] makertype 0 MZA6393 MZA6393L 5-GTATTTCTACCAGCGTGGCCT-3 412bp/325bp codominant [50] [23/47] MZA6393R 5-GACAAGCTGCAGATCGAAGA-3 [51] 7.27kb 1M2-9 1M2-9L 5-TCGTGACGGACCTGTAGTGC-3 618bp/759bp codominant [52] [54/55] 1M2-9R 5-TCGCGGTTCAGAAGAACAAC-3 [53] 26.4kb E6765-3 E6765-3L 5-CATGTGCCGACCGACCATTC-3 426bp dominant [56] [58 E6765-3R 5-GGAGTGCGATGTCTACAGCT-3 [57] 99kb 2M4-1 2M4-1L 5-CACGTTGTGACTCAAGATCG-3 573bp dominant [59 [61] 2M4-1R 5-ATCAAGGACCATCAGCACAG-3 [60] 141.5kb 2M10-5 2M10-5L 5-CCTCCTCTCCATCTGGTCCA-3 589bp dominant [62] [64] 2M10-5R 5-CGTGTGCTTGGAAGAATCTC-3 [63] 148kb 2M11-3 2M11-3L 5-TGGACAGACCTTAGCTTGCT-3 563bp dominant [65] [67] 2M11-3R 5-GTTCGTAAGTGCGTCAATGG-3 [66] 163kb 3M1-25 3M1-25L 5-GCTAGATAGCTGCTTCTTCC-3 328bp/468bp codominant [68] [70/71] 3M1-25R 5-GTACCTACGATTCGGCAGAA-3 [69] 172.1kb STS148-1 STS148-1L 5-CTTCCATCGGTACTCCATTC-3 177bp/132bp codominant [72] [24/49] STS148-1R 5-TTCTCCAGGTGTGAGAAATC-3 [73]

[0369] The genetic effect of the qHSR1 region in resistance to head smut was tested using eleven BC4 populations. The Mo17 inbred line was crossed to Ji853, 444, 4287, 98107, 99094, Chang7-2, V022, V4, 982, 8903, and 8902. The qHSR1 region was then backcrossed for four generations, using markers, such as MZA6393, 2M10-5, STS148-1, STS661 and E148-4, to select the plants with the qHSR1 region. These BC4 populations were phenotyped in the winter nursery in Hainan Island. These BC4 populations contained plants both with and without the qHSR1 (Table 6A and B.) The plants without the qHSR1 region were considered controls to tell the baseline resistance of the different genetic backgrounds. The individual plants within the BC4 populations were scored for resistance to head smut, and the percentage of resistant plants was calculated, for the groups both with and without the qHSR1 region. The qHSR1 region conferred an increase of approximately 25% in resistance index. The inbred line 4287 itself has the qHSR1 region and shows resistance to head smut, this is why the integration of the qHSR1 region in 4287 genetic background has minimal effect on resistance to head smut.

TABLE-US-00007 TABLE 6A The genetic effects of the qHSR1 region in resistance to head smut Size of the population Genetic Without With backgrounds qHSR1 qHSR1 Markers following the R region Ji853 353 28 MZA6393, 2M10-5, STS148-1 444 118 29 MZA6393, 2M10-5, STS148-1 4287 226 64 MZA6393, STS661 98107 81 27 MZA6393, 2M10-5, STS661 99094 17 46 MZA6393, 2M10-5, STS661 Chang7-2 176 86 MZA6393, 2M10-5, STS148-1 V022 148 91 MZA6393, 2M10-5, STS148-1 V4 69 134 MZA6393, 2M10-5, STS148-1 982 99 83 MZA6393, 2M10-5, STS661 8903 201 143 MZA6393, 2M10-5, E148-4 8902 67 118 MZA6393, 2M10-5, E148-4

TABLE-US-00008 TABLE 6B Percentage of the resistant plants Genetic in backcross populations backgrounds Without qHSR1 With qHSR1 Difference P-value Ji853 20.54% 52.60% 32.06% 5.27E09 444 35.37% 59.53% 24.16% 0.0012 4287 84.67% 84.31% 0.36% 98107 18.22% 42.22% 24.00% 0.0004 99094 0 33.93% 33.93% 0.01253 Chang7-2 12.48% 38.63% 26.15% 7.52E08 V022 44.41% 71.82% 27.41% 1.71E06 V4 21.29% 49.97% 28.68% 5.24E05 982 16.83% 29.91% 13.08% 3.30E05 8903 23.96% 40.34% 16.38% 2.79E09 8902 18.41% 38.26% 19.85% 9.19E06

Example 20

Additional Development of Markers in the qHSR1 Region Useful for Marker-Assisted Selection

[0370] Introgression lines for qHSR1 are being created for breeding material and the evaluation of qHSR1 efficacy in Western North America, Mexico, and China. Thirty-five Pioneer inbred lines (CN3K7 is the donor line; GRB1M, HNA9B, HN4CV, HNVS3, HNN4B, HNH9H, HNGFT, GR0RA, HFTWK, and GRVNS are non-stiff-stalk lines for China; GR0P2, HEF3D, HF0SV, HFHHN, HN05F, HN088, HN0E1, HN8T0, HNNWJ, and HNW4C are non-stiff-stalk lines for Western North America; EDGJ4, EDW1N, EDVNA, EDVS9, and EDV9Z are stiff-stalk lines for China; and 2HC5H, 2H071, 4F1FM, 4F1VJ, 4FJNE, 7T9HV, 1ARMJ, 1AY0M, 1AGFC, and 1A1V3 are stiff-stalk lines for Mexico) were crossed with Mo17 to create the F1. SNP markers, such as MZA15839-4, MZA18530-16, MZA5473-801, MZA16870-15, MZA4087-19, MZA158-30, MZA15493-15, MZA9967-11, MZA1556-23, MZA1556-801, MZA17365-10, MZA17365-801, MZA14192-8, MZA15554-13 and MZA4454-14, are being used to select for the qHSR1 region during subsequent backcrosses. Between 39 and 65 SNP markers on unlinked chromosomal regions were used in the BC1 generation to select against the background.

