TCRS SPECIFIC FOR MINOR HISTOCOMPATIBILITY (H) ANTIGEN HA-1 AND USES THEREOF
20240279307 ยท 2024-08-22
Inventors
Cpc classification
A61K39/4632
HUMAN NECESSITIES
A61K39/4611
HUMAN NECESSITIES
C12N9/22
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C07K2319/40
CHEMISTRY; METALLURGY
C07K14/70596
CHEMISTRY; METALLURGY
A61K2239/38
HUMAN NECESSITIES
International classification
A61K35/17
HUMAN NECESSITIES
C07K14/705
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
Abstract
The present disclosure provides compositions and methods for targeting a minor histocompatibility (H) antigen (HA-1.sup.H) to, for example, prevent or manage relapse of a hematological malignancy after allogeneic hematopoietic stem cell transplantation (HCT). Also provided are transgene constructs encoding engineered binding proteins, such as a T cell receptor or a chimeric antigen receptor, optionally encoding additional components such as a co-receptor and/or safety switch. Such transgene constructs can be transduced into an immune cell, such as a T cell, and used as an immunotherapy in a subject having a hematological malignancy or at risk for recurrence of the hematological malignancy (e.g., leukemia, lymphoma, myeloma).
Claims
1.-26. (canceled)
27. A method for treating or for preventing a relapse of a hyperproliferative disorder characterized by expression of an HA-1.sup.H antigen in a subject, the method comprising administering to the subject an effective amount of an engineered T cell comprising a heterologous polynucleotide encoding a binding protein that includes: (a) a T cell receptor (TCR) ?-chain variable (V?) domain comprising a CDR3 amino acid sequence of SEQ ID NO.:88, a CDR2 amino acid sequence of SEQ ID NO.:136, and a CDR1 amino acid sequence of SEQ ID NO.:135, and; (b) a TCR ?-chain variable (V?) domain comprising a CDR3 amino acid sequence of SEQ ID NO.:14, a CDR2 amino acid sequence of SEQ ID NO:134, and a CDR1 amino acid sequence of SEQ ID NO. :133, wherein the encoded binding protein is capable of being expressed at a cell surface of the engineered T cell and specifically binding to a VLHDDLLEA (SEQ ID NO.:66):HLA-A2 complex, and wherein the subject is positive for expression of the HLA-A2.
28. The method of claim 27, wherein the encoded binding protein is a TCR.
29. The method of claim 28, wherein the HLA comprises HLA-A*0201.
30. The method of claim 27, wherein the engineered T cell further comprises a heterologous polynucleotide encoding: (a) a safety switch protein; (b) a selection marker; (c) a CD8 co-receptor ?-chain; and/or (d) a CD8 co-receptor ?-chain.
31. The method of claim 27, wherein the encoded V? domain has at least 90% identity to the amino acid sequence of SEQ ID NO.: 3 or 98, and the encoded V.sub.? domain has at least 90% identity to the amino acid sequence of SEQ ID NO.:4 or 99.
32. The method of claim 31, wherein the encoded V.sub.? domain comprises the amino acid sequence of SEQ ID NO.: 3 or 98, and the encoded V.sub.? domain comprises the amino acid sequence of SEQ ID NO.:4 or 99.
33. The method of claim 27, wherein the encoded binding protein comprises: a TCR ?-chain having at least 90% identity to the amino acid sequence of SEQ ID NO.:30 or 111; and/or a TCR ?-chain having at least 90% identity to the amino acid sequence of SEQ ID NO.:29 or 110.
34. The method of claim 27, wherein the encoded binding protein comprises: (i) a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.:29, and a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.:30; or (ii) a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.:110, and a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.:111.
35. The method of claim 27, wherein the heterologous polynucleotide encodes the amino acid sequence of SEQ ID NO.: 54.
36. A method for treating or for preventing a relapse of a hyperproliferative disorder characterized by expression of an HA-1.sup.H antigen in a subject, the method comprising administering to the subject an effective amount of a T cell expressing a T cell receptor (TCR) that comprises: a ?-chain comprising a variable (V?) domain comprising the amino acid sequence of SEQ ID NO.: 98; and an ?-chain comprising a variable (V?) domain comprising the amino acid sequence of SEQ ID NO.: 99, wherein the TCR is capable of specifically binding to a VLHDDLLEA (SEQ ID NO.:66):HLA-A2 complex, wherein the subject is positive for expression of the HLA-A2, and wherein the T cell comprises a CD8+ T cell, a CD4+ T cell, or both.
37. The method of claim 36, wherein the TCR comprises: (i) a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.:29, and a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.:30; or (ii) a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.:110, and a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.:111.
38. The method of claim 27, wherein the engineered T cell is administered to the subject in a composition comprising the engineered T cell and a pharmaceutically acceptable carrier, diluent, or excipient.
39. A method for treating or for preventing a relapse of a hyperproliferative disorder characterized by expression of an HA-1.sup.H antigen in a subject, the method comprising administering to the subject an effective amount of an engineered T cell comprising a heterologous polynucleotide encoding a binding protein that includes: (a) a TCR ?-chain variable (V?) domain, wherein the encoded V? domain (i) comprises a CDR3 amino acid sequence of SEQ ID NO.:88, and (ii) has at least about 90% sequence identity to the V? domain amino acid sequence of SEQ ID NO.:4 or 99, provided that the encoded V? domain comprises no change in amino acid sequence of CDR1 and CDR2, and; (b) a TCR ?-chain variable (V?) domain, wherein encoded the V? domain (i) comprises a CDR3 amino acid sequence of SEQ ID NO.:14, and (ii) has at least about 90% sequence identity to the amino acid sequence of SEQ ID NOs.: 3 or 98, provided that the encoded V? domain comprises no change in amino acid sequence of CDR1 and CDR2, wherein the encoded binding protein is capable of being expressed at a cell surface of the engineered T cell and specifically binding to a VLHDDLLEA (SEQ ID NO.:66):HLA-A2 complex, and wherein the subject is positive for expression of the HLA-A2.
40. The method of claim 27, wherein the hyperproliferative disorder comprises a hematological malignancy.
41. The method of claim 40, wherein the hematological malignancy comprises a leukemia, a lymphoma, a myelodysplastic disorder, or a myeloma.
42. The method of claim 40, wherein the hematological malignancy comprises (A) a leukemia selected from acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), mixed phenotype acute leukemia (MPAL), chronic myeloid leukemia (CML), B cell prolymphocytic leukemia, hairy cell leukemia, or chronic lymphocytic leukemia (CLL), (B) a lymphoma is selected from Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), a central nervous system lymphoma, small lymphocytic lymphoma (SLL), CD37+ dendritic cell lymphoma, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, extra-nodal marginal zone B-cell lymphoma of mucosa-associated (MALT) lymphoid tissue, nodal marginal zone B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, diffuse large B-cell lymphoma, mediastinal (thymic) large B-cell lymphoma, precursor B-lymphoblastic lymphoma, immunoblastic large cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, or Burkitt's lymphoma; or (C) a myelodysplastic disorder selected from refractory cytopenia with unilineage dysplasia (refractory anemia, refractory neutropenia, and refractory thrombocytopenia), refractory anemia with ring sideroblasts (RARS), refractory anemia with ring sideroblaststhrombocytosis (RARS-t), refractory cytopenia with multinieage dysplasia (RCMD), refractory cytopenia with multinieage dysplasia and ring sideroblasts (RCMD-RS), refractory anemia with excess blasts (RAEB), myelodysplasia unclassifiable, or refractory cytopenia of childhood.
43. The method of claim 27, wherein the subject is receiving or previously received a hematopoietic cell transplant (HCT) a lymphodepleting chemotherapy, or both a hematopoietic cell transplant (HCT) and a lymphodepleting chemotherapy.
44. The method of claim 36, wherein the hyperproliferative disorder comprises a hematological malignancy.
45. The method of claim 44, wherein the hematological malignancy comprises a leukemia, a lymphoma, a myelodysplastic disorder, or a myeloma.
46. The method of claim 44, wherein the hematological malignancy comprises (A) a leukemia selected from acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), mixed phenotype acute leukemia (MPAL), chronic myeloid leukemia (CML), B cell prolymphocytic leukemia, hairy cell leukemia, or chronic lymphocytic leukemia (CLL), (B) a lymphoma is selected from Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), a central nervous system lymphoma, small lymphocytic lymphoma (SLL), CD37+ dendritic cell lymphoma, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, extra-nodal marginal zone B-cell lymphoma of mucosa-associated (MALT) lymphoid tissue, nodal marginal zone B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, diffuse large B-cell lymphoma, mediastinal (thymic) large B-cell lymphoma, precursor B-lymphoblastic lymphoma, immunoblastic large cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, or Burkitt's lymphoma; or (C) a myelodysplastic disorder selected from refractory cytopenia with unilineage dysplasia (refractory anemia, refractory neutropenia, and refractory thrombocytopenia), refractory anemia with ring sideroblasts (RARS), refractory anemia with ring sideroblaststhrombocytosis (RARS-t), refractory cytopenia with multinieage dysplasia (RCMD), refractory cytopenia with multinieage dysplasia and ring sideroblasts (RCMD-RS), refractory anemia with excess blasts (RAEB), myelodysplasia unclassifiable, or refractory cytopenia of childhood.
47. The method of claim 36, wherein the subject is receiving or previously received a hematopoietic cell transplant (HCT) a lymphodepleting chemotherapy, or both a hematopoietic cell transplant (HCT) and a lymphodepleting chemotherapy.
48. The method of claim 36, wherein the method comprises administering to the subject a composition comprising a plurality of the T cell, wherein at least about 30% of the T cells in the composition are CD4.sup.+ T cells and at least about 30% of the T cells in the composition are CD8.sup.+ T cells, wherein the CD4.sup.+ T cells and the CD8.sup.+ T cells are present in about a 1:1 ratio in the composition, and wherein the composition contains substantially no na?ve T cells.
49. A binding protein comprising: a T cell receptor (TCR) ?-chain variable (V?) domain comprising a CDR3 amino acid sequence of SEQ ID NO.:88, a CDR2 amino acid sequence of SEQ ID NO.:136, and a CDR1 amino acid sequence of SEQ ID NO.:135; and a TCR ?-chain a variable (V?) domain comprising a CDR3 amino acid sequence of SEQ ID NO.:14, a CDR2 amino acid sequence of SEQ ID NO.:134, and a CDR1 amino acid sequence of SEQ ID NO.:133, wherein the binding protein is capable of specifically binding to a VLHDDLLEA (SEQ ID NO.:66):HLA-A2 complex, and wherein the binding protein is selected from: (1) a single-chain TCR (scTCR); (2) a chimeric antigen receptor (CAR); and (3) a TCR comprising an ?-chain and a ?-chain, each of the ?-chain and the ?-chain comprising, in a constant domain, a modification that promotes preferential pairing of the ?-chain with the ?-chain when the TCR is expressed in a T cell.
50. The binding protein of claim 49, wherein the binding protein is a TCR comprising an ?-chain and a ?-chain, each of the ?-chain and the ?-chain comprising, in a TCR constant domain, a non-native cysteine, wherein the non-native cysteine of the ?-chain constant domain is complementary to the non-native cysteine residue of the ?-chain constant domain.
51. The binding protein of claim 49, wherein the V? domain comprises the amino acid sequence of SEQ ID NO.:98, and the V? domain comprises the amino acid sequence of SEQ ID NO.:99.
52. The binding protein of claim 49, wherein the binding protein is a TCR comprising: a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.: 110; and a TCR ?-chain comprising or consisting of the amino acid sequence of SEQ ID NO.: 111.
53. A polynucleotide encoding the binding protein of claim 49.
54. A polynucleotide encoding the binding protein of claim 50.
55. A polynucleotide encoding the binding protein of claim 51.
56. A polynucleotide encoding the binding protein of claim 52.
57. A vector comprising the polynucleotide of claim 53.
58. A vector comprising the polynucleotide of claim 54.
59. A vector comprising the polynucleotide of claim 55.
60. A vector comprising the polynucleotide of claim 56.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0006]
[0007]
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
DETAILED DESCRIPTION
[0041] In some aspects, the present disclosure provides compositions and methods for treating hyperproliferative diseases characterized by expression of minor histocompatibility antigen HA-1.sup.H. By way of background, human leukocyte antigen (HLA) testing is typically used to match organ, cell, and tissue transplant recipients with compatible donors. HLA testing identifies the major HLA genes a person has inherited and the corresponding antigens, or proteins, which are present on the surface of their cells. These antigens help the body's immune system distinguish which cells are self, and which are foreign or non-self. Any cells that are recognized as non-self can trigger an immune response, such as T cell-mediated cytotoxicity or the production of antibodies. Of note, tests for major HLA genes do not identify the minor HLA genes, which give rise to further antigens. Accordingly, even HLA-matched donor cells may attack healthy recipient cells expressing a perceived foreign minor HLA protein or peptide. Minor H antigens that are expressed on epithelial tissues are targets of alloreactive T cells, leading to graft-versus-host disease. However, some minor H antigens are associated with genes that are expressed predominantly or exclusively in the hematopoietic system, including hematopoietic cells that can be affected by hematological malignancies. Thus, minor H antigens with restricted expression are potential targets for therapies that seek to augment the graft-versus-leukemia effect and thereby prevent relapse.
[0042] The minor histocompatibility antigen HA-1.sup.H is encoded by the polymeric HMHA1 gene (also called Rho GTPase-activating protein 45) and is highly expressed in leukemia cells and normal hematopoietic cells (see, e.g, Griffioen et al., Front. Immunol. 7:100, 2016; Spierings et al. Biol. Blood Marrow Transpl. 19:1244-1253, 2013, the HA-1 expression disclosure of which is incorporated herein by reference), but not in normal non-hematopoietic cells. HMHA1 variants (rs1801284 A/A or A/G) present in 52% of individuals give rise to an immunogenic peptide containing a histidine residue in place of an arginine (VLHDDLLEA; SEQ ID NO:66) (R139.sup.H polymorphism) and HLA presentation of this peptide occurs in individuals with the common HLA-A*0201 (A2) allele (den Haan et al., Science 279:1054-1057, 1998). T cell therapies targeting HA-1.sup.H are therefore applicable to approximately 25% of subjects transplanted for hematological malignancies and require a T cell donor who is either HLA-A2 negative or HA-1.sup.H negative (HA-1.sup.R; rs1801284 G/G-VLRDDLLEA; SEQ ID NO: 65).
[0043] In some aspects, the present disclosure provides engineered immune cells expressing binding proteins, such as TCRs and CARs, specific for HA-1.sup.H. Such engineered immune cells can be used as a standalone therapy to treat a hematologic malignancy or to prevent a relapse or recurrence thereof, or such cells can be used as part of a therapeutic regimen comprising additional therapies or agents (e.g., following, or in combination with, allogeneic HCT).
[0044] Prior to setting forth this disclosure in more detail, it may be helpful to an understanding thereof to provide definitions of certain terms to be used herein. Additional definitions are set forth throughout this disclosure.
[0045] In the present description, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. Also, any number range recited herein relating to any physical feature, such as polymer subunits, size or thickness, are to be understood to include any integer within the recited range, unless otherwise indicated. As used herein, the term about means ?20% of the indicated range, value, or structure, unless otherwise indicated. It should be understood that the terms a and an as used herein refer to one or more of the enumerated components. The use of the alternative (e.g., or) should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, the terms include, have, and comprise are used synonymously, which terms and variants thereof are intended to be construed as non-limiting.
[0046] In addition, it should be understood that the individual compounds, or groups of compounds, derived from the various combinations of the structures and substituents described herein, are disclosed by the present application to the same extent as if each compound or group of compounds was set forth individually. Thus, selection of particular structures or particular substituents is within the scope of the present disclosure.
[0047] The term consisting essentially of is not equivalent to comprising and refers to the specified materials or steps of a claim, or to those that do not materially affect the basic characteristics of a claimed subject matter. For example, a protein domain, region, or module (e.g., a binding domain, hinge region, linker module) or a protein (which may have one or more domains, regions, or modules) consists essentially of a particular amino acid sequence when the amino acid sequence of a domain, region, module, or protein includes extensions, deletions, mutations, or a combination thereof (e.g., amino acids at the amino- or carboxy-terminus or between domains) that, in combination, contribute to at most 20% (e.g., at most 15%, 1 0%, 8%, 6%, 5%, 4%, 3%, 2% or 1%) of the length of a domain, region, module, or protein and do not substantially affect (i.e., do not reduce the activity by more than 50%, such as no more than 40%, 30%, 25%, 20%, 15%, 10%, 5%, or 1%) the activity of the domain(s), region(s), module(s), or protein (e.g., the target binding affinity of a binding protein).
[0048] As used herein, an immune system cell means any cell of the immune system that originates from a hematopoietic stem cell in the bone marrow, which gives rise to two major lineages, a myeloid progenitor cell (which give rise to myeloid cells such as monocytes, macrophages, dendritic cells, meagakaryocytes and granulocytes) and a lymphoid progenitor cell (which give rise to lymphoid cells such as T cells, B cells and natural killer (NK) cells). Exemplary immune system cells include a CD4.sup.+ T cell, a CD8.sup.+ T cell, a CD4?CD8?double negative T cell, a ?? T cell, a regulatory T cell, a natural killer cell, and a dendritic cell. Macrophages and dendritic cells can be referred to as antigen presenting cells or APCs, which are specialized cells that can activate T cells when a major histocompatibility complex (MHC) receptor on the surface of the APC complexed with a peptide interacts with a TCR on the surface of a T cell.
