Thermolabile Exonucleases
20180363042 · 2018-12-20
Assignee
Inventors
- Terese Solstad (Kvaloysletta, NO)
- Elisabeth Lill Andreassen (Tromso, NO)
- Marit Sjo Lorentzen (Krokelvdalen, NO)
- Olav Lanes (Tromso, NO)
- Morten Elde (Tromso, NO)
- Atle Noralf Larsen (Kvaloysletta, NO)
- Yvonne Piotrowski (Tomasjord, NO)
- Nils Peder Willassen (Tomasjord, NO)
Cpc classification
C12Q1/6848
CHEMISTRY; METALLURGY
G01N1/30
PHYSICS
C12N9/22
CHEMISTRY; METALLURGY
International classification
C12Q1/6848
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
The invention provides an exonuclease or an enzymatically active fragment thereof, said exonuclease having the amino acid sequence of SEQ ID NO:1 or an amino acid sequence which is at least about 50% identical thereto, wherein said exonuclease or enzymatically active fragment thereof (i) is substantially irreversibly inactivated by heating at a temperature of about 55 C. for 10 minutes in a buffer consisting of 10 mM Tris-HCl, pH 8.5 at 25 C., 50 mM KCl and 5 mM MgCl.sub.2; (ii) is substantially specific for single stranded DNA; and (iii) has a 3-5 exonuclease activity. The invention further provides a method of removing single stranded DNA from a sample, a method of nucleic acid amplification, a method of reverse transcription and a method of nucleic acid sequence analysis in which the exonuclease or enzymatically active fragment thereof is used. The invention still further provides nucleic acids encoding said exonuclease or an enzymatically active fragment thereof and kits or compositions comprising the same.
Claims
1. A method of nucleic acid amplification, said method comprising a step, subsequent to the final amplification step, of contacting the product of the nucleic acid amplification reaction with an exonuclease or enzymatically active fragment thereof under conditions which permit the digestion of at least a portion of any single stranded DNA present in the product and optionally then heating the mixture to inactivate said exonuclease or enzymatically active fragment thereof, wherein said exonuclease has the amino acid sequence of SEQ ID No. 1 or an amino acid sequence which is at least about 85% identical thereto, wherein said enzymatically active fragment of said exonuclease is at least about 85% identical to the amino acid sequence of said exonuclease, wherein said exonuclease or enzymatically active fragment thereof (i) is at least 90% irreversibly inactivated by heating at a temperature of about 55 C. for 10 mins in a buffer consisting of 10 mM Tris-HCl, pH 8.5 at 25 C., 50 mM KCl and 5 mM MgCl.sub.2; (ii) has activity against double stranded DNA that is equal to or less than 15% of its activity against an equivalent amount of single stranded DNA under the same assay conditions; and (iii) has a 3-5 exonuclease activity.
2. The method of claim 1, wherein said method further comprises, subsequent to the final amplification step, contacting an alkaline phosphatase with the product of the amplification reaction prior to, at the same time as, or after, contacting said product with the exonuclease or enzymatically active fragment thereof, under conditions which permit the dephosphorylation of any unincorporated nucleotide triphosphates present in the product.
3. The method of claim 1, wherein said product is the direct product of the final amplification step.
4. The method of claim 1, wherein said nucleic acid amplification reaction is selected from PCR, 3SR, SDA, LAR/LCR, and LAMP.
5. A method of reverse transcription, said method comprising a step, subsequent to the final reverse transcription step, and/or, if present, the final second strand cDNA synthesis step, of contacting the product of the reverse transcription reaction with an exonuclease or enzymatically active fragment thereof under conditions which permit the digestion of at least a portion of any single stranded DNA present in the product and optionally then heating the mixture to inactivate said exonuclease or enzymatically active fragment thereof, wherein said exonuclease has the amino acid sequence of SEQ ID No. 1 or an amino acid sequence which is at least about 85% identical thereto, wherein said enzymatically active fragment of said exonuclease is at least about 85% identical to the amino acid sequence of said exonuclease, wherein said exonuclease or enzymatically active fragment thereof (i) is at least 90% irreversibly inactivated by heating at a temperature of about 55 C. for 10 mins in a buffer consisting of 10 mM Tris-HCl, pH 8.5 at 25 C., 50 mM KCl and 5 mM MgCl.sub.2; (ii) has activity against double stranded DNA that is equal to or less than 15% of its activity against an equivalent amount of single stranded DNA under the same assay conditions; and (iii) has a 3-5 exonuclease activity.
6. The method of claim 5, wherein said method further comprises, subsequent to the final reverse transcription step, and/or, if present, the final second strand cDNA synthesis step, contacting an alkaline phosphatase with the product of the reverse transcription reaction prior to, at the same time as, or after, contacting said product with the exonuclease or enzymatically active fragment thereof, under conditions which permit the dephosphorylation of any unincorporated nucleotide triphosphates present in the product.
