H9 avian influenza vaccine strain which differentiates infected from vaccinated animals, and preparation method therefor

Abstract

Provided is an application of a label gene sequence in the preparation of an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination, the label gene sequence containing a DNA sequence for coding an influenza B virus NA protein extracellular region amino acid sequence. Also provided are an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination, a preparation method therefor, and an application.

Claims

1. A preparation method of an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination, comprising the following steps: the label gene sequence is rescued with an HA gene of H9 avian influenza viruses over a reverse genetic system to obtain a recombinant vaccine strain, that is an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination; the label gene sequence containing a DNA sequence for coding an influenza B virus NA protein extracellular region amino acid sequence, or containing a DNA sequence for coding an amino acid sequence having at least 90% identity, or at least 92% identity, or at least 95% identity, or at least 98% identity with the extracellular region amino acid sequence; alternatively, the label gene sequence containing a DNA sequence for coding an extracellular region amino acid sequence in influenza B virus NA gene, or containing a sequence having at least 90% identity, or at least 92% identity, or at least 95% identity, or at least 98% identity with the DNA sequence; alternatively, the label gene sequence is a DNA sequence for coding influenza B virus NA protein, or a DNA sequence for coding an amino acid sequence having at least 90% identity, or at least 92% identity, or at least 95% identity, or at least 98% identity with the NA protein amino acid sequence; alternatively, the label gene sequence is a DNA sequence of influenza B virus NA gene, or a sequence having at least 90% identity, or at least 92% identity, or at least 95% identity, or at least 98% identity with the DNA sequence; wherein the label gene sequence further contains packaging signal sequences at its both ends; the 5′-end packaging signal sequence of the label gene sequence is SEQ ID NO: 3, or a sequence having at least 80% identity, or at least 85% identity, or at least 90% identity, or at least 95% identity with SEQ ID NO: 3; the 3′-end packaging signal sequence of the label gene sequence is SEQ ID NO: 4, or a sequence having at least 80% identity, or at least 85% identity, or at least 90% identity, or at least 95% identity with SEQ ID NO: 4.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is the structure schematic diagram of artificially synthesized A/B chimeric NA gene;

(2) FIG. 2 is the pFLu vector map and the clone schematic diagram of influenza virus gene segments;

(3) FIG. 3 shows the changes of HI antibody titers after vaccination with Re-H9-DIVA-J2 inactivated vaccine on 3-week-old chicken.

(4) FIG. 4 is detecting the reactivity of anti-Re-H9-DIVA-J2 (artificially synthesized chimeric NA gene) serum with influenza A NA protein by immunofluorescence.

DESCRIPTION OF THE EMBODIMENTS

(5) An application of a label gene sequence in the preparation of an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination, the label gene sequence containing a DNA sequence for coding an influenza B virus NA protein extracellular region amino acid sequence, or containing a DNA sequence for coding an amino acid sequence having at least 90% homology, or at least 92% homology, or at least 95% homology, or at least 98% homology with the extracellular region amino acid sequence.

(6) An application of a label gene sequence in the preparation of an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination, the label gene sequence containing a DNA sequence for coding the extracellular region amino acid sequence in influenza B virus NA gene, or containing a sequence having at least 90% homology, or at least 92% homology, or at least 95% homology, or at least 98% homology with the DNA sequence.

(7) An application of a label gene sequence in the preparation of an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination, the label gene sequence is a DNA sequence for coding influenza B virus NA protein, or a DNA sequence for coding an amino acid sequence having at least 90% homology, or at least 92% homology, or at least 95% homology, or at least 98% homology with the NA protein amino acid sequence.

(8) An application of a label gene sequence in the preparation of an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination, the label gene sequence is a DNA sequence of influenza B virus NA gene, or a sequence having at least 90% homology, or at least 92% homology, or at least 95% homology, or at least 98% homology with the DNA sequence.

(9) Preferably, the H9 avian influenza vaccine strain contains an H9 subtype HA gene.

(10) Preferably, the amino acid sequence encoded by the H9 subtype HA gene is as shown in SEQ ID NO: 2.

(11) Preferably, the DNA sequence of HA gene is as shown in SEQ ID NO: 1.

(12) Preferably, the influenza B virus includes influenza B viruses of Victoria group and Yamagata group.

