MONOCLONAL ANTIBODY SPECIFIC TO PCV2 AND METHOD FOR DIAGNOSING PMWS USING SAME
20180362667 ยท 2018-12-20
Inventors
- Sun Hee Cho (Seongnam-si, KR)
- Tae Eun Kim (Yongin-si, KR)
- Jun Ho Chung (Seongnam-si, KR)
- Hyo Ri KIM (Seoul, KR)
- Jun Yeong Jin (Gwacheon-si, KR)
Cpc classification
C07K2317/34
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to a monoclonal antibody specific to porcine circovirus 2 (PCV2) and a method for diagnosing post-weaning multi-systemic wasting syndrome (PMWS) using the same. More specifically, the present invention relates to monoclonal antibodies C4-1 and C4-8 of scFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of porcine circovirus 2, and to a method for diagnosing post-weaning multi-systemic wasting syndrome using the same. The monoclonal antibody of the present invention makes it possible to determine whether an antibody against PCV2 is a neutralizing antibody by a vaccine antigen or an antibody induced by immune decoy.
Claims
1. A monoclonal antibody specific to porcine circovirus 2 (PCV2), wherein the monoclonal antibody is scFV-human C fusion recombinant protein that specifically binds to a decoy epitope of PCV2.
2. The monoclonal antibody of claim 1, wherein the ScFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of PCV2, is C4-1, C4-8, or C4-1 and C4-8.
3. The monoclonal antibody of claim 1, wherein the decoy epitope of the PCV2 is 12 amino acids positioned from the 169.sup.th to the 180.sup.th.
4. The monoclonal antibody of claim 3, wherein the amino acids are STIDYFQPNNKR (SEQ ID NO: 11).
5. A reagent for diagnosing post-weaning multi-systemic wasting syndrome (PMWS), comprising an antigen for diagnosis, a monoclonal antibody for capturing the antigen for diagnosis, a label for detection, a monoclonal antibody to which the label for detection is bound, and a reagent for measuring the activity of the label for detection, wherein the monoclonal antibody for capturing the antigen for diagnosis is an scFV-human C fusion recombinant protein which specifically binds to the decoy epitope of porcine circovirus 2 (PCV2).
6. The PMWS reagent of claim 5, wherein the ScFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of PCV2, is C4-1, C4-8, or C4-1 and C4-8.
7. The PMWS reagent of claim 5, wherein the decoy epitope of the PCV2 is the amino acids of STIDYFQPNNKR (SEQ ID NO: 11) positioned from the 169.sup.th to the 180.sup.th.
8. A method for analyzing the characteristics of porcine circovirus 2 (PCV2) antibody using an enzyme-linked immunosorbent assay (ELISA), comprising: performing a competitive reaction between the monoclonal antibody according to any one of claims 1 to 4 and the antibody in the serum of a subject infected with PCV2 or vaccinated subject; measuring the absorbance of the monoclonal antibody; and determining whether the antibody in the serum is a neutralizing antibody or an antibody induced by immune decoy based on the absorbance of the monoclonal antibody.
9. The method of claim 8, further comprising determining the antibody as a neutralizing antibody when the absorbance of the monoclonal antibody is constantly maintained.
10. The method of claim 8, further comprising determining the antibody as an antibody induced by immune decoy when the absorbance of the monoclonal antibody is decreased.
11. A method for quantitating the decoy antigen in the porcine circovirus 2 (PCV2) antigen using an enzyme-linked immunosorbent assay (ELISA), wherein scFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of PCV2, is used as a PCV2-specific monoclonal antibody.
12. The method of claim 11, wherein the ScFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of PCV2, is C4-1, C4-8, or C4-1 and C4-8.
13. The method of claim 11, wherein the decoy epitope of PCV2 is the amino acids of STIDYFQPNNKR (SEQ ID NO: 11) positioned from the 169.sup.th to the 180.sup.th.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
DESCRIPTION OF EXEMPLARY EMBODIMENTS
[0033] Unless specified otherwise, all the technical and scientific terms used in the present application have the same meaning as that usually understood by an ordinary specialist in the field to which the invention belongs. All the patents, patent applications, patent application publications, Genbank sequences, databases, websites, and other references mentioned over the entire disclosure of the present application, unless known otherwise, are incorporated in their entirety by way of reference. When URL or other such identifiers or addresses are referenced, such identifiers may be changed and particular information on the internet may vary but equivalent information may be discovered by searching through the internet. The reference of the present application proves the availability and pervasiveness of the information made public.