[0049] A T cell or T lymphocyte is an immune system cell that matures in the thymus and produces T cell receptors (TCRs). T cells can be na?ve (T.sub.N; not exposed to antigen; increased expression of CD62L, CCR7, CD28, CD3, CD127, and CD45RA, and decreased or no expression of CD45RO as compared to T.sub.CM (described herein)), memory T cells (T.sub.M) (antigen experienced and long-lived), and effector cells (antigen-experienced, cytotoxic). T.sub.M can be further divided into subsets of central memory T cells (T.sub.CM expresses CD62L, CCR7, CD28, CD45RO) and effector memory T cells (T.sub.EM express CD45RO, decreased expression of CD62L, CCR7, and CD28). Effector T cells (T.sub.E) refers to antigen-experienced CD8.sup.+ cytotoxic T lymphocytes that express CD45RA, have decreased expression of CD62L, CCR7, and CD28 as compared to T.sub.CM, and are positive for granzyme and perforin. Helper T cells (TH) are CD4.sup.+ cells that influence the activity of other immune cells by releasing cytokines. CD4.sup.+ T cells can activate and suppress an adaptive immune response, and which of those two functions is induced will depend on presence of other cells and signals. T cells can be collected using known techniques, and the various subpopulations or combinations thereof can be enriched or depleted by known techniques, such as by affinity binding to antibodies, flow cytometry, or immunomagnetic selection. Other exemplary T cells include regulatory T cells, such as CD4.sup.+ CD25.sup.+ (Foxp3.sup.+) regulatory T cells and Treg17 cells, as well as Tr1, Th3, CD8.sup.+ CD28.sup.?, and Qa-1 restricted T cells.
[0050] T cell receptor (TCR) refers to an immunoglobulin superfamily member (having a variable binding domain, a constant domain, a transmembrane region, and a short cytoplasmic tail; see, e. g., Janeway et al., Immunobiology: The Immune System in Health and Disease, 3rd Ed., Current Biology Publications, p. 433, 1997) capable of specifically binding to an antigen peptide bound to a MHC receptor. A TCR can be found on the surface of a cell or in soluble form and generally is comprised of a heterodimer having ? and ? chains (also known as TCR ? and TCR?, respectively), or ? and ? chains (also known as TCR? and TCR?, respectively).
[0051] Like other immunoglobulins (e.g., antibodies), the extracellular portion of TCR chains (e.g., ?-chain, ?-chain) contain two immunoglobulin domains, a variable domain (e.g., ?-chain variable domain or V.sub.? chain variable domain or V.sub.?; typically amino acids 1 to 116 based on Kabat numbering (Kabat et al., Sequences of Proteins of Immunological Interest, US Dept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5.sup.th ed.) at the N-terminus, and one constant domain (e.g., ?-chain constant domain or C.sub.?, typically 5 amino acids 117 to 259 based on Kabat, ?-chain constant domain or C.sub.? typically amino acids 117 to 295 based on Kabat) adjacent the cell membrane. Also, like immunoglobulins, the variable domains contain complementary determining regions (CDRs) separated by frame work regions (FRs) (see, e.g., Jores et al., Proc. Natl Acad. Sci. USA 87:9138, 1990; Chothia et al., EMBO J. 7:3745, 1988; see also Lefranc et al., Dev. Comp. Immunol. 27:55, 2003).
[0052] Antigen or Ag as used herein refers to an immunogenic molecule that provokes an immune response. This immune response may involve antibody production, activation of specific immunologically-competent cells (e.g., T cells), or both. An antigen (immunogenic molecule) may be, for example, a peptide, glycopeptide, polypeptide, glycopolypeptide, polynucleotide, polysaccharide, lipid or the like. It is readily apparent that an antigen can be synthesized, produced recombinantly, or derived from a biological sample. Exemplary biological samples that can contain one or more antigens include tissue samples, tumor samples, cells, biological fluids, or combinations thereof. Antigens can be produced by cells that have been modified or genetically engineered to express an antigen, or that endogenously (e.g., without modification or genetic engineering by human intervention) express a mutation or polymorphism that is immunogenic.
[0053] Major histocompatibility complex (MHC) refers to glycoproteins that deliver peptide antigens to a cell surface of all nucleated cells. MHC class I molecules are heterodimers having a membrane spanning a chain (with three a domains) and a non-covalently associated 132 microglobulin. MHC class II molecules are composed of two transmembrane glycoproteins, ? and ?, both of which span the membrane. Each chain has two domains. MHC class I molecules deliver peptides originating in the cytosol to the cell surface, where a peptide:MHC complex is recognized by CD8.sup.+ T cells. MHC class II molecules deliver peptides originating in the vesicular system to the cell surface, where they are recognized by CD4.sup.+ T cells. Human MHC is referred to as human leukocyte antigen (HLA).
[0054] The term epitope or antigenic epitope includes any molecule, structure, amino acid sequence or protein determinant that is recognized and specifically bound by a cognate binding molecule, such as an immunoglobulin, T cell receptor (TCR), chimeric antigen receptor, or other binding molecule, domain or protein. Epitopic determinants generally contain chemically active surface groupings of molecules, such as amino acids or sugar side chains, and can have specific three dimensional structural characteristics, as well as specific charge characteristics.
[0055] As used herein specifically binds or specific for refers to an association or union of a binding protein (e.g., TCR receptor) or a binding domain (or fusion protein thereof) to a target molecule with an affinity or K.sub.a (i.e., an equilibrium association constant of a particular binding interaction with units of 1/M) equal to or greater than 10.sup.5 M.sup.?1 (which equals the ratio of the on-rate [k.sub.on] to the off-rate [k.sub.off] for this association reaction), while not significantly associating or uniting with any other molecules or components in a sample. Binding proteins or binding domains (or fusion proteins thereof) may be classified as high affinity binding proteins or binding domains (or fusion proteins thereof) or as low affinity binding proteins or binding domains (or fusion proteins thereof). High affinity binding proteins or binding domains refer to those binding proteins or binding domains having a K.sub.a of at least 10.sup.7 M.sup.?1, at least 10.sup.8 M.sup.?1, at least 10.sup.9 M.sup.?1, at least 10.sup.10 M.sup.?1, at least 10.sup.11 M.sup.?1, at least 10.sup.12 M.sup.?1, or at least 10.sup.13 M.sup.?1. Low affinity binding proteins or binding domains refer to those binding proteins or binding domains having a K.sub.a of up to 10.sup.7 M.sup.?1, up to 10.sup.6 M.sup.?1, up to 10.sup.5 M.sup.?1. Alternatively, affinity can be defined as an equilibrium dissociation constant (K.sub.d) of a particular binding interaction with units of M (e.g., 10.sup.?5 M to 10.sup.?13 M).
[0056] In certain embodiments, a receptor or binding domain may have enhanced affinity, which refers to selected or engineered receptors or binding domains with stronger binding to a target antigen than a wild type (or parent) binding domain. For example, enhanced affinity may be due to a K.sub.a (equilibrium association constant) for the target antigen that is higher than the wild type binding domain, due to a K.sub.d (dissociation constant) for the target antigen that is less than that of the wild type binding domain, due to an off-rate (k.sub.off) for the target antigen that is less than that of the wild type binding domain, or a combination thereof. In certain embodiments, enhanced affinity TCRs can be codon optimized to enhance expression in a particular host cell, such as a cell of the immune system, a hematopoietic stem cell, a T cell, a primary T cell, a T cell line, a NK cell, or a natural killer T cell (Scholten et al., Clin. Immunol. 119:135, 2006). The T cell can be a CD4.sup.+ or a CD8.sup.+ T cell.
[0057] A variety of assays are known for identifying binding domains of the present disclosure that specifically bind a particular target, as well as determining binding domain or fusion protein affinities, such as multimer/tetramer staining, Western blot, ELISA, analytical ultracentrifugation, spectroscopy and surface plasmon resonance (Biacore?) analysis (see, e.g., Dolton et al., Immunology 146:11-22, 2015, Scatchard et al., Ann. NY Acad. Sci. 51:660, 1949; Wilson, Science 20295:2103, 2002; Wolff et al., Cancer Res. 53:2560, 1993; and U.S. Pat. Nos. 5,283,173, 5,468,614, or the equivalent; all incorporated herein by reference).
[0058] The source of a TCR as used in the present disclosure can be from various animal species, such as a human, mouse, rat, rabbit or other mammal.
[0059] As used herein, the term CD8 co-receptor or CD8 means the cell surface glycoprotein CD8, either as an alpha-alpha homodimer or an alpha-beta heterodimer. The CD8 co-receptor assists in the function of cytotoxic T cells (CD8.sup.+) and functions through signaling via its cytoplasmic tyrosine phosphorylation pathway (Gao and Jakobsen, Immunol. Today 21:630-636, 2000; Cole and Gao, Cell. Mol. Immunol. 1:81-88, 2004). There are five (5) different CD8 beta chains (see UniProtKB identifier P10966) and a single CD8 alpha chain (see UniProtKB identifier P01732)
[0060] CD4 is an immunoglobulin co-receptor glycoprotein that assists the TCR in communicating with antigen-presenting cells (see, Campbell & Reece, Biology 909 (Benjamin Cummings, Sixth Ed., 2002)). CD4 is found on the surface of immune cells such as T helper cells, monocytes, macrophages, and dendritic cells, and includes four immunoglobulin domains (D1 to D4) that are expressed at the cell surface. During antigen presentation, CD4 is recruited, along with the TCR complex, to bind to different regions of the MHCII molecule (CD4 binds MHCII ?2, while the TCR complex binds MHCII ?1/?1). Without wishing to be bound by theory, it is believed that close proximity to the TCR complex allows CD4-associated kinase molecules to phosphorylate the immunoreceptor tyrosine activation motifs (ITAMs) present on the cytoplasmic domains of CD3. This activity is thought to amplify the signal generated by the activated TCR in order to produce various types of T helper cells.
[0061] In certain embodiments, a TCR is found on the surface of T cells (or T lymphocytes) and associates with a CD3 complex. CD3 is a multi-protein complex of six chains (see, Abbas and Lichtman, 2003; Janeway et al., p. 172 and 178, 1999) that is associated with antigen signaling in T cells. In mammals, the complex comprises a CD3? chain, a CD3? chain, two CD3? chains, and a homodimer of CD3? chains. The CD3?, CD31?, and CD3? chains are highly related cell surface proteins of the immunoglobulin superfamily containing a single immunoglobulin domain. The transmembrane regions of the CD3?, CD313, and CD3? chains are negatively charged, which is a characteristic that allows these chains to associate with the positively charged T cell receptor chains. The intracellular tails of the CD3?, CD31?, and CD3? chains each contain a single conserved motif known as an immunoreceptor tyrosine based activation motif or ITAM, whereas each CD3? chain has three. Without wishing to be bound by theory, it is believed that the ITAMs are important for the signaling capacity of a TCR complex. CD3 as used in the present disclosure may be from various animal species, including human, mouse, rat, or other mammals.
[0062] As used herein, TCR complex refers to a complex formed by the association of CD3 with TCR. For example, a TCR complex can be composed of a CD3? chain, a CD3? chain, two CD3? chains, a homodimer of CD3? chains, a TCR? chain, and a TCR? chain. Alternatively, a TCR complex can be composed of a CD3? chain, a CD3? chain, two CD3? chains, a homodimer of CD3? chains, a TCR? chain, and a TCR? chain.
[0063] A component of a TCR complex, as used herein, refers to a TCR chain (i.e., TCR?, TCR?, TCR? or TCR?), a CD3 chain (i.e., CD3?, CD3?, CD3? or CD3?), or a complex formed by two or more TCR chains or CD3 chains (e.g., a complex of TCR? and TCR?, a complex of TCR? and TCR?, a complex of CD3? and CD3?, a complex of CD3? and CD3?, or a sub-TCR complex of TCR?, TCR?, CD3?, CD3?, and two CD3? chains).
[0064] As used herein, the term HA-1.sup.H antigen or HA-1.sup.H peptide antigen or HA-1.sup.H-containing peptide antigen (or minor HA-1.sup.H antigen or minor HA-1.sup.H peptide antigen or minor HA-1.sup.H-containing peptide antigen or minor Histocompatibility HA-1.sup.H antigen peptide) refers to a naturally or synthetically produced peptide portion of a HMHA1 protein ranging in length from about 7 amino acids, about 8 amino acids, about 9 amino acids, about 10 amino acids, up to about 20 amino acids, and comprising the R139H substitution polymorphism), which can form a complex with a MHC (e.g., HLA) molecule, and a binding protein of this disclosure specific for a HA-1.sup.H peptide:MHC (e.g., HLA) complex can specifically bind to such as complex. An exemplary HA-1.sup.H HA-1 peptide antigen comprises a peptide having the amino acid VLHDDLLEA (SEQ ID NO: 66), wherein the bolded histidine in the sequence represents the R139.sup.H polymorphism.
[0065] The term HA-1.sup.H-specific binding protein, as used herein, refers to a protein or polypeptide, such as a TCR or CAR, that specifically binds to an HA-1.sup.H peptide antigen (or to an HA-1.sup.H peptide antigen:HLA complex, e.g., on a cell surface), and does not bind an HMHA peptide that does not contain the HA-1.sup.H polymorphism (e.g., a peptide comprising the amino acid sequence shown in SEQ ID NO:65) and does not bind to an HLA complex containing such an HMHA peptide.
[0066] In certain embodiments, a HA-1.sup.H-specific binding protein specifically binds to an HA-1-containing peptide (or an HA-1.sup.H peptide:HLA complex) with a K.sub.d of less than about 10.sup.?8 M, less than about 10.sup.?9 M, less than about 10.sup.?10 M, less than about 10.sup.?11 M, less than about 10.sup.?12 M, or less than about 10.sup.?13 M, or with an affinity that is about the same as, at least about the same as, or is greater than at or about the affinity exhibited by an exemplary HA-1.sup.H-specific binding protein provided herein, such as any of the HA-1.sup.H-specific TCRs provided herein, for example, as measured by the same assay. In certain embodiments, a HA-1-specific binding protein comprises a HA-1-specific immunoglobulin superfamily binding protein or binding portion thereof.
[0067] Principles of antigen processing by antigen presenting cells (APC) (such as dendritic cells, macrophages, lymphocytes or other cell types), and of antigen presentation by APC to T cells, including major histocompatibility complex (MHC)-restricted presentation between immunocompatible (e.g., sharing at least one allelic form of an MHC gene that is relevant for antigen presentation) APC and T cells, are well established (see, e.g., Murphy, Janeway's Immunobiology (8.sup.th Ed.) 2011 Garland Science, NY; chapters 6, 9 and 16). For example, processed antigen peptides originating in the cytosol (e.g., tumor antigen, intracellular pathogen) are generally from about 7 amino acids to about 11 amino acids in length and will associate with class I MHC (HLA) molecules, whereas peptides processed in the vesicular system (e.g., bacterial, viral) will vary in length from about 10 amino acids to about 25 amino acids and associate with class II MHC (HLA) molecules.
[0068] Analtered domain or altered protein refers to a motif, region, domain, peptide, polypeptide, or protein with a non-identical sequence identity to a wild type motif, region, domain, peptide, polypeptide, or protein (e.g., a wild type TCR? chain, TCR? chain, TCR? constant domain, TCR? constant domain) of at least 85% (e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%).
[0069] Altered domains or altered proteins or derivatives can include those based on all possible codon choices for the same amino acid and codon choices based on conservative amino acid substitutions. For example, the following six group's each contain amino acids that are conservative substitutions for one another: 1) alanine (ala; A), serine (ser; S), threonine (thr; T); 2) aspartic acid (asp; D), glutamic acid (glu; E); 3) asparagine (asn; N), glutamine (gln; Q); 4) arginine (arg; R), lysine (lys; K); 5) Isoleucine (ile; I), leucine (L), methionine (met; M), valine (val; V); and 6) phenylalanine (phe; F), tyrosine (tyr; Y), tryptophan (trp; W). (See also WO97/09433 at page 10, Lehninger, Biochemistry, 2.sup.nd Edition, Worth Publishers, Inc., NY, NY, pp. 71-77, 1975; Lewin Genes IV, Oxford University Press, NY and Cell Press, Cambridge, MA, p.8, 1990; Creighton, Proteins, W.H. Freeman and Company 1984). In addition, individual substitutions, deletions or additions that alter, add or delete, a single amino acid or a small percentage of amino acids in an encoded sequence are also conservative substitutions.
[0070] As used herein, nucleic acid or nucleic acid molecule refers to any of deoxyribonucleic acid (DNA), ribonucleic acid (RNA), oligonucleotides, polynucleotides, fragments thereof generated, for example, by the polymerase chain reaction (PCR) or by in vitro translation, and also to fragments generated by any of ligation, scission, endonuclease action, or exonuclease action. In certain embodiments, the nucleic acids of the present disclosure are produced by PCR. Nucleic acids can be composed of monomers that are naturally occurring nucleotides (such as deoxyribonucleotides and ribonucleotides), analogs of naturally occurring nucleotides (e.g., a-enantiomeric forms of naturally occurring nucleotides), or a combination of both. Modified nucleotides can have modifications in or replacement of sugar moieties, or pyrimidine or purine base moieties. Nucleic acid monomers can be linked by phosphodiester bonds or analogs of such linkages. Analogs of phosphodiester linkages include phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphorodiselenoate, phosphoroanilothioate, phosphoranilidate, phosphoramidate, and the like. Nucleic acid molecules can be either single stranded or double stranded.
[0071] The term isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally occurring nucleic acid or polypeptide present in a living animal is not isolated, but the same nucleic acid or polypeptide, separated from some or all of the co-existing materials in the natural system, is isolated. Such a nucleic acid could be part of a vector and/or such nucleic acid or polypeptide could be part of a composition (e.g., a cell lysate), and still be isolated in that such vector or composition is not part of the natural environment for the nucleic acid or polypeptide. The term gene means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).