(13) Preferably, the influenza B virus specifically includes, but not limited to, virus strains B/Massachusetts/2/2012, B/Brisbane/60/2008, B/Yamagata/16/1988, B/Malaysia/2506/04.

(14) Preferably, the label gene sequence further contains packaging signal sequences at its both ends.

(15) Preferably, the packaging signal is a packaging signal of H1 subtype NA, or a packaging signal sequence having at least 80% homology, or at least 85% homology, or at least 90% homology, or at least 95% homology with the packaging signal of H1 subtype NA.

(16) Preferably, the 5′-end packaging signal sequence of the label gene sequence includes the noncoding region sequence, the intracellular region sequence, and the transmembrane region sequence.

(17) Preferably, the intracellular region sequence encodes 5-7 amino acids, with the amino acid sequences within the cell.

(18) Preferably, the transmembrane region sequence encodes 24-32 amino acids, with the amino acid sequences in the transmembrane region.

(19) More preferably, the 5′-end packaging signal sequence of the label gene sequence is SEQ ID NO: 3, or a sequence having at least 80% homology, or at least 85% homology, or at least 90% homology, or at least 95% homology with SEQ ID NO: 3.

(20) More preferably, the 3′-end packaging signal sequence of the label gene sequence is SEQ ID NO: 4, or a sequence having at least 80% homology, or at least 85% homology, or at least 90% homology, or at least 95% homology with SEQ ID NO: 4.

(21) A preparation method of an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination, including the following steps: the label gene sequence is rescued with an HA gene of H9 avian influenza viruses over a reverse genetic system to obtain a recombinant vaccine strain, that is an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination;

(22) the label gene sequence containing a DNA sequence for coding an influenza B virus NA protein extracellular region amino acid sequence, or containing a DNA sequence for coding an amino acid sequence having at least 90% homology, or at least 92% homology, or at least 95% homology, or at least 98% homology with the extracellular region amino acid sequence;

(23) alternatively, the label gene sequence containing a DNA sequence for coding an extracellular region amino acid sequence in influenza B virus NA gene, or containing a sequence having at least 90% homology, or at least 92% homology, or at least 95% homology, or at least 98% homology with the DNA sequence;

(24) alternatively, the label gene sequence is a DNA sequence for coding influenza B virus NA protein, or a DNA sequence for coding an amino acid sequence having at least 90% homology, or at least 92% homology, or at least 95% homology, or at least 98% homology with the NA protein amino acid sequence;

(25) alternatively, the label gene sequence is a DNA sequence of influenza B virus NA gene, or a sequence having at least 90% homology, or at least 92% homology, or at least 95% homology, or at least 98% homology with the DNA sequence.

(26) Preferably, the label gene sequence further contains packaging signal sequences at its both ends.

(27) Preferably, the packaging signal is a packaging signal of H1 subtype NA, or a packaging signal sequence having at least 80% homology, or at least 85% homology, or at least 90% homology, or at least 95% homology with the packaging signal of H1 subtype NA.

(28) Preferably, the 5′-end packaging signal sequence of the label gene sequence is SEQ ID NO: 3, or a sequence having at least 80% homology, or at least 85% homology, or at least 90% homology, or at least 95% homology with SEQ ID NO: 3.

(29) Preferably, the 3′-end packaging signal sequence of the label gene sequence is SEQ ID NO: 4, or a sequence having at least 80% homology, or at least 85% homology, or at least 90% homology, or at least 95% homology with SEQ ID NO: 4.

(30) Preferably, there are additional 6 PR8 internal genes used during the rescue with the reverse genetic system: PB2, PB1, PA, NP, M and NS.

(31) An H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination, which is named as H9 subtype avian influenza vaccine candidate strain Re-H9-DIVA-J2, has been preserved in China Center for Type Culture Collection, with the preservation number of CCTCC NO: V201743.

(32) An application of any one of the above described vaccine strains in the preparation of avian influenza vaccines.

(33) The present invention will be illustrated in detail in conjunction with the following specific examples and the accompanying figures, however, the embodiments of the invention are not limited to this. For unnoted conventional experimental methods, see “Guideline for Molecular Cloning”, the 3rd edition (Sambrook, ed., Science press, 2002).

Example 1. A Preparation Method of an H9 Avian Influenza Vaccine Strain Re-H9-DIVA-J2 which Differentiates Influenza A Virus Infection from Vaccination

(34) The pFlu vector is a kind of bidirectional transcription vector, which may transcribe viral RNA by the human polI promoter, and also may transcribe viral mRNA by CMV promoter, thus synthesizing the viral proteins (Hoffmann et al., PNAS, USA 97, 6108-6113, 2000).