7. The method of claim 5, wherein said product is the direct product of the final reverse transcription step, and/or, if present, the direct product of the final second strand cDNA synthesis step.
8. A method of nucleic acid sequence analysis, said method comprising a step of sample preparation prior to the analysis step(s), said step of sample preparation comprising contacting the sample to be analysed with an exonuclease or enzymatically active fragment thereof under conditions which permit the digestion of at least a portion of any single stranded DNA present in the sample and optionally then heating the mixture to inactivate said exonuclease or enzymatically active fragment thereof, wherein said exonuclease has the amino acid sequence of SEQ ID No. 1 or an amino acid sequence which is at least about 85% identical thereto, wherein said enzymatically active fragment of said exonuclease is at least about 85% identical to the amino acid sequence of said exonuclease, wherein said exonuclease or enzymatically active fragment thereof (i) is at least 90% irreversibly inactivated by heating at a temperature of about 55 C. for 10 mins in a buffer consisting of 10 mM Tris-HCl, pH 8.5 at 25 C., 50 mM KCl and 5 mM MgCl.sub.2; (ii) has activity against double stranded DNA that is equal to or less than 15% of its activity against an equivalent amount of single stranded DNA under the same assay conditions; and (iii) has a 3-5 exonuclease activity.
9. The method of claim 8, wherein said step of sample preparation further comprises contacting an alkaline phosphatase with the sample to be analysed prior to, at the same time as, or after, contacting the sample with the exonuclease or enzymatically active fragment thereof, under conditions which permit the dephosphorylation of any unincorporated nucleotide triphosphates present in the sample.
10. The method of claim 8, wherein said nucleic acid sequence analysis is a sequencing technique or an oligonucleotide hybridisation probe based technique.
11. The method as claimed in claim 1, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
12. The method as claimed in claim 2, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
13. The method as claimed in claim 3, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
14. The method as claimed in claim 4, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
15. The method as claimed in claim 5, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
16. The method as claimed in claim 6, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
17. The method as claimed in claim 7, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
18. The method as claimed in claim 8, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
19. The method as claimed in claim 9, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
20. The method as claimed in claim 10, wherein said exonuclease has the amino acid sequence of SEQ ID NO: 1 or SEQ ID NO: 11.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0098] The invention will now be described by way of non-limiting Examples with reference to the following figures in which:
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
EXAMPLES
Example 1Cloning, Recombinant Expression and Partial Purification of Exonucleases
[0120] The sbcB exodeoxyribonuclease I (exoI) gene from Moritella viscosa (HL-ExoI (Mv)), Vibrio wodanis (HL-ExoI (Vw)), Halomonas (HL-ExoI (Ha)), Psychromonas (HL-ExoI (Ps)) and Shewanella (HL-ExoI (Sh)) gDNA was cloned by overlap extension PCR cloning (Bryksin and Matsumura, 2010, Biotechniques, 48 (6), 463-465) with a C-terminal His-tag by inserting the cloned gene into the pTrc99A expression vector for expression in E. coli TOP10. The primers used are listed in Table 1. Genetic source material was obtained from bacteria isolated from Norwegian offshore waters.
TABLE-US-00001 TABLE1 PrimersusedforcloningofExoIgenes. Primer SEQID name Sequence No Mvforward GTGAGCGGATAACAATTTCACACAGGAAACAGACCATGG 23 ATAACAATTCGAACAAAACAGCAACAG Mvreverse GCTGAAAATCTTCTCTCATCCGCCAAAACAGCCtcagtgatggt 24 gatggtgatg-gcctgcagaTGCGCCAATTATTTTTTGACCATAAAGG Vwforward GTGAGCGGATAACAATTTCACACAGGAAACAGACCATGCC 25 GCAGGATAACGCACCAAG Vwreverse GCTGAAAATCTTCTCTCATCCGCCAAAACAGCCtcagtgatggtga 26 tggtgatggcctgcagaTGATACTAACTGTTGTACGTAATTATAAACG GCGC Haforward GTGAGCGGATAACAATTTCACACAGGAAACAGACCATGGCA 27 TCACCCAATGCTGCC Hareverse GCTGAAAATCTTCTCTCATCCGCCAAAACAGCCtcagtgatggtga 28 tggtgatggcctgcagaGGCATCAAATGCCTGGGCCG Psforward GTGAGCGGATAACAATTTCACACAGGAAACAGACCATGAAT 29 CAAGAATCCCCAAGCCTTCTTTGG Psreverse GCTGAAAATCTTCTCTCATCCGCCAAAACAGCCtcagtgatggtga 30 tggtgatggcctgcagaTGTATTCCCTGTCAAAAACTCTAAGTAATGT CC Shforward GTGAGCGGATAACAATTTCACACAGGAAACAGACCATGAAC 31 AACACTAAGAAACAGCCAACTTTATTTTGG Shreverse GCTGAAAATCTTCTCTCATCCGCCAAAACAGCCtcagtgatggtga 32 tggtgatggcctgcagaAAGATTTCTAAGATAATGACACAAAGCCTGT AA Bold letters, pTrc99A specific sequence; upper case letters, gene specific sequence; lower case letters, spacer and tag sequence.