[0034] As used herein, the term antibody refers to an immunoglobulin or an immunoglobulin fragment, which includes any fragment including at least a part of the variable region of an immunoglobulin molecule, which possesses the specific binding affinity of a full-length immunoglobulin, which is a native or synthesized (e.g., prepared by recombination) in part or entirety. Accordingly, an antibody includes a protein, which has a binding domain homologous to the immunoglobulin antigen-binding domain (antibody binding domain), or substantially the same. The antibody may include a synthetic antibody, an antibody prepared by recombination, a multi-specific antibody, a human antibody, a non-human antibody, a humanized antibody, a chimeric antibody, an intrabody, or a fragment of antibody, but is not limited thereto. For example, the antibody may include an Fab fragment, an Fab fragment, an F(ab).sub.2 fragment, an Fv fragment, a disulfide-stabilized Fv (dsFv), an Fd fragment, an Fd fragment, a single-chain Fv (scFv), a single-chain Fab (scFab), diabody, and anti-idiotypci (anti-Id) antibody, or an antigen-binding fragment thereof.
[0035] As used herein, the term neutralizing antibody refers to any antibody or an antigen-binding fragment thereof, which binds to a pathogen and thereby prevents the ability of the pathogen that infects cells and/or causes a disease in a subject. Examples of the neutralizing antibody may include those which bind to virus, bacteria, and fungal pathogens. Typically, the neutralizing antibody provided in the present invention binds to the surface of a pathogen. According to the virus classification, the surface protein may be a capsid protein or a viral coated protein.
[0036] As used herein, the term monoclonal antibody refers to a population of the same antibody in which each individual antibody molecule in the population is the same as those of others. This characteristic is in contrast to the antibody of the polyclonal population of antibodies having multiple different sequences.
[0037] As used herein, the term Fv antibody fragment refers to a fragment of an antibody which consists of a variable heavy chain (VH) domain and a variable light chain (VL) domain linked by a non-covalent interaction.
[0038] As used herein, the term scFc fragment refers to an antibody fragment which includes a variable light chain (VL) and a variable heavy chain (VH) domain, covalently-linked in a random sequence by a polypeptide linker. The linker is a length that enables a crosslinking of two variable domains without substantial interference. Examples of the linker include (Gly-Ser).sub.n residues, in which some of the Glu or Lys residues are dispersed over the entire region for the increase of solubility.
[0039] As used herein, the term linker peptide or spacer peptide refers to a short amino acid sequence that connects two polypeptide sequences (or nucleic acids encoding the amino acids). The polypeptide linker refers to a short amino acid sequence that connects two polypeptide sequences. Examples of the polypeptide linker include a linker that connects a peptide transfer domain to an antibody, or a linker that connects two antibody chains within a synthetic antibody fragment (e.g., an scFv fragment).
[0040] As used herein, the term polypeptide refers to two or more amino acids which are covalently-linked. In the present invention, the terms polypeptide and protein can be used interchangeably.
[0041] As used herein, the term peptide refers to a polypeptide having a length of about 2 to t 40 amino acids.
[0042] As used herein, the term peptide refers to an organic compound including an amino group or carboxylic acid group. A polypeptide includes two or more amino acids. For the purpose of the present invention, the amino acids included in the antibody being provided include 20 naturally-occurring amino acids, non-natural amino acids, and amino acid analogs (e.g., an amino acid where -carbon has a side chain).
[0043] As used herein, the term amino acid residue refers to an amino acid in the peptide bond which is formed during the chemical digestion (hydrolysis) of a polypeptide. The amino acid residue described in the present invention is generally in the form of an L isomer. The residue within the D isomer may be replaced with any L-amino acid residue as long as the desired functional property is maintained by the polypeptide. NH.sub.2 represents a free amino group present in the amino terminus of a polypeptide. COOH represents a free carboxyl group present in the carboxyl terminus of a polypeptide.
[0044] As used in the present invention, the property of a polypeptide, for example an antibody, refers to any property exhibited by a polypeptide, which includes binding specificity, structural configuration or shape, protein stability, resistance to proteolysis, structural stability, thermal resistance, and pH conditions, but is not limited thereto. For example, the change in the binding specificity of an antibody polypeptide may be able to change the binding ability to antigens and/or various activities, for example, affinity or binding affinity or in vivo activity of the polypeptide.
[0045] As used in the present invention, the functional activity of a polypeptide, for example an antibody, refers to any activity exhibited by a polypeptide. The activities can be determined by experiments. The activity may include antigen-binding, DNA binding, ligand binding or isomerization, and enzyme activity (e.g., an ability to interact with a biomolecule through the kinase activity or proteolysis activity), but is not limited thereto. The activity to an antibody may include an ability to specifically bind to a particular antigen, antigen-binding affinity, binding affinity of an antigen-binding, on-rate, off-rate, effector function (e.g., neutralization or removal of antigens), ability to promote neutralization of virus, and in vivo activities (e.g., ability to prevent pathogenic infection or invasion, promote the removal of pathogen, penetrate particular tissue or body fluid or cell), but is not limited thereto. The activities may be measured in vivo or in vitro using the known measurement methods (e.g., ELISA, flow cytometer, surface plasmon resonance or an equivalent method for measuring on-rate or off-rate, immunohistochemical method, immunofluorescence histology, microscopic observation, cell-based measurement, flow cytometry, and binding analysis (e.g., panning analysis).
