FETAL CHROMOSOMAL ANEUPLOIDY DIAGNOSIS
20180363058 ยท 2018-12-20
Inventors
Cpc classification
G16B40/00
PHYSICS
G16B25/00
PHYSICS
C12Q2537/16
CHEMISTRY; METALLURGY
G16H50/20
PHYSICS
C12Q2537/16
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
C12Q2537/143
CHEMISTRY; METALLURGY
G16B25/20
PHYSICS
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12Q1/6883
CHEMISTRY; METALLURGY
G16H50/20
PHYSICS
Abstract
The invention relates to prenatal detection methods using non-invasive techniques. In particular, it relates to prenatal diagnosis of a fetal chromosomal aneuploidy by detecting fetal and maternal nucleic acids in a maternal biological sample. More particularly, the invention applies multiplex PCR to amplify selected fractions of the respective chromosomes of maternal and fetal chromosomes. Respective amounts of suspected aneuploid chromosomal regions and reference chromosomes are determined from massive sequencing analysis followed by a statistical analysis to detect a particular aneuploidy.
Claims
1-11. (canceled)
12. A method for analyzing DNA sequencing reads, comprising sequencing amplified target DNA sequences from at least one quantitative multiplex PCR reaction, wherein the amplified target DNA sequences are from a biological sample of a pregnant female and comprise one or more chromosomal regions suspected of being aneuploidy and one or more chromosomal regions of a reference chromosome; and calculating the sum of read counts for all amplified target DNA sequences of the suspected chromosomal aneuploidy followed by normalization, against the sum of read counts for all amplified DNA sequences of the reference chromosome to determine by statistical methods a set score indicative for the presence of a fetal chromosomal aneuploidy.
13. The method of claim 12, wherein said fetal chromosomal aneuploidy is chromosome 13 and/or chromosome 18 and/or chromosome 21 and/or chromosome X and/or chromosome Y.
14. The method of claim 12, wherein said biological sample is maternal blood, plasma, urine, cerebrospinal fluid, serum, saliva or is transcervical lavage fluid.
15. The method of claim 12, wherein the amplified target DNA sequences have a size between 30-180 base pairs.
16. The method of claim 12, wherein the GC content of the amplified target DNA sequences is between 20 and 70%.
17. The method of claim 12, wherein the amplified target DNA sequences are obtained in a single multiplex PCR reaction.
18. The method of claim 17, wherein in said single multiplex PCR reaction more than 40 amplified DNA sequences are obtained.
19. The method of claim 17, wherein in said single multiplex PCR reaction more than 60 amplified DNA sequences are obtained.
20. A kit comprising primers capable of amplifying target nucleic acid sequences from chromosomes 13, 18, and/or 21, and primers capable of amplifying a reference chromosome, wherein each primer has a tag or barcode.
21. The kit of claim 20, wherein the kit comprises primers capable amplifying target nucleic acid sequences from chromosome 13, and primers capable of amplifying a reference chromosome.
22. The kit of claim 20, wherein the kit comprises primers capable amplifying target nucleic acid sequences from chromosome 18, and primers capable of amplifying a reference chromosome.
23. The kit of claim 20, wherein the kit comprises primers capable amplifying target nucleic acid sequences from chromosome 21, and primers capable of amplifying a reference chromosome.
24. The kit of claim 20, wherein the kit comprises primers capable amplifying target nucleic acid sequences from chromosome 13, 18, and 21, and primers capable of amplifying a reference chromosome.
25. The kit of claim 20, further comprising a polymerase and buffer.
26. The kit of claim 21, further comprising a polymerase and buffer.
27. The kit of claim 22, further comprising a polymerase and buffer.
28. The kit of claim 23, further comprising a polymerase and buffer.
29. The kit of claim 24, further comprising a polymerase and buffer.
Description
FIGURE LEGENDS
[0022]
[0023] Dosage Quotients (DQ) of trisomic fetus when compared to euploid fetus. The grey shaded area indicates the expected percentages of fetal DNA.
[0024]
[0025] Number of SNPs needed to gent minimally a given number of informative SNPs, plotted per Minor Allele Frequency (MAF). The calculations are done for a minimal probability of 99%.
[0026]
[0027]
[0028]
[0029]
DETAILED DESCRIPTION OF THE INVENTION
[0030] The prior art has shown the feasibility of massive parallel sequencing as an analysis platform for free floating DNA based aneuploidy testing. However, current protocols result in expensive and low throughput tests when used as a molecular diagnostic tool. The main reason for this is the fact that current tests are based on genome wide sequencing of free floating DNA resulting in the production of huge sequencing datasets of which only a small fraction (5%) is used to determine the ploidy status of the fetus. With this genome wide approach it is obligatory to use a substantial part of the capacity of a massive parallel sequencer resulting in sequencing of a limited number of individuals per run, which takes several days to complete. Furthermore, huge sequencing datasets are generated per individual that hamper efficient data storage and analysis.