[0072] As used herein, the terms recombinant and engineered refer to a cell, microorganism, nucleic acid molecule, polypeptide, protein, plasmid, or vector that has been modified by introduction of an exogenous nucleic acid molecule, or refers to a cell or microorganism that has been genetically engineered by human interventionthat is, modified by introduction of of a heterologous nucleic acid molecule, or refers to a cell or microorganism that has been altered such that expression of an endogenous nucleic acid molecule or gene is controlled, deregulated or constitutive, where such alterations or modifications can be introduced by genetic engineering. Human-generated genetic alterations can include, for example, modifications introducing nucleic acid molecules (which may include an expression control element, such as a promoter) encoding one or more proteins or enzymes, or other nucleic acid molecule additions, deletions, substitutions, or other functional disruption of or addition to a cell's genetic material. Exemplary modifications include those in coding regions or functional fragments thereof of heterologous or homologous polypeptides from a reference or parent molecule.
[0073] As used herein, mutation refers to a change in the sequence of a nucleic acid molecule or polypeptide molecule as compared to a reference or wild-type nucleic acid molecule or polypeptide molecule, respectively. A mutation can result in several different types of change in sequence, including substitution, insertion or deletion of nucleotide(s) or amino acid(s). In certain embodiments, a mutation is a substitution of one or three codons or amino acids, a deletion of one to about 5 codons or amino acids, or a combination thereof.
[0074] A conservative substitution is recognized in the art as a substitution of one amino acid for another amino acid that has similar properties. Exemplary conservative substitutions are well known in the art (see, e.g., WO 97/09433 at page 10; Lehninger, Biochemistry, 2.sup.nd Edition; Worth Publishers, Inc. NY, NY, pp. 71-77, 1975; Lewin, Genes IV, Oxford University Press, NY and Cell Press, Cambridge, MA, p. 8, 1990).
[0075] The term construct refers to any polynucleotide that contains a recombinant nucleic acid molecule. A transgene or transgene construct refers to a construct that contains two or more genes operably linked in an arrangement that is not found in nature. The term operably-linked (or operably linked herein) refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter is operably-linked with a coding sequence when it can affect the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). Unlinked means that the associated genetic elements are not closely associated with one another and the function of one does not affect the other. In some embodiments, the genes present in a transgene are operably linked to an expression control sequence (e.g., a promoter).
[0076] A construct (e.g., a transgene) can be present in a vector (e.g., a bacterial vector, a viral vector) or can be integrated into a genome. A vector is a nucleic acid molecule that is capable of transporting another nucleic acid molecule. Vectors can be, for example, plasmids, cosmids, viruses, a RNA vector or a linear or circular DNA or RNA molecule that can include chromosomal, non-chromosomal, semi-synthetic or synthetic nucleic acid molecules. Exemplary vectors are those capable of autonomous replication (episomal vector) or expression of nucleic acid molecules to which they are linked (expression vectors). Vectors useful in the compostions and methods of this disclosure are described further herein.
[0077] The term expression, as used herein, refers to the process by which a polypeptide is produced based on the encoding sequence of a nucleic acid molecule, such as a gene. The process can include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post translational modification, or any combination thereof.
[0078] The term introduced in the context of inserting a nucleic acid molecule into a cell, means transfection, or transformation, or transduction and includes reference to the incorporation of a nucleic acid molecule into a eukaryotic or prokaryotic cell wherein the nucleic acid molecule can be incorporated into the genome of a cell (e.g., a chromosome, a plasmid, a plastid, or a mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
[0079] As used herein, heterologous or exogenous nucleic acid molecule, construct or sequence refers to a nucleic acid molecule or portion of a nucleic acid molecule that is not native to a host cell, but can be homologous to a nucleic acid molecule or portion of a nucleic acid molecule from the host cell. The source of the heterologous or exogenous nucleic acid molecule, construct or sequence can be from a different genus or species. In certain embodiments, a heterologous or exogenous nucleic acid molecule is added (i.e., not endogenous or native) to a host cell or host genome by, for example, conjugation, transformation, transfection, transduction, electroporation, or the like, wherein the added molecule can integrate into the host genome or exist as extra-chromosomal genetic material (e.g., as a plasmid or other form of self-replicating vector), and can be present in multiple copies. In addition, heterologous refers to a non-native enzyme, protein or other activity encoded by an exogenous nucleic acid molecule introduced into the host cell, even if the host cell encodes a homologous protein or activity.
[0080] As described herein, more than one heterologous or exogenous nucleic acid molecule can be introduced into a host cell as separate nucleic acid molecules, as a plurality of individually controlled genes, as a polycistronic nucleic acid molecule, as a single nucleic acid molecule encoding a fusion protein, or any combination thereof. For example, as disclosed herein, a host cell can be modified to express two or more heterologous or exogenous nucleic acid molecules encoding the desired TCR specific for a minor histocompatibility (H) antigen HA-1.sup.H peptide (e.g., TCR ? and TCR ?). When two or more exogenous nucleic acid molecules are introduced into a host cell, it is understood that the two or more exogenous nucleic acid molecules can be introduced as a single nucleic acid molecule (e.g., on a single vector), on separate vectors, integrated into the host chromosome at a single site or multiple sites, or any combination thereof. The number of referenced heterologous nucleic acid molecules or protein activities refers to the number of encoding nucleic acid molecules or the number of protein activities, not the number of separate nucleic acid molecules introduced into a host cell.
[0081] As used herein, the term endogenous or native refers to a gene, protein, or activity that is normally present in a host cell. Moreover, a gene, protein or activity that is mutated, overexpressed, shuffled, duplicated or otherwise altered as compared to a parent gene, protein or activity is still considered to be endogenous or native to that particular host cell. For example, an endogenous control sequence from a first gene (e.g., a promoter, translational attenuation sequences) can be used to alter or regulate expression of a second native gene or nucleic acid molecule, wherein the expression or regulation of the second native gene or nucleic acid molecule differs from normal expression or regulation in a parent cell.
[0082] The term homologous or homolog refers to a molecule or activity found in or derived from a host cell, species or strain. For example, a heterologous or exogenous nucleic acid molecule can be homologous to a native host cell gene, and can optionally have an altered expression level, a different sequence, an altered activity, or any combination thereof.
[0083] Sequence identity, as used herein, refers to the percentage of amino acid residues in one sequence that are identical with the amino acid residues in another reference polypeptide sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. The percentage sequence identity values can be generated using the NCBI BLAST 2.0 software as defined by Altschul et al. (1997), Nucl. Acids Res. 25:3389-3402, with the parameters set to default values.
HA-1.SUP.H.-Specific Binding Proteins, Accessory Proteins, and Engineered Host Cells
[0084] In certain aspects, the present disclosure provides engineered immune cells comprising a heterologous polynucleotide that encodes a binding protein that specifically binds to an HA-1.sup.H antigen. In certain embodiments, the encoded binding protein is an HA-1.sup.H antigen-specific T cell receptor (TCR) or an HA-1.sup.H antigen-specific chimeric antigen receptor (CAR). In further embodiments, a binding protein is expressed as part of a transgene construct that encodes additional accessory proteins, such as a safety switch protein, a tag, a selection marker, a CD8 co-receptor ?-chain. ?-chain or both, or any combination thereof.
[0085] In any of the embodiments described herein, an encoded polypeptide of this disclosure (e.g., iCasp9, TCR ?-chain. TCR ?-chain. CD8 ?-chain. CD8 ?-chain) can comprise a signal peptide (also known as a leader sequence, leader peptide, or transit peptide). Signal peptides target newly synthesized polypeptides to their appropriate location inside or outside the cell. A signal peptide may be removed from the polypeptide during or once localization or secretion is completed. Polypeptides that have a signal peptide are referred to herein as a pre-protein and polypeptides having their signal peptide removed are referred to herein as mature proteins or polypeptides. Representative signal peptides include the amino acids from position 1 to position 21 of any one of SEQ ID NOS: 1-3, 5-9, and 70-75, or the amino acids from position 1 to position 19 of any one of SEQ ID NOS:4, 10, and 12.
[0086] Binding proteins of this disclosure, such as TCRs and CARs, will contain a binding domain specific for a target (in this case, HA-1.sup.H). A binding domain (also referred to as a binding region or binding moiety), as used herein, refers to a molecule or portion thereof (e.g., peptide, oligopeptide, polypeptide, protein) that possesses the ability to specifically and non-covalently associate, unite, or combine with a target (e.g., HA-1.sup.H peptide or HA-1.sup.H peptide:MHC complex). A binding domain includes any naturally occurring, synthetic, semi-synthetic, or recombinantly produced binding partner for a biological molecule, a molecular complex (i.e. complex comprising two or more biological molecules), or other target of interest. Exemplary binding domains include single chain immunoglobulin variable regions (e.g., single chain TCR (scTCR), single chain Fv (scFv)), receptor ectodomains, ligands (e.g., cytokines, chemokines), or synthetic polypeptides selected for their specific ability to bind to a biological molecule, a molecular complex or other target of interest.
[0087] In certain embodiments, an HA-1.sup.H-specific binding domain alone (i.e., without any other portion of a HA-1-specific binding protein) can be soluble and can bind to HA-1.sup.H with a K.sub.d of less than about 10.sup.?8 M, less than about 10.sup.?9 M, less than about 10.sup.?10 M, less than about 10.sup.?11 M, less than about 10.sup.?12 M, or less than about 10.sup.?13 M. In particular embodiments, an HA-1.sup.H-specific binding domain includes an HA-1.sup.H-specific scTCR (e.g., single chain ??TCR proteins such as V?-L-V?, V?-L-V?, V?-C?-L-V?, or V?-L-V?-C?, wherein V? and V? are TCR? and ? variable domains respectively, C? and C? are TCR? and ? constant domains, respectively, and L is a linker).
[0088] The term variable region or variable domain refers to the domain of an immunoglobulin superfamily binding protein (e.g., a TCR ?-chain or ?-chain (or ? chain and ? chain for ?? TCRs)) that is involved in binding of the immunoglobulin superfamily binding protein (e.g., TCR) to antigen. The variable domains of the ?-chain and ?-chain (V.sub.?, and V.sub.?, respectively) of a native TCR generally have similar structures, with each domain comprising four conserved framework regions (FRs) and three CDRs. The V.sub.?, domain is encoded by two separate DNA segments, the variable gene segment and the joining gene segment (V-J); the V.sub.? domain is encoded by three separate DNA segments, the variable gene segment, the diversity gene segment, and the joining gene segment (V-D-J). A single V.sub.?, or V.sub.? domain may be sufficient to confer antigen-binding specificity. Furthermore, TCRs that bind a particular antigen may be isolated using a V.sub.?, or V.sub.? domain from a TCR that binds the antigen to screen a library of complementary V.sub.?,or V.sub.? domains, respectively.
[0089] The terms complementarity determining region, and CDR, are synonymous with hypervariable region or HVR, and are known in the art to refer to non-contiguous sequences of amino acids within TCR variable regions, which confer antigen specificity and/or binding affinity. In general, there are three CDRs in each ?-chain variable region (?CDR1, ?CDR2, ?CDR3) and three CDRs in each ?-chain variable region (?CDR1, ?CDR2, ?CDR3). CDR3 is thought to be the main CDR responsible for recognizing processed antigen. CDR1 and CDR2 mainly interact with the MHC.
[0090] In certain embodiments, an encoded binding protein comprises: (a) a T cell receptor (TCR) ? chain variable (V?) domain having an amino acid sequence encoded by a TRAV17 gene, a TRAV21 gene, or a TRAV10 gene, and a TCR ?-chain variable (V?) domain comprising a CDR3 amino acid sequence as shown in any one of SEQ ID NOS: 13-17 and 86; (b) a TCR V? domain comprising a CDR3 amino acid sequence as shown in any one of SEQ ID NOS:87-92, and a TCR V? domain having an amino acid sequence encoded by a TRBV7-9 gene; or (c) a TCR V? domain comprising a CDR3 amino acid sequence of any one of SEQ ID NOS:87-92, and a TCR V? domain comprising a CDR3 amino acid sequence of any one of SEQ ID NOS:13-17 and 86, wherein the encoded binding protein is capable of specifically binding to a peptide containing an HA-1.sup.H minor antigen and does not bind to a peptide that does not contain an HA-1.sup.H minor antigen.
[0091] In further embodiments, an encoded binding protein comprises a TCR V.sub.?, domain and a TCR Vp domain, wherein: (a) the encoded V.sub.? CDR3 comprises the amino acid sequence of SEQ ID NO: 13, and the encoded V.sub.?, CDR3 comprises the amino acid sequence of SEQ ID NO:87; (b) the encoded V.sub.? CDR3 comprises the amino acid sequence shown in SEQ ID NO: 14, and the encoded V.sub.?, CDR3 comprises the amino acid sequence of SEQ ID NO:88; (c) the encoded V.sub.? CDR3 comprises the amino acid sequence shown in SEQ ID NO: 15, and the encoded V.sub.?, CDR3 comprises the amino acid sequence of SEQ ID NO:89; (d) the encoded V.sub.? CDR3 comprises the amino acid sequence shown in SEQ ID NO: 16, and the encoded V.sub.?, CDR3 comprises the amino acid sequence of SEQ ID NO:90; (e) the encoded V.sub.? CDR3 comprises the amino acid sequence shown in SEQ ID NO: 17, and the encoded V.sub.?, CDR3 comprises the amino acid sequence of SEQ ID NO:91; or (f) the encoded V.sub.? CDR3 comprises the amino acid sequence shown in SEQ ID NO:86, and the encoded V.sub.?, CDR3 comprises the amino acid sequence of SEQ ID NO:92.
[0092] In further embodiments, an encoded binding protein comprises a V.sub.? domain, wherein the encoded V.sub.?, domain comprises an amino acid sequence that has at least about 90% sequence identity to the amino acid sequence of any one of SEQ ID NOS:2, 4, 6, 8, 10, and 12. In additional embodiments, an encoded binding protein comprises a V.sub.? domain, wherein the encoded V.sub.? domain comprises an amino acid sequence that has at least about 90% sequence identity to the amino acid sequence of any one of SEQ ID NOS:1, 3, 5, 7, 9, and 11.
[0093] In some embodiments, the encoded V.sub.?, domain comprises no change in amino acid sequence of CDR1, the encoded V.sub.? domain comprises no change in amino acid sequence of CDR 1, or the CDR 1 of the encoded V.sub.?, domain and the CDR 1 of the encoded V.sub.? domain comprise no change in amino acid sequence. In further embodiments, the encoded V.sub.?, domain comprises no change in amino acid sequence of CDR2, the encoded V.sub.? domain comprises no change in amino acid sequence of CDR2, or the CDR2 of the encoded V.sub.?, domain and the CDR2 of the encoded V.sub.? domain comprise no change in amino acid sequence.
[0094] In particular embodiments, an encoded binding protein comprises a TCR V.sub.? domain and a TCR V.sub.? domain, wherein: (a) the encoded V.sub.? domain comprises or consists of the amino acid sequence of SEQ ID NO: 1, and the encoded V.sub.? domain comprises or consists of the amino acid sequence of SEQ ID NO:2; (b) the encoded V.sub.? domain comprises or consists of the amino acid sequence of SEQ ID NO:3, and the encoded V.sub.?, domain comprises or consists of the amino acid sequence of SEQ ID NO:4; (c) the encoded V.sub.? domain comprises or consists of the amino acid sequence of SEQ ID NO:5, and the encoded V.sub.? domain comprises or consists of the amino acid sequence of SEQ ID NO:6; (d) the encoded V.sub.? domain comprises or consists of the amino acid sequence of SEQ ID NO:7, and the encoded V.sub.?, domain comprises or consists of the amino acid sequence of SEQ ID NO:8; (e) the encoded V.sub.? domain comprises or consists of the amino acid sequence of SEQ ID NO:9, and the encoded V.sub.? domain comprises or consists of the amino acid sequence of SEQ ID NO: 10; or (f) the encoded V.sub.? domain comprises or consists of the amino acid sequence of SEQ ID NO: 11, and the encoded V.sub.?, domain comprises or consists of the amino acid sequence of SEQ ID NO:12.
[0095] Exemplary binding proteins of this disclosure expressed by a cell may include a signal peptide (e.g., binding pre-proteins), and the cell may remove the signal peptide to generate a mature binding protein. In certain embodiments, a binding protein comprises two components, such as an ?-chain and a ?-chain, which can associate on the cell surface to form a functional binding protein. The two associated components may comprise mature proteins. In certain embodiments, a binding protein of this disclosure comprises a mature V.sub.? domain, wherein the mature V.sub.? domain comprises or consists of the amino acid sequence of any one of SEQ ID NOS:96, 98, 100, 102, 104, or 106. In further embodiments, a binding protein of this disclosure comprises a mature V.sub.? domain, wherein the mature V.sub.?, domain comprises or consists of the amino acid sequence of any one of SEQ ID NOS:97, 99, 101, 103, 105, or 107. In still further embodiments, a binding protein of this disclosure comprises a mature V.sub.? domain and a mature V.sub.?, domain, wherein the mature V.sub.? domain comprises or consists of the amino acid sequence of any one of SEQ ID NOS:96, 98, 100, 102, 104, or 106, and the mature V.sub.?, domain comprises or consists of the amino acid sequence of any one of SEQ ID NOS:97, 99, 101, 103, 105, or 107. In certain embodiments, a binding protein of this disclosure comprises a mature TCR ?-chain, wherein the mature TCR ?-chain comprises or consists of the amino acid sequence of any one of SEQ ID NOS: 108, 110, 112, 114, 116, or 118. In further embodiments, a binding protein of this disclosure comprises a mature TCR ?-chain, wherein the mature TCR ?-chain comprises or consists of the amino acid sequence of any one of SEQ ID NOS:109, 111, 113, 115, 117, or 119. In yet further embodiments, a binding protein of this disclosure comprises a mature TCR ?-chain and a mature TCR ?-chain, wherein the mature TCR ?-chain comprises or consists of the amino acid sequence of any one of SEQ ID NOS: 108, 110, 112, 114, 116, or 118, and the mature TCR ?-chain comprises or consists of the amino acid sequence of any one of SEQ ID NOS:109, 111, 113, 115, 117, or 119. In certain embodiments, a binding protein of this disclosure is expressed with a CD8 ?-chain and the CD8 ?-chain comprises a mature CD8 ?-chain, wherein the mature CD8 ?-chain comprises or consists of the amino acid sequence shown in any one of SEQ ID NOS: 121-125. In further embodiments, a binding protein of this disclosure is expressed with a CD8 ?-chain and the CD8 ?-chain comprises a mature CD8 ?-chain, wherein the mature CD8 ?-chain comprises or consists of the amino acid sequence of SEQ ID NO: 120. In more embodiments, a binding protein of this disclosure is expressed with a CD8 ?-chain and a CD8 ?-chain, wherein the CD8 ?-chain and ?-chain comprises a mature CD8 ?-chain and ?-chain, wherein the mature CD8 ?-chain comprises or consists of the amino acid sequence shown in any one of SEQ ID NOS:121-125, and the mature CD8 ?-chain comprises or consists of the amino acid sequence of SEQ ID NO: 120.