[0121] The pTrc99A-exoI vectors were transformed into E. coli TOP10 following the protocol for Z-competent cells (Zymo Research, U.S.A.). The cells were grown in baffled shake flasks in Terrific Broth (TB) medium; approximately 1.5% overnight precultures were transferred to 250 ml TB medium containing 100 g/ml Ampicillin in 1000 ml growth flasks and incubated at 37 C., 200 rpm, until the OD.sub.600 reached 0.4-0.6. The temperature was decreased to 15 C. and the cells were incubated for 30 minutes before they were induced for 4 hours with 0.5 mM IPTG. The cells were harvested by centrifugation and the cell pellets frozen at 20 C.
[0122] Cell pellets from the 250 ml cultures were thawed on ice, 40 ml lysis buffer (50 mM Tris-HCl (pH 7.5 at 25 C.), 5 mM imidazole, 1 M NaCl, 0.1% Triton X-100, 10% glycerol, 10 mM MgCl.sub.2) was added and the mixture was sonicated in an ice water bath for 10 min (25% amplitude, 0.1 sec on, 0.2 sec off) using a Branson Sonifier. The lysate was centrifuged in a 50 ml tube at 25,000 g for 20 minutes and the supernatant filtered through a 0.45 M filter. The filtered lysate was diluted with 50 ml of lysis buffer to a total volume of 90 ml. All purification steps were performed with ice cold buffers and a column cooled on ice. The 90 ml lysate was applied to a HisTrap HP 1 ml column equilibrated in lysis buffer using a flow of 1 ml/min. The column was washed with 5 column volumes (CV) of lysis buffer and 10 CV of buffer A2 (50 mM Tris-HCl, (pH 7.5 at 25 C.), 5 mM imidazole, 500 mM NaCl). The protein was then eluted with 20 CV of a 0-30% gradient of buffer B (50 mM Tris-HCl, (pH 7.5 at 25 C.), 500 mM Imidazole, 500 mM NaCl) to buffer A2 in 1 ml fractions. Fractions containing ExoI activity were pooled and either dialysed against 10 mM Tris-HCl (pH 7.5 at 25 C.), 500 mM NaCl and 0.5 mM EDTA, or 10 mM Tris-HCl (pH 7.5 at 25 C.), 500 mM NaCl, 10 mM MgCl.sub.2 and 0.5 mM EDTA, and then diluted 1:1 with 100% glycerol and stored at 20 C.
[0123] Two more exonuclease I sequences (not disclosed) have been examined, but failed to express and isolate actively.
Example 2Activity Profiling of Exonucleases: Optimum Temperature for Catalytic Activity
[0124] A temperature profile was created to better characterise the different recombinant HL-ExoI from Example 1. The different HL-ExoI were diluted to concentrations enabling differentiation between substrate degradations on the gel. Due to the different dilution factors, samples could not directly be compared to each other, but relative temperature-dependent differences in activity could be estimated. Samples were incubated for various time intervals to determine if the enzyme could sustain a set temperature for longer periods of time.
Detailed Method
[0125] HL-ExoI was diluted (10 mM Tris-HCl pH 7.5 at 25 C., 5 mM MgCl.sub.2) to what was thought to give the best differentiation between samples. To mimic the PCR clean-up protocol, post-PCR solutions were used as reaction buffers. Robustness was achieved by running the experiment in parallel using post-PCR solutions based on two different PCR buffers; GoTaq (Promega) or TEMPase Key (VWR). As substrate, 5 pmol of a 5 FAM labeled oligonucleotide (GCTAACTACCACCTGATTAC; SEQ ID No 21) was added to each reaction. Following addition of the ExoI, the total volume for each sample was 7 l. Samples were incubated in a thermocycler for 1 minute, 5 minutes or 10 minutes at 20 C., 25 C., 30 C. or 37 C. followed by 5 minutes at 80 C. A TBE-Urea Sample Buffer (Bio-Rad) was added and samples were applied to a casted 20% Acrylamide/7M Urea gel and run at 180 V for approximately 45 minutes. All reagents were kept on ice during the full protocol unless specified otherwise and workflow was performed on cooling blocks.
Results
[0126] Results are shown in
[0127] HL-ExoI (Ha) showed an overall increasing activity up to 37 C. and could withstand this temperature for at least 10 minutes (
[0128] HL-ExoI (Ps) showed an overall best activity at 30 C., with loss of activity when using 37 C. as incubation temperature (
[0129] HL-ExoI (Sh) showed an overall best activity at 37 C., and could withstand this temperature for at least 10 minutes (
[0130] HL-ExoI (Mv) showed an overall best activity at 30 C., while incubation at 37 C. resulted in loss of activity (
[0131] Using PAGE for activity profiling appeared to give good estimates as to how the HL ExoI behaved depending on temperature over time.