[0031] The present invention offers a solution for this problem by using a multiplex-PCR based approach to amplify a number of selected chromosomal regions. Selected chromosomal regions are amplified in a multiplex PCR reaction from one or more chromosomes which are presumed to be aneuploid and selected set of chromosomal regions are amplified, preferably in the same multiplex PCR reaction, from one or more chromosomes which are presumed to be euploid. Chromosomes which are presumed to be euploid are herein further designated as a reference chromosome.
[0032] Accordingly the present invention provides in a first embodiment a method for the detection of a fetal chromosomal aneuploidy in a pregnant female comprising i) receiving a biological sample from said pregnant female, ii) preparing nucleic acids from said biological sample, iii) amplifying a selected set of target DNA sequences in a quantitative multiplex PCR reaction wherein at least one amplified DNA sequence comprises at least one SNP which is considered informative if the pregnant female is heterozygous for this SNP, iv) sequencing of the amplified target DNA sequences and v) calculating the sum of read counts for all amplified DNA sequences of a suspected chromosomal aneuploidy followed by normalization, against the sum of read counts for all amplified DNA sequences of a reference chromosome to determine by statistical methods a set score indicative for the presence of a fetal chromosomal aneuploidy and/or determining the allelic ratios of the informative SNPs wherein a distorted allelic ratio is indicative for the presence of a fetal chromosomal aneuploidy in said pregnant female.
[0033] The term biological sample as used herein refers to any sample that is taken from a subject (e.g. such as a pregnant female or a pregnant woman) and contains one or more nucleic acid molecule(s) of interest.
[0034] Accordingly a biological sample comprises for example blood, sputum, urine, cerebrospinal fluid (CSF), tears, plasma, serum, saliva or transcervical lavage fluid.
[0035] The term nucleic acid or polynucleotide refers to a deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and a polymer thereof in either single- or double-stranded form. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues The term nucleic acid is used interchangeably with gene, cDNA, mRNA, small noncoding RNA, micro RNA (miRNA), Piwi-interacting RNA, and short hairpin RNA (shRNA) encoded by a gene or locus.
[0036] The term gene means the segment of DNA involved in producing a polypeptide chain. It may include regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons). The term reaction as used herein refers to any process involving a chemical, enzymatic, or physical action that is indicative of the presence or absence of a particular polynucleotide sequence of interest. An example of a reaction is an amplification reaction such as a polymerase chain reaction (PCR), preferably a multiplex PCR reaction. Another example of a reaction is a sequencing reaction, either by synthesis or by ligation. The term clinically relevant nucleic acid sequence as used herein can refer to a polynucleotide sequence corresponding to a segment of a larger genomic sequence whose potential imbalance is being tested or to the larger genomic sequence itself. Examples include chromosome 18, 13, 21, X and Y. Yet other examples include mutated genetic sequences or genetic polymorphisms or copy number variations that a fetus may inherit from one or both of its parents. The term background nucleic acid sequence as used herein may refer to nucleic acid sequences originating from the mother or originating from the chromosome not tested for aneuploidy in a particular analysis.
[0037] The term free-floating DNA is DNA which is derived from genomic DNA, free-floating DNA is in fact degraded genomic DNA and occurs in the extra-cellular space. As such free-floating DNA can be isolated from body fluids (e.g. serum, plasma, sputum). The term quantitative data as used herein means data that are obtained from one or more reactions and that provide one or more numerical values. The term parameter as used herein means a numerical value that characterizes a quantitative data set and/or a numerical relationship between quantitative data sets. For example, a ratio (or function of a ratio) between a first amount of a first nucleic acid sequence and a second amount of a second nucleic acid sequence is a parameter.
[0038] The term cutoff value as used herein means a numerical value whose value is used to arbitrate between two or more states (e.g. diseased and non-diseased) of classification for a biological sample. For example, if a parameter is greater than the cutoff value, a first classification of the quantitative data is made (e.g. diseased state); or if the parameter is less than the cutoff value, a different classification of the quantitative data is made (e.g. non-diseased state).
[0039] The term imbalance as used herein means any significant deviation as defined by at least one cutoff value in a quantity of the clinically relevant nucleic acid sequence from a reference quantity.
[0040] The term chromosomal aneuploidy as used herein means a variation in the quantitative amount of a chromosome from that of a diploid genome. The variation may be a gain or a loss. It may involve the whole of one chromosome or a region of a chromosome. Examples of chromosomal aneuploidies are derived from chromosome 13, 18, 21, X and Y.