(35) (1) Cloning HA Gene of H9 Avian Influenza Virus

(36) Total RNAs of H9 avian influenza virus A/chicken/Guangdong/J2/2016 (J2 strain for short) are extracted following the instruction of Qiagen RNeasy mini kit. A one step RT-PCR kit (TAKARA) is used to reverse transcribe and amplify the full-length HA gene of J2 strain (SEQ ID NO: 1). RT-PCR primers are Up-primer: CACACACGTCTCCGGGAGCAAAAGCAGGGGAATTTC (SEQ ID NO: 7); Low-Primer: CACACACGTCTCCTATTAGTAGAAACAAAGGGTGTTTTTGC (SEQ ID NO: 8), respectively. Reaction conditions were: 50° C. for 30 min, 94° C. for 2 min; 94° C. for 30 sec, 53° C. for 30 sec, 72° C. for 2 min, 30 cycles; 72° C. for 10 min. The amplified HA gene (1.7 kb around) is recycled, then cloned into the pFlu vector by enzyme digestion with BsmBI to obtain a recombinant plasmid pFlu-H9J2-HA (the construction schematic diagram as shown in FIG. 2).

(37) (2) Construction of A/B Chimeric NA Gene

(38) Constructing the artificially synthesized A/B chimeric NA gene as shown in FIG. 1, which contains a DNA sequence (SEQ ID NO: 5) for coding an extracellular region amino acid sequence in influenza B virus NA as the label gene sequence, the sequence containing type B NA extracellular region as shown in SEQ ID NO: 5 deriving from B/Massachusetts/2/2012 in the influenza B virus Yamagata group (Ping J et al, PNAS, 2016, 113(51):E8296-E8305), the label gene sequence further contains packaging signal sequences at its both ends, wherein the 5′-end packaging signal sequence (SEQ ID NO:3) includes the noncoding region sequence, the intracellular region sequence and the transmembrane region sequence, the 3′-end packaging signal sequence is SEQ ID NO:4. The artificially synthesized A/B chimeric NA gene is inserted into the pFlu vector through the BsmBI site to obtain a recombinant plasmid pFlu-PR8-BNA.

(39) (3) Acquisition of Re-H9-DIVA-J2 Vaccine Strain

(40) The recombinant vaccine strain Re-H9-DIVA-J2 is rescued with the classical “6+2” influenza reverse genetic system. Each 0.5 μg of 6 viral PR8 internal genes pFlu-PR8-PB2, pFlu-PR8-PB1, pFlu-PR8-PA, pFlu-PR8-NP, pFlu-PR8-M, pFlu-PR8-ΔNS and 2 external genes pFlu-H9J2-HA, pFlu-PR8-BNA are co-transfected into 293T cells (Lipofectamine 3000), a culture medium containing TPCK-Trypsin at a final concentration of 0.5 μg/ml is exchanged after 24 h, and the cell supernatant is collected after 48 h, obtaining the Re-H9-DIVA-J2 vaccine strain.

(41) The Re-H9-DIVA-J2 vaccine strain prepared in this example will be further detected for its effects below.

(42) Process: The Re-H9-DIVA-J2 vaccine strain (cell supernatant) prepared in this example is inoculated into 9-11-day-old SPF chick-embryos at 0.2 ml per embryo by allantoic cavity inoculation. After inoculation, chick-embryos are cultured in an incubator at 37° C. for 72 hs. The chick-embryo allantoic fluid (F0-generation) is collected for determining its hemagglutinin titer. F0-generation viruses are diluted by a factor of 10,000 and inoculated into 10 SPF chick-embryos, cultured for 72 hs to obtain viruses which are defined as F1-generation. With the same process, F1-generation viruses are serially passaged to F3-generation.