Example 3Activity Profiling of Exonucleases: Inactivation Temperatures for Catalytic Activity
[0132] In this Example, the thermal inactivation characteristics of HL-ExoI (Sh) were compared to various commercially available E. coli ExoI.
[0133] The thermal inactivation characteristics of four different commercially available E. coli ExoI and one commercially available enzymatic PCR clean-up kit were compared to HL-ExoI (Sh). To ensure that any observed effects were irrespective of the choice of reaction buffer, two different post-PCR solutions were used as a reaction buffer (TEMPase Key, TEMPase Extra, VWR). All reactions received about 10 U of ExoI to enable comparison between the ExoI activities and ease of thermal inactivation. The exonuclease activity of HL-ExoI (Sh) was calculated as described in Example 8. For the commercial ExoIs, exonuclease activity was taken as that stated by the manufacturers. Final volume for each reaction was 7 l. Samples were incubated at 80 C. for 1 minute before cooling and addition of 5 pmol of a 5 FAM labeled oligonucleotide (GCTAACTACCACCTGATTAC; SEQ ID No 21). Samples were further incubated at 37 C. for 15 minutes. Following incubation, a TBE-Urea Sample Buffer (Bio-Rad) was added and samples were applied to a casted 20% acrylamide/7 M urea gel and run at 180 V for approx. 45 minutes. All reagents were kept on ice during the full protocol and workflow was performed on cooling blocks unless specified otherwise.
[0134] Results are shown in
Example 4Demonstration of Utility of HL-ExoI (Sh) in a Rapid PCR Clean-Up Prior to Nucleic Acid Sequencing
[0135] Experiments were set up to verify that HL-ExoI (Sh) could perform satisfactorily in a rapid PCR clean-up scenario. For comparison and positive control, parallel samples were treated with a leading brand of enzymatic PCR clean-up reagent ExoSAP-IT (Affymetrix).
[0136] To verify that HL-ExoI (Sh) enabled a 5 minute enzymatic PCR clean-up protocol, an experiment was designed to stress-test the protocol limitations. Thus, to all post-PCR solutions under test there were added excess primers or dNTPs following the PCR. If left unremoved prior to the sequencing reaction, residual primers would result in sequence reactions in the opposite direction and thereby strongly compromise the length and quality of the reaction, and dNTPs would result in ddNTP:dNTP ratios which would fail to yield high quality sequences. Robustness was achieved by using different PCR reagents and amplicons.
[0137] Following PCR, 10 pmol primers or 40 nmol dNTPs were added to the post-PCR solutions.
[0138] Samples to be treated with ExoSAP-IT were handled according to manufacturer protocol. Following addition of either reverse primer or dNTP to the PCR solution, samples received 2 l of the clean-up reagent, giving a final volume of 7 l. Samples were incubated 15 minutes at 37 C. followed by 15 minutes at 80 C. Samples were set up using two different PCR buffers and all samples were set up as triplicates.
[0139] Samples to be treated with HL-ExoI (Sh) received the same amount of added primers and dNTPs as above, before addition of 1 l of HL-ExoI (Sh) (10 U/l, as calculated in Example 8) and 1 l of SAP (2 U/l). As with the positive controls, the final volume of the samples were 7 l. Samples were incubated 4 minutes at 37 C. followed by 1 minute at 80 C. Samples were set up using two different PCR buffers and all samples were set up as triplicates.
[0140] To evaluate how ExoSAP-IT would perform given a protocol identical to HL-ExoI, samples were spiked with reverse primers before the addition of 2 l of the ExoSAP-IT PCR clean-up reagent. Samples were set up as duplicates.
[0141] As negative controls, samples received reverse primers or dNTPs, but instead of enzymatic clean-up solutions, samples received 2 l water. Samples were set up as duplicates.
TABLE-US-00002 TABLE 2 provides an overview of the above described experimental set up. Reagent Volume Post-PCR solution (TEMPase Extra, VWR or GoTaq, Promega) 4 l Spike dNTP (10 mM ACGT each) or Reverse primer (10 M) 1 l PCR clean-up ExoSAP-IT (commercially available PCR clean-up solution) or 2 l HL-Exol & SAP or dH.sub.2O Total 7 l
TABLE-US-00003 TABLE 3 provides an overview of the PCR clean-up incubation Protocol Incubation Total time ExoSAP-IT 15 minutes at 37 C. .fwdarw. 15 minutes at 80 C. 15 minutes 4 minutes at 37 C. .fwdarw. 1 minute at 80 C. 5 minutes HL-Exol + 4 minutes at 37 C. .fwdarw. 1 minute at 80 C. 5 minutes SAP Negative 15 minutes at 37 C. .fwdarw. 15 minutes at 80 C. 15 minutes control
[0142] Following PCR clean-up treatment, samples were immediately cooled on ice. A prepared sequencing reaction mastermix was aliquoted into separate tubes. A total of 2.5 l of each treated/untreated solution was added to each tube to be used as a template in the subsequent sequencing reaction. Samples were immediately transferred to a thermocycler and the sequencing program was initiated.