[0041] The term random sequencing as used herein refers to sequencing whereby the nucleic acid fragments sequenced have not been specifically identified or targeted before the sequencing procedure. Sequence-specific primers to target specific gene loci are not required when random sequencing is applied. The pools of nucleic acids sequenced vary from sample to sample and even from analysis to analysis for the same sample. In random sequencing the identities of the sequenced nucleic acids are only revealed from the sequencing output generated in contrast to sequencing of multiplex-PCR amplified nucleotide sequences.
[0042] Embodiments of this invention provide methods, systems, and apparatus for determining whether an increase or decrease (diseased state) of a clinically-relevant chromosomal region exists compared to a non-diseased state. This determination may be done by using a parameter of an amount of a clinically-relevant chromosomal region in relation to other non-clinically-relevant chromosomal regions (background regions) within a biological sample. Nucleic acid molecules of the biological sample are sequenced, such that a fraction of the genome is sequenced, and the amount may be determined from results of the sequencing. One or more cutoff values are chosen for determining whether a change compared to a reference quantity exists (i.e. an imbalance), for example, with regards to the ratio of amounts of two chromosomal regions (or sets of regions).
[0043] The change detected in the reference quantity may be any deviation (upwards or downwards) in the relation of the clinically-relevant nucleic acid sequence to the other non-clinically-relevant sequences. Thus, the reference state may be any ratio or other quantity (e.g. other than a 1-1 correspondence), and a measured state signifying a change may be any ratio or other quantity that differs from the reference quantity as determined by the one or more cutoff values.
[0044] The clinically relevant chromosomal region (also called a clinically relevant nucleic acid sequence or suspected aneuploid chromosome or chromosomal region) and the background nucleic acid sequence may come from a first type of cells and from one or more second types of cells. For example, fetal nucleic acid sequences originating from fetal/placental cells are present in a biological sample, such as maternal plasma, which contains a background of maternal nucleic acid sequences originating from maternal cells. Preferentially, maternal and fetal nucleic acid sequences are derived from free-floating DNA. In one embodiment, the cutoff value is determined based at least in part on a percentage of the first type of cells in a biological sample. Note the percentage of fetal sequences in a sample may be determined by any fetal-derived loci and not limited to measuring the clinically-relevant nucleic acid sequences.
[0045] In another embodiment the methods of the invention use cell (e.g. blood cells) stabilizing chemicals in the preparation of the nucleic acids present in the biological sample which is received from the pregnant female. Indeed, one of the major technical challenges in using free-floating fetal DNA from maternal blood is the low fraction of fetal DNA present in the sample. This fraction is typically between 10 and 20% in the first trimester of pregnancy (week 11-14), which corresponds with the stage where an aneuploidy DNA test is best performed. This low fraction of fetal DNA is even for molecular counting methods challenging with respect to the sensitivity and specificity of the test. Therefore it is important to maximize the ratio fetal/maternal free floating DNA. The present invention provides different solutions for this problem.
[0046] In a particular embodiment the disruption of nucleated blood cells is prevented during the collection, storage or transport of the biological material, in particular a maternal blood sample prior to plasma isolation. This is important to prevent dilution of fetal DNA resulting in a decreased ratio fetal/maternal free floating DNA. Several commercial cell stabilizing blood collection tubes are available which stabilize blood cells for at least 14 days at room temperature allowing convenient sample collection, transport and storage (available for example at www.streck.com).
[0047] In yet another particular embodiment a size fractionation is used in the methods of the invention to prepare maternal and fetal nucleic acids.
[0048] Indeed, the prior art shows that fetal and maternal free-floating DNA have different size distributions. Free floating fetal DNA is generally 20 bp shorter than the maternal free floating DNA and this observation can be used to further enrich the free-floating fetal DNA fraction if this smaller sized fraction is specifically separated from the maternal fraction. One way to accomplish this is by means of gel electrophoresis. In a particular embodiment, a gel electrophoresis based size-fractionating device is used as marketed by Sage Science (www.sagescience.com). This device is a fully automated system enabling tight size selection and a high recovery rate. Furthermore, it eliminates the cross contamination risk completely since all samples are separated from each other during the whole size fractionation process.
[0049] In a particular embodiment the amplified DNA sequences obtained in the quantitative multiplex PCR reaction in the methods of the invention have a size between 80 and 140 base pairs.
[0050] In view of the size distributions of the fetal and maternal free floating DNA populations it is essential to keep the amplified DNA sequence lengths below 140 bp to ensure efficient amplification of the shorter fetal free-floating DNA fraction.