[0096] In further embodiments, an encoded binding protein comprises a mature TCR V.sub.?, domain and a mature TCR V.sub.? domain, wherein: (a) the V.sub.? domain comprising or consisting of the amino acid sequence of SEQ ID NO:96, and the V.sub.?, domain comprising or consisting of the amino acid sequence of SEQ ID NO:97; (b) the V.sub.? domain comprising or consisting of the amino acid sequence of SEQ ID NO:98, and the V.sub.?, domain comprising or consisting of the amino acid sequence of SEQ ID NO:99; (c) the V.sub.? domain comprising or consisting of the amino acid sequence of SEQ ID NO: 100, and the V.sub.? domain comprising or consisting of the amino acid sequence of SEQ ID NO: 101; (d) the V.sub.? domain comprising or consisting of the amino acid sequence of SEQ ID NO: 102, and the V.sub.?, domain comprising or consisting of the amino acid sequence of SEQ ID NO: 103; (e) the V.sub.? domain comprising or consisting of the amino acid sequence of SEQ ID NO: 104, and the V.sub.?, domain comprising or consisting of the amino acid sequence of SEQ ID NO: 105; or (f) the V.sub.? domain comprising or consisting of the amino acid sequence of SEQ ID NO: 106, and the V.sub.?, domain comprising or consisting of the amino acid sequence of SEQ ID NO: 107.
[0097] An encoded binding protein contained in an engineered immune cell of the present disclosure may, in some embodiments, comprise a TCR constant domain. In certain embodiments, a TCR constant domain is modified to enhance pairing of desired TCR chains. For example, enhanced pairing between a heterologous TCR ?-chain and a heterologous TCR ?-chain due to a modification results in the preferential assembly of a TCR comprising two heterologous chains over an undesired mispairing of a heterologous TCR chain with an endogenous TCR chain (see, e.g., Govers et al., Trends Mol. Med. 16(2):77 (2010), the TCR modifications of which are herein incorporated by reference). Exemplary modifications to enhance pairing of heterologous TCR chains include the introduction of complementary cysteine residues in each of the heterologous TCR ?-chain and ?-chain. In some embodiments, a polynucleotide encoding a heterologous TCR ?-chain encodes a cysteine at amino acid position 48 (corresponding to the full-length, mature human TCR ?-chain sequence) and a polynucleotide encoding a heterologous TCR ?-chain encodes a cysteine at amino acid position 57 (corresponding to the full-length mature human TCR ?-chain sequence).
[0098] In certain embodiments, the encoded binding protein comprises a TCR ?-chain constant (C.sub.?) domain having at least about 90% sequence identity to the amino acid sequence of any one of SEQ ID NOS: 19, 22, 24 and 26. In further embodiments, the encoded binding protein comprises a TCR C.sub.?, domain having at least about 90% sequence identity to the amino acid sequence of any one of SEQ ID NOS: 19, 22, 24 and 26, provided that the TCR C.sub.?, domain retains the introduced cysteine residue at postion 48. In still further embodiments, the encoded binding protein comprises a TCR C.sub.? domain comprising or consisting of the amino acid sequence of any one of SEQ ID NOS:19, 22, 24 and 26.
[0099] In certain embodiments, the encoded binding protein comprises a TCR ?-chain constant (C.sub.?) domain having at least about 90% sequence identity to the amino acid sequence of any one of SEQ ID NOS: 18, 23 and 25. In further embodiments, the encoded binding protein comprises a TCR C.sub.? domain having at least about 90% sequence identity to the amino acid sequence of any one of SEQ ID NOS: 18, 23 and 25, provided that the TCR C.sub.? domain retains the introduced cysteine residue at postion 57. In still further embodiments, the encoded binding protein comprises a TCR C.sub.? domain comprising or consisting of the amino acid sequence of any one of SEQ ID NOS: 18, 23 and 25.
[0100] In certain embodiments, an encoded binding protein comprises a TCR ?-chain (e.g., a TCR V.sub.?, domain operatively associated with a TCR C.sub.?, domain) having an amino acid sequence that is at least about 90% identical to the amino acid sequence of any one of SEQ ID NOS:28, 30, 32, 34, 36 and 38, optionally wherein the TCR C.sub.? domain retains the cysteine at position 47 (as counted from the beginning of the C.sub.?, domain). In further embodiments, an encoded binding protein comprises a TCR ?-chain comprising or consisting of the amino acid sequence of any one of SEQ ID NOS:28, 30, 32, 34, 36 and 38. In other embodiments, an encoded binding protein comprises a TCR ?-chain (e.g., a TCR V.sub.? domain operatively associated with a TCR C.sub.? domain) having an amino acid sequence that is at least about 90% identical to the amino acid sequence of any one of SEQ ID NOS:27, 29, 31, 33, 35, and 37, optionally wherein the TCR C.sub.? domain retains the cysteine at position 57 (as counted from the beginning of the Cp domain). In still further embodiments, the encoded binding protein comprises a TCR ?-chain comprising or consisting of the amino acid sequence of any one of SEQ ID NOS:27, 29, 31, 33, 35, and 37.
[0101] A binding protein encoded by an engineered immune cell of this disclosure may comprise any of the presently disclosed TCR ?-chains in association with any of the disclosed TCR ?-chains. For example, in certain embodiments, an encoded binding protein comprises: (a) a TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:27, and a TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:28; (b) a TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:29, and a TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:30; (c) a TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:31, and the TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:32; (d) a TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:33, and a TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:34; (e) a TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:35, and a TCR-a chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:36; or (f) a TCR ?-chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:37, and a TCR-a chain comprising or consisting of the amino acid sequence shown in SEQ ID NO:38.
[0102] An engineered immune cell of the present disclosure may comprise a single polynucleotide that encodes a binding protein as described herein, or the binding protein may be encoded by more than one polynucleotide. In other words, components or portions of a binding protein may be encoded by two or more polynucleotides, which may be contained on a single nucleic acid molecule or may be contained on two or more nucleic acid molecules.
[0103] In certain embodiments, a polynucleotide encoding two or more components or portions of a binding protein of the present disclosure comprises the two or more coding sequences operatively associated in a single open reading frame. Such an arrangement can advantageously allow coordinated expression of desired gene products, such as, for example, contemporaneous expression of alpha- and beta-chains of a TCR, such that they are produced in about a 1:1 ratio. In certain embodiments, two or more substituent gene products of a binding protein of this disclosure, such as a TCR (e.g., alpha- and beta-chains) or CAR, are expressed as separate molecules and associate post-translationally. In further embodiments, two or more substituent gene products of a binding protein of this disclosure are expressed as a single peptide with the parts separated by a cleavable or removable segment. For instance, self-cleaving peptides useful for expression of separable polypeptides encoded by a single polynucleotide or vector are known in the art and include, for example, a Porcine teschovirus-1 2A (P2A) peptide, such as a peptide encoded by a polynucleotide having the nucleotide sequence shown in any one of SEQ ID NOS:76-81, a Thoseaasigna virus 2A (T2A) peptide, such as a peptide encoded by a polynucleotide having the nucleotide sequence shown in SEQ ID NO:82, an Equine rhinitis A virus (ERAV) 2A (E2A) peptide, such as a peptide encoded by a polynucleotide having the nucleotide sequence shown in SEQ ID NO:83, and a Foot-and-Mouth disease virus 2A (F2A) peptide, such as a peptide encoded by a polynucleotide having the nucleotide sequence shown in SEQ ID NO:84.
[0104] In certain embodiments, a binding protein of the present disclosure comprises one or more junction amino acids. Junction amino acids or junction amino acid residues refer to one or more (e.g., 2 to about 10) amino acid residues between two adjacent motifs, regions or domains of a polypeptide, such as between a binding domain and an adjacent constant domain or between a TCR chain and an adjacent self-cleaving peptide. Junction amino acids can result from the design of a construct that encodes a fusion protein (e.g., amino acid residues resulting from the use of a restriction enzyme site during the construction of a nucleic acid molecule encoding a fusion protein), or from cleavage of, for example, a self-cleaving peptide adjacent one or more domains of an encoded binding protein of this disclosure (e.g., a P2A peptide disposed between a TCR ?-chain and a TCR ?-chain, the self-cleavage of which can leave one or more junction amino acids in the ?-chain, the TCR ?-chain, or both).
[0105] Binding proteins contained in engineered immune cells of this disclosure can, in certain embodiments, specifically bind to an HA-1.sup.H peptide:HLA complex. For example, in specific embodiments, a binding protein of this disclosure is capable of specifically binding to an HA-1.sup.H peptide:HLA complex, wherein the HLA can comprise HLA-A*0201. In particular embodiments, the HA-1.sup.H peptide comprises the amino acid sequence VLHDDLLEA (SEQ ID NO:66).
[0106] In any of the aforementioned embodiments, an encoded binding protein contained in an engineered immune cell can comprise a TCR, an antigen-binding fragment of a TCR (e.g., a single chain TCR (scTCR)), or a chimeric antigen receptor (CAR).
[0107] In certain embodiments, an antigen-binding fragment of a TCR comprises a single chain TCR (scTCR), which comprises both the TCR V.sub.?, and TCR V.sub.? domains, but only a single TCR constant domain (C.sub.?, or C.sub.?). In further embodiments, an antigen-binding fragment of a TCR or a chimeric antigen receptor is chimeric (e.g., comprises amino acid residues or motifs from more than one donor or species), humanized (e.g., comprises residues from a non-human organism that are altered or substituted so as to reduce the risk of immunogenicity in a human), or human.
[0108] Chimeric antigen receptor (CAR) refers to a fusion protein that is engineered to contain two or more naturally-occurring amino acid sequences linked together in a way that does not occur naturally or does not occur naturally in a host cell, which fusion protein can function as a receptor when present on a surface of a cell. CARs of the present disclosure include an extracellular portion comprising an antigen binding domain (i.e., obtained or derived from an immunoglobulin or immunoglobulin-like molecule, such as an scFv derived from an antibody or TCR specific for a cancer antigen, or an antigen binding domain derived or obtained from a killer immunoreceptor from an NK cell) linked to a transmembrane domain and one or more intracellular signaling domains (optionally containing co-stimulatory domain(s)) (see, e.g., Sadelain et al., Cancer Discov., 3(4):388 (2013); see also Harris and Kranz, Trends Pharmacol. Sci., 37(3):220 (2016), and Stone et al., Cancer Immunol. Immunother., 63(11):1163 (2014)).
[0109] Methods for producing engineered TCRs are described in, for example, Bowerman et al., Mol. Immunol., 46(15):3000 (2009), the techniques of which are herein incorporated by reference. Methods for making CARs are well known in the art and are described, for example, in U.S. Pat. Nos. 6,410,319; 7,446,191; U.S. Patent Publication No. 2010/065818; U.S. Pat. No. 8,822,647; PCT Publication No. WO 2014/031687; U.S. Pat. No. 7,514,537; and Brentjens et al., 2007, Clin. Cancer Res. 13:5426, the techniques of which are herein incorporated by reference.
[0110] Engineered immune cells of this disclosure can be administered as therapies for, e.g., cancer. In some circumstances, it may be desirable to reduce or stop the activity associated with a cellular immunotherapy. Thus, in certain embodiments, an engineered immune cell of the present disclosure comprises a heterologous polynucleotide encoding a binding protein and an accessory protein, such as a safety switch protein, which can be targeted using a cognate drug or other compound to selectively modulate the activity (e.g., lessen or ablate) of such cells when desirable. Safety switch proteins used in this regard include, for example, a truncated EGF receptor polypeptide (huEGFRt) that is devoid of extracellular N-terminal ligand binding domains and intracellular receptor tyrosine kinase activity but retains the native amino acid sequence, type I transmembrane cell surface localization, and a conformationally intact binding epitope for pharmaceutical-grade anti-EGFR monoclonal antibody, cetuximab (Erbitux) tEGF receptor (tEGFr; Wang et al., Blood 118:1255-1263, 2011), a caspase polypeptide (e.g., iCasp9; Straathof et al., Blood 105:4247-4254, 2005; Di Stasi et al., N. Engl. J. Med. 365:1673-1683, 2011; Zhou and Brenner, Exp. Hematol. pii:S0301-472X(16)30513-6. doi:10.1016/j.exphem.2016.07.011), RQR8 (Philip et al., Blood 124:1277-1287, 2014), a 10 amino acid tag of the human c-myc protein (Myc) (Kieback et al., Proc. Natl. Acad. Sci. USA 105:623-628, 2008), as discussed herein, and a marker/safety switch polypeptide, such as RQR (CD20+CD34; Philip et al., 2014).
[0111] Other accessory components useful for therapeutic cells comprise a tag or selection marker that allows the cells to be identified, sorted, isolated, enriched, or tracked. For example, marked immune cells having desired characteristics (e.g., an antigen-specific TCR and a safety switch protein) can be sorted away from unmarked cells in a sample and more efficiently activated and expanded for inclusion in a therapeutic product of desired purity.
[0112] As used herein, the term selection marker comprises a nucleic acid construct that confers an identifiable change to a cell permitting detection and positive selection of immune cells transduced with a polynucleotide comprising a selection marker. RQR is a selection marker that comprises a major extracellular loop of CD20 and two minimal CD34 binding sites. In some embodiments, an RQR-encoding polynucleotide comprises a polynucleotide that encodes the 16 amino acid CD34 minimal epitope. In some embodiments, such as certain embodiments provided in the examples herein, the CD34 minimal epitope is incorporated at the amino terminal position of the CD8 stalk domain (Q8). In further embodiments, the CD34 minimal binding site sequence can be combined with a target epitope for CD20 to form a compact marker/suicide gene for T cells (RQR8) (Philip et al., 2014, incorporated by reference herein). This construct allows for the selection of immune cells expressing the construct, with for example, CD34 specific antibody bound to magnetic beads (Miltenyi) and that utilizes clinically accepted pharmaceutical antibody, rituximab, that allows for the selective deletion of a transgene expressing engineered T cell (Philip et al., 2014).
[0113] Further exemplary selection markers also include several truncated type I transmembrane proteins normally not expressed on T cells: the truncated low-affinity nerve growth factor, truncated CD19, and truncated CD34 (see for example, Di Stasi et al., N. Engl. J. Med. 365:1673-1683, 2011; Mavilio et al., Blood 83:1988-1997, 1994; Fehse et al., Mol. Ther. 1:448-456, 2000; each incorporated herein in their entirety). A particularly attractive feature of CD19 and CD34 is the availability of the off-the-shelf Miltenyi CliniMACs? selection system that can target these markers for clinical-grade sorting. However, CD19 and CD34 are relatively large surface proteins that may tax the vector packaging capacity and transcriptional efficiency of an integrating vector. Surface markers containing the extracellular, non-signaling domains or various proteins (e.g., CD19, CD34, LNGFR) also can be employed. Any selection marker may be employed and should be acceptable for Good Manufacturing Practices. In certain embodiments, selection markers are expressed with a polynucleotide that encodes a gene product of interest (e.g., a binding protein of the present disclosure, such as a TCR or CAR). Further examples of selection markers include, for example, reporters such as GFP, EGFP, ?-gal or chloramphenicol acetyltransferase (CAT). In certain embodiments, a selection marker, such as, for example, CD34 is expressed by a cell and the CD34 can be used to select enrich for, or isolate (e.g., by immunomagnetic selection) the transduced cells of interest for use in the methods described herein. As used herein, a CD34 marker is distinguished from an anti-CD34 antibody, or, for example, a scFv, TCR, or other antigen recognition moiety that binds to CD34.
[0114] In certain embodiments, a selection marker comprises an RQR polypeptide, a truncated low-affinity nerve growth factor (tNGFR), a truncated CD19 (tCD19), a truncated CD34 (tCD34), or any combination thereof.
[0115] By way of background, inclusion of CD4.sup.+ T cells in an immunotherapy cell product can provide antigen-induced IL-2 secretion and augment persistence and function of transferred cytotoxic CD8.sup.+ T cells (see, e.g., Kennedy et al., Immunol. Rev. 222:129 (2008); Nakanishi et al., Nature 462(7272):510 (2009)). In certain circumstances, a class I restricted TCR in CD4.sup.+ T cells may require the transfer of a CD8 co-receptor to enhance sensitivity of the TCR to class I HLA peptide complexes. CD4 co-receptors differ in structure to CD8 and cannot effectively substitute for CD8 co-receptors (see, e.g., Stone & Kranz, Front. Immunol. 4:244 (2013); see also Cole et al., Immunology 137(2):139 (2012). Thus, another accessory protein for use in the compositions and methods of this disclosure comprises a CD8 co-receptor or component thereof.
