SESAME CULTIVARS SUITABLE FOR MECHANICAL HARVEST WITH ENHANCED YIELD AND QUALITY
20180359981 ยท 2018-12-20
Assignee
Inventors
Cpc classification
International classification
Abstract
Provided are sesame plants having a mutation conferring closed capsules at maturity and means and methods for producing same. The plants of the present subject matter produce high yield of sesame seeds, the seeds having improved content of at least one of zinc, iron and calcium.
Claims
1.-39. (canceled)
40. A sesame crop plant having a genetic element comprising a quantitative trait locus (QTL) conferring indehiscence phenotype to the plant, the QTL corresponds to a segment of wild type Sesamum indicum linkage group (LG)-8 spanning from position 5,162,951 to 7,447,238 or part thereof wherein the QTL nucleic acid sequence comprises at least one mutation compared to the wild type LG-8.
41. The sesame crop plant of claim 40, wherein the QTL comprises at least one SNP selected from the group consisting of: T (Thymine) at position 5,176,856 on LG-8, T (Thymine) at position 5,207,071 on LG-8, A (Adenine) at position 5,164,512 on LG-8, G (Guanine) at position 5,107,812 on LG-8, A (Adenine) at position 5,448,993 on LG-8, and any combination thereof.
42. The sesame crop plant of claim 40, said plant having closed capsules when said plant reaches full maturity.
43. The sesame crop plant of claim 40, said plant comprising seeds having elevated content of at least one nutrient selected from the group consisting of zinc, iron, calcium, and any combination thereof compared to the nutrient content in seeds of a corresponding sesame crop plant lacking the QTL.
44. The sesame crop plant of claim 40, wherein the QTL comprises a nucleic acid sequence at least 90% homologous to a nucleic acid sequence located within position 5,162,951 and position 7,447,238 of wild type Sesamum indicum LG-8, said sequence comprises at least 80 nucleic acid residues.
45. The sesame crop plant of claim 44, wherein said nucleic acid sequence has at least one SNP.
46. The sesame crop plant of claim 45, wherein the QTL comprises the nucleic acid sequence set forth in SEQ ID NO:1.
47. The sesame crop plant of claim 40, said plant produces higher seed yield compared to a corresponding sesame crop plant lacking the QTL.
48. A seed of the sesame crop plant of claim 40.
49. A method for producing sesame plants having indehiscent capsules at maturity, the method comprising: introducing into at least one cell or part of a sesame plant characterized by dehiscent capsules a genetic element comprising a QTL corresponding to a segment of wild type Sesamum indicum LG8 spanning from position 5,162,951 to 7,447,238 or part thereof, wherein said QTL nucleic acid sequence comprises at least one mutation compared to the wild type LG-8; thereby producing a sesame plant characterized by indehiscent capsules at maturity.
50. The method of claim 49, wherein the QTL comprises at least one SNP selected from the group consisting of: T (Thymine) at position 5,176,856 on LG-8, T (Thymine) at position 5,207,071 on LG-8, A (Adenine) at position 5,164,512 on LG-8, G (Guanine) at position 5,107,812 on LG-8, A (Adenine) at position 5,448,993 on LG-8, and any combination thereof.
51. The method of claim 49, wherein the genetic element is introduced by a method selected from the group consisting of introgression and transformation.
52. A plant produced by the method of claim 49, said plant comprises the QTL.
53. The plant of claim 52, said plant comprises seeds having elevated content of at least one nutrient selected from the group consisting of zinc, iron and calcium compared to the nutrient content in seeds of a corresponding sesame crop plant lacking the QTL.
54. An isolated polynucleotide comprising a nucleic acid sequence conferring indehiscent phenotype to a sesame plant, wherein the nucleic acid sequence is at least 90% homologous to a nucleic acid sequence located within position 5,162,951 and position 7,447,238 of wild type Sesamum indicum LG-8, said sequence comprises at least 80 nucleic acid residues.
55. The isolate polynucleotide of claim 54, said nucleic acid having T (Thymine) at a position that corresponds to position 5,176,856 of LG-8.
56. The isolated polynucleotide of claim 55, said isolated polynucleotide comprises the nucleic acid sequence set forth in SEQ ID NO:1.