[0046] As used in the present invention, the terms oligonucleotide and oligo are used as synonyms. An oligonucleotide is a polynucleotide including a limited length of nucleotides. One of ordinary skill in the art generally considers an oligonucleotide to have a nucleotide length of about 250 or less, typically about 200 or less, and typically about 100 or less. Typically, the oligonucleotide provided in the present invention is a synthetic oligonucleotide. The synthetic oligonucleotide includes a nucleotide with a length shorter than about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, and 200. Typically, an oligonucleotide is a single-stranded oligonucleotide. The suffix, mer, can be used to indicate the length of oligonucleotides, for example, 100-mer can be used to describe an oligonucleotide which has a 100 nucleotide length.
[0047] As used in the present invention, the terms polynucleotide and nucleic acid molecule represent an oligomer or polymer which includes deoxyribose nucleic acid (DNA) and ribose nucleic acid (RNA), generally a nucleotide or nucleotide derivative of two or more connected with each other by a phosphodiester bond. The polynucleotide includes, for example, nucleotide analogs, or DNA and RNA derivatives which includes a backbone binding (e.g., a phosphodiester bond, a phosphoramidate bond, a phosphorothioate bond, a thioester bond, or a peptide bond (peptide nucleic acid). Polynucleotide (peptide nucleic acid) includes single-stranded and/or double-stranded polynucleotide, for example, not only deoxyribose nucleic acid (DNA) and ribose nucleic acid (RNA), but also analogs of any one of RNA or DNA.
[0048] As used in the present invention, the term primer refers to a nucleic acid molecule which can act as an initiation point for the template-directed nucleic acid synthesis under an appropriate condition (for example, 4 different nucleoside triphosphate and polymerase (e.g., in the presence of DNA polymerase, RNA polymerase, or reverse transcriptase)) in an appropriate buffer and temperature. It may be understood that a particular nucleic acid molecule can be provided as a probe and a primer. However, a primer has a 3 hydroxy group for its extension. Primers can be used for various methods, (e.g., polymerase chain reaction (PCR), reverse transcriptase (RT)-PCR, RNA PCR, LCR, multiple PCR, panhandle PCR, capture PCR, expression PCR, 3 and 5 RACE, in situ PCR, ligation-mediated PCR, and other amplification protocols).
[0049] As used in the present invention, the term primer pair refers to, for example, a primer set including a 5 (upstream) primer which specifically hybridizes with the 5 end of a sequence to be amplified by PCR, and a 3 (downstream) primer which specifically hybridizes with a complementary sequence at the 3 end. Since primer is mentioned as a pool of the same nucleic acid molecules, primer pair generally refers to a pair of two pools of primers.
[0050] As used in the present invention, the term panning refers to an affinity-based selection procedure for the separation of a phage which indicates the region, part, or location of a molecule, which has a specificity to a binding partner, for example a capture molecule (e.g., an antigen) or an amino acid or a nucleotide.
[0051] As used in the present invention, the term isolated or purified polypeptide or protein (e.g., an isolated antibody or an antigen-binding fragment thereof) or a biologically active part thereof (e.g., an isolated antigen-binding fragment) substantially has no cellular material from the cell or tissue, from which the protein is derived, or other contaminated proteins, or has no chemical precursor or other chemical materials at the time of chemical synthesis. With regard to preparations, when they are determined by a standard analysis method used by one of ordinary skill in the art for purity measurement (e.g., thin layer chromatography (TLC), gel electrophoresis, and high performance liquid chromatography (HPLC)) and appear to contain no easily detectable impurities, or are pure enough so that additional purification cannot detectably change the physical and chemical properties of a material (e.g., enzyme and biological activities), they may be determined as being not present. The method for purifying compounds for the preparation of a compound with substantial and chemical purity is known to one of ordinary skill in the art. However, the compound with substantial and chemical purity may be a mixture of stereoisomers. In that case, additional purification may increase specific properties of a compound.
[0052] As used in the present invention, the singular forms a, an, and the are intended to include the plural forms as well, unless the context clearly indicates otherwise. Accordingly, the description with respect to a polypeptide including immunoglobulin domain may include a polypeptide having a single or multiple immunoglobulin domains.
[0053] As used in the present invention, the term or may be use to refer to and/or, unless it is explicitly indicated to represent a selective item, or the selective items are mutually exclusive.
[0054] The range and amount used in the present invention may be expressed by way of about particular value or range. About also includes an exact amount. Therefore, about 5 amino acids refers to about 5 amino acids and also 5 amino acids.
[0055] As used in the present invention, the term random or randomly refers to a case where the incident or environment that is to be described hereinbelow may occur or may not occur, and the description include the exemplary case that the incident or environment occurs and the exemplary case that the incident or environment does not occur. For example, the random variation part means that the part is a variation or non-variation.
[0056] As used in the present invention, the abbreviations for the protective groups, amino acids, and other compounds shall comply with the IUPAC-IUB committee on the conventional usage, recognized abbreviations, or biochemical nomenclature, unless described otherwise (see Biochem. (1972) 11(9): 1726-1732).