TABLE-US-00004 Reagent Volume BigDye v3.1 (LifeTech) 1 l 5X Sequencing Buffer (LifeTech) 4 l Sequencing primer (10 M) 0.32 l Template (treated/untreated PCR product with spike) 2.5 l dH.sub.2O 12.18 l Total 20 l
TABLE-US-00005 Cycling temperature Time 96 C. 5 min 96 C. 10 sec 50 C. 5 sec {close oversize bracket} 25 cycles 60 C. 4 min 4 C. Hold
[0143] Sequences were delivered to the DNA Sequencing core Facility at University of Tromso for purification and sequencing using an Applied Biosystems 3130xl Genetic Analyzer. Results were analyzed using the Sequence Scanner Software v1.0 (LifeTech).
[0144] Selected results are shown in
[0145] The sequence plots of
[0146] On the other hand
Example 5Inactivation Experiments to Determine Minimum Inactivation Time and Temperature for Certain Heat-Labile Exonucleases of the Invention
[0147] Minimum inactivation temperature and time was determined for each HL-ExoI under test under the given assay conditions. This was achieved by incubating HL-ExoI at different temperatures for different time intervals. Following heat-treatment, 5 labeled single stranded DNA was added and degree of substrate degradation was visualized (
[0148] Undiluted HL-ExoI was added to Reaction Buffer (10 mM Tris-HCl, pH 8.5 at 25 C., 50 mM KCl, 5 mM MgCl.sub.2), giving a final volume of 9 l. Samples were incubated for 5 minutes, 10 minutes or 15 minutes at 40 C., 45 C., 50 C. or 55 C. or for 5 minutes or 10 minutes at 60 C. Following cooling of samples, 5 pmol of a 5FAM labeled oligonucleotide (GCTAACTACCACCTGATTAC; SEQ ID No 21) was added. Samples were further incubated at 30 C. for 30 minutes and then for 2 minutes at 95 C. A TBE-Urea Sample Buffer (Bio-Rad) was added and samples were applied to a precast 20% acrylamide/7 M urea gel and run at 180 V for approximately 45 minutes. All reagents were kept on ice during the full protocol and workflow was performed on cooling blocks unless specified otherwise. PAGE results were imaged using the Molecular Imager PharosFX system (Bio-Rad).
[0149] Results are shown in
Example 6Determination of Sensitivity Threshold for Inactivation Experiments by Measuring Degree of Substrate Degradation for a Dilution Series of Exonucleases
[0150] In order to determine the minimum inactivation temperature for the various HL-ExoI of the previous Example, the sensitivity threshold for the inactivation assay of Example 5 was determined. A semi-quantitative assay was prepared using serial dilutions of the exonucleases and estimating the degree of substrate degradation for each dilution. For comparative measurements, the same assay conditions and reaction set-up as used in the inactivation assays were also applied here.
[0151] Each HL-ExoI under test was diluted 1, 10, 100, 200, 1000 and 10,000 times, corresponding to 100%, 10%, 1%, 0.5%, 0.1% and 0.01% activities. The same buffer as used as Reaction Buffer was also used as Dilution Buffer (10 mM Tris-HCl, pH 8.5 at 25 C., 50 mM KCl, 5 mM MgCl.sub.2). Reaction Buffer and 5 pmol of FAM-labeled substrate (GCTAACTACCACCTGATTAC; SEQ ID No 21) were premixed prior to HL-ExoI addition. Total volume of reaction was 10 l. Samples were incubated for 30 minutes at 30 C., followed by 2 minutes at 95 C. A TBE-Urea Sample Buffer (Bio-Rad) was added and samples were applied to a precast 20% acrylamide/7M urea gel and run at 180 V for approx. 45 minutes. All reagents were kept on ice during the full protocol and workflow was performed on cooling blocks unless specified otherwise. PAGE results were imaged using the Molecular Imager PharosFX system (Bio-Rad).