57. A method for identifying sesame plants having an indehiscent phenotype, comprising detecting a QTL corresponding to LG-8 of Sesamum indicum comprising at least one SNP selected from the group consisting of: T (Thymine) at position 5,176,856 on LG-8, T (Thymine) at position 5,207,071 on LG-8, A (Adenine) at position 5,164,512 on LG-8, G (Guanine) at position 5,107,812 on LG-8, A (Adenine) at position 5,448,993 on LG-8, and any combination thereof, or having a genetic linkage to said SNP genomic localization in an isolated genetic material obtained from the plant.
58. The method of claim 57, wherein detecting the QTL comprises detecting a polynucleotide having the nucleic acid sequence set forth in SEQ ID NO:1.
59. The method of claim 58, wherein the polynucleotide having the nucleic acid sequence set forth in SEQ ID NO:1 is detected by a pair of primers having the nucleic acid sequence set forth in SEQ ID NO:6 and SEQ ID NO:7.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
DETAILED DESCRIPTION OF THE INVENTION
[0046] The present invention discloses for the first time a QTL corresponding to linkage group 8 of Sesamum indicum. The QTL comprises a genetic linkage to a single nucleotide polymorphism (SNP) T (tyrosine) instead of C (Cytosine), and is associated with the phenotype of closed (indehiscent) fully ripen capsules. The seeds within the indehiscent capsules comprise elevated seed concentration of zinc, iron and calcium. The present invention thus provides sesame plants comprising the QTL characterized by indehiscent capsules and methods of producing same. The present invention further provides isolated polynucleotides comprising the QTL or parts thereof useful in identifying indehiscent sesame plants. Advantageously, the sesame seeds remain in the sesame capsules even after the plant dries, which allows for a mechanical harvesting by a combine with a minimal loss of yield. Then, the combine can open the capsule and release the seeds as it is harvested. In addition, the sesame plant holds its seeds in capsules for four or more weeks after fully ripening, enabling flexibility in harvesting time.
Definitions
[0047] The term plant is used herein in its broadest sense. It also refers to a plurality of plant cells that are largely differentiated into a structure that is present at any stage of a plant's development. Such structures include, but are not limited to, a root, stem, shoot, leaf, flower, petal, fruit, etc. According to certain exemplary embodiments, the sesame plants of the present invention are hardy cultivars grown for commercial production of sesame seeds.
[0048] As used herein, the term plant part typically refers to a part of the sesame plant, including single cells and cell tissues such as plant cells that are intact in plants, cell clumps and tissue cultures from which sesame plants can be regenerated. Examples of plant parts include, but are not limited to, single cells and tissues from pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits (capsules), stems, shoots, and seeds; as well as pollen, ovules, leaves, embryos, roots, root tips, anthers, flowers, fruits, stems, shoots, scions, rootstocks, seeds, protoplasts, calli, and the like.
[0049] The terms dehiscence or its adjective dehiscent as used herein with reference to a sesame plant or a sesame capsule (fruit) refer to a plant characterized by capsules or to the capsules per se that are visibly open when fully ripen (matured). The terms indehiscence or its adjective indehiscent as used herein with reference to a sesame plant or a sesame capsule (fruit) refer to a plant characterized by capsules or to the capsules per se that are visibly closed when fully ripen (matured). Without wishing to be bound by any specific theory or mechanism of action, the indehiscence phenotype is associated with increased number of cell layers between the median vascular bundle and the pericarp and the small numbers of cells with thin walls at this area. As a result, the tension force applied on the endocarp by the shrinking mesocarp upon dryness does not result in the rupture of the capsule wall.
[0050] The term locus (plural loci) is defined herein as the position that a given gene occupies on a chromosome or a linkage group of a given species.
[0051] As used herein, the term linkage group refers to all of the genes or genetic traits that are located on the same chromosome. Within the linkage group, those loci that are close enough together will exhibit linkage in genetic crosses. Since the probability of crossover increases with the physical distance between genes on a chromosome, genes whose locations are far removed from each other within a linkage group may not exhibit any detectable linkage in direct genetic tests. The term linkage group is mostly used to refer to genetic loci that exhibit linked behavior in genetic systems where chromosomal assignments have not yet been made. Thus, in the present context, the term linkage group is synonymous to (the physical entity of) chromosome.