[0116] Engineered immune cells comprising a heterologous polynucleotide encoding a binding protein of the present disclosure may, in certain embodiments, further comprise a heterologous polynucleotide encoding a CD8 co-receptor protein, or a beta-chain or alpha-chain component thereof. An encoded CD8 co-receptor includes, in some embodiments, a ?-chain comprising the amino acid sequence of any one of SEQ ID NOS:71-75. In further embodiments, the encoded CD8 co-receptor is a recombinant CD8 co-receptor further comprising a RQR polypeptide having the amino acid sequence of SEQ ID NO:69. Without wishing to be bound by theory, it is believed that distance from the host cell surface is important for RQR polypeptides to function as selection markers/safety switches (Philip et al., 2010 (supra)). In some embodiments, the encoded RQR polypeptide is contained in a ?-chain, an ?-chain, or both, of the encoded CD8 co-receptor. In specific embodiments, an engineered immune cell comprises a heterologous polynucleotide encoding iCasp9 and a heterologous polynucleotide encoding a recombinant CD8 co-receptor protein that comprises a ?-chain containing a RQR polypeptide and further comprises a CD8 ?-chain. In particular embodiments, the encoded CD8 ?-chain comprises the amino acid sequence shown in SEQ ID NO:70.
[0117] In further embodiments, an engineered immune cell comprises a heterologous polynucleotide encoding iCasp9 and a heterologous polynucleotide encoding a recombinant CD8 co-receptor protein that comprises an ?-chain containing a RQR polypeptide and further comprises a CD8 ?-chain. In some embodiments, both of the encoded CD8 ?-chain and the encoded CD8 ?-chain contain a RQR polypeptide.
[0118] An engineered immune cell may be efficiently transduced to contain, and may efficiently express, a single polynucleotide that encodes the binding protein, safety switch protein, selection marker, and CD8 co-receptor protein. For example, in some embodiments, an engineered immune cell of the present disclosure comprises a heterologous polynucleotide that encodes, from 5 to 3, ([an iCasp9 polypeptide]-[a porcine teschovirus 2A (P2A) peptide]-[a TCR ?-chain]-[a P2A peptide]-[a TCR ?-chain]-[a P2A peptide]-[a CD8 ?-chain comprising an RQR polypeptide]-[a P2A peptide]-[a CD8 ?-chain]). In specific embodiments, the TCR?-chain-encoding polynucleotide comprises or consists of the nucleotide sequence of SEQ ID NO:41, and the TCR?-chain-encoding polynucleotide comprises or consists of the nucleotide sequence of SEQ ID NO:42.
[0119] In particular embodiments, an engineered immune cell contains a heterologous polynucleotide that comprises or consists of the nucleotide sequence of SEQ ID NO:85. Any suitable immune cell may be engineered to include a heterologous polynucleotide encoding a binding protein of this disclosure, including, for example, a T cell, a NK cell, or a NK-T cell. In some embodiments, an engineered immune cell comprises a CD4.sup.+ T cell, a CD8.sup.+ T cell, or both. Methods for transfecting/transducing T cells with desired nucleic acids have been described (e.g., U.S. Patent Application Pub. No. US 2004/0087025) as have adoptive transfer procedures using T cells of desired target-specificity (e.g., Schmitt et al., Hum. Gen. 20:1240, 2009; Dossett et al., Mol. Ther. 17:742, 2009; Till et al., Blood 112:2261, 2008; Wang et al., Hum. Gene Ther. 18:712, 2007; Kuball et al., Blood 109:2331, 2007; US 2011/0243972; US 2011/0189141; Leen et al., Ann. Rev. Immunol. 25:243, 2007), such that adaptation of these methodologies to the presently disclosed embodiments is contemplated, based on the teachings herein.
[0120] Any appropriate method can be used to transfect or transduce the cells, for example, the T cells, or to administer the polynucleotides or compositions of the present methods. Known methods for delivering polynucleotides to host cells include, for example, use of cationic polymers, lipid-like molecules, and certain commercial products such as, for example, IN-VIVO-JET PEI. Other methods include ex vivo transduction, injection, electroporation, DEAE-dextran, sonication loading, liposome-mediated transfection, receptor-mediated transduction, microprojectile bombardment, transposon-mediated transfer, and the like. Still further methods of transfecting or transducing host cells employ vectors, described in further detail herein.
[0121] In any of the foregoing embodiments, an engineered immune cell may be a universal donor cell that is modified to reduce or eliminate expression of one or more endogenous genes that encode a polypeptide involved in immune signaling or other related activities. Exemplary gene knockouts include those that encode PD-1, LAG-3, CTLA4, TIM3, an HLA molecule, a TCR molecule, or the like. Without wishing to be bound by theory, certain endogenously expressed immune cell proteins may be recognized as foreign by an allogeneic host receiving the engineered immune cells, which may result in elimination of the engineered immune cells (e.g., an HLA allele), or may downregulate the immune activity of the engineered immune cells (e.g., PD-1, LAG-3, CTLA4), or may interfere with the binding activity of a heterologously expressed binding protein of the present disclosure (e.g., an endogenous TCR that binds a non-HA-1.sup.H antigen and thereby interferes with the engineered immune cell binding a cell that expresses HA-1.sup.H antigen). Accordingly, decreasing or eliminating expression or activity of such endogenous genes or proteins can improve the activity, tolerance, and persistence of the engineered immune cells within an allogeneic host, and allows for universal, off-the-shelf cells for administration (e.g., to any recipient regardless of HLA type).
[0122] In certain embodiments, an engineered immune cell of this disclosure comprises a chromosomal gene knockout of one or more of a gene that encodes PD-1, LAG-3, CTLA4, TIM3, an HLA component (e.g., a gene that encodes an ?1 macroglobulin, an ?2 macroglobulin, an ?3 macroglobulin, a 131 microglobulin, or a 132 microglobulin), or a TCR component (e.g., a gene that encodes a TCR variable region or a TCR constant region) (see, e.g., Torikai et al., Nature Sci. Rep. 6:21757 (2016); Torikai et al., Blood 119(24):5697 (2012); and Torikai et al., Blood 122(8):1341 (2013), the gene editing techniques and compositions of which are herein incorporated by reference in their entirety). As used herein, the term chromosomal gene knockout refers to a genetic alteration in an engineered immune cell that prevents production, by the engineered immune cell, of a functionally active endogenous polypeptide product. Alterations resulting in a chromosomal gene knockout can include, for example, introduced nonsense mutations (including the formation of premature stop codons), missense mutations, gene deletion, and strand breaks, as well as the heterologous expression of inhibitory nucleic acid molecules that inhibit endogenous gene expression in the engineered immune cell.
[0123] A chromosomal gene knockout may be introduced by chromosomal editing of the immune cell. In certain embodiments, the chromosomal gene knockout is made by chromosomal editing of the immune cell. Chromosomal editing can be performed using, for example, endonucleases. As used herein endonuclease refers to an enzyme capable of catalyzing cleavage of a phosphodiester bond within a polynucleotide chain. In certain embodiments, an endonuclease is capable of cleaving a targeted gene thereby inactivating or knocking out the targeted gene. An endonuclease may be a naturally occurring, recombinant, genetically modified, or fusion endonuclease. The nucleic acid strand breaks caused by the endonuclease are commonly repaired through the distinct mechanisms of homologous recombination or non-homologous end joining (NHEJ). During homologous recombination, a donor nucleic acid molecule may be used for gene knock-in to inactivate a target gene. NHEJ is an error-prone repair process that often results in changes to the DNA sequence at the site of the cleavage, e.g., a substitution, deletion, or addition of at least one nucleotide. NHEJ may be used to knock-out a target gene. Methods of disrupting or knocking out genes or gene expression in immune cells using endonucleases are known in the art and described, for example, in PCT Publication Nos. WO 2015/066262; WO 2013/074916; and WO 2014/059173; methods from each of which is incorporated by reference. Examples of endonucleases include zinc finger nucleases, TALE-nucleases, CRISPR-Cas nucleases, and meganucleases.
[0124] As used herein, a zinc finger nuclease (ZFN) refers to a fusion protein comprising a zinc finger DNA-binding domain fused to a non-specific DNA cleavage domain, such as a Fokl endonuclease. Each zinc finger motif of about 30 amino acids binds to about 3 base pairs of DNA, and amino acids at certain residues can be changed to alter triplet sequence specificity (see, e.g., Desjarlais et al., Proc. Natl. Acad. Sci. 90:2256-2260, 1993; Wolfe et al., J. Mol. Biol. 285:1917-1934, 1999). Multiple zinc finger motifs can be linked in tandem to create binding specificity to desired DNA sequences, such as regions having a length ranging from about 9 to about 18 base pairs. By way of background, ZFNs mediate genome editing by catalyzing the formation of a site-specific DNA double strand break (DSB) in the genome, and targeted integration of a transgene comprising flanking sequences homologous to the genome at the site of DSB is facilitated by homology directed repair. Alternatively, a DSB generated by a ZFN can result in knock out of target gene via repair by non-homologous end joining (NHEJ), which is an error-prone cellular repair pathway that results in the insertion or deletion of nucleotides at the cleavage site. In certain embodiments, a gene knockout comprises an insertion, a deletion, a mutation or a combination thereof, made using a ZFN molecule.
[0125] As used herein, a transcription activator-like effector nuclease (TALEN) refers to a fusion protein comprising a TALE DNA-binding domain and a DNA cleavage domain, such as a FokI endonuclease. A TALE DNA binding domain or TALE is composed of one or more TALE repeat domains/units, each generally having a highly conserved 33-35 amino acid sequence with divergent 12.sup.th and 13.sup.th amino acids. The TALE repeat domains are involved in binding of the TALE to a target DNA sequence. The divergent amino acid residues, referred to as the Repeat Variable Diresidue (RVD), correlate with specific nucleotide recognition. The natural (canonical) code for DNA recognition of these TALEs has been determined such that an HD sequence at positions 12 and 13 leads to a binding to cytosine (C), NG binds to T, NI to A, NN binds to G or A, and NG binds to T and non-canonical (atypical) RVDs are also known (see, e.g., U.S. Patent Publication No. US 2011/0301073, which atypical RVDs are incorporated by reference herein in its entirety). TALENs can be used to direct site-specific double-strand breaks (DSB) in the genome of T cells. Non-homologous end joining (NHEJ) ligates DNA from both sides of a double-strand break in which there is little or no sequence overlap for annealing, thereby introducing errors that knock out gene expression. Alternatively, homology directed repair can introduce a transgene at the site of DSB providing homologous flanking sequences are present in the transgene. In certain embodiments, a gene knockout comprises an insertion, a deletion, a mutation or a combination thereof, and made using a TALEN molecule.
[0126] As used herein, a clustered regularly interspaced short palindromic repeats/Cas (CRISPR/Cas) nuclease system refers to a system that employs a CRISPR RNA (crRNA)-guided Cas nuclease to recognize target sites within a genome (known as protospacers) via base-pairing complementarity and then to cleave the DNA if a short, conserved protospacer associated motif (PAM) immediately follows 3 of the complementary target sequence. CRISPR/Cas systems are classified into three types (i.e., type I, type II, and type III) based on the sequence and structure of the Cas nucleases. The crRNA-guided surveillance complexes in types I and III need multiple Cas subunits. Type II system, the most studied, comprises at least three components: an RNA-guided Cas9 nuclease, a crRNA, and a trans-acting crRNA (tracrRNA). The tracrRNA comprises a duplex forming region. A crRNA and a tracrRNA form a duplex that is capable of interacting with a Cas9 nuclease and guiding the Cas9/crRNA:tracrRNA complex to a specific site on the target DNA via Watson-Crick base-pairing between the spacer on the crRNA and the protospacer on the target DNA upstream from a PAM. Cas9 nuclease cleaves a double-stranded break within a region defined by the crRNA spacer. Repair by NHEJ results in insertions and/or deletions which disrupt expression of the targeted locus. Alternatively, a transgene with homologous flanking sequences can be introduced at the site of DSB via homology directed repair. The crRNA and tracrRNA can be engineered into a single guide RNA (sgRNA or gRNA) (see, e.g., Jinek et al., Science 337:816-21, 2012). Further, the region of the guide RNA complementary to the target site can be altered or programed to target a desired sequence (Xie et al., PLOS One 9:e100448, 2014; U.S. Pat. Appl. Pub. No. US 2014/0068797, U.S. Pat. Appl. Pub. No. US 2014/0186843; U.S. Pat. No. 8,697,359, and PCT Publication No. WO 2015/071474; the techniques and compositions of each of which are incorporated by reference). In certain embodiments, a gene knockout comprises an insertion, a deletion, a mutation or a combination thereof, and made using a CRISPR/Cas nuclease system.
[0127] As used herein, a meganuclease, also referred to as a homing endonuclease, refers to an endodeoxyribonuclease characterized by a large recognition site (double stranded DNA sequences of about 12 to about 40 base pairs). Meganucleases can be divided into five families based on sequence and structure motifs: LAGLIDADG (SEQ ID NO: 131), GIY-YIG, HNH, His-Cys box and PD-(D/E)XK (SEQ ID NO: 132). Exemplary meganucleases include I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-Csml, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-Tevl, I-TevII and I-TevIII, whose recognition sequences are known (see, e.g., U.S. Pat. Nos. 5,420,032 and 6,833,252; Belfort et al., Nucleic Acids Res. 25:3379-3388, 1997; Dujon et al., Gene 82:115-118, 1989; Perler et al., Nucleic Acids Res. 22:1125-1127, 1994; Jasin, Trends Genet. 12:224-228, 1996; Gimble et al., J. Mol. Biol. 263:163-180, 1996; Argast et al., J. Mol. Biol. 280:345-353, 1998).
[0128] In certain embodiments, naturally-occurring meganucleases may be used to promote site-specific genome modification of a target selected from PD-1, LAG3, TIM3, CTLA4, an HLA-encoding gene, or a TCR component-encoding gene. In other embodiments, an engineered meganuclease having a novel binding specificity for a target gene is used for site-specific genome modification (see, e.g., Porteus et al., Nat. Biotechnol. 23:967-73, 2005; Sussman et al., J. Mol. Biol. 342:31-41, 2004; Epinat et al., Nucleic Acids Res. 31:2952-62, 2003; Chevalier et al., Molec. Cell 10:895-905, 2002; Ashworth et al., Nature 441:656-659, 2006; Paques et al., Curr. Gene Ther. 7:49-66, 2007; U.S. Patent Publication Nos. US 2007/0117128; US 2006/0206949; US 2006/0153826; US 2006/0078552; and US 2004/0002092).
[0129] In certain embodiments, a chromosomal gene knockout comprises an inhibitory nucleic acid molecule that is introduced into an engineered immune cell comprising a heterologous polynucleotide encoding an antigen-specific receptor that specifically binds to a tumor associated antigen, wherein the inhibitory nucleic acid molecule encodes a target-specific inhibitor and wherein the encoded target-specific inhibitor inhibits endogenous gene expression (i.e., of PD-1, TIM3, LAG3, CTLA4, an HLA component, a TCR component, or any combination thereof) in the engineered immune cell.
[0130] A chromosomal gene knockout can be confirmed directly by DNA sequencing of the engineered immune cell following use of the knockout procedure or agent. Chromosomal gene knockouts can also be inferred from the absence of gene expression (e.g., the absence of an mRNA or polypeptide product encoded by the gene) following the knockout.
[0131] In another aspect, compositions are provided herein that comprise an engineered immune cell of the present disclosure and a pharmaceutically acceptable carrier, diluent, or excipient. Also provided herein are unit doses that comprise an effective amount of an engineered immune cell or of a composition comprising the engineered immune cell. In certain embodiments, a unit dose comprises (i) a composition comprising at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% engineered CD4.sup.+ T cells, combined with (ii) a composition comprising at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% engineered CD8.sup.+ T cells, in about a 1:1 ratio, wherein the unit dose contains a reduced amount or substantially no na?ve T cells (i.e., has less than about 50%, less than about 40%, less than about 30%, less then about 20%, less than about 10%, less than about 5%, or less then about 1% the population of na?ve T cells present in a unit dose as compared to a patient sample having a comparable number of PBMCs).
[0132] In some embodiments, a unit dose comprises (i) a composition comprising at least about 50% engineered CD4.sup.+ T cells, combined with (ii) a composition comprising at least about 50% engineered CD8.sup.+ T cells, in about a 1:1 ratio, wherein the unit dose contains a reduced amount or substantially no na?ve T cells. In further embodiments, a unit dose comprises (i) a composition comprising at least about 60% engineered CD4.sup.+ T cells, combined with (ii) a composition comprising at least about 60% engineered CD8.sup.+ T cells, in about a 1:1 ratio, wherein the unit dose contains a reduced amount or substantially no na?ve T cells. In still further embodiments, a unit dose comprises (i) a composition comprising at least about 70% engineered CD4.sup.+ T cells, combined with (ii) a composition comprising at least about 70% engineered CD8.sup.+ T cells, in about a 1:1 ratio, wherein the unit dose contains a reduced amount or substantially no na?ve T cells. In some embodiments, a unit dose comprises (i) a composition comprising at least about 80% engineered CD4.sup.+ T cells, combined with (ii) a composition comprising at least about 80% engineered CD8.sup.+ T cells, in about a 1:1 ratio, wherein the unit dose contains a reduced amount or substantially no na?ve T cells. In some embodiments, a unit dose comprises (i) a composition comprising at least about 85% engineered CD4.sup.+ T cells, combined with (ii) a composition comprising at least about 85% engineered CD8.sup.+ T cells, in about a 1:1 ratio, wherein the unit dose contains a reduced amount or substantially no na?ve T cells. In some embodiments, a unit dose comprises (i) a composition comprising at least about 90% engineered CD4.sup.+ T cells, combined with (ii) a composition comprising at least about 90% engineered CD8.sup.+ T cells, in about a 1:1 ratio, wherein the unit dose contains a reduced amount or substantially no na?ve T cells.