[0152] Results are shown in
Example 7Assay for Determining Double-Stranded and Single-Stranded Exonuclease Activity
[0153] Exonuclease activity is measured by incubating the test exonuclease enzyme with a short 5-FAM-DNA-TAMRA-3 labelled single or double stranded substrate of approximately 20 nucleotides. If the exonuclease is able to degrade the substrate this will start immediately and the fluorophore will be released. The activity can be followed over time since the released fluorophore can re-emit light upon light excitation. Specifically, the assay mix consists of 1 l 10 M ssDNA/dsDNA, 10 l 5TDB (250 mM Tris-HCl, pH 8.5 at 25 C., 5 mM DTT, 1 mg/ml BSA, 10% Glycerol) and 29 l MiliQ H.sub.2O. 40 l assay mix is transferred to the wells of a black flat bottom 96-well plate and 5 l MiliQ H.sub.2O or dilution buffer (as negative control) and enzyme samples are added to the wells. The reactions are initiated by adding 5 l 50 mM MgCl.sub.2 using a multichannel pipette, making the final volume of the reaction 50 l. Fluorescence is measured immediately (excitation 485 nm and emission at 520 nm) and then at appropriate time intervals, include a shaking step, and the reactions are allowed to proceed for 15 minutes. An increase in fluorescence indicates degradation of the substrate is taking place.
Example 8Assay for Quantifying Single-Stranded Exonuclease Activity
[0154] Single strand DNA exonuclease activity was measured by incubating the enzyme with a denatured .sup.3H-dATP incorporated PCR product. If the exonuclease is able to degrade the substrate the exonuclease will release acid soluble nucleotides that can be detected in a scintillation counter. Excess high molecular weight substrate DNA is precipitated with trichloroacetic acid (TCA). In this assay, one Unit (1 U) is defined as the amount of enzyme that will catalyse the release of 10 nmol acid-soluble nucleotides in a final volume of 20 l in 30 minutes at 30 C.
[0155] Specifically, the assay mix consisted of 4 l 5 Exonuclease buffer (250 mM Tris-HCl, pH 7.5 at 25 C., 50 mM MgCl.sub.2, 5 mM DTT), 5 l denatured substrate (denatured by incubation for 3 minutes at 100 C. and immediate transfer to an ice water bath for 3 minutes) and 6 l MiliQ H.sub.2O. 15 l was transferred to 1.5 ml microcentrifuge tubes on ice. The enzyme under test was diluted when necessary and 5 l each of enzyme sample, control and blank was added to the assay mix and mixed by pipetting up and down. The samples were incubated in a water bath at 30 C. for 10 minutes. After incubation the reactions were placed on ice and 20 l ice cold calf thymus DNA (1 mg/ml) and 250 l ice cold 10% (w/v) TCA were added immediately. The samples were then incubated on ice for 15 minutes and centrifuged at 4 C. for 10 minutes at 13,000 rpm. The supernatants, 200 l, were transferred to a 24-well plate and 0.8 ml Ultima Gold XR Scintillation fluid was then added. The wells were sealed with sealing tape and the samples were mixed thoroughly by shaking. The samples were counted in a MicroBeta.sup.2 Plate Counter for 5 minutes.
Example 9Assay for Quantifying Double-Stranded Exonuclease Activity
[0156] Double strand DNA exonuclease activity is measured in the same way as Example 8 with the exception that the PCR substrate is not denatured prior to incubation with the enzyme.
Example 10Comparison of the Double Stranded and Single Stranded Exonuclease Activities of the Heat Labile Exonucleases of the Invention
[0157] Single strand DNA exonuclease activity was measured by incubating the test enzyme with a denatured .sup.3H-dATP incorporated PCR product. Double strand DNA exonuclease activity was similarly measured with the exception that the enzyme was incubated with a non-denatured .sup.3H-dATP incorporated PCR product. If an exonuclease is able to degrade the substrate the exonuclease will release acid soluble nucleotides that can be detected in a scintillation counter. Excess high molecular weight substrate DNA is precipitated with trichloroacetic acid (TCA). In this assay, one Unit (1 U) is defined as the amount of enzyme that will catalyse the release of 10 nmol acid-soluble nucleotides in a final volume of 20 l in 30 minutes at 30 C. Specifically, the assay mix consisted of 4 l 5 buffer (50 mM Tris-HCl, pH 8.5 at 25 C., 250 mM KCl and 25 mM MgCl.sub.2), 5 l substrate (to obtain ssDNA the dsDNA substrate was denatured by incubation for 3 minutes at 100 C. and immediate transferred to an ice water bath for 3 minutes) and 3 l MiliQ H.sub.2O. The assay mix, 12 l, was transferred to 1.5 ml microcentrifuge tubes on ice. The enzyme under test was diluted and 8 l of enzyme sample was added to the assay mix and mixed by pipetting up and down. Control and blank were also included in the set-up. The samples were incubated in a water bath at 30 C. for 10 minutes. After incubation the reactions were placed on ice and 20 l ice cold calf thymus DNA (1 mg/ml) and 250 l ice cold 10% (w/v) TCA were added immediately. The samples were then incubated on ice for 15 minutes and centrifuged at 4 C. for 10 minutes at 13,000 rpm. The supernatants, 200 l, were transferred to a 24-well plate and added 0.8 ml Ultima Gold XR Scintillation fluid. The wells were sealed with sealing tape and the samples mixed thoroughly by shaking. The samples were counted in a MicroBeta.sup.2 Plate Counter for 5 minutes.