[0052] The term QTL (Quantitative Trait Loci) is used herein in its art-recognized meaning. The term QTL corresponding to sesame LG-8 that comprises or has a genetic linkage to an SNP selected from the group consisting of: T (Thymine) at position 5,176,856 on LG-8, T (Thymine) at position 5,207,071 on LG-8, A (Adenine) at position 5,164,512 on LG-8, G (Guanine) at position 5,107,812 on LG-8, A (Adenine) at position 5,448,993 on LG-8, and any combination thereof. The QTL according to the invention comprises at least one mutation. The term QTL conferring indehiscent phenotype refers to a region located on a particular linkage group of Sesamum indicum as described herein that may be associated with at least one gene that encodes for the indehiscent characteristics of the plant and/or for a regulatory region, i.e. a region of a chromosome that controls the expression of one or more genes involved in indehiscence. The phenotypic expression of that putative gene and/or regulatory region is typically closed capsules of a sesame plant standing in the field and ready for harvest. A QTL may for instance comprise one or more genes the products of which confer the indehiscence phenotype. Additionally or alternatively, a QTL may for instance comprise regulatory genes or sequences the products of which influence the expression of genes on other loci in the genome of the plant thereby conferring the indehiscence phenotype. The QTL of the present invention may be defined by indicating its genetic location in the genome of the respective Sesamum indicum accession using one or more markers. According to some embodiments, The QTL of the present invention is defined by the presence of T (Thymine) at position 5,176,856.
[0053] The term homozygous as is used herein means a genetic condition existing when identical alleles reside at corresponding loci on homologous chromosomes.
[0054] As used herein, the term inbred means a substantially homozygous individual plant or plant line.
[0055] The terms introgression, introgressed and introgressing refer to the transmission of a desired allele(s) of a gene or trait locus from a genetic background of one species, variety or cultivar into the genome of another species, variety or cultivar. In one method, the desired allele(s) can be introgressed through a sexual cross between two parents, wherein one of the parents has the desired allele in its genome. The desired allele can include desired gene or genes, a marker locus, a QTL or the like.
[0056] The term genetic element is used in its broadest sense and includes a series of two or more nucleotides. The genetic element of the present invention comprises a mutated quantitative trait locus as described herein.
[0057] The terms corresponding or corresponds are used herein to describe the correlation between the QTL and a sequence such as Sesamum indicum linkage group (LG)-8, and refer to a position or region within a polynucleotide sequence that is identified by comparison to a reference sequence. The reference sequence is a wild-type form of the Sesamum indicum linkage group (LG)-8 sequence. In other words, the QTL sequence is identical to a sequence spanning from position 5,162,951 to 7,447,238 or part thereof of LG-8 except for at least one mutation. The mutation within the QTL may be, without limiting, a SNP, a deletion, or an insertion.
[0058] According to certain embodiments, the QTL sequence comprises at least 100 contiguous nucleic acids identical to the wild type Sesamum indicum linkage group (LG)-8 except of the at least one mutation.
[0059] As used herein, the term population refers to a genetically heterogeneous collection of plants sharing a common genetic derivation.
[0060] According to one aspect, the present invention provides a sesame crop plant homozygous for a genetic element comprising a quantitative trait locus (QTL) comprising a single nucleotide polymorphism (SNP), wherein the QTL is derived from Sesamum indicum linkage group (LG)-8 and wherein the QTL confers indehiscence phenotype to the plant.
[0061] According to some embodiments, the SNPs are ad described above. According to certain embodiments, the SNP is T (Thymine) at position 5,176,856 on LG-8.
[0062] According to certain embodiments, the QTL comprises a nucleic acid sequence homologous to Sesamum indicum LG-8 sequence from position 5,162,951 to position 7,447,238. According to other embodiments, the QTL comprises a nucleic acid sequence homologous to sesame LG-8 sequence from position 5,162,951 to position 5,515,472. According to some embodiments, said nucleic acid sequence has at least one SNP. According to certain exemplary embodiments, the SNP is T (Thymine) at position 5,176,856 on LG-8.