[0133] In any of the embodiments described herein, a unit dose comprises equal, or approximately equal numbers of engineered CD45RA.sup.? CD3.sup.+ CD8.sup.+ and engineered CD45RA.sup.?CD3.sup.+CD4.sup.+ T.sub.M cells.
Polynucleotides, Transgenes and Vectors
[0134] In further aspects, the present disclosure provides an isolated polynucleotide that encodes a binding protein as described herein (e.g., an HA-1.sup.H-specific TCR, scTCR, or CAR that comprises TCR V.sub.?, and V.sub.? domains as described herein (and optionally further comprises constant domains or other components as described herein)), and may additionally encoded a safety switch protein, a selection marker, a CD8 co-receptor ?-chain, or a CD8 co-receptor ?-chain, or any combination thereof, provided that at least a portion of the isolated polynucleotide is codon-optimized for expression in a host cell (e.g., an engineered immune cell as disclosed herein).
[0135] In particular, any of the aforementioned heterologous polynucleotides comprised in the engineered immune cells (e.g., encoding any of the binding proteins of the present disclosure) may also or alternatively be provided in an isolated form, wherein the polynucleotide is codon-optimized for expression in a host cell. For example, in certain embodiments, an isolated polynucleotide encodes a TCR ?-chain of an HA-1.sup.H-specific binding protein and comprises or consists of the nucleotide sequence of any one of SEQ ID NOS:39, 41, 43, 45, 47, 49, or 51. In further embodiments, an isolated polynucleotide encodes a TCR ?-chain of an HA-1.sup.H-specific binding protein and comprises or consists of the nucleotide sequence of any one of SEQ ID NOS:40, 42, 46, 48, 50, or 52.
[0136] In certain embodiments, a heterologous polynucleotide encoding a TCR ?-chain and a heterologous polynucleotide encoding a TCR ?-chain are contained in a single open reading frame comprised in the engineered immune cell, wherein the single open reading frame further comprises a polynucleotide encoding a self-cleaving peptide disposed between the ?-chain-encoding polynucleotide and the ?-chain-encoding polynucleotide. In some embodiments, the polynucleotide encoding the self-cleaving peptide comprises or consists of the nucleotide sequence of any one of SEQ ID NOS:76-84.
[0137] In further embodiments, the single open reading frame comprises a nucleotide sequence that is at least about 80% identical to the nucleotide sequence of any one of SEQ ID NOS:59-63. In specific embodiments, the single open reading frame comprises or consists of the nucleotide sequence of any one of SEQ ID NOS: 59-63. In still further embodiments, the encoded ([TCR ?-chain]-[self-cleaving-peptide]-[TCR ?-chain]) comprises or consists of the amino acid sequence of any one of SEQ ID NOS: 53-57, which exists before the cell removes the signal peptide, and before the ?-chain and ?-chains are separated by the self cleaving peptide.
[0138] An isolated polynucleotide of this disclosure may further comprise a polynucleotide encoding a safety switch protein, a selection marker, a CD8 co-receptor beta chain (e.g., SEQ ID NOs:71-75), or a CD8 co-receptor alpha chain (e.g., SEQ ID NO:70) as disclosed herein, or may comprise a polynucleotide encoding any combination thereof. In specific embodiments, an isolated comprising a heterologous polynucleotide encoding iCasp9 and a heterologous polynucleotide encoding a recombinant CD8 co-receptor protein that comprises a ?-chain or ?-chain that contains a RQR polypeptide.
[0139] In some embodiments, an isolated polynucleotide comprises a single open reading frame containing, from 5 to 3, ([a polynucleotide encoding a safety switch protein]-[a polynucleotide encoding a self-cleaving peptide]-[the polynucleotide encoding a TCR ?-chain]-[a polynucleotide encoding a self-cleaving polypeptide]-[a polynucleotide encoding a TCR ?-chain]-[a polynucleotide encoding a self-cleaving polypeptide]-[a polynucleotide encoding a CD8 ?-chain that contains an RQR polypeptide]-[a polynucleotide encoding a self-cleaving polypeptide]-[a polynucleotide encoding a CD8 ?-chain]).
[0140] In further embodiments, an isolated polynucleotide comprises a single open reading frame that encodes, from 5 to 3, ([an iCasp9 polypeptide]-[a porcine teschovirus 2A (P2A) peptide]-[a TCR ? chain]-[a P2A peptide]-[a TCR ?-chain]-[a P2A peptide]-[a CD8 ?-chain comprising an RQR polypeptide]-[a P2A peptide]-[a CD8 ?-chain]). In certain embodiments, the TCR ?-chain-encoding polynucleotide comprises or consists of the nucleotide sequence of SEQ ID NO:41, and wherein the TCR ?-chain-encoding polynucleotide comprises or consists of the nucleotide sequence of SEQ ID NO:42.
[0141] In specific embodiments, an isolated polynucleotide comprises or consists of the nucleotide sequence of SEQ ID NO:85.
[0142] In any of the embodiments described herein, an isolated polynucleotide is codon-optimized for expression in an immune cell, such as a T cell.
[0143] In another aspect, transgene constructs are provided herein, wherein a transgene construct comprises an expression control sequence (e.g., a promoter sequence) operatively linked to a single open reading frame comprising (a) a polynucleotide encoding a safety switch protein; (b) a polynucleotide encoding a TCR ?-chain; (c) a polynucleotide encoding a TCR ?-chain; (b) a polynucleotide encoding a selection marker; (c) a polynucleotide encoding a CD8 co-receptor ?-chain; and (d) a polynucleotide encoding a CD8 co-receptor ?-chain.
[0144] Construction of an transgene construct for genetically engineering and producing a polypeptide of interest can be accomplished by using any suitable molecular biology engineering technique known in the art. To obtain efficient transcription and translation, a polynucleotide in each transgene construct of the present disclosure includes, in certain embodiments, at least one appropriate expression control sequence (also called a regulatory sequence), such as a leader sequence and particularly a promoter operably (i.e., operatively) linked to the nucleotide sequence encoding the polypeptide of interest. In certain embodiments, a transgene construct comprises a polynucleotide that encodes a safety switch protein, wherein the encoded safety switch protein comprises: (i) a truncated EGF receptor (tEGFR); (ii) iCasp9; (iii) a RQR polypeptide; (iv) a myc epitope; or (v) any combination thereof.
[0145] In further embodiments, the encoded selection marker comprises: (i) a RQR polypeptide; (ii) a truncated low-affinity nerve growth factor (tNGFR); (iii) a truncated CD19 (tCD19); (iv) a truncated CD34 (tCD34); or (v) any combination thereof.
[0146] In some embodiments, the encoded CD8 co-receptor is a recombinant CD8 co-receptor comprising a RQR polypeptide having the amino acid sequence shown in SEQ ID NO:69. In particular embodiments, a transgene construct includes a polynucleotide that encodes an RQR polypeptide that is contained in an encoded CD8 ?-chain. In further embodiments, a transgene construct includes a polynucleotide that encodes an RQR polypeptide that is contained in an encoded CD8 ?-chain.
[0147] For example, a transgene construct of the present disclosure comprises, in certain embodiments, an open reading frame containing (a) a polynucleotide encoding a safety switch protein; (b) a polynucleotide encoding a TCR?-chain; (c) a polynucleotide encoding a TCR?-chain; (d) a polynucleotide encoding a CD8 ?-chain that contains an RQR polypeptide; and (e) a polynucleotide encoding a CD8 ?-chain. Any arrangement of the component polynucleotides is contemplated herein, including, for example, a single open reading frame that comprises, from 5 to 3, ([the polynucleotide encoding a safety switch protein]-[a polynucleotide encoding a self-cleaving peptide]-[the polynucleotide encoding a TCR ?-chain]-[the polynucleotide encoding a self-cleaving polypeptide]-[the polynucleotide encoding a TCR ?-chain]-[a polynucleotide encoding a self-cleaving polypeptide]-[the polynucleotide encoding a CD8 ?-chain that contains an RQR polypeptide]-[a polynucleotide encoding a self-cleaving polypeptide]-[the polynucleotide encoding a CD8 ?-chain]).
[0148] In specific embodiments, a transgene construct of the instant disclosure comprises a single open reading frame that encodes, from 5to 3, ([an iCasp9 polypeptide]-[a P2A peptide]-[a TCR ?-chain]-[a P2A peptide]-[a TCR ?-chain]-[a P2A peptide]-[a CD8 ?-chain comprising an RQR polypeptide]-[a P2A peptide]-[a CD8 ?-chain]).
[0149] In further embodiments, a transgene construct can comprise an expression control sequence operatively linked to a polynucleotide as described herein. For example, a transgene construct can comprise an expression control sequence operatively linked to a polynucleotide that encodes a binding protein of the present disclosure, wherein the binding protein includes (a) a T cell receptor (TCR) a chain variable (V.sub.?) domain having an amino acid sequence encoded by a TRAV17 gene, a TRAV21 gene, or a TRAV10 gene, and a TCR ?-chain variable (Vp) domain comprising a CDR3 amino acid sequence as shown in any one of SEQ ID NOS: 13-17 and 86; (b) a TCR V.sub.?, domain comprising a CDR3 amino acid sequence as shown in any one of SEQ ID NOS:87-92, and a TCR V.sub.? domain having an amino acid sequence encoded by a TRBV7-9 gene; or (c) a TCR V.sub.?, domain comprising a CDR3 amino acid sequence of any one of SEQ ID NOS:87-92, and a TCR V.sub.? domain comprising a CDR3 amino acid sequence of any one of SEQ ID NOS: 13-17 and 86, wherein the encoded binding protein is capable of specifically binding to a peptide containing an HA-1.sup.H antigen and does not bind to a peptide that does not contain an HA-1.sup.H antigen.
[0150] Also provided herein are vectors that comprise a transgene construct of the instant disclosure. Some examples of vectors include plasmids, viral vectors, cosmids, and others. Some vectors may be capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors), whereas other vectors may be integrated into the genome of a host cell or promote integration of the polynucleotide insert upon introduction into the host cell and thereby replicate along with the host genome (e.g., lentiviral vector, retroviral vector). Additionally, some vectors are capable of directing the expression of genes to which they are operatively linked (these vectors may be referred to as expression vectors). According to related embodiments, it is further understood that, if one or more agents (e.g., polynucleotides encoding binding proteins as described herein) are co administered to a subject, that each agent may reside in separate or the same vectors, and multiple vectors (each containing a different agent or the same agent) may be introduced to a cell or cell population or administered to a subject.
[0151] In certain embodiments, polynucleotides of the present disclosure may be operatively linked to certain elements of a vector. For example, polynucleotide sequences that are needed to effect the expression and processing of coding sequences to which they are ligated may be operatively linked. Expression control sequences may include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (i.e., Kozak consensus sequences); sequences that enhance protein stability; and possibly sequences that enhance protein secretion. Expression control sequences may be operatively linked if they are contiguous with the gene of interest and expression control sequences that act in trans or at a distance to control the gene of interest.
[0152] In certain embodiments, the vector comprises a plasmid vector or a viral vector (e.g., a vector selected from lentiviral vector or a y-retroviral vector). Viral vectors include retrovirus, adenovirus, parvovirus (e.g., adeno-associated viruses), coronavirus, negative strand RNA viruses such as ortho-myxovirus (e.g., influenza virus), rhabdovirus (e.g., rabies and vesicular stomatitis virus), paramyxovirus (e.g., measles and Sendai), positive strand RNA viruses such as picornavirus and alphavirus, and double-stranded DNA viruses including adenovirus, herpesvirus (e.g., Herpes Simplex virus types 1 and 2, Epstein-Barr virus, cytomega-ilovirus), and poxvirus (e.g., vaccinia, fowlpox and canarypox). Other viruses include Norwalk virus, togavirus, flavivirus, reoviruses, papovavirus, hepadnavirus, and hepatitis virus, for example. Examples of retroviruses include avian leukosis-sarcoma, mammalian C-type, B-type viruses, D type viruses, HTLV-BLV group, lentivirus, and spumavirus (Coffin, J. M., Retroviridae: The viruses and their replication, In Fundamental Virology, Third Edition, B. N. Fields et al., Eds., Lippincott-Raven Publishers, Philadelphia, 1996).
[0153] Retroviruses are viruses having an RNA genome, which is reverse-transcribed into DNA using a reverse transcriptase enzyme, the reverse-transcribed DNA is then incorporated into the host cell genome. Gammaretrovirus refers to a genus of the retroviridae family. Examples of gammaretroviruses include mouse stem cell virus, murine leukemia virus, feline leukemia virus, feline sarcoma virus, and avian reticuloendotheliosis viruses. Lentiviral vector, as used herein, means HIV-based lentiviral vectors for gene delivery, which can be integrative or non-integrative, have relatively large packaging capacity, and can transduce a range of different cell types. Lentiviral vectors are usually generated following transient transfection of three (packaging, envelope and transfer) or more plasmids into producer cells. Like HIV, lentiviral vectors enter the target cell through the interaction of viral surface glycoproteins with receptors on the cell surface. On entry, the viral RNA undergoes reverse transcription, which is mediated by the viral reverse transcriptase complex. The product of reverse transcription is a double-stranded linear viral DNA, which is the substrate for viral integration into the DNA of infected cells.
[0154] In certain embodiments, the viral vector can be a gammaretrovirus, e.g., Moloney murine leukemia virus (MLV)-derived vectors. In other embodiments, the viral vector can be a more complex retrovirus-derived vector, e.g., a lentivirus-derived vector. HIV-1-derived vectors belong to this category. Other examples include lentivirus vectors derived from HIV-2, FIV, equine infectious anemia virus, SIV, and Maedi-Visna virus (ovine lentivirus). Methods of using retroviral and lentiviral viral vectors and packaging cells for transducing mammalian host cells with viral particles containing TCR or CAR transgenes are known in the art and have been previous described, for example, in: U.S. Pat. No. 8,119,772; Walchli et al., PLoS One 6:327930, 2011; Zhao et al., J. Immunol. 174:4415, 2005; Engels et al., Hum. Gene Ther. 14:1155, 2003; Frecha et al., Mol. Ther. 18:1748, 2010; and Verhoeyen et al., Methods Mol. Biol. 506:97, 2009. Retroviral and lentiviral vector constructs and expression systems are also commercially available. Other viral vectors also can be used for polynucleotide delivery including DNA viral vectors, including, for example adenovirus-based vectors and adeno-associated virus (AAV)-based vectors; vectors derived from herpes simplex viruses (HSVs), including amplicon vectors, replication-defective HSV and attenuated HSV (Krisky et al., Gene Ther. 5:1517, 1998).
[0155] Other vectors recently developed for gene therapy uses can also be used with the compositions and methods of this disclosure. Such vectors include those derived from baculoviruses and a-viruses. (Jolly, D J. 1999. Emerging Viral Vectors. pp 209-40 in Friedmann T. ed. The Development of Human Gene Therapy. New York: Cold Spring Harbor Lab), or plasmid vectors (such as Sleeping Beauty or other transposon vectors).
[0156] When a viral vector genome comprises a plurality of polynucleotides to be expressed in a host cell as separate transcripts, the viral vector may also comprise additional sequences between the two (or more) transcripts allowing for bicistronic or multicistronic expression. Examples of such sequences used in viral vectors include internal ribosome entry sites (IRES), furin cleavage sites, viral 2A peptide, or any combination thereof.
[0157] In certain embodiments, a vector is capable of delivering the transgene construct to a host cell (e.g., a hematopoietic progenitor cell or a human immune system cell). In specific embodiments, a vector is capable of delivering a transgene construct to human immune system cell, such as, for example, a CD4.sup.+ T cell, a CD8.sup.+ T cell, a CD4.sup.?CD8.sup.? double negative T cell, a ?? T cell, a natural killer cell, a dendritic cell, or any combination thereof. In further embodiments, a vector is capable of delivering a transgene construct to a na?ve T cell, a central memory T cell, an effector memory T cell, or any combination thereof. In some embodiments, a vector that encodes a polynucleotide or transgene construct of the present disclosure may further comprise a polynucleotide that encodes a nuclease that can be used to perform a chromosomal knockout in a host cell (e.g., a CRISPR-Cas endonuclease or another endonuclease as disclosed herein) or that can be used to to deliver a therapeutic transgene or portion thereof to a host cell in a gene therapy replacement or gene repair therapy. Alternatively, a nuclease used for a chromosomal knockout or a gene replacement or gene repair therapy can be delivered to a host cell independent of a vector that encodes a polynucleotide or transgene construct of this disclosure.
Uses
[0158] In still other aspects, the present disclosure provides methods for treating or for preventing a relapse of a hyperproliferative disorder characterized by expression of an HA-1 antigen in a subject, the method comprising administering to the subject a unit dose comprising an engineered immune cell of this disclosure (or a composition comprising an engineered immune cell), thereby treating the hyperproliferative disorder.
[0159] Treat or treatment or ameliorate refers to medical management of a disease, disorder, or condition of a subject (e.g., a human or non-human mammal, such as a primate, horse, cat, dog, goat, mouse, or rat). In general, an appropriate dose or treatment regimen comprising an engineered immune cell of the present disclosure, and optionally an adjuvant, is administered in an amount sufficient to elicit a therapeutic or prophylactic benefit. Therapeutic or prophylactic/preventive benefit includes improved clinical outcome; lessening or alleviation of symptoms associated with a disease; decreased occurrence of symptoms; improved quality of life; longer disease-free status; diminishment of extent of disease, stabilization of disease state; delay of disease progression; remission; survival; prolonged survival; or any combination thereof.