[0371] The lines are being backcrossed to a BC1, BC2, BC3, or BC4 generation, and then selfed. The plants homozygous for the qHSR1 region are identified in the selfed generation, and then crossed to an appropriate Test Cross Inbred, such as EF6WC or EF890 for NSS introgressions. The Test Cross BC lines are then evaluated for efficacy at the location appropriate for the inbred line, such as Western North America, Mexico, or China. At each location, a sufficient number of reps and population size are used to evaluate the qHSR1 efficacy. The equivalent hybrid without the head smut QTL was also grown for comparison. If high disease pressure is not expected, the experiment will be artificially inoculated with the head smut pathogen to insure high disease pressure.

[0372] Markers that are useful for marker assisted breeding to develop introgression lines are shown in Table 7. Eight of these markers (MZA6393, 1M2-9, E6765-3, 2M4-1, 2M10-5, 2M11-3, 3M1-25, and STS148-1) are located within the qHSR region. The markers in Table 7 that are outside of the qHSR region have been developed to be specific for Mo17, and therefore are linked to the qHSR region. These markers, although exemplary, are not intended to be a complete listing of all useful markers. Many markers that are specific for the qHSR region can be developed. In addition, any marker that is linked or associated with one of these specific markers could be useful in marker assisted selection.

TABLE-US-00009 TABLE 7A Markers in the qHSR Region Physical Marker Chrom- Genetic Position Mo17 Marker Type some Position (bp)* SNP MZA15839-4 SNP 2 220.22 T MZA18530-16 SNP 2 220.34 G MZA5473-801 SNP 2 225.11 G MZA16870-15 SNP 2 226.92 G MZA4087-19 SNP 2 228.58 C MZA158-30 SNP 2 228.58 T MZA15493-15 SNP 2 230.55 G MZA9967-11 SNP 2 231.1 T MZA6393 codominant 2 x 0 x 1M2-9 codominant 2 x 7.27 x E6765-3 dominant 2 x 26.4 x 2M4-1 dominant 2 x 99 x 2M10-5 dominant 2 x 141.5 x 2M11-3 dominant 2 x 148 x 3M1-25 codominant 2 x 163 x STS148-1 codominant 2 x 172.1 x MZA1556-23 SNP 2 235.32 A MZA1556-801 SNP 2 235.32 C MZA17365-10 SNP 2 235.68 G MZA17365-801 SNP 2 235.68 D MZA14192-8 SNP 2 235.8 G MZA15554-13 SNP 2 244.27 G MZA4454-14 SNP 2 245.91 C

TABLE-US-00010 TABLE7B MarkersintheqHSRRegion Size ForwardPrimer ReversePrimer (Ji1037/Huangzhao4) Marker [SEQIDNO:] [SEQIDNO:] [SEQIDNO:] MZA15839-4 gatgcaatggaagaattcgtg tgaactcagctttggataccaa [74] [75] MZA18530-16 gtttcctcatggcactactct agtaaagccacacatcttattc [76] [77] MZA5473-801 cccatgatggctacattctg cagaggcttgcgttaacaac [78] [79] MZA16870-15 atttcagcgtttgcggtgtc ataatgaagttgacctaagtcc [80] [81] MZA4087-19 agctaaacagcggatgactg caaacatgcaaagaatgaggtt [82] [83] MZA158-30 ccaccaccggccccagta aaagtgatacataaggcacaca [84] [85] MZA15493-15 gataattgggaatgggcagat agaaatatcctcatcctcaatg [86] [87] MZA9967-11 tttccggttttggtggacga cgtccgactcattatacatca [88] [89] MZA6393 gtatttctaccagcgtggcct gacaagctgcagatcgaaga 412/325 [50] [51] [23/47] 1M2-9 tcgtgacggacctgtagtgc tcgcggttcagaagaacaac 618/759 [52] [53] [54/55] E6765-3 catgtgccgaccgaccattc ggagtgcgatgtctacagct 426 [56] [57] [58] 2M4-1 cacgttgtgactcaagatcg atcaaggaccatcagcacag 573 [59] [60] [61] 2M10-5 cctcctctccatctggtcca cgtgtgcttggaagaatctc 589 [62] [63] [64] 2M11-3 tggacagaccttagcttgct gttcgtaagtgcgtcaatgg 563 [65] [66] [67] 3M1-25 gctagatagctgcttcttcc gtacctacgattcggcagaa 328/468 [68] [69] [70/71] STS148-1 cttccatcggtactccattc ttctccaggtgtgagaaatc 176/132 [72] [73] [24/49] MZA1556-23 tgtgctccctggtccgcc tcaagtgcccctagctcct [90] [91] MZA1556-801 tgtgctccctggtccgcc tcaagtgcccctagctcct [92] [93] MZA17365-10 cctatggctggttgctctt gccaacaagtcaacatcctaa [94] [95] MZA17365-801 cctatggctggttgctctt gccaacaagtcaacatcctaa [96] [97] MZA14192-8 tcctggaacgccatggtact cagggacatcaagcgcca [98] [99] MZA15554-13 acttccgaggcgtcgcagtt atgaacactcactcactcctc [100] [101] MZA4454-14 atgagggtttggaggcgtat ttacctcaactaagggcatcc [102] [103]