[0057] According to an exemplary embodiment, the present invention provides a monoclonal antibody specific to porcine circovirus 2 (PCV2).
[0058] In the above exemplary embodiment, the monoclonal antibody specific to PCV2 may be an scFV-human C fusion recombinant protein that specifically binds to a decoy epitope of PCV2.
[0059] In the above exemplary embodiment, the monoclonal antibody specific to PCV2 may be C4-1, C4-8, or C4-1 and C4-8 of the ScFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of PCV2.
[0060] In the above exemplary embodiment, the decoy epitope of PCV2 may be 12 amino acids positioned from the 169.sup.th to the 180.sup.th.
[0061] In the above exemplary embodiment, the decoy epitope of PCV2 may be a STIDYFQPMMKR peptide.
[0062] In the above exemplary embodiment, the monoclonal antibody may be used for analyzing the characteristics of PCV2 using an enzyme-linked immunosorbent assay (ELISA). The method for analyzing the characteristics of the PCV2 antibody using an enzyme-linked immunosorbent assay (ELISA) includes:
[0063] performing a competitive reaction between the monoclonal antibody according to the present invention and the antibody in the serum of a subject infected with PCV2 or vaccinated subject;
[0064] measuring the absorbance of the monoclonal antibody; and
[0065] determining whether the antibody in the serum is a neutralizing antibody or an antibody induced by immune decoy based on the absorbance of the monoclonal antibody. The method for determining whether the antibody in the serum is a neutralizing antibody or an antibody induced by immune decoy may further include determining the antibody as a neutralizing antibody when the absorbance of the monoclonal antibody is constantly maintained; and determining the antibody as an antibody induced by immune decoy when the absorbance of the monoclonal antibody is decreased.
[0066] According to another exemplary embodiment, the present invention provides a reagent for diagnosing PMWS, which includes an antigen for diagnosis, a monoclonal antibody for capturing the antigen for diagnosis, a label for detection, a monoclonal antibody to which the label for detection is bound, and a reagent for measuring the activity of the label for detection.
[0067] In the above exemplary embodiment, the monoclonal antibody for capturing the antigen for diagnosis may be a monoclonal antibody specific to porcine circovirus 2 (PCV2).
[0068] In the above exemplary embodiment, the monoclonal antibody specific to PCV2 may be an ScFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of PCV2.
[0069] In the above exemplary embodiment, the monoclonal antibody specific to PCV2 may be C4-1, C4-8, or C4-1 and C4-8 of the ScFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of PCV2.
[0070] In the above exemplary embodiment, the decoy epitope of PCV2 may be 12 amino acids positioned from the 169.sup.th to the 180.sup.th.
[0071] According to another exemplary embodiment, the present invention provides a kit for diagnosing PMWS, which includes an antigen for diagnosis, a monoclonal antibody for capturing the antigen for diagnosis, a label for detection, a monoclonal antibody to which the label for detection is bound, and a reagent for measuring the activity of the label for detection.
[0072] In the above exemplary embodiment, the monoclonal antibody for capturing the antigen for diagnosis may be a monoclonal antibody specific to porcine circovirus 2 (PCV2).
[0073] In the above exemplary embodiment, the monoclonal antibody specific to PCV2 may be an ScFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of PCV2.
[0074] In the above exemplary embodiment, the monoclonal antibody specific to PCV2 may be C4-1, C4-8, or C4-1 and C4-8 of the ScFV-human C fusion recombinant protein, which specifically binds to a decoy epitope of PCV2.
[0075] In the above exemplary embodiment, the decoy epitope of PCV2 may be 12 amino acids positioned from the 169.sup.th to the 180.sup.th.
[0076] In the above exemplary embodiment, the decoy epitope of PCV2 may be a STIDYFQPMMKR peptide.
[0077] Hereinafter, the present invention will be explained in further detail with reference to Examples. However, the present invention should not be limited by these Examples.
Example 1. Preparation of PCV2 Antigen
[0078] 1-1. Synthesis of Peptides
[0079] Cysteine was added to the end of the 12 amino acids positioned from the 169.sup.th to the 180.sup.th, which was known as a decoy epitope of porcine circovirus 2 (PCV2), to synthesize a peptide (Peptron, Korea). BSA and KLH were conjugated to the cysteine of the C-terminus and used it as an antigen for screening antibody and the immunity of chickens. The STIDYFQPMMKR peptide was named as CP-BSA or CP-KLH, short for the circovirus peptide.
[0080] 1-2. PCV2 Recombinant Protein (Monomer)
[0081] The amino acids at the N-terminus of PCV2 were deleted not to generate an icosahedral structure but to be present in a monomeric form to expose the CP (169 to 180) decoy epitope, thereby enabling a recombinant protein expressed in E. coli to include the amino acid residues of the CP of PCV2 from the 43.sup.rd to the 233.sup.rd (
[0082] 1-3. PCV2 Virus Like Particle (VLP, Icosahedral)
[0083] PCR was performed using the ORF2 gene of PCV2 virus along with the following primers and each ORF2 gene was subjected to TA cloning into the XL-Topo vector.