[0160] A therapeutically effective amount or effective amount, as used herein, refers to an amount of engineered immune cells sufficient to result in a therapeutic effect, including improved clinical outcome; lessening or alleviation of symptoms associated with a disease; decreased occurrence of symptoms; improved quality of life; longer disease-free status; diminishment of extent of disease, stabilization of disease state; delay of disease progression; remission; survival; or prolonged survival in a statistically significant manner. When referring to an individual active ingredient or a cell expressing a single active ingredient, administered alone, a therapeutically effective amount refers to the effects of that ingredient or cell expressing that ingredient alone. When referring to a combination, a therapeutically effective amount refers to the combined amounts of active ingredients or combined adjunctive active ingredient with a cell expressing an active ingredient that results in a therapeutic effect, whether administered serially or simultaneously. A combination may also be a cell expressing more than one active ingredient.
[0161] The term pharmaceutically acceptable excipient or carrier or physiologically acceptable excipient or carrier refer to biologically compatible vehicles, e.g., physiological saline, which are described in greater detail herein, that are suitable for administration to a human or other non-human mammalian subject and generally recognized as safe or not causing a serious adverse event.
[0162] As used herein, statistically significant refers to a p value of 0.050 or less when calculated using the Students t-test and indicates that it is unlikely that a particular event or result being measured has arisen by chance.
[0163] The presently disclosed methods may be useful to, for example, treat or prevent a relapse of a hyperproliferative disorder characterized by expression of HA-1 antigen in a subject, wherein the HA-1.sup.H antigen is present in an HLA complex expressed by hyperproliferating cells in the subject.
[0164] Examples of hyperproliferative disorders characterized by HA-1.sup.H:HLA complexes include hematological malignancies. In certain embodiments, the hematological malignancy comprises a leukemia (e.g., an acute leukemia or a chronic leukemia). In specific embodiments, the leukemia comprises acute myeloid leukemia (AML), acute lymphocytic leukemia (ALL), mixed phenotype acute leukemia (MPAL), chronic myeloid leukemia (CML), B cell prolymphocytic leukemia, hairy cell leukemia, or chronic lymphocytic leukemia (CLL). In certain embodiments, the hematological malignancy comprises a lymphoma. In certain embodiments, the lymphoma comprises Hodgkin's lymphoma (HL), non-Hodgkin's lymphoma (NHL), a central nervous system lymphoma, small lymphocytic lymphoma (SLL), CD37+ dendritic cell lymphoma, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, extraosseous plasmacytoma, extra-nodal marginal zone B-cell lymphoma of mucosa-associated (MALT) lymphoid tissue, nodal marginal zone B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, diffuse large B-cell lymphoma, mediastinal (thymic) large B-cell lymphoma, precursor B-lymphoblastic lymphoma, immunoblastic large cell lymphoma, intravascular large B-cell lymphoma, primary effusion lymphoma, Burkitt's lymphoma/leukemia, B-cell proliferations of uncertain malignant potential, lymphomatoid granulomatosis, and post-transplant lymphoproliferative disorder. In certain embodiments, the hematological malignancy comprises a myelodysplastic disorder, such as, for example, refractory cytopenia with unilineage dysplasia (refractory anemia, refractory neutropenia, and refractory thrombocytopenia), refractory anemia with ring sideroblasts (RARS), refractory anemia with ring sideroblaststhrombocytosis (RARS-t), refractory cytopenia with multinieage dysplasia (RCMD), refractory cytopenia with multinieage dysplasia and ring sideroblasts (RCMD-RS), refractory anemia with excess blasts (RAEB), myelodysplasia unclassifiable, and refractory cytopenia of childhood. In further embodiments, the hematological malignancy comprises a myeloma.Subjects that can be treated by the present invention are, in general, human and other primate subjects, such as monkeys and apes for veterinary medicine purposes. In any of the aforementioned embodiments, the subject may be a human subject. The subjects can be male or female and can be any suitable age, including infant, juvenile, adolescent, adult, and geriatric subjects. Cells according to the present disclosure may be administered in a manner appropriate to the disease, condition, or disorder to be treated as determined by persons skilled in the medical art. In any of the above embodiments, an engineered immune cell or unit dose as described herein is administered intravenously, intraperitoneally, intratumorally, into the bone marrow, into a lymph node, or into the cerebrospinal fluid so as to encounter target cells (e.g., leukemia cells). An appropriate dose, suitable duration, and frequency of administration of the compositions will be determined by such factors as a condition of the patient; size, type, and severity of the disease, condition, or disorder; the particular form of the active ingredient; and the method of administration.
[0165] The amount of cells in a composition or unit dose is at least one cell (for example, one engineered CD8.sup.+ T cell subpopulation; one engineered CD4.sup.+ T cell subpopulation) or is more typically greater than 10.sup.2 cells, for example, up to 10.sup.6, up to 10.sup.7, up to 10.sup.8 cells, up to 10.sup.9 cells, or more than 10.sup.10 cells. In certain embodiments, the cells are administered in a range from about 106 to about 10.sup.10 cells/m.sup.2, preferably in a range of about 10.sup.5 to about 10.sup.9 cells/m.sup.2. The number of cells will depend upon the ultimate use for which the composition is intended as well the type of cells included therein. For example, cells modified to contain a fusion protein specific for a particular antigen will comprise a cell population containing at least 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of such cells. For uses provided herein, cells are generally in a volume of a liter or less, 500 mls or less, 250 mls or less, or 100 mls or less. In embodiments, the density of the desired cells is typically greater than 104 cells/ml and generally is greater than 107 cells/ml, generally 10.sup.8 cells/ml or greater. The cells may be administered as a single infusion or in multiple infusions over a range of time. A clinically relevant number of immune cells can be apportioned into multiple infusions that cumulatively equal or exceed 10.sup.6, 10.sup.7, 10.sup.8, 10.sup.9, 10.sup.10, or 10.sup.11 cells. In certain embodiments, a unit dose of the engineered immune cells can be co-administered with (e.g., simultaneously or contemporaneously) hematopoietic stem cells from an allogeneic donor (e.g., a donor that is HA1.sup.R-negative, HLA-A2-negative, or both).
[0166] Also contemplated are pharmaceutical compositions (i.e., compositions) that engineered immune cells as disclosed herein and a pharmaceutically acceptable carrier, diluents, or excipient. Suitable excipients include water, saline, dextrose, glycerol, or the like and combinations thereof. In embodiments, compositions comprising fusion proteins or host cells as disclosed herein further comprise a suitable infusion media. Suitable infusion media can be any isotonic medium formulation, typically normal saline, Normosol R (Abbott) or Plasma-Lyte A (Baxter), 5% dextrose in water, Ringer's lactate can be utilized. An infusion medium can be supplemented with human serum albumin or other human serum components.
[0167] Pharmaceutical compositions may be administered in a manner appropriate to the disease or condition to be treated (or prevented) as determined by persons skilled in the medical art. An appropriate dose and a suitable duration and frequency of administration of the compositions will be determined by such factors as the health condition of the patient, size of the patient (i.e., weight, mass, or body area), the type and severity of the patient's condition, the particular form of the active ingredient, and the method of administration. In general, an appropriate dose and treatment regimen provide the composition(s) in an amount sufficient to provide therapeutic and/or prophylactic benefit (such as described herein, including an improved clinical outcome, such as more frequent complete or partial remissions, or longer disease-free and/or overall survival, or a lessening of symptom severity).
[0168] An effective amount of a pharmaceutical composition refers to an amount sufficient, at dosages and for periods of time needed, to achieve the desired clinical results or beneficial treatment, as described herein. An effective amount may be delivered in one or more administrations. If the administration is to a subject already known or confirmed to have a disease or disease-state, the term therapeutic amount may be used in reference to treatment, whereas prophylactically effective amount may be used to describe administrating an effective amount to a subject that is susceptible or at risk of developing a disease or disease-state (e.g., recurrence) as a preventative course.
[0169] The pharmaceutical compositions described herein may be presented in unit-dose or multi-dose containers, such as sealed ampoules or vials. Such containers may be frozen to preserve the stability of the formulation until infusion into the patient. In certain embodiments, a unit dose comprises an engineered immune cell as described herein at a dose of about 10.sup.7 cells/m.sup.2 to about 10.sup.11 cells/m.sup.2. The development of suitable dosing and treatment regimens for using the particular compositions described herein in a variety of treatment regimens, including e.g., parenteral or intravenous administration or formulation.
[0170] If the subject composition is administered parenterally, the composition may also include sterile aqueous or oleaginous solution or suspension. Suitable non-toxic parenterally acceptable diluents or solvents include water, Ringer's solution, isotonic salt solution, 1,3-butanediol, ethanol, propylene glycol or polythethylene glycols in mixtures with water. Aqueous solutions or suspensions may further comprise one or more buffering agents, such as sodium acetate, sodium citrate, sodium borate or sodium tartrate. Of course, any material used in preparing any dosage unit formulation should be pharmaceutically pure and substantially non-toxic in the amounts employed. In addition, the active compounds may be incorporated into sustained-release preparation and formulations. Dosage unit form, as used herein, refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit may contain a predetermined quantity of engineered immune cells or active compound calculated to produce the desired effect in association with an appropriate pharmaceutical carrier.
[0171] In general, an appropriate dosage and treatment regimen provides the active molecules or cells in an amount sufficient to provide a benefit. Such a response can be monitored by establishing an improved clinical outcome (e.g., more frequent remissions, complete or partial, or longer disease-free survival) in treated subjects as compared to non-treated subjects. Increases in preexisting immune responses to a tumor protein generally correlate with an improved clinical outcome. Such immune responses may generally be evaluated using standard proliferation, cytotoxicity or cytokine assays, which are routine.
[0172] For prophylactic use, a dose should be sufficient to prevent, delay the onset of, or diminish the severity of a disease associated with disease or disorder. Prophylactic benefit of the immunogenic compositions administered according to the methods described herein can be determined by performing pre-clinical (including in vitro and in vivo animal studies) and clinical studies and analyzing data obtained therefrom by appropriate statistical, biological, and clinical methods and techniques, all of which can readily be practiced by a person skilled in the art.
[0173] As used herein, administration of a composition refers to delivering the same to a subject, regardless of the route or mode of delivery. Administration may be effected continuously or intermittently, and parenterally. Administration may be for treating a subject already confirmed as having a recognized condition, disease or disease state, or for treating a subject susceptible to or at risk of developing such a condition, disease or disease state. Co-administration with an adjunctive therapy may include simultaneous and/or sequential delivery of multiple agents in any order and on any dosing schedule (e.g., engineered immune cells with one or more cytokines; immunosuppressive therapy such as calcineurin inhibitors, corticosteroids, microtubule inhibitors, low dose of a mycophenolic acid prodrug, or any combination thereof).
[0174] In certain embodiments, a plurality of doses of an engineered immune cell described herein is administered to the subject, which may be administered at intervals between administrations of about two to about four weeks.
[0175] Treatment or prevention methods of this disclosure may be administered to a subject as part of a treatment course or regimen, which may comprise additional treatments prior to, or after, administration of the instantly disclosed unit doses, cells, or compositions. For example, in certain embodiments, a subject receiving a unit dose of the engineered immune cell is receiving or had previously received a hematopoietic cell transplant (HCT; including myeloablative and non-myeloablative HCT). In specific embodiments, the HCT comprises donor cells that are HA-1.sup.?, HLA-A2.sup.?, or both, and the subject receiving the HCT donor cells is HA-1.sup.+/HLA-A2.sup.+. In any of the foregoing embodiments, a hematopoietic cell used in an HCT may be a universal donor cell that is modified to reduce or eliminate expression of one or more endogenous genes that encode a polypeptide product selected from an HLA molecule or a TCR molecule (e.g., by a chromosomal gene knockout according to the methods described herein). Techniques and regimens for performing HCT are known in the art and can comprise transplantation of any suitable donor cell, such as a cell derived from umbilical cord blood, bone marrow, or peripheral blood, a hematopoietic stem cell, a mobilized stem cell, or a cell from amniotic fluid. Accordingly, in certain embodiments, an engineered immune cell of the present disclosure can be administered with or shortly after hematopoietic stem cells in a modified HCT therapy.
[0176] In further embodiments, the subject had previously received lymphodepleting chemotherapy prior to receiving the engineered immune cells or HCT. In certain embodiments, a lymphodepleting chemotherapy comprises a conditioning regimen comprising cyclophosphamide, fludarabine, anti-thymocyte globulin, or a combination thereof.
[0177] Methods according to this disclosure may further include administering one or more additional agents to treat the disease or disorder in a combination therapy. For example, in certain embodiments, a combination therapy comprises administering an engineered immune cell with (concurrently, simultaneously, or sequentially) an immune checkpoint inhibitor. In some embodiments, a combination therapy comprises administering an engineered immune cell with an agonist of a stimulatory immune checkpoint agent. In further embodiments, a combination therapy comprises administering an engineered immune cell with a secondary therapy, such as chemotherapeutic agent, a radiation therapy, a surgery, an antibody, or any combination thereof.
[0178] As used herein, the term immune suppression agent or immunosuppression agent refers to one or more cells, proteins, molecules, compounds or complexes providing inhibitory signals to assist in controlling or suppressing an immune response. For example, immune suppression agents include those molecules that partially or totally block immune stimulation; decrease, prevent or delay immune activation; or increase, activate, or up regulate immune suppression. Exemplary immunosuppression agents to target (e.g., with an immune checkpoint inhibitor) include PD-1, PD-L1, PD-L2, LAG3, CTLA4, B7-H3, B7-H4, CD244/2B4, HVEM, BTLA, CD160, TIM3, GAL9, KIR, PVR1G (CD112R), PVRL2, adenosine, A2aR, immunosuppressive cytokines (e.g., IL-10, IL-4, IL-1RA, IL-35), IDO, arginase, VISTA, TIGIT, LAIR1, CEACAM-1, CEACAM-3, CEACAM-5, Treg cells, or any combination thereof.
[0179] An immune suppression agent inhibitor (also referred to as an immune checkpoint inhibitor) may be a compound, an antibody, an antibody fragment or fusion polypeptide (e.g., Fc fusion, such as CTLA4-Fc or LAG3-Fc), an antisense molecule, a ribozyme or RNAi molecule, or a low molecular weight organic molecule. In any of the embodiments disclosed herein, a method may comprise an engineered immune cell with one or more inhibitor of any one of the following immune suppression components, singly or in any combination.
[0180] In certain embodiments, an engineered immune cell is used in combination with a PD-1 inhibitor, for example a PD-1-specific antibody or binding fragment thereof, such as pidilizumab, nivolumab, pembrolizumab, MEDI0680 (formerly AMP-514), AMP-224, BMS-936558 or any combination thereof. In further embodiments, an engineered immune cell of the present disclosure (or an engineered host cell expressing the same) is used in combination with a PD-Li specific antibody or binding fragment thereof, such as BMS-936559, durvalumab (MEDI4736), atezolizumab (RG7446), avelumab (MSB0010718C), MPDL3280A, or any combination thereof.
[0181] In certain embodiments, an engineered immune cell of the present disclosure is used in combination with a LAG3 inhibitor, such as LAG525, IMP321, IMP701, 9H12, BMS-986016, or any combination thereof.
[0182] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of CTLA4. In particular embodiments, an engineered immune cell is used in combination with a CTLA4 specific antibody or binding fragment thereof, such as ipilimumab, tremelimumab, CTLA4-Ig fusion proteins (e.g., abatacept, belatacept), or any combination thereof.
[0183] In certain embodiments, an engineered immune cell is used in combination with a B7-H3 specific antibody or binding fragment thereof, such as enoblituzumab (MGA271), 376.96, or both. A B7-H4 antibody binding fragment may be a scFv or fusion protein thereof, as described in, for example, Dangaj et al., Cancer Res. 73:4820, 2013, as well as those described in U.S. Pat. No. 9,574,000 and PCT Patent Publication Nos. WO/201640724A1 and WO 2013/025779A1.
[0184] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of CD244.
[0185] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of BLTA, HVEM, CD160, or any combination thereof. Anti CD-160 antibodies are described in, for example, PCT Publication No. WO 2010/084158.
[0186] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of TIM3.
[0187] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of Gal9.
[0188] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of adenosine signaling, such as a decoy adenosine receptor.
[0189] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of A2aR.
[0190] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of KIR, such as lirilumab (BMS-986015).
[0191] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of an inhibitory cytokine (typically, a cytokine other than TGF?) or Treg development or activity.
[0192] In certain embodiments, an engineered immune cell is used in combination with an IDO inhibitor, such as levo-1-methyl tryptophan, epacadostat (INCB024360; Liu et al., Blood 115:3520-30, 2010), ebselen (Terentis et al., Biochem. 49:591-600, 2010), indoximod, NLG919 (Mautino et al., American Association for Cancer Research 104th Annual Meeting 2013; Apr. 6-10, 2013), 1-methyl-tryptophan (1-MT)-tira-pazamine, or any combination thereof.
[0193] In certain embodiments, an engineered immune cell is used in combination with an arginase inhibitor, such as N(omega)-Nitro-L-arginine methyl ester (L-NAME), N-omega-hydroxy-nor-1-arginine (nor-NOHA), L-NOHA, 2(S)-amino-6-boronohexanoic acid (ABH), S-(2-boronoethyl)-L-cysteine (BEC), or any combination thereof.
[0194] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of VISTA, such as CA-170 (Curis, Lexington, Mass.).
[0195] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of TIGIT such as, for example, COM902 (Compugen, Toronto, Ontario Canada), an inhibitor of CD155, such as, for example, COM701 (Compugen), or both.
[0196] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of PVRIG, PVRL2, or both. Anti-PVRIG antibodies are described in, for example, PCT Publication No. WO 2016/134333. Anti-PVRL2 antibodies are described in, for example, PCT Publication No. WO 2017/021526.
[0197] In certain embodiments, an engineered immune cell is used in combination with a LAIR1 inhibitor.