[0158] The results are summarized in Table 4 and shows that the HL-ExoI of the invention display very little activity against double stranded DNA compared to the activity against single stranded DNA. It is however difficult to conclude if the low amounts of activity against double stranded DNA are related to intrinsic properties of the enzymes or is caused merely by contaminations of the enzymes. The two commercial ExoI (ExoI A and ExoI B) tested also displayed very low activity against double stranded DNA.
TABLE-US-00006 TABLE 4 Activity of HL-Exol and commercial Exoi against ssDNA and dsDNA. Relative activity Activity Activity against dsDNA against ssDNA against dsDNA and ssDNA (U/l) (U/l) (%) HL-Exol Ha 50.9 0.05 0.10 HL-Exol Ps 11.2 0.02 0.18 HL-Exol Sh 65.1 0.01 0.02 HL-Exol Vw 21.0 0.01 0.05 HL-Exol Mv 16.7 0.01 0.06 Exol A 16.7 0.01 0.06 Exol B 41.2 0.01 0.02
Example 11Activity Profiling of Exonucleases: Directionality Determination Using Urea Polyacrylamide Gel
[0159] This experiment was performed in order to verify that the HL-ExoI of the invention exhibited 3 to 5 exonuclease activity and no substantial 5 to 3 exonuclease activity. The substrate specificity was analysed using either a 5 FAM or a 3 FAM-labeled oligonucleotide (GCTAACTACCACCTGATTAC; SEQ ID No 21) on a polyacrylamide gel.
[0160] Each HL-ExoI under test was diluted to a final concentration of about 0.1 U/l. Two master mixes were prepared, one for the 5 FAM-labeled oligo and one for the 3 FAM-labeled oligo. The master mix contained Reaction Buffer (10 mM Tris pH 8.5, 50 mM KCl, 5 mM MgCl.sub.2) and the respective FAM-labeled substrate, giving a final amount of 0.25 pmol substrate per reaction. Both a negative control, containing dilution buffer instead of enzyme solution, and a positive control, using Exo I from E. coli, were included. The enzymes were pipetted into the pre-cooled reaction tubes and then the master mix with the reaction buffer and substrate was added. All reactions consisted of a final volume of 10 l and were incubated at 30 C. for 1 h. Reactions were stopped by adding 2.5 l of sample loading buffer (95% formamide, 10 mM EDTA, Xylene) and incubated at 95 C. for 5 min. For analysis, 6 l of the samples were loaded onto a 12% acrylamide/7 M urea gel. The gel was run at 50 W for 1 h 45 minutes. During the set-up of the reactions all reagents and samples were kept on ice.
[0161] Results are shown in
Example 12Activity Profiling of Exonucleases: Directionality on Crystallisation Structure
[0162] To further support the directionality of the HL-ExoI I enzymes of the invention having 3-5 directionality, the HL-ExoI (Mv) was crystalised with ssDNA and the structure of the complex was determined.
[0163] Protein crystallisation was performed with a protein concentration of 5.4 mg/ml. The desalted 13mer oligonucleotide (dT13) was purchased from Sigma Aldrich and added to the protein in a 1.2 molar excess. To inhibit the degradation of the ssDNA by the exonucleaseI, 10 mM EDTA was added. The drops were set up automatically in a 96-well format in MRC 2 Well Crystallization Plates (Swissci, Hampton Research) with the Phenix (Art Robbin Instruments) using the sitting drop vapor diffusion technique. The drop size was 0.4 l (0.2 l+0.2 l) and the volume of the reservoir solution was 60 l. The crystallisation plates were incubated at 4 C.
[0164] A crystal co-crystallised with dT13/EDTA grew with 20.02% PEG MME 5000, 0.1 M Na-acetate pH 4.5 and 0.09 M Ca-acetate. The X-ray diffraction experiment was performed at the ESRF in Grenoble (France). The crystal diffracted to 2.5 resolution. Structure determination has been performed by molecular replacement with the E. coli ExoI (PDB: 1FXX) as the search model.
[0165] In the early rounds of refinement, electron density for the ssDNA became visible and all nucleotides could be fit in. The ssDNA binds with the 3-end in the active site in a similar manner as seen for E. coli Exo I (Korada et al., Nucleic Acids Research, 2013, 41(11):5887-97) providing structural evidence for the HL-ExoI (Mv) 3-5directionality.
Example 13Activity Profiling of Exonucleases: Rapid Inactivation of Certain HL-ExoI of the Invention at 80 C.
[0166] This experiment was performed to confirm that certain of the HL-ExoI of the invention could perform satisfactorily in a rapid PCR clean-up scenario. In this experiment, the thermal inactivation characteristics of the HL-ExoI under test at 80 C. were compared to two commercially available E. coli ExoI (ExoI A and ExoI B).