[0063] The term homologous as used herein denotes a characteristic of a nucleic acid sequence, wherein a nucleic acid sequence has at least about 85 percent sequence identity as compared to a reference sequence, typically at least about 90 percent sequence identity, or at least about 95 percent sequence identity as compared to a reference sequence. The reference sequence may be a subset of a larger sequence, such as a portion of a chromosome, typically at least about 50 to 100 nucleotides long.
[0064] According to an additional aspect, the present invention provides a sesame crop plant having a genetic element comprising a quantitative trait locus (QTL), said QTL maps to a position between position 5,107,812 and position 5,448,993 on LG-8, said QTL nucleic acid sequence comprises at least one mutation and wherein said QTL confers indehiscence phenotype to the plant.
[0065] According to an additional aspect, the present invention provides a sesame crop plant comprising a genetic element comprising a quantitative trait locus (QTL), said QTL comprises genetic linkage to at least one SNP or its genomic localization, said SNP is selected from the group consisting of: T (Thymine) at position 5,176,856 on LG-8, T (Thymine) at position 5,207,071 on LG-8, A (Adenine) at position 5,164,512 on LG-8, G (Guanine) at position 5,107,812 on LG-8, A (Adenine) at position 5,448,993 on LG-8, and any combination thereof.
[0066] According to certain exemplary embodiments, the QTL comprises the nucleic acid sequence set forth in SEQ ID NO:2. According to these embodiments, identifying sesame plants having indehiscent phenotype is performed by identifying SEQ ID NO:2 in the sesame plant. According to some embodiment, SEQ ID NO:2 is identified using a pair of amplification primers. According to certain exemplary embodiments, the pair of amplification primers comprises the nucleic acid sequence set forth in SEQ ID NO:8 (CAGTAACCGCCCTTTGTGA) and SEQ ID NO:9 (CAAATGCGATTAAAAGTGAAACA).
[0067] According to certain exemplary embodiments, the QTL comprises the nucleic acid sequence set forth in SEQ ID NO:3. According to these embodiments, identifying sesame plants having indehiscent phenotype is performed by identifying SEQ ID NO:3 in the sesame plant. According to some embodiment, SEQ ID NO:3 is identified using a pair of amplification primers. According to certain exemplary embodiments, the pair of amplification primers comprises the nucleic acid sequence set forth in SEQ ID NO:10 (AGGGAGCGTTCTTCGGATA) and SEQ ID NO:11 (CGCCTCATTAGAGGGCAGT).
[0068] According to certain exemplary embodiments, the QTL comprises the nucleic acid sequence set forth in SEQ ID NO:4. According to these embodiments, identifying sesame plants having indehiscent phenotype is performed by identifying SEQ ID NO:4 in the sesame plant. According to some embodiment, SEQ ID NO:4 is identified using a pair of amplification primers. According to certain exemplary embodiments, the pair of amplification primers comprises the nucleic acid sequence set forth in SEQ ID NO:12 (GGTCCGAGAGAGCTGTTTTC) and SEQ ID NO:13 (ATCACAACTCGACCTGCTTG).
[0069] According to certain exemplary embodiments, the QTL comprises the nucleic acid sequence set forth in SEQ ID NO:5. According to these embodiments, identifying sesame plants having indehiscent phenotype is performed by identifying SEQ ID NO:5 in the sesame plant. According to some embodiment, SEQ ID NO:5 is identified using a pair of amplification primers. According to certain exemplary embodiments, the pair of amplification primers comprises the nucleic acid sequence set forth in SEQ ID NO:14 (GCAGCCAGGGTGGCTTAT) and SEQ ID NO:15 (GCACTAGCCGATATGTGCTTT).
[0070] The present invention discloses for the first time a genetic configuration resulting in indehiscence phenotype of a sesame plant. Plants comprising such configuration produce capsules that are kept closed when the plant reach maturity and dries; produce seeds with elevated amounts of significant nutrients including iron, zinc and/or calcium; and produce high seed yield.
[0071] The genetic unit QTL indicates a region on the genome that is directly related to a phenotypic quantifiable trait, the indehiscent phenotype according to the present invention. The QTL of the present invention has been first observed in F.sub.2 population of a cross between a dehiscent line (S-297) and the mutated indehiscent line (S-91) produced by the inventors. The QTL was found to be associated with at least one marker, an SNP of T (Thymine) at position 5,176,856 of LG-8 instead of C (cytosine). The QTL of the invention may include one or more genes, which may or may not be related to the indehiscent phenotype.