TABLE-US-00001 TABLE1 PCV2-ORF2- 5 AAGGATCC- SEQIDNO. F ATGACGTATCCAAGGAGGCGTT3 1 PCV2-a-R 5 GCTCTAGA- SEQIDNO. TTAGGGTTTAAGTGGGGGGTCT3 2 PCV2-b-R 5 GCTCTAGA- SEQIDNO. TTAAGGGTTAAGTGGGGGGTCT3 3 PCV2-d-R 5 GCTCTAGA- SEQIDNO. TTAGGGGTTAAGTGGGGGGTCT3 4
[0084] After PCV2a-1 was treated with NotI and SpeI restriction enzymes and PCV2d was treated with NotI and BamHI restriction enzymes respectively, a vector containing ORF2 gene and the pFast BacI vector for the expression of baculovirus were reacted with T4 DNA ligase for 2 hours 30 minutes at 1 C. Then, the resultant was transformed into E. coli DH5a, plated on an LB agar containing ampicillin, cultured at 37 C. overnight, and transformed colonies were isolated. The isolated plasmid vectors were subjected to a midi-prep for transfection using the NucleoBond Xtra Midi Plus. The Sf9 cells obtained from Invitrogen (Lot. No. 1211757) were cultured using Grace's insect medium (10% FBS). The Sf9 cells were cultured in a 6-well plate using Sf-900II media to a concentration of 910.sup.5 cells/well, transfected, and the virus was obtained 3 days thereafter. Each recombinant baculovirus was infected into High5 cells (Invitrogen: Lot. NO. 1179361), which were cultured using Express Five SFM (L-glutamine 200 mM) media at a concentration of 0.5 MOI, and the PCV2 VLP obtained from the culture broth cultured for 8 days thereafter, was used for tests.
Example 2. Preparation of Library of Immune Antibody Against PCV2
[0085] 2-1. Immunization
[0086] The peptide KLH conjugate (CP-KLH; 50 g) synthesized in Example 1, as an antigen, was mixed with phosphate buffered saline (PBS; 750 L) and cultured at 37 C. for 30 minutes. Then, the resultant was emulsified in an adjuvant of water-in-oil emulsion (RIBI+MPL+TDM+CWS adjuvant, Sigma, St. Louis, Mo., USA) containing detoxified endotoxin (monophosphorylate lipid A species; MPL) and mycobacterial cell wall components (TDW, CWS) in 2% squalene, and then subcutaneously injected to 3 chickens. In the same manner, the chickens were further inoculated 3 weeks thereafter, and subsequently 2 weeks thereafter thereby performing a total of 3 immunizations. The antibody titer of the immunized chickens was determined by an enzyme-linked immunosorbent assay (ELISA) using the horseradish peroxidase (HRP) conjugated anti-chicken IgG (Y) polyclonal antibody (rabbit anti-chicken IgG(Y)-HRP, Millipore corporation, Billeria, Mass., USA) as a secondary antibody.
[0087] 2-2. Preparation of Single Chain Fv Library of Chicken
[0088] Total RNA was extracted from spleen, spleen, bursa, and bone marrow of the immunized chickens of 2-1 using TRI reagent (Invitrogen, Carlsbad, Calif., USA). First strand cDNA was synthesized using oligo-dT primer and Superscript III First-Strand Synthesis System (Invitrogen).
[0089] A single-chain Fc (scFv) library was prepared using the primers of Table 2 below, which are specific to the heavy chain variable region and light chain variable region of immunoglobulin using the Expand High Fidelity PCR system (Roche Molecular Systems, IN, USA) with respect to the cDNA obtained from the immune system of chickens.
TABLE-US-00002 TABLE2 V Primers CSCVK GTGGCCCAGGCGGCCCTGACTCAGCCGTCCTCG SEQID (sense) GTGTC NO.5 CKJo-B GGAAGATCTAGAGGACTGACCTAGGACGGTCAG SEQID (reverse) G NO.6 V.sub.HPrimers CSCVHo- GGTCAGTCCTCTAGATCTTCCGGCGGTGGTGGC SEQID FL AGCTCCGGTGGTGGCGGTTCCGCCGTGACGTTG NO.7 (sense) GACGAG CSCG-B CTGGCCGGCCTGGCCACTAGTGGAGGAGACGAT SEQID (reverse) GACTTCGGTCC NO.8 OverlapExtensionPrimers CSC-F GAGGAGGAGGAGGAGGAGGTGGCCCAGGCGGCC SEQID (sense) CTGACTCAG NO.9 CSC-B GAGGAGGAGGAGGAGGAGGAGCTGGCCGGCCTG (reverse) GCCACTAGTGGAGG
[0090] In each reaction, 1 L of cDNA was mixed with 60 pmol of each primer, 10 L of 10 reaction buffer, 8 L of 2.5 mM dNTP (Promega, Madison, Wis., USA), 0.5 L of Tap DNA polymerase and water to a final volume of 100 L. The PCR reaction was performed for a total of 30 cycles under the following conditions: at 94 C. for 15 sec, at 56 C. for 30 sec, and at 72 C. for 90 sec, and subsequently at 72 C. for 10 min for final extension. The fragment having a size of about 350 bp was electrophoresed by loading on a 1.5% agarose gel and purified using a QIAGEN II Gel Extraction Kit (QIAGEN, Valencia, Calif., USA). The purified PCR product was read at OD 260 nm and quantitated (1 OD unit=50 g/mL).