[0051] Preferred amplified DNA sequence lengths are between 80 and 140 basepairs.
[0052] In yet another embodiment the amplified DNA sequences obtained in one single multiplex PCR reaction are between 30 and 60.
[0053] In yet another embodiment the amplified DNA sequences obtained in one single multiplex PCR reaction are between 60 and 80.
[0054] In yet another embodiment the amplified DNA sequences obtained in one single multiplex PCR reaction are between 70 and 80.
[0055] Preferably only one quantitative multiplex PCR reaction is applied to practice the methods of the invention.
[0056] In yet another embodiment the GC-content of the target DNA sequences (i.e. the DNA sequences which are amplified with the quantitative multiplex PCR reaction) is between 30% and 70%. Our experimental data point out that a range of 40%-60% GC is optimal for a close to 100% sensitivity and specificity of the methods of the invention.
[0057] An essential step in the methods of the present invention is the sequencing of the amplified target DNA sequences. As a high number of sequencing reads, in the order of hundred thousand to millions or even possibly hundreds of millions or billions can theoretically be generated from each sample in each run, the resultant sequenced reads form a representative profile of the mix of nucleic acid species in the original biological sample. However, the person skilled in the art would know how many runs to perform based on the stage of pregnancy (which is correlated with the amount of free-floating fetal DNA in the biological sample) and based on the origin of the biological sample derived from a pregnant female. The most important aspect is that a high degree of statistical confidence is obtained. In order to improve statistical confidence, it is preferable to perform a large number of reads, preferably between 10.000 and 100.000 or more reads, depending on the percentage of fetal DNA present in the mixture. A commonly used measure of statistical significance when a highly significant result is desired is p<0.01, i.e. a 99% confidence interval based on a chi-square or t-test.
[0058] In a preferred embodiment massive parallel sequencing methods are used. In particular embodiments, the sequencing is done using massively parallel sequencing. Massively parallel sequencing, such as for example on the 454 platform (Roche) (Margulies, M. et al. 2005 Nature 437, 376-380), Illumina Genome Analyzer (or Solexa platform) or SOLID System (Applied Biosystems) or the Helicos True Single Molecule DNA sequencing technology (Harris T D et al. 2008 Science, 320, 106-109), the single molecule, real-time (SMRT) technology of Pacific Biosciences, and nanopore sequencing (Soni G V and Meller A. 2007 Clin Chem 53: 1996-2001), allow the sequencing of many nucleic acid molecules isolated from a specimen at high orders of multiplexing in a parallel fashion. Each of these platforms sequences clonally expanded or even non-amplified single molecules of nucleic acid fragments.
[0059] An important advantage of the limited set of amplified nucleotide sequences which is generated by the methods of the present invention is that emerging low cost and lower capacity massive parallel sequencers can be used such as the 454 junior (Roche), PGM (Life Technologies) or MiSeq (Illumine). The combination of the methods of the invention and the low end sequencers results in a fast turnaround time per test since these platforms typically take only a few hours per sequencing run. In addition, the lower cost is also an important improvement over the methods used in the prior art.
[0060] In a particular embodiment the massive parallel sequencing data are analyzed by calculating the sum of read counts for all amplified DNA sequences of a suspected chromosomal aneuploidy (e.g. all amplified DNA sequences derived from chromosome 21 and/or chromosome 13 and/or chromosome 18 and/or chromosome X and/or chromosome Y) are counted (i.e. the number of times a specific amplified chromosomal sequence is present in the biological sample). The sum of read counts for the amplified DNA sequences derived from a particular suspected aneuploid chromosome (e.g. chromosome 13 or 18 or 21 or X or Y) is then normalized against the sum of read counts for the amplified DNA sequences derived from a reference chromosome (i.e. a chromosome for which no aneuploidy is reported). Thus, the multiplex PCR allows the calculation of dosage quotients (DQs) by comparing (target region read count, i.e. the suspected aneuploidy chromosome or chromosomal region)/(control region read count, i.e. the reference chromosome or chromosomal region) ratios between the pregnant female and the fetus. The DQs in function of the percentage fetal DNA is depicted in
[0061] An essential element of the methods of the present invention is that the amplified target DNA sequences are reflecting identical ratios of the amounts of maternal and fetal free floating nucleic acids in the biological sample and hence the methods require quantitative amplification. Based on multiplex PCR assays and the PCR conditions used to amplify samples (limited number of cycles) we previously showed that template DNA is amplified quantitatively.sup.16. If there is a normal distribution between the two read counts then a score (e.g. a Z-score or a dosage quotient) is obtained. A Z-score of 1 means that there is no aneuploidy for the suspected aneuploidy chromosome. A Z-score higher than 1, preferentially higher than 2, more preferentially higher than 3, is an indication for the presence of an aneuploidy of the chromosome. It is understood that Z-scores are determined for all the suspected aneuploidy chromosomes for which a selected set of target DNA sequences are obtained by the methods of the invention. The normalization and the calculation of the Z-score is assisted by the use of statistical methods. Useful statistical methods which can be used in the context of the present invention include Bayesian-type likelihood method, sequential probability ratio testing (SPRT), false discovery, confidence interval and receiver operating characteristic (ROC).