[0072] As described in the Example section hereinbelow, an efficient High Resolution Melt (HRM) marker was developed based on the identified SNP detected on LG-8. Amplification of a QTL fragment comprising the SNP was performed using the primers having the nucleic acids sequences set forth in SEQ ID NO:2 (forward) and SEQ ID NO:3 (reverse). The resulted amplicon contained 84 nucleic acids. The mutated amplicon comprising the SNP consists of SEQ ID NO: 1. The marker was tested by HRM on the parental lines as well as on F.sub.1 and F.sub.2 progenies in order to test its efficiency (
[0073] The present invention further provides a method for identifying sesame plants having indehiscent phenotype, comprising detecting a mutated QTL corresponding to LG-8 of Sesamum indicum comprising SNP of T (Thymine) at position 5,176,856 in an isolated genetic material obtained from the plant. It is to be explicitly understood that the SNP marker identified in the present invention is an example of markers suitable for use in marker assisted selection (MAS) procedures. Additional markers associated with the QTL conferring indehiscence phenotype, as such markers may exist, are also encompassed within the scope of the present invention.
[0074] The present invention further provides a method for producing sesame plant characterized by indehiscent capsules at maturity, the method comprises introducing into at least one cell or part thereof of a sesame plant characterized by dehiscent capsule a genetic element comprising a QTL derived from LG-8 of Sesamum indicum plant characterized by indehiscent capsule, the QTL comprises an SNP of T (Thymine) at position 5,176,856, thereby producing a sesame plant characterized by indehiscent capsules at maturity.
[0075] Introducing the genetic element comprising the QTL conferring indehiscent phenotype according to the teachings of the present invention can be performed by any method as is known to a person skilled in the art. It is to be explicitly understood that in the sesame plant produced, the segment comprising the QTL is not in its natural background. As used herein, the term natural genetic background indicates the original genetic background of a QTL. Such a background is the genome of the mutated Sesamum indicum produced as described herein. Accordingly, S. indicum line S-91 represents the natural genetic background of the QTL of the invention. A method involving the transfer of DNA comprising the QTL from linkage group 8 of S. indicum to the same or different position on the corresponding linkage group of another S. indicum lines will result in that the QTL or part thereof not being in its natural genetic background.
[0076] Alternatively, nucleic acid (preferably DNA) sequence comprising the QTL of the present invention or any part thereof that can confer indehiscence phenotype as disclosed herein may be used for the production of indehiscent sesame plants. According to certain embodiments, the QTL is introduced into dehiscent sesame plant, typically a cultivar suitable for commercial growth. According to the teachings of the present invention, said nucleic acid sequence is derived from mutated S. indicum donor plant.
[0077] The QTL conferring indehiscence phenotype can be isolated from the donor plant by using any method as is known in the art.
[0078] The QTL sequence may be transferred to a recipient sesame plant by any method as is known to a person skilled in the art. According to certain embodiments, the QTL can be introduced by crossing the donor with a recipient dehiscent sesame plant (i.e. by introgression). Alternatively, isolated nucleic acid sequence comprising the QTL can be introduced by transformation as described hereinbelow. Transformation is optionally followed by selection of offspring plants comprising the QTL and exhibiting indehiscence phenotype.
[0079] Transforming plants with isolated nucleic acid sequence generally involves the construction of an expression vector that will function in plant cells. According to the teachings of the present invention, such a vector comprises the QTL of the invention or part thereof. Typically, the vector comprises the QTL under control of or operatively linked to a regulatory element. According to certain embodiments, the regulatory element is selected from the group consisting of a promoter, enhancer, a translation termination sequence, and any combinations thereof. The vector(s) may be in the form of a plasmid, and can be used, alone or in combination with other plasmids, in a method for producing transgenic indehiscent sesame plants.
[0080] Expression vectors can include at least one marker (reporter) gene, operably linked to a regulatory element (such as a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (by inhibiting the growth of cells that do not contain the selectable marker gene), or by positive selection (by screening for the product encoded by the markers gene). Many commonly used selectable marker genes for plant transformation are known in the art, and include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or an herbicide, or genes that encode an altered target which is insensitive to the inhibitor. Several positive selection methods are known in the art, such as mannose selection. Alternatively, the presence of the QTL in the transformed plant is identified using the marker of the present invention.