[0091] In the second PCR, the first VL and VH products were randomly connected by overlap extension PCR. Each PCR reaction was performed by mixing 100 ng of purified VL and VH products, 60 pmol of each primer, 10 L of 10 reaction buffer, 8 L of 2.5 mM dNTP, 0.5 L of Tap DNA polymerase and water to a final volume of 100 L. The PCR reaction was performed for a total of 25 cycles under the following conditions: at 94 C. for 15 sec, at 56 C. for 30 sec, and at 72 C. for 2 min, and subsequently at 72 C. for 10 min for final extension. The scFv fragment having a size of about 700 bp was electrophoresed by loading on a 1.5% agarose gel and purified using a QIAGEN II Gel Extraction Kit (QIAGEN). The purified PCR product was read at OD 260 nm and quantitated (1 OD unit=50 g/mL).
[0092] 2-3. Library Ligation and Transformation
[0093] For the cloning of the scFv fragment and pComb3-SS vector (The Scripps Research Institute, CA, USA), which are PCR products, were cleaved with SfiI restriction enzyme. The purified overlap PCR product (10 g) was mixed with 360 unit of SfiI (16 units/g of DNA, Roche Molecular Systems, Pleasanton, Calif., USA), 20 L of 10 reaction buffer, and water to a final volume of 200 L. The mixture was cleaved at 50 C. for 8 hours. The scFv fragment with a size of about 700 bp and a vector with a size of 3400 bp were electrophoresed by loading on a 1% agarose gel and purified using a QIAGEN II Gel Extraction Kit (QIAGEN, Valencia, Calif., USA).
[0094] The SfiI-cleaved pComb3 vector (1400 ng) and the scFv fragment (700 ng) were mixed with 40 L of 5 ligase buffer, 10 L of T4 DNA ligase (Invitrogen, Carlsbad, Calif., USA), and water to a final volume of 200 L, and ligated by culturing at 16 C. for 16 hours. Then, the resultant was precipitated with ethanol and only the DNA pellet was dissolved in 15 L of water.
[0095] The ligated library sample was transformed into ER2738 (New England Biolabs Inc., Hitchin, Hertfordshine, SG4 OTY, England, UK), an E. coli strain, by electroporation using the Gene pulser (Bio-Rad Laboratories, Hercules, Calif., USA). The cells were mixed in a super broth (SB) medium (5 mL) at 37 C. and cultured with stirring at 250 rpm for 1 hour. Then, 10 mL of SB medium and 3 L of carbenicillin (100 mg/mL) were added to the culture broth. The culture broth (0.1 L, 1 L, and 10 L) was plated on a Luria broth (LB) agar plate containing carbenicillin (50 g/mL) and the library size was determined. The culture product was stirred for additional 1 hour and 4.5 L of carbenicillin (100 mg/mL) was added to the culture broth and was stirred further for additional 1 hour. 2 mL of VCM13 helper phage (>10.sup.11 cfu/mL), 183 mL of preheated SB, and 92.5 L of carbenicillin (100 mg/mL) were added to the culture broth and stirred at a rate of 250 rpm at 37 C. for 2 hours. 280 L (50 mg/mL) of kanamycin was added to the culture broth and stirred at a rate of 250 rpm at 37 C. overnight. On the next day, the culture broth was centrifuged at 3,000 g, 4 C. using a high speed centrifuge (Beckman, JA-10 rotor). Then, the bacteria pellet was stored for the preparation of phagemid DNA and the supernatant was transferred into a sterile centrifuge bottle. Subsequently, 8 g of polyethylene glycol-8000 (PEG-8000, Sigma) and 6 g of NaCl (Merck) were added thereto, stored on ice for 30 minutes, and the supernatant was centrifuged at 15,000 g, 4 C. for 15 minutes. The supernatant was discarded and the phage pellet was resuspended in Tris-buffer saline (TBS) containing 1% BSA.