[0062] In yet another particular embodiment the massive parallel sequencing data of the amplified target DNA sequences are analyzed based on the determination of the allelic ratios of the informative SNPs wherein a distorted ratio is indicative for the presence of a fetal chromosomal aneuploidy in the pregnant female. The allelic ratio is distorted for informative SNPs on aneuploid chromosomes. This distortion can be measured when the mother is heterozygous for a given SNP (referred herein as informative SNP). Therefore, sequence analysis of the MASTR assay will result in a number of informative SNPs that can be used to determine the fetal ploidy status on top of the fetal ploidy status determination by molecular counting as described above.
[0063] In yet another particular embodiment the massive parallel sequencing data of the amplified target DNA sequences are analyzed based on the determination of the allelic ratios of the informative SNPs wherein a distorted ratio is indicative for the presence of a fetal chromosomal aneuploidy in the pregnant female in combination with calculating the sum of read counts for all amplified DNA sequences of a suspected chromosomal aneuploidy (e.g. all amplified DNA sequences derived from chromosome 21 and/or chromosome 13 and/or chromosome 18 and/or chromosome X and/or chromosome Y) are counted (i.e. the number of times a specific amplified chromosomal sequence is present in the biological sample).
[0064] In yet another embodiment based on carrying out the methods of the invention a classification of whether a fetal chromosomal aneuploidy exists for one or more suspected aneuploid chromosomes determined. In one embodiment, the classification is a definitive yes or no. In yet another embodiment, a classification may be unclassifiable or uncertain. In yet another embodiment, the classification may be a score that is to be interpreted at a later date, for example, by a medical doctor.
[0065] In particular embodiments the bioinformatics, computational and statistical approaches used to determine if a biological sample obtained from a pregnant woman conceived with an aneuploid chromosome or chromosomal region or euploid fetus could be compiled into a computer program product used to determine parameters from the sequencing output. The operation of the computer program would involve the determining of a quantitative amount from the potentially aneuploid chromosome as well as amount(s) from one or more of the other chromosomes. A parameter would be determined and compared with appropriate cut-off values to determine if a fetal chromosomal aneuploidy exists for the potentially aneuploid chromosome.
[0066] In yet another embodiment the invention provides a diagnostic kit for carrying out the method of the invention. Such a diagnostic kit comprises at least a set of primers to amplify target maternal and target fetal nucleic acids wherein these target nucleic acids are derived from chromosome 13 and/or chromosome 18 and/or chromosome 21 and/or chromosome X and/or chromosome Y. Preferentially the kit comprises primers for amplifying target nucleic acids derived from chromosomes 13, 18, 21, X and Y. In addition, the diagnostic kit comprises a set of primers which are able to identify target DNA sequences of a reference chromosome or a reference chromosomal part. It is understood that such a reference chromosome or part thereof is an euploid chromosome. Euploid refers to the normal number of chromosomes. Other reagents which can optionally be included in the diagnostic kit are instructions and a polymerase and buffers to carry out the quantitative polymerase multiplex PCR reaction.
EXAMPLES
[0067] The following examples are offered to illustrate, but not to limit the claimed invention.
[0068] 1. Prenatal Diagnosis of Fetal Trisomy 21
[0069] The DNA samples used in the present examples are samples prepared by mixing a diploid DNA sample derived from a female (representing the maternal DNA) with either a male DNA sample sample euploid for chromosome 21 (referred to as artificial euploid pregnancy or AEP) or with a male DNA sample triploid for chromosome 21 (referred to as artificial trisomy pregnancy or ATP). Each artificial sample was comprised of a mixture of 80% maternal DNA and 20% of male DNA. In addition, included in the analysis was a DNA sample derived from a Down syndrome individual, having 3 copies of chromosome 21.