(43) Results: the detection results are shown in Table 1, from which it can be seen that HA titers (log 2) of F0-F3-generations of Re-H9-DIVA-J2 vaccine strains are all greater than 10, with excellent growth properties, indicating that NA gene in the Re-H9-DIVA-J2 vaccine strain obtained in this example exhibited good matching with H9 avian influenza, without the need of passage adaptation in vitro, thus avoiding the disadvantage of antigenic variation caused by the passage adaptation. The inventive Re-H9-DIVA-J2 vaccine strain has low pathogenicity to SPF chick-embryos, there are no deaths of inoculated chick-embryos within 72 hours. After serial passages for the 3rd generation of Re-H9-DIVA-J2 on SPF chick-embryos, it remains low pathogenicity and high titer growth properties in chick-embryos. No SPF chick-embryo deaths caused by viruses are observed during the passages and viral HA titers are all greater than 10 log 2.

(44) In addition, taking F0 and F3-generation viruses of which the artificial chimeric NA genes are amplified by RT-PCR, it is demonstrated by sequencing that chimeric NA gene can be stably passed to progeny viruses. The results indicated that the recombinant Re-H9-DIVA-J2 vaccine strain rescued in the invention has advantages of safety, high titer growth and stable inheritance of marker gene (see Table 1).

(45) TABLE-US-00001 TABLE 1 Growth properties of Re-H9-DIVA-J2 vaccine strain (NA extracellular region gene from B/Massachusetts/2/2012) on SPF chick-embryos and the stability of artificial chimeric NA gene (the label gene) Stability of Virus Titers Chick-Embryo Artificial Passage (HA titers, Deaths Within Chimeric Number log2) 72 hs NA Gene F0 10 No deaths Presence F1 11 No deaths Not determined F2 10.5 No deaths Not determined F3 11 No deaths Presence

Example 2. A Preparation Method of an H9 Avian Influenza Vaccine Strain Re-H9-DIVA-J2 which Differentiates Influenza A Virus Infection from Vaccination

(46) The preparation method of Example 2 is the same as that of Example 1, except that in constructing the artificially synthesized A/B chimeric NA gene as shown in FIG. 1, the DNA sequence for coding the extracellular region protein amino acid sequence in influenza B virus NA is different from that in Example 1, the remaining are all the same as Example 1.

(47) In this Example, the DNA sequence for coding the extracellular region protein amino acid sequence in influenza B virus NA is shown in SEQ ID NO: 6. As the label gene sequence, the sequence shown in SEQ ID NO: 6 derived from B/Brisbane/60/2008 of influenza B virus Victoria group (Ping J et al, PNAS, 2016, 113(51):E8296-E8305).

(48) The Re-H9-DIVA-J2 vaccine strain prepared in this example will be further detected for its effects below.

(49) Process: The Re-H9-DIVA-J2 vaccine strain (cell supernatant) prepared in this example is inoculated into 9-11-day-old SPF chick-embryos at 0.2 ml per embryo by allantoic cavity inoculation. After inoculation, chick-embryos are cultured in an incubator at 37° C. for 72 hs. The chick-embryo allantoic fluid (F0-generation) is collected for determining its hemagglutinin titer. F0-generation viruses are diluted by a factor of 10,000 and inoculated into 10 SPF chick-embryos, cultured for 72 hs to obtain viruses which are defined as F1-generation. With the same process, F1-generation viruses are serially passaged to F3-generation.

(50) Results: the detection results are shown in Table 2. As can be seen from the results that HA titers (log 2) of F0-F3-generations of Re-H9-DIVA-J2 vaccine strains are all greater than 9, indicating that NA gene in the Re-H9-DIVA-J2 vaccine strain obtained in this example exhibited good matching with H9 avian influenza, without the need of passage adaptation in vitro, thus avoiding the disadvantage of antigenic variation caused by the passage adaptation. No SPF chick-embryo deaths caused by viruses are observed during the passages and viral HA titers are all greater than 9 log 2.

(51) Taking F0 and F3-generation viruses of which the chimeric NA genes are amplified by RT-PCR, it is demonstrated by sequencing that chimeric NA gene can be stably passed to progeny viruses. The results indicated that the rescued recombinant viruses have advantages of safety, high titer growth and stable inheritance of marker gene (see Table 2).