Example 3. Library Panning on Fixed Antigen (Bio-Panning)
[0096] Bio-panning was performed using magnetic beads (Dynabeads M-270 Epoxy, Invitrogen). An antigen was coated while rotating/stirring 3 g of CP-BSA (peptide) and PCV2 recombinant protein (monomer) to the 110.sup.7 beads at room temperature for 20 hours. The coated beads were washed 4 times with PBS, blocked with PBS containing 3% BSA at room temperature for 1 hour, and cultured with the phage-displayed scFv obtained from Example 2-3 at room temperature for 2 hours. To remove the phage, which is not bound to the antigen coated to the beads, the beads were washed with 0.05% Tween 20/PBS, and the bound phage was eluted using 50 L of 0.1 M glycine-HCl (pH 2.2) and neutralized with 2 M Tris-HCl (pH 9.1). E. coli ER2738 was infected using the phage-containing supernatant and, for the overnight amplification of phage, was rescued using VCSM13 helper phage. Additionally, the culture broth infected with the phage was plated on an LB agar plate containing carbenicillin, and the titer of input and output phages was determined. On the next day, as in Example 1-4, PEG-8000 and NaCl were added thereto to precipitate only phage, and the precipitated phage was used for the next bio-panning.
[0097] By repeating the above procedure, panning was performed as follows: using a CP-BSA peptide for the 1.sup.st panning, using a PCV2 recombinant protein as an antigen for from the 2.sup.nd panning, and alternatively using a peptide and a recombinant protein for from the 3.sup.rd to the 7.sup.th panning. Additionally, with respect to the washing step, in the 1.sup.st panning, the number of washing was gradually increased since the 1.sup.st wash and performed the 10.sup.th wash in the 7.sup.th panning, thereby allowing selection and enrichment of phages with high affinity.
Example 4. Selection of Clones by Phage ELISA
[0098] For the analysis of clones selected from bio-panning, an ELISA was performed to confirm whether the randomly selected individual phage-displayed scFv clones simultaneously have binding affinity to PCV2 CP-BSA peptide and PCV2 recombinant protein (monomer).
[0099] CP-BSA (peptide) and a PCV2 recombinant protein (monomer) were diluted in 0.1 M NaHCO.sub.3 buffer, coated into a 96-well microtiter plate at a concentration of 100 ng/well at 4 C. for 16 hours, and blocked with 3% BSA/PBS at 37 C. for 1 hour. Then, the phage supernatant was mixed equally with 6% BSA/PBS and cultured at 37 C. for 2 hours. The culture broth was washed with 0.05% Tween 20/PBS, and the HRP conjugated anti-M13 antibody (a-M13-HRP, Pierce Chemical Co, Rockford, Ill., USA) was diluted in a 1:5000 ratio, added into the plate in an amount of 50 L, and cultured at 37 C. for 1 hour. Upon completion of cultivation and washing, for the color reaction, 2,2-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) (ABTS, Amresco, Solon, Ohio, USA) at a concentration of 1 g/mL and 0.1% H.sub.2O.sub.2 were added into each well in the 0.05 M citrate buffer, and developed color, and the absorbance was measured at 405 nm. The results are shown in
[0100]
Example 5. Preparation of Recombinant Anti-PCV2 scFv-Human C Fusion Protein
[0101] 5-1. Subcloning of Anti-PCV2 scFv Using a Mammalian Expression Vector (scFv-C)
[0102] The mammalian expression vector pCEP4 (Invitorgen), in which restriction sites are modified for easy cloning, was inserted with a gene encoding human immunoglobulin C by HindIII and XhoI (New England Biolabs, UK) restriction enzymes. The gene encoding the anti-PCV2 scFv was subcloned from the pComb3 vector into the 5 end of human C region by two SfiI restriction sites (
[0103] 5-2. Transfection and Protein Purification
[0104] For the expression and purification of pCEP4-anti PCV2 scFv-human C into a protein form, a mammalian transfection and overexpression system were used. Per mL of the culture volume, 2 g of a mammalian expression vector and 4 g of polyethyleneimine (PEI, Polysciences, Warrington, Pa., USA) were mixed with 150 mM NaCl (Merck) corresponding to a 1/10 of the cell culture volume, and placed at room temperature for 15 minutes. The mixture was added to a mammalian cell HEK293F (210.sup.6 cells/mL, Invitrogen) and cultured in a Freestyle 293 expression medium containing 100 U/mL of penicillin and streptomycin in conditions of at 37 C., 7% CO.sub.2, and stirring at 135 rpm for 6 days. The cell culture broth was centrifuged and, for the purification of only the fusion protein in the form of anti-PCV2 scFv-C expressed from the supernatant, an affinity gel chromatography using the Kappaselect (GE Healthcare Bio science, Sweden) was used.