[0070] Measurements were performed on 4 AEP samples, 2 ATP samples and 1 Down syndrome DNA sample. For each measurement, approximately 50 ng of DNA was used in a standard 2-step MASTR assay PCR amplification procedure (see Materials and Methods). The fetal chromosome 21 MASTR assay is comprised of 20 primer pairs derived from chromosome 21 and 10 primer pairs derived from chromosome 18. The resulting amplicons from each MASTR amplified individual DNA sample contained a specific barcode. The resulting barcoded amplicons of each DNA sample were equimolarly mixed and subjected to the 454 junior emulsion PCR protocol as described by the manufacturer. After emulsion PCR, beads were isolated and loaded on a 454 junior according to the manufacturer's protocol. A total of two 454 junior runs were performed in order to obtain sufficient reads to reach a per amplicon coverage between 300 and 500.
[0071] Since the Down syndrome DNA sample contains 3 chromosome 21 copies, it should provide 50% more chromosome 21 reads then the AEP samples. To calculate this, the following calculation steps were performed on the Down sample and on the AEP samples: [0072] (i) Read counts for each chromosome 18 and 21 amplicon was divided by the total number of chromosome 18 derived read counts [0073] (ii) For each chromosome 18 and 21 amplicon, the average read count over the different AEP samples was calculated [0074] (iii) For each chromosome 18 and 21 amplicon, (i) was divided by (ii) [0075] (iv) For each chromosome and each sample, the average value of (iii) was calculated [0076] (v) The observed normalized ratio chromosome21/chromosome18 was calculated by dividing averages calculated under (iv) per AEP and ATP
[0077]
[0078] These data show that a clear distinction can be made between a normal, euploid DNA sample and a trisomy (i.e. Down syndrome), chromosome 21 DNA sample.
[0079] To evaluate the feasibility to distinguish between an euploid sample (represented by the AEP artificial samples) and an artificial chromosome 21 aneuploidy sample containing 20% chromosome 21 trisomy derived DNA, the above calculations were performed on the ATP samples relative to the AEP samples.
[0080] A presence of 20% of trisomy DNA in the ATP samples should result in a 10% increase in chromosome 21 amplicon read count compared to the AEP samples. Indeed using the above calculations,
[0081] Material and Methods
[0082] 1. Primer Sequences Used in the Examples
TABLE-US-00001 TABLE1 listof30primerpairscomposingthe chromosome21aneuploidydetectionMASTRassay Amplicon Chrom Forw Rev NITT_089 chr18 AAGACTCGGCAGCATCTCCATTTG GCGATCGTCACTGTTCTCCAGAGA GAGTTAGCTTGACTTTGG TGGTATTAGGAAGGTTTGGT NITT_092 chr18 AAGACTCGGCAGCATCTCCACACT GCGATCGTCACTGTTCTCCAGTGG TTCTCCTAACACCCTTGG GTGTCCTTAGGGGTCT NITT_096 chr18 AAGACTCGGCAGCATCTCCATCAG GCGATCGTCACTGTTCTCCACTCA CACTCCCTCCATGA AAGAAATGGAAGAGAATACAAAA NITT_097 chr18 AAGACTCGGCAGCATCTCCACCTG GCGATCGTCACTGTTCTCCAGGCA CATCTTGACACAGTCG TCCAGGAGGAGAAAA NITT_093 chr18 AAGACTCGGCAGCATCTCCAGGAT GCGATCGTCACTGTTCTCCAGAAG GGTCACAGTGGGTCA AGGGGAGAAGTAGAGGTTAAA NITT_085 chr18 AAGACTCGGCAGCATCTCCATAAG GCGATCGTCACTGTTCTCCAGAGG