(52) TABLE-US-00002 TABLE 2 Growth properties of Re-H9-DIVA-J2 vaccine strain (NA extracellular region gene from B/Brisbane/60/2008) on SPF chick-embryos and the stability of artificial chimeric NA gene (the label gene) Stability of Virus Titers Chick-Embryo Artificial Passage (HA titer, Deaths Within Chimeric Number log2) 72 hs NA Gene F0 9 No deaths Presence F1 9 No deaths Not determined F2 9.5 No deaths Not determined F3 9 No deaths Presence

(53) As can be seen from the detection data of the above examples 1 and 2, for demonstrating whether type B NA genes of different branches can match with H9 subtype HA (H9-BNA) well, NA genes of representative strains from different groups: B/Brisbane/60/2008 (Victoria group) and Massachusetts/2/2012 (Yamagata group) are selected for study, it is found from the results that NA genes of influenza B viruses of different groups both exhibited good matching with H9, the resulting Re-H9-DIVA-J2 vaccine strains may reach high titers (≥9 log 2) without the need of passage adaptation on chick-embryos.

(54) For representative influenza B virus strains from different groups: B/Brisbane/60/2008 (Victoria group) and Massachusetts/2/2012 (Yamagata group), the homology between the two NA whole gene nucleotide sequences is 94.9%, the homology of the amino acid sequences is 94.9%; the homology between the two DNA sequences for coding NA protein extracellular region is 95.1%, the homology of the NA protein extracellular region amino acid sequences is 94.6%. Because influenza B is only classified into Victoria group and Yamagata group, it is demonstrated in the invention that representative NA strains from the two groups both have good compatibilities with H9 HA, showing that NA type B may all be used in preparing an H9 avian influenza vaccine strain which differentiates influenza A virus infection from vaccination.

Example 3. Preparation of Re-H9-DIVA-J2 Inactivated Vaccine

(55) 50 ml of F0-generation allantoic fluids from Re-H9-DIVA-J2 vaccine strains prepared in the above examples are harvested, and inactivated with a formalin solution at a final concentration of 0.25% at 37° C. for 24 hs. The inactivated allantoic fluids are added into 2% of Tween-80, dissolved sufficiently and then emulsified with white oil containing 3% of Span 80 at a proportion of 1:3, at a shear emulsification rate of 12000 rpm for 3 mins. Upon a dosage form test, a sizing test, a viscosity test, and a stability test, it is determined that the inactivated vaccine is an off-white water-in-oil emulsion with low viscosity, uniform particle sizes, good stability and suitable for injection.

Example 4. Detection of Effects of Re-H9-DIVA-J2 Inactivated Vaccine on Vaccinating Animals

(56) Process: ten 3-week-old SPF chicken are vaccinated with the above prepared Re-H9-DIVA-J2 inactivated vaccine at 0.2 ml per chick by subcutaneous injection at the neck, blood is sampled on days 14, 21 and 28 respectively, serum is isolated and HI antibodies are determined.

(57) Results: the detection results are shown in Table 3, from which it can be seen that Re-H9-DIVA-J2 inactivated vaccine can promptly stimulate the organism to generate high level of HI antibodies, the average HI titers for weeks 2, 3, 4 are 10.9±0.57, 11.5±0.53, 11.8±0.42 (log 2), respectively. For HA and HI tests, reference to GBT 18936-2003 (diagnosis technology of highly pathogenic avian influenza).

Example 5. Serological Experiments

(58) N1, N2, N6, and N9 genes of the existing influenza A are cloned into pCAGGS eukaryotic expression plasmid through KpnI and NheI sites, which are named as pCAGGS-N1, pCAGGS-N2, pCAGGS-N6, pCAGGS-N9. Each 1 μg of pCAGGS-N1, pCAGGS-N2, pCAGGS-N6, pCAGGS-N9 plasmid is transfected to 293T cells pre-coated on 24-hole cell culture plates. 30 hs after transfection, the reactivities of the following 7 groups of chicken serum with N1, N2, N6, N9 are detected by immunofluorescence.

(59) The profiles of the 7 groups of chicken serum are as below:

(60) Anti-Re-H9-DIVA-J2 chicken serum: chicken serum which is only vaccinated with the inventive Re-H9-DIVA-J2 inactivated vaccine;

(61) Anti-H9N2 chicken serum: chicken serum which is only vaccinated with H9N2 whole virus inactivated vaccine;

(62) H9N2-infected chicken serum: 3-week-old SPF chicken are infected with 10.sup.6EID.sub.50 A/chicken/Guangdong/J2/2016 in nasal cavities, the whole blood is harvested 3 weeks after transfection with H9N2 to prepare the serum.

(63) Anti-N1 chicken serum: one-week-old SPF chicken are vaccinated with 100 μg pCAGGS-N1 (by intramuscular injection) respectively, the whole blood is harvested 4 weeks after vaccination to prepare the serum.