[0167] The activities of the HL-ExoI of the invention against ssDNA was calculated as described in Example 8, with the exception that the 1 assay mix consisted of 67 mM Glycin-KOH, pH 9.5, 63.5 mM NaCl, 9.2 mM MgCl.sub.2, 10 mM DTT including .sup.3H dA-labelled DNA. For the commercial E. coli ExoI, the activity was taken as that stated by the manufacturers. To mimic the set-up in a PCR clean-up setting, a post PCR buffer was used as the reaction buffer. The composition of the reaction buffer was 10 mM Tris-HCl pH 8.5 (25 C.), 50 mM KCl, 1.5 mM MgCl.sub.2, DyNAzyme II (Thermo Fisher Scientific, formerly Finnzymes) and remnants of dNTPs (initially 200 M of each before the PCR-reaction was run), remnants of primers (initially 200 nM of each primer before the PCR-reaction was run) and template.
[0168] Each reaction received 10 U ExoI, giving a final reaction volume of 7 l. The experiment contained both an activity control for all ExoI, as well as a check for residual activity following heat incubation. For the activity control, reaction buffer, ExoI and 5 pmol substrate (GCTAACTACCACCTGATTAC; SEQ ID No 21) were mixed and incubated for 15 minutes at 30 C. followed by 95 C. for 20 minutes. For samples to be analysed with respect to inactivation at 80 C., substrate was added following 1 minute incubation at 80 C. and subsequent cooling. These samples were subsequently incubated for 15 minutes at 30 C. followed by 95 C. for 20 minutes. Following all incubation steps, TBE-Urea Sample buffer was added and samples were applied to a precast 20% acrylamide/7 M urea gel and run at 180 V for approximately 45 minutes.
[0169] Results are shown in
[0170] To further compare the ease of inactivation of HL-ExoI (Sh) with that of two commercially available E. coli ExoI, 10 U of each ExoI was incubated for 1, 5, 10 or 20 minutes at 80 C. before cooling and addition of 5 pmol of a 5 FAM labeled substrate (GCTAACTACCACCTGATTAC; SEQ ID No 21). The samples were further incubated for 15 minutes at 30 C. followed by 20 minutes at 95 C. Reaction set-up was otherwise identical to the above experiment, using the same post-PCR buffer as reaction buffer. An activity control was included for the three ExoI, and these samples were not subjected to heat incubation prior to incubation at 30 C. for 15 minutes. Residual activity was visualized on a Urea-PAGE gel as described above.
[0171] Results are shown in
Example 14Demonstration of the Utility of HL-ExoI in a Rapid One-Tube PCR Clean-Up Prior to Nucleic Acid Sequencing
[0172] This example was performed to show functionality of certain HL-ExoI of the invention in a PCR clean-up situation. The experimental set-up was very similar to Experiment 4. As in Example 4, to the post PCR solution under test was added excess primers (10 pmol) following the PCR. However, unlike Example 4 only one PCR buffer (GoTaq, Promega) was used, the incubation temperature for samples treated with HL-ExoI was reduced from 37 C. to 30 C. and only the regular 30 minutes protocol was tested for ExoSAP-IT.
[0173] Prior to initiating the experiment, the activity of each HL-ExoI was calculated as described in Example 8, with the exception that the 1 assay mix consisted of 67 mM Glycin-KOH, pH 9.5, 63.5 mM NaCl, 9.2 mM MgCl.sub.2, 10 mM DTT including .sup.3H dA-labelled DNA. Samples treated with HL-ExoI received the amount of primers as stated above, before the addition of 2 l premixed HL-ExoI (10-20 U/l) and SAP (1.5 U/l). Total volume for each clean-up reaction was 7 l. Samples were incubated 4 minutes at 30 C. followed by 1 minute at 80 C. Samples were set up as triplicates
[0174] For comparison and positive control, samples were treated with a leading brand of enzymatic PCR clean-up; ExoSAP-IT (Affymetrix). Samples treated with ExoSAP-IT were handled according to manufacturer protocol. Following addition of primers to the PCR solution, samples received 2 l of the PCR clean-up reagent, giving a final volume of 7 l. ExoSAP-IT-treated samples were incubated 15 minutes at 37 C. followed by 15 minutes at 80 C. Samples were set up as triplicates.
[0175] Negative controls were set up and these received the same amount of primers as treated samples. Instead of enzymatic clean-up solution, these samples received 2 l water. Samples were set up as triplicates.
[0176] Example 4 should be referred to for more details.
[0177] Sequences were delivered to the DNA Sequencing core Facility at University of Tromso for purification and sequencing using Applied Biosystems 3500xl Genetic Analyzer. Results were analyzed using the Sequence Scanner Software v2.0 (LifeTech)
[0178] Selected results are shown in