CAAACAGCAGCACAAAA GAATCTGTAATCCACATGA NITT_094 chr18 AAGACTCGGCAGCATCTCCACCAG GCGATCGTCACTGTTCTCCACTCC AGTGGAATTGCTGAGAC TTCTCTTTCTTCTTCTTCTAAGC NITT_084 chr18 AAGACTCGGCAGCATCTCCATGCA GCGATCGTCACTGTTCTCCATTAA GATGGAGGACATCGT ATTTGCTCTTGGTATACTTCTTG NITT_083 chr18 AAGACTCGGCAGCATCTCCATGGT GCGATCGTCACTGTTCTCCATCAC CCAGTTGGAGGGTCT AGATGACATGGAAAATAAGC NITT_091 chr18 AAGACTCGGCAGCATCTCCATAAA GCGATCGTCACTGTTCTCCACCCA AGTGCCTTTGAACTCTGACTA TGTGAAATCGCATAGTT NITT_050 chr21 AAGACTCGGCAGCATCTCCACATC GCGATCGTCACTGTTCTCCACAAC CAGGACCTACCATCTTG GCTGGCATTCAAAA NITT_010 chr21 AAGACTCGGCAGCATCTCCACCTT GCGATCGTCACTGTTCTCCAGTGT CTCACTCACCTCTTTCTTG GCAGAGGAGAGACATGA NITT_011 chr21 AAGACTCGGCAGCATCTCCATGTG GCGATCGTCACTGTTCTCCATATG TGTGTGTTCTCTACCTTGG AGTAGGTGTCTGGTGTATGAAAA NITT_047 chr21 AAGACTCGGCAGCATCTCCAGCAA GCGATCGTCACTGTTCTCCATCAG ATCTGGTACTGGGTATGA ATAGTATGGATAAAGGCAATGA NITT_006 chr21 AAGACTCGGCAGCATCTCCACAAT GCGATCGTCACTGTTCTCCACATT AATCAGACTTTGCCTTGG AAGGGTCTTAGGGTGGTAAA NITT_049 chr21 AAGACTCGGCAGCATCTCCATCCT GCGATCGTCACTGTTCTCCAGAAG GTTGGGGAAATTGG ATAGAGTTTCTCCTGCATCA NITT_017 chr21 AAGACTCGGCAGCATCTCCAGGAA GCGATCGTCACTGTTCTCCACAGC CAGGTGCACACATCA ACTGTCCAGCACTTG NITT_007 chr21 AAGACTCGGCAGCATCTCCACAGC GCGATCGTCACTGTTCTCCAGTCT TGTAACCTGCTGAGAAAA TAATTCTGCTCAGGAAAAGC NITT_009 chr21 AAGACTCGGCAGCATCTCCAGAAC GCGATCGTCACTGTTCTCCATTGA AGCATTCCTCCTCCTAGT ACCATAAATGTCAGCTCTTG NITT_070 chr21 AAGACTCGGCAGCATCTCCACCTC GCGATCGTCACTGTTCTCCATTCC ACATGTCTGTGCATTAAAA CTCTTCACATTCTGCTC NITT_071 chr21 AAGACTCGGCAGCATCTCCAGACA GCGATCGTCACTGTTCTCCACTCT CAACATCAGAGGCAATCT TCAAACAGAGAAAACTTAGATGA NITT_016 chr21 AAGACTCGGCAGCATCTCCATCAG GCGATCGTCACTGTTCTCCACAGA GGTAGAGAATCAGAATTGG GATCAACCGGAGAAGTAAA NITT_076 chr21 AAGACTCGGCAGCATCTCCACCAC GCGATCGTCACTGTTCTCCAGTTC GGATCCACTGCATA TCTGTAAGTGAAAGCATCCTAAA NITT_057 chr21 AAGACTCGGCAGCATCTCCATCTG GCGATCGTCACTGTTCTCCAGAGG GTCTAAATAAAGTCTTCACATCA TAGGAAATGCACCATCA NITT_020 chr21 AAGACTCGGCAGCATCTCCACAGA GCGATCGTCACTGTTCTCCAGAAA GGCCATGCCAGTAGT GTCTGGGAGGTTGAAGC NITT_039 chr21 AAGACTCGGCAGCATCTCCATGCC GCGATCGTCACTGTTCTCCACACA ATCAGAACCCGTAAA CAGAAGCACAGGAAAATC NITT_059 chr21 AAGACTCGGCAGCATCTCCACCTT GCGATCGTCACTGTTCTCCATAGT CTCTGCCTCCATTCTAGT GTCCGATAATGAAGAACAGTAAA NITT_053 chr21 AAGACTCGGCAGCATCTCCATGGC GCGATCGTCACTGTTCTCCACTGA TAAGCACATACCCTTAAA CACAAATGAAGGCAAAA NITT_044 chr21 AAGACTCGGCAGCATCTCCATCTC GCGATCGTCACTGTTCTCCAGAAC CATTCCTTCTGCTCTTAGT TCACTCTGGAAGCAATGA NITT_072 chr21 AAGACTCGGCAGCATCTCCAGAAA GCGATCGTCACTGTTCTCCAGAAC GCTGGGCGTATTGG ATTCTGAACATCTGGAATGA
[0083] 2. MASTR Assay Principle
[0084] Primerpairs were first tested in simplex PCR reactions on 20 ng of genomic DNA using 10 pmol per primer; the other parameters were equal to those of the multiplex PCR. The multiplex PCR reactions were performed on 50 ng genomic DNA in a 25-ml reaction containing Titanium Taq PCR buffer (Clontech, Palo Alto, Calif.) with a final concentration of 0.25 mM for each dNTP (Invitrogen, Carlsbad, Calif.) and a total of 0.125 ml of Titanium Taq DNA Polymerase (Clontech). Primer concentrations were optimized and varied between 0.05 pmol/ml and 0.2 pmol/ml final concentration.