[0081] Methods for transforming a plant cell with nucleic acids sequences according to the present invention are known in the art. As used herein the term transformation or transforming describes a process by which a foreign nucleic acid sequence, such as a vector, enters and changes a recipient cell into a transformed, genetically modified or transgenic cell. Transformation may be stable, wherein the nucleic acid sequence is integrated into the plant genome and as such represents a stable and inherited trait, or transient, wherein the nucleic acid sequence is expressed by the cell transformed but is not integrated into the genome, and as such represents a transient trait. According to typical embodiments the nucleic acid sequence of the present invention is stably transformed into a plant cell.
[0082] The following examples are presented in order to more fully illustrate some embodiments of the invention. They should, in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
EXAMPLES
Materials and Methods
Phenotypic Measurements
[0083] Phenotyping the trait for capsule dehiscence was conducted at the end of plants growth, when the plant had dried and reached full physiological maturity. Each plant from the F.sub.2 population and both of the parental lines were marked as open or closed capsule.
Micronutrients Analysis
[0084] Sesame seeds were grind in a coffee grinder for 5-10 sec each. A batch of each sample (about 250 mg of dry material) was digested in 8 ml of 65% HNO.sub.3 and 2 ml of 30% H.sub.2O.sub.2. Internal standard Yttrium (Y) was used to control digestion process quality and possible matrix effects. Digestion was carried out in Teflon vessels using a Milestone Ethos 1 microwave-digestion-system at high temperature and pressure. During 20 min the temperature inside the vessel was increased linearly to 180 C. using 900W energy, then the temperature was maintained during next 15 min at 180 C. Vessels were cooled down and the volume was made up to 25 ml with deionized water. Micronutrient concentration was measured in the clear solutions using a radial ICP-OES model ARCOS from Spectro GMBH, Germany, equipped with cross-flow nebulizer and Scott spray chamber. Measurements were calibrated with standards for ICP from Merck. Element concentrations that exceed the linear dynamic range were diluted and reanalysed. Dilution was made using calibrated pipettes. The continuing calibration verification standard was measured at least every 10 samples to check the instrument stability.
Example 1
Development of an Indehiscent Sesame Line
[0085] Sesame plants characterized by closed capsules at maturity were developed by mutagenesis of sesame seeds. Seeds from a collection of dehiscent sesame plants were used. Follow calibration, the sesame seeds were soaked in ddH.sub.2O for 4 hours, and then treated with 1% of Ethyl methanesulfonate (EMS) for 24 hours at room temperature (24 C.). After treatment, the seeds were washed for 4 hours under running water. The washed seeds were sown in planting trays with clay and grown until four leaves stage (14-20 days) and then transplanted into the field (M.sub.0 plants).
[0086] The seeds produced by the M.sub.0 plants (M.sub.1 generation) were collected and after cleaning they were sown in the field to get M.sub.2 seeds. M.sub.2 seeds were sown in the field and the resulting plants were characterized for indehiscence capsule phenotype. Characterization was made by visible differentiation between open capsules (
[0087] The obtained M.sub.2 plant was backcrossed with the parental line for three generations to get homozygote line. The homozygous line, designated S-91, was used for the production of the mapping population.
Example 2
Production of Mapping Population
[0088] An indehiscent line (S-91) was crossed with dehiscent line (S-297) and the F.sub.1 progeny was selfed to produce an F.sub.2 mapping population of 148 lines. This population, alongside with the two parental lines was grown in insect proof net-house (
[0089] Microscopy characterization of the dehiscence zone was performed for the indehiscent line (S-91), the dehiscent line (S-297) and for a representative F.sub.2 indehiscent line.