(64) Anti-N2 chicken serum: one-week-old SPF chicken are vaccinated with 100 μg pCAGGS-N2 (by intramuscular injection) respectively, the whole blood is harvested 4 weeks after vaccination to prepare the serum.

(65) Anti-N6 chicken serum: one-week-old SPF chicken are vaccinated with 100 μg pCAGGS-N6 (by intramuscular injection) respectively, the whole blood is harvested 4 weeks after vaccination to prepare the serum.

(66) Anti-N9 chicken serum: one-week-old SPF chicken are vaccinated with 100 μg pCAGGS-N9 (by intramuscular injection) respectively, the whole blood is harvested 4 weeks after vaccination to prepare the serum.

(67) The immunofluorescence process is as below:

(68) 1) Into each cell is added 0.5 ml of 4% paraformaldehyde for immobilization for 20 minutes, and then washed with PBS for three times.

(69) 2) It is permeated with 0.2% Triton X 100 for 10 minutes, and then washed with PBS for three times.

(70) 3) It is blocked with 5% BSA for 1 hour, and then washed with PBS for three times.

(71) 4) Primary antibodies are diluted with PBS containing 1% BSA by corresponding factors (anti-Re-H9-DIVA-J2, anti-H9N2, H9N2 infection, dilution for 100-fold; anti-N1/N2/N6/N9, dilution for 20-fold), and added into each hole at 0.5 ml, incubated in a wet box at 37° C. for 1 hour, and then washed with PBS for three times.

(72) 5) Anti-Chicken secondary antibodies (Alexa Fluor 594 Donkey Anti-Chicken IgY) are diluted with PBS containing 1% BSA for 200-fold, added into each hole at 0.5 ml, incubated at room temperature for 0.5 hours, and then washed with PBS for three times.

(73) 6) Observing with a fluorescence microscope.

(74) Results: Influenza N1, N2, N6 and N9 neuraminidases are respectively expressed in 293T cells, the immunofluorescence process is used to detect whether serum has reacted with N1, N2, N6 and N9 3 weeks after vaccination with Re-H9-DIVA-J2. It is found that the anti-Re-H9-DIVA-J2 serum does not cross react with N1, N2, N6 and N9 proteins (e.g., as shown in Table 3 and FIG. 4), on the contrary, the serum after vaccinated or infected with H9N2 whole virus may strongly reacted with N2 protein. As in nature, influenza B don't infect avian, it is demonstrated from this experiment that vaccination with the inventive Re-H9-DIVA-J2 vaccine can differentiate infected from vaccinated animals, which overcomes the disadvantage that the existing H9N2 whole virus vaccine is unable to differentiate infected from vaccinated animals.

(75) TABLE-US-00003 TABLE 3 The reactivity profiles between each vaccinated chicken serum antibodies and N1, N2, N6 and N9 neuraminidases Antigens Antibodies N1 N2 N6 N9 Anti-Re-H9-DIVA-J2 HI: 11 log2 No No No No reactivity reactivity reactivity reactivity Anti-H9N2 HI: 10 log2 ND Reactivity ND ND H9N2 Infection HI: 7 log2 ND Reactivity ND ND Anti-N1 HI: N/A Reactivity ND ND ND Anti-N2 HI: N/A ND Reactivity ND ND Anti-N6 HI: N/A ND ND Reactivity ND Anti-N9 HI: N/A ND ND ND Reactivity Note: N/A: not applicable; ND: not detected.

Example 6. A Preparation Method of an H9 Avian Influenza Vaccine Strain Re-H9-DIVA-J2 which Differentiates Influenza A Virus Infection from Vaccination

(76) The preparation method of Example 6 is the same as that of Example 1, except that in constructing the artificially synthesized A/B chimeric NA gene as shown in FIG. 1, the influenza B virus NA sequence used is the DNA sequence for coding NA whole protein sequence, the remaining are all the same as Example 1, wherein, the DNA sequence of NA derived from the NA whole gene sequence of B/Massachusetts/2/2012 in the Yamagata group of influenza B virus (Ping J et al, PNAS, 2016, 113(51): E8296-E8305).

(77) The above examples are the preferable embodiments of the invention, however, the detailed description of the invention is not limited to the examples described above, any other changes, modifications, substitutions, combinations, simplifications made without deviating from the spirit and principle of the invention should all be considered as equivalent replacements, which are all within the scope of the present invention.