[0085] The final multiplex assay (MASTR assay) was used to amplify all DNA samples. The first PCR reaction was performed on 50 ng of DNA with following settings: initial sample denaturation 10 min at 95 C. followed by 20 cycles each consisting of: 45 sec at 95 C., 45 sec at 60 C. and 2 min at 68 C. ending with a final extension step of 10 min of 72 C. (see
[0086] The resulting PCR fragments were 1000 times diluted followed by a second PCR step to incorporate the individual barcode. The PCR conditions of this step are identical to the conditions of the first PCR step (see
[0087] The resulting barcoded amplicons are equimolarly mix and used in an emulsion PCR reaction as described by the manufacturer (Roche diagnostics).
REFERENCES
[0088] .sup.1Lo Y, Corbetta N, Chamberlain P, Rai V, Sargent I, Redman C, and Wainscoat J (1997) Presence of fetal DNA in maternal plasma and serum. The Lancet 350: 485-487
[0089] .sup.2Poon L, Leung T, Lau T, Lo Y (2000) Presence of fetal RNA in maternal plasma. Clin Chem 46: 1832-1834
[0090] .sup.3Ng E, Tsui N, Lau T, Leung T, Chiu R, Panesar N, et al. (2003) mRNA of placental origin is readily detectable in maternal plasma. PNAS 100: 4748-4753
[0091] .sup.4Lo Y, Tsui N, Chiu R, Lau T, Leung T, Heung M, et al. (2007) Plasma placental RNA allelic ratio permits noninvasive prenatal chromosomal aneuploidy detection. Nat Med 13:218-23
[0092] .sup.5Tsui N,2, Wong B, Leung T, Lau T, Chiu R and Lo Y (2009) Non-invasive prenatal detection of fetal trisomy 18 by RNA-SNP allelic ratio analysis using maternal plasma SERPINB2 mRNA: a feasibility study. Prenat Diagn 29: 1031-1037
[0093] .sup.6Yang Y, Ding J, Lee M, Loria 0. Mohsenian F, Tang M, et al. (2008) Identification of mRNA-SNP markers for a noninvasive prenatal trisomy 21 (T21) test. Prenat Diagn 2008: 28-S12
[0094] .sup.7Chim S, Tong Y, Chiu R, Lau T, Leung T, Chan L, et al. (2005) Detection of the placental epigenetic signature of the maspin gene in maternal plasma. PNAS 102: 14753-14758
[0095] .sup.8Chan K, Ding C, Gerovassili A, Yeung S, Chiu R, Leung T et al. (2006) Hypermethylated RASSF1A in Maternal Plasma: A Universal Fetal DNA Marker that Improves the Reliability of Noninvasive Prenatal Diagnosis. Clin Chem 52: 2211-2218
[0096] .sup.9Lo D, Chan A, Sun H, Chen E, Jiang P, Lun F et al. (2010) Maternal Plasma DNA Sequencing Reveals the Genome-Wide Genetic and Mutational Profile of the Fetus. Sci Transl Med 2: 6
[0097] .sup.10Dhallan R, Guo X, Emche S, Damewood M, Bayliss P , Cronin M et al. (2007) A non-invasive test for prenatal diagnosis based on fetal DNA present in maternal blood: a preliminary study. Lancet 369: 474-481
[0098] .sup.11Lo D, Lun F, Chan A, Tsui Y, Chong C, Lau T, et al. (2007) Digital PCR for the molecular detection of fetal chromosomal aneuploidy. PNAS 104:13116-131121
[0099] .sup.12Ehrich M, Deciu C, Zwiefelhofer T; Tynan J, Cagasan L, Tim R et al. (2011) Noninvasive detection of fetal trisomy 21 by sequencing of DNA in maternal blood: a study in a clinical setting. Am J Obstet Gynecol 204:205.e1-11
[0100] .sup.13Sehnert A, Rhees B, Comstock D, de Feo E, Heilek G,1 Burke J and Raval P (2011) Optimal Detection of Fetal Chromosomal Abnormalities by Massively Parallel DNA Sequencing of Cell-Free Fetal DNA from Maternal Blood. Clin Chem 57: 1042-1047
[0101] .sup.14Chen E, Chiu R, Sun H, Akolekar R, Chan A, Leung T et al. (2011) Noninvasive Prenatal Diagnosis of Fetal Trisomy 18 and Trisomy 13 by Maternal Plasma DNA Sequencing. PLoS ONE 6: e21791
[0102] .sup.15Liao G, Lun F, Zheng Y, Chan A, Leung T, Lau T et al. (2011) Targeted Massively Parallel Sequencing of Maternal Plasma DNA Permits Efficient and Unbiased Detection of Fetal Alleles. Clin Chem 57: 92-101