Example 3
OTL Analysis
[0090] The mapping population was genotyped using genotype-by-sequencing (GBS), performed by Energin R Technologies 2009 LTD. (NRGene, http://nrgene.com). A high-density genetic map was constructed (including about 20,000 SNPs). QTLs analysis was conducted on the F2 population and revealed the genetic location of the indehiscence and seed nutrient traits (Table 1). An SNP at position 5,176,856 was identified, with the dehiscent plants comprising C (Cytosine) at this location and the indehiscent plant comprising T (Thymine) at this location. Based on the identified SNP detected on LG-8, an efficient High Resolution Melt (HRM) marker was developed (
TABLE-US-00001 TABLE 1 Major QTLs detected on LG-8 for the indehiscence trait (qualitative: open vs. close) and seed nutrient (iron, zinc and calcium) concentration. LG LG Peak Peak LOD Trait name starts ends start ends P-value R.sup.2 score Capsule 5,162,951 5,515,472 5,162,951 5,515,472 0 1 Inf. dehiscence Seed Calcium 4,497,023 7,823,496 5,162,951 6,306,717 2.07E08 0.214 7.84 Seed Iron 4,374,000 9,570,814 5,162,951 7,447,238 1.65E08 0.216 7.94 Seed Zinc 4,374,000 7,667,265 5,162,951 7,125,811 3.04E20 0.457 19.92
Example 4
Seed Nutrient Concentration
[0091] Micronutrient analysis was performed in seeds of the indehiscent line developed in the present invention (S-91) and of the dehiscent line (S-297) as described in Material and Methods hereinabove. Table 2 present elevated amounts of all nutrients examined in seeds produced by indehiscent plants comprising the SNP marker. A significant increase in the amount of zinc (55%), iron (30%) and calcium (12%) was found (Table 2). This result is of high significance, as food sources of zinc and iron are highly desired.
TABLE-US-00002 TABLE 2 Concentration of calcium, iron and zinc in seeds of S-91 and S-297. Seed nutrient concentrations (mg/kg) Genotype Calcium Iron Zinc S-91 12193.324* 108.561* 92.912* S-297 10386.674 82.978 60.083 *Indicate significant differences between the two sesame genotypes (student-t test) at P 0.05.
Example 5
Plant Material Tested With HUSi001 HRM Marker
[0092] In order to test HUSi001 marker efficiency in differentiating between dehiscence and non-dehiscence capsules under different genetic backgrounds, non-dehiscent line S-91 were crossed with 28 dehiscent lines from the Hebrew University collection (S-4, S-8, S-10, S-34, S-37, S-43, S-46, S-47, S-53, S-59, S-64, S-65, S-67, S-79, S-80, S-92, S-100, S-110, S-274, S-278, S-289, S-301, S-308 S-313, S-315, S-316, S-326, S-1038). The F1 hybrids were grown in a net-house and seeds were collected from each F1 plants. F.sub.2 seeds were sown in the field (10 seeds from each cross) and characterized for capsule morphology. Young leaves from 5-8 plants of each cross were collected (108 samples in total) and used for DNA extraction. All samples were analyzed in HRM with HUSi001 marker and resulted in 100% ability of the HUSi001 to differentiate between dehiscence and non-dehiscence capsule.
[0093] Additionally, HUSi001 marker was used for backcross screening. Two indehiscent F.sub.2 were chosen from 3 different families: plants #55 and #149 from S-91S-297, #53 and #166 from S-91S-65, and #57 and #92 from S-8S-91. The plants were correspondingly backcrossed with the dehiscent parent (i.e. S-297, S-65 or S-8) in order to create near isogenic lines (NILs). Each backcross generation was scanned with HUSi001 marker to ensure successful fertilization; 66 BC.sub.1F.sub.1, 23 BC.sub.2F.sub.1, 78 BC.sub.2F.sub.2, and 174 BC.sub.3F.sub.1 plants were scanned.
Example 6
Plant Material Tested With Different Markers
[0094] HUSi002, HUSi003, HUSi004, and HUSi005 Markers were found to be efficient in differentiating between dehiscence and non-dehiscence capsules. A representative High Resolution Melt (HRM) graphs of indehiscent line (S-91) and dehiscent line (S-297) are shown in
[0095] The foregoing description of the specific embodiments will so fully reveal the general nature of the invention that others can, by applying current knowledge, readily modify and/or adapt for various applications such specific embodiments without undue experimentation and without departing from the generic concept, and, therefore, such adaptations and modifications should and are intended to be comprehended within the meaning and range of equivalents of the disclosed embodiments. It is to be understood that the phraseology or terminology employed herein is for the purpose of description and not of limitation. The means, materials, and steps for carrying out various disclosed functions may take a variety of alternative forms without departing from the invention.