Example 6. Measurement of Binding Ability of scFv-C Fusion Protein
[0105] 6-1. Confirmation of PCV2-Binding Region of Anti-PCV2-scFv-C Fusion Protein
[0106] To confirm whether the antibody of the scFv-C fusion protein produced in Example 5 exhibits the binding ability only when the amino acids positioned from the 169.sup.th to the 180.sup.th, which is expected to be as the CP-BSA peptide and epitope, is in an exposed form, an enzyme-linked immunosorbent assay (ELISA) was performed. As the type of the antigen to be coated, CP-BSA peptide, PCV2 recombinant protein (monomer), and PCV2 virus like particle (VLP, icosahedral) were diluted in 0.1 M NaHCO.sub.3, and added to a 96-well microtiter plate at a concentration of 100 ng/well, and coated at 4 C. for 16 hours. The anti-PCV2 scFv-C fusion protein was diluted in 3% BSA/PBS at a concentration of 1 g/mL and added to each well in an amount of 50 L and reacted for 2 hours. Upon completion of the cultivation, the culture broth was washed with 0.05% Tween 20/PBS, and HRP conjugated anti-human C antibody (Goat anti-human C-HRP, Abcam, Cambridge, UK) was diluted in a 1:5000 ratio and added to each well at a concentration of 50 L/well, cultured for 1 hour, washed with tetramethylbenzidine (TMB, Gendepot, Barker, Tex., USA), allowed to develop a color, and the absorbance was measured at the wavelength of 650 nm. The results are shown in
[0107] As can be seen from
[0108] 6-2. Measurement of Binding Ability of scFv-C Fusion Protein
[0109] To measure the binding ability of the scFv-C fusion protein produced in Example 5 to the CP-BSA peptide, an ELISA was performed. CP-BSA peptide was diluted in 0.1 M NaHCO.sub.3, and subjected to a 1:10 serial dilution starting from 7500 nM (the concentration where the scFv-C fusion protein is included in 50 L a 100-fold moles of the epitopes of the CP-BSA peptide) to 0.00075 nM by adding at a concentration of 8 points to a 96-well coated plate at a concentration of 25 ng/well at 4 C. for 16 hours, and reacted for 2 hours. As the types of the scFv-C fusion proteins to be added, the C4-1 and C4-8 clones, which have the binding affinity for the CP-BSA peptide were used, and the Control-scFv-C, which does not bind to the CP-BSA peptide, was used as a negative control. Then, the absorbance was measured in the same manner as in Example 6-1, and the results are shown in
[0110] As can be seen from
Example 7. Anti-PCV2-scFv-C Fusion Protein and Competition ELISA Between Porcine Sera
[0111] 7-1. Competition ELISA Between Porcine Sera According to the Concentration of Anti-PCV2-scFv-C Fusion Protein
[0112] Whether the competition effect between the porcine antibody present in the serum produced with respect to the amino acids positioned from the 169.sup.th to the 180.sup.th, which is the region to be exposed by infection, and the anti-PCV2-scFv-C generates a concentration gradient according to the amount was confirmed using the antibody in the form of the anti-PCV2-scFv-C fusion protein produced in Example 4. The point where the signal changes most rapidly was set by a 1:2 ratio dilution of the amount of the antigen to be coated through a preliminary experiment, and diluted in 0.1 M NaHCO.sub.3 at a concentration of 25 ng/well, and coated to a 96-well microtiter plate at 4 C. for 16 hours. On the next day, each serum of germ-free pigs (Seoul national university, Korea), vaccinated pigs, and infected pigs was diluted in 3% BSA/PBS at a 1:50 ratio, and the anti-PCV2-scFv-C and negative control scFv-C were prepared by a 1:10 serial dilution starting from 15000 nM to 0.00015 nM by adding at a concentration of 8 points, and the sera and the anti-PCV2-scFv-C were mixed at an equal volume of 25 L. As the final concentration, with respect to the serum, the 1:100 anti-PCV2-scFv-C was added at a concentration of 8 points from 7500 nM to 0.00075 nM and reacted for 2 hours. The plate was washed with 0.05% Tween 20/PBS and, the HRP conjugated anti-swine immunoglobulin antibody (goat anti-swine IgG-HRP, Santacruz, Calif., USA), as a secondary antibody, was diluted in a 1:4000 ratio and used at a concentration of 50 L/well. 1 hour thereafter, tetramethylbenzidine (TMB, Gendepot, Barker, Tex., USA) was added thereto to develop a color and the absorbance was measured at the wavelength of 650 nm. The results are shown in
[0113] As can be seen from
[0114] 7-2. Anti-PCV2-scFv-C Fusion Protein and Competition ELISA Between Porcine Sera
[0115] The experiment was performed in the same manner as in Example 7-1. The amount of antigen to be coated was set at 25 ng/well, and the final concentration of the primary antibody was set at a 1:100 ratio, and the anti-PCV2-scFv-C fusion protein at 750 nM. Experiments were performed using a total of 41 pigs; i.e., a single germ-free pig as the control, and the sera from a group of 20 vaccinated pigs and the sera from a group of 20 pigs suspected of infection due to lack of vaccination. The results are shown in
[0116] As can be seen from
INDUSTRIAL APPLICABILITY
[0117] The monoclonal antibody according to the present invention can make it possible to determine whether the antibody against PCV2 is a neutralizing antibody by a vaccine antigen or an antibody induced by immune decoy.