[0198] In certain embodiments, an engineered immune cell is used in combination with an inhibitor of CEACAM-1, CEACAM-3, CEACAM-5, or any combination thereof.
[0199] In certain embodiments, an engineered immune cell is used in combination with an agent that increases the activity (i.e., is an agonist) of a stimulatory immune checkpoint molecule. For example an engineered immune cell can be used in combination with a CD137 (4-1BB) agonist (such as, for example, urelumab), a CD134 (OX-40) agonist (such as, for example, MEDI6469, MEDI6383, or MEDI0562), lenalidomide, pomalidomide, a CD27 agonist (such as, for example, CDX-1127), a CD28 agonist (such as, for example, TGN1412, CD80, or CD86), a CD40 agonist (such as, for example, CP-870,893, rhuCD40L, or SGN-40), a CD122 agonist (such as, for example, IL-2) an agonist of GITR (such as, for example, humanized monoclonal antibodies described in PCT Patent Publication No. WO 2016/054638), an agonist of ICOS (CD278) (such as, for example, GSK3359609, mAb 88.2, JTX-2011, Icos 145-1, Icos 314-8, or any combination thereof). In any of the embodiments disclosed herein, a method may comprise administering an engineered immune cell with one or more agonist of a stimulatory immune checkpoint molecule, including any of the foregoing, singly or in any combination.
[0200] In certain embodiments, a combination therapy comprises an engineered immune cell and a secondary therapy comprising one or more of: an antibody or antigen binding-fragment thereof that is specific for a cancer antigen expressed by the non-inflamed solid tumor, a radiation treatment, a surgery, a chemotherapeutic agent, a cytokine, RNAi, or any combination thereof.
[0201] In certain embodiments, a combination therapy method comprises administering a fusion protein and further administering a radiation treatment or a surgery. Radiation therapy is well-known in the art and includes X-ray therapies, such as gamma-irradiation, and radiopharmaceutical therapies. Surgeries and surgical techniques appropriate to treating a given cancer in a subject are well-known to those of ordinary skill in the art.
[0202] In certain embodiments, a combination therapy method comprises administering an engineered immune cell and further administering a chemotherapeutic agent. A chemotherapeutic agent includes, but is not limited to, an inhibitor of chromatin function, a topoisomerase inhibitor, a microtubule inhibiting drug, a DNA damaging agent, an antimetabolite (such as folate antagonists, pyrimidine analogs, purine analogs, and sugar-modified analogs), a DNA synthesis inhibitor, a DNA interactive agent (such as an intercalating agent), and a DNA repair inhibitor. Illustrative chemotherapeutic agents include, without limitation, the following groups: anti-metabolites/anti-cancer agents, such as pyrimidine analogs (5-fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine) and purine analogs, folate antagonists and related inhibitors (mercaptopurine, thioguanine, pentostatin and 2-chlorodeoxyadenosine (cladribine)); antiproliferative/antimitotic agents including natural products such as vinca alkaloids (vinblastine, vincristine, and vinorelbine), microtubule disruptors such as taxane (paclitaxel, docetaxel), vincristin, vinblastin, nocodazole, epothilones and navelbine, epidipodophyllotoxins (etoposide, teniposide), DNA damaging agents (actinomycin, amsacrine, anthracyclines, bleomycin, busulfan, camptothecin, carboplatin, chlorambucil, cisplatin, cyclophosphamide, Cytoxan, dactinomycin, daunorubicin, doxorubicin, epirubicin, hexamethylmelamineoxaliplatin, iphosphamide, melphalan, merchlorehtamine, mitomycin, mitoxantrone, nitrosourea, plicamycin, procarbazine, taxol, taxotere, temozolamide, teniposide, triethylenethiophosphoramide and etoposide (VP 16)); antibiotics such as dactinomycin (actinomycin D), daunorubicin, doxorubicin (adriamycin), idarubicin, anthracyclines, mitoxantrone, bleomycins, plicamycin (mithramycin) and mitomycin; enzymes (L-asparaginase which systemically metabolizes L-asparagine and deprives cells which do not have the capacity to synthesize their own asparagine); antiplatelet agents; antiproliferative/antimitotic alkylating agents such as nitrogen mustards (mechlorethamine, cyclophosphamide and analogs, melphalan, chlorambucil), ethylenimines and methylmelamines (hexamethylmelamine and thiotepa), alkyl sulfonatesbusulfan, nitrosoureas (carmustine (BCNU) and analogs, streptozocin), trazenes-dacarbazinine (DTIC); antiproliferative/antimitotic antimetabolites such as folic acid analogs (methotrexate); platinum coordination complexes (cisplatin, carboplatin), procarbazine, hydroxyurea, mitotane, aminoglutethimide; hormones, hormone analogs (estrogen, tamoxifen, goserelin, bicalutamide, nilutamide) and aromatase inhibitors (letrozole, anastrozole); anticoagulants (heparin, synthetic heparin salts and other inhibitors of thrombin); fibrinolytic agents (such as tissue plasminogen activator, streptokinase and urokinase), aspirin, dipyridamole, ticlopidine, clopidogrel, abciximab; antimigratory agents; antisecretory agents (breveldin); immunosuppressives (cyclosporine, tacrolimus (FK-506), sirolimus (rapamycin), azathioprine, mycophenolate mofetil); anti-angiogenic compounds (TNP470, genistein) and growth factor inhibitors (vascular endothelial growth factor (VEGF) inhibitors, fibroblast growth factor (FGF) inhibitors); angiotensin receptor blocker; nitric oxide donors; anti-sense oligonucleotides; antibodies (trastuzumab, rituximab); chimeric antigen receptors; cell cycle inhibitors and differentiation inducers (tretinoin); mTOR inhibitors, topoisomerase inhibitors (doxorubicin (adriamycin), amsacrine, camptothecin, daunorubicin, dactinomycin, eniposide, epirubicin, etoposide, idarubicin, irinotecan (CPT-11) and mitoxantrone, topotecan, irinotecan), corticosteroids (cortisone, dexamethasone, hydrocortisone, methylpednisolone, prednisone, and prenisolone); growth factor signal transduction kinase inhibitors; mitochondrial dysfunction inducers, toxins such as Cholera toxin, ricin, Pseudomonas exotoxin, Bordetella pertussis adenylate cyclase toxin, or diphtheria toxin, and caspase activators; and chromatin disruptors.
[0203] Cytokines are increasingly used to manipulate host immune response towards anticancer activity. See, e.g., Floros & Tarhini, Semin. Oncol. 42(4):539-548, 2015. Cytokines useful for promoting immune anticancer or antitumor response include, for example, IFN-a, IL-2, IL-3, IL-4, IL-10, IL-12, IL-13, IL-15, IL-16, IL-17, IL-18, IL-21, IL-24, and GM-CSF, singly or in any combination with an engineered immune cell of this disclosure.
[0204] Also provided herein are methods for modulating an adoptive immunotherapy, wherein the methods comprise administering, to a subject who has previously received an engineered immune cell of the present disclosure that comprises a heterologous polynucleotide encoding a safety switch protein, a cognate compound of the safety switch protein in an amount effective to ablate in the subject the previously administered engineered immune cell.
[0205] As used herein, the term adoptive immune therapy or adoptive immunotherapy refers to administration of naturally occurring or genetically engineered, disease- or antigen-specific immune cells (e.g., T cells). Adoptive cellular immunotherapy may be autologous (immune cells are from the recipient), allogeneic (immune cells are from a donor of the same species) or syngeneic (immune cells are from a donor genetically identical to the recipient).
[0206] In certain embodiments, the safety switch protein comprises tEGFR and the cognate compound is cetuximab, or the safety switch protein comprises iCasp9 and the cognate compound is AP1903 (e.g., dimerized AP1903), or the safety switch protein comprises a RQR polypeptide and the cognate compound is rituximab, or the safety switch protein comprises a myc binding domain and the cognate compound is an antibody specific for the myc binding domain.
[0207] In still further aspects, methods are provided for manufacturing a composition, or unit dose of the present disclosure. In certain embodiments, the methods comprise combining (i) an aliquot of a host cell transduced with a vector of the present disclosure with (ii) a pharmaceutically acceptable carrier. In certain embodiments, vectors of the present disclosure are used to transfect/transduce a host cell (e.g., a T cell) for use in adoptive transfer therapy (e.g., targeting a cancer antigen).
[0208] In some embodiments, the methods further comprise, prior to the aliquotting, culturing the transduced host cell and selecting the transduced cell as having incorporated (i.e., expressing) the vector. In further embodiments, the methods comprise, following the culturing and selection and prior to the aliquotting, expanding the transduced host cell. In any of the embodiments of the instant methods, the manufactured composition or unit dose may be frozen for later use. Any appropriate host cell can be used for manufacturing a composition or unit dose according to the instant methods, including, for example, a hematopoietic stem cell, a T cell, a primary T cell, a T cell line, a NK cell, or a NK-T cell. In specific embodiments, the methods comprise a host cell which is a CD4.sup.+ T cell or a CD8.sup.+ T cell.
EXAMPLES
Example 1
Isolation and Cloning of HA-1.SUP.H.-Specific TCRS
[0209] HA-1.sup.H-specific CD8.sup.+ T cell clones were isolated using in vitro methods previously described (Bleakley et al., Blood 115:4923-4933, 2010 (
[0210] Clones were screened by ?CRA on day 11-13. T cell clones from wells showing specific cytotoxicity, using the above criteria, were expanded using anti-CD3 mAb, IL-2 and feeder cells, by the Rapid Expansion Protocol (REP). The specificity of expanded clones was evaluated by CRA, HA-1/HLA-A2 multimer staining, and intracellular cytokine staining (ICC). The HA-1.sup.H specificity of the CTL clones was verified with HA-1.sup.H/HLA A2 multimers. In particular, HLA-A2/HA-1.sup.H multimer and CD8.sup.+ monoclonal antibody (mAb) were used to stain HA-1 specific clones (clones 1, 2, 10, 13, 14, 16, and 5) and a control clone specific for another tumor antigen (
[0211] In addition, a chromium release assay (CRA) was used to test 7 of the HA-1-specific CTL clones (1, 2, 10, 13, 14, 16 and 5) for killing of HA-1.sup.H peptide-pulsed targets. The T cell clones recognized HA-1.sup.H peptide (VLHDDLLEA)-pulsed target cells at very low peptide concentrations and half-maximal lysis is seen at a peptide concentration of 10 pM. (
[0212] Next, the isolated HA-1.sup.H TCRs were cloned. The TCR V.sub.? and V.sub.?, genes of the 8 CTL were sequenced and 6 distinct TCRs were identified (TCR1 and TCR13 were found to be identical, as were TCR2 and TCR14). The genes (and specific alleles) encoding the 6 TCRs, as well as the V.sub.? CDR3 amino acid sequences of the TCRs, are shown in Table 1:
TABLE-US-00001 TABLE1 Genesand?CDR3sequencesofisolatedTCRs Alpha Beta Vgene Jgene Vgene Dgene Jgene CDR3(aa) TCR1 TRAV17*01F TRAJ28*01F TRVB7- TRBD1*01 TRBJ21*01 CASSSTGGHNEQFF 9*03 TCR13 TRAV17*01F TRAJ28*01F TRVB7- TRBD1*01 TRBJ21*01 CASSSTGGHNEQFF 9*03 TCR2 TRAV21*02F TRAJ40*01F TRVB7- TRBD1*01 TRBJ1-4*01 CASSLVKGEKLFF 9*03 TCR14 TRAV21*02F TRAJ40*01F TRVB7- TRBD1*01 TRBJ1-4*01 CASSLVKGEKLFF 9*03 TCR10 TRAV10*01F TRAG45*01F TRVB7- TRBD2*01 TRBJ27*01 CASSMLTNYEQYF 9*03 TCR16 TRAV21*01 TRAF20*01F TRVB7- TRBD1*01 TRBJ21*01 CASSLVVGNEQFF or*02 9*03 F TCR5 TRAV17 TRAJ29 TRVB7- TRBD1/2 TRBJ2-7 CASSLTTLDEQY 9*03 TCR24 TRAV8-3 TRAJ27 TRBV15 TRBD1*01 TRBJ2-5 ATSKTRIAQETQYF
[0213] A seventh TCR, TCR29 was also identified and sequenced. After sequencing, the genes encoding the HA-1.sup.H TCRs (except for TCR24, which had poor function in transduced CD8.sup.+ T cells) were codon optimized to maximize expression and cysteine modifications were introduced and to reduce the risk of mispairing with endogenous TCR chains, as described below. The nucleotide sequences of the CTL clone TCR? and TCR? genes after codon optimization and cysteine modification are provided in SEQ ID NOs 39-48 and 51-52.
[0214] RNA was extracted from each HA-1.sup.H-specific T cell clone. 5-first-strand cDNA amplification and Rapid Amplification of cDNA Ends (RACE) PCR were performed to identify full-length TCR regions, using a SMARTer RACE cDNA Amplification Kit (Clontech Laboratories). cDNA was synthesized from RNA using 5 CDS Primer A, SMARTer IIA oligo and SMARTScribe Reverse Transcriptase. Subsequently, the cDNA was used to perform a RACE PCR reaction, using Phusion? High Fidelity DNA polymerase, and Gene-Specific Primers for the TCR alpha (?)-(5-GGTGAATAGGCAGACAGACTT-3) (SEQ ID NO:93) or TCR beta (?)-chain (GTGGCCAGGCACACCAGTGT) (SEQ ID NO:94). The RACE PCR product was purified and sequenced to identify the TCR ?- and ?-chains. IMGT/V-QUEST was used to define the TCR variable (V), diversity (D) and joining (J) regions.
[0215] Complementary cysteine residues at positions 48 (Thr to Cys) and 57 (Ser to Cys) were incorporated into the constant domains of the TCR ? and ? genes to increase exogenous TCR pairing and decrease mispairing with the endogenous TCR. To ensure coordinated gene expression, the TCR chains were separated by 2A elements from the porcine teschovirus (P2A). The transgenes were codon-optimized to enhance expression and synthesized by GeneArt (Life Technologies), and were cloned into the pRRLSIN.cPPT.MSCV.WPRE LV vector by restriction digestion and ligation. The amino acid sequences of the encoded TCR constructs are provided in SEQ ID NOS: 53-57.
Example 2
Heterologous Expression and Activity of HA-1.SUP.H.-Specific TCRS
[0216] Next, codon-optimized and cysteine modified TCRs were tested for expression and activity.
[0217] Lentiviral (LV) vectors were used to transduce primary T cells to deliver a polynucleotide encoding the engineered HA-1.sup.Hspecific TCR constructs. The transduced T cells were sorted, expanded, and tested for HA-1.sup.Hspecificity (
[0218] In sum, these data demonstrate that T cells effectively express transduced HA-1.sup.H TCRs and have antigen-specific killing activity against lymphoid cells.
Example 3
[0219] CD8 Co-Receptor Function in CD4.sup.+HA-1.sup.H TCR Cells
[0220] Inclusion of CD4.sup.+ T cells in an immunotherapy cell product can provide antigen-induced IL-2 secretion and augment persistence and function of transferred cytotoxic CD8.sup.+ T cells (see, e.g., Kennedy et al., Immunol. Rev. 222:129 (2008); Nakanishi et al., Nature 462(7272):510 (2009)). However, optimal function of many class I restricted TCR in CD4.sup.+ T cells requires the transfer of a CD8 co-receptor to enhance sensitivity of the TCR to class I HLA peptide complexes. CD4 co-receptors differ in structure to CD8 and cannot effectively substitute for CD8 co-receptors (see, e.g., Stone & Kranz, Front. Immunol. 4:244 (2013); see also Cole et al., Immunology 137(2):139 (2012). Relatively high HA-1.sup.H peptide concentrations were required to induce cytolytic activity in CD4.sup.+ T cells transduced with an HA-1.sup.H TCR alone, and HA-1 TCR CD4.sup.+ T cells did not recognize cell lines or leukemia, implying CD8 co-receptor dependency of the TCR (data not shown).
[0221] Various options for including a CD8 co-receptor in the transgene construct were explored. CD8 co-receptors exist on the surface of human conventional ?? TCR T cells, typically as dimers of CD8a- and ?-chains, and there are five ?-chain variants with different intracytoplasmic tail sequences (13M1-5) (see, e.g., Thakral et al., J. Immunol. 180(11):7431 (2008); see also Thakral et al., PLoS One 8(3):e59374 (2013)). The amino acid sequences of the CD8 co-receptor chains are provided in SEQ ID NOs: 48-53.
[0222] HA-1.sup.H TCR2 constructs were generated that included one or both of the CD8 ?-chain and the CD8 ?-chain as full-length or truncated variants. When used to transduce primary CD4.sup.+ T cells, the ?- and ?-chains were expressed on the cell surface; ?? dimers and a monomers increased HA-1.sup.H/HLA-A2 multimer binding by TCR-transduced T cells to a greater extent than did ? monomers (
Example 4
[0223] Introduction of a Safety Switch into the HA-1.sup.H TCR Constructs
[0224] To ensure that HA-1.sup.H TCR-transduced T cells can be rapidly depleted in case of any unexpected toxicity, four codon-optimized safety switch HA-1.sup.H TCR constructs were generated: (1) The inducible caspase 9 (iCasp9) is based on the fusion of human caspase 9 to a modified human FK-binding protein, allowing conditional dimerization; when exposed to a synthetic dimerizing drug, iCasp9 becomes activated and initiates rapid death of cells expressing this construct (see, e.g., Straathof et al., Blood 105(11):4247 (2005)); (2) The truncated human EGFR (tEGFR) is a polypeptide devoid of extracellular N-terminal ligand binding domains and intracellular receptor tyrosine kinase activity, but retains type I transmembrane cell surface localization and a binding epitope for pharmaceutical-grade anti-EGFR mAb, cetuximab (see Wang et al., Blood 118(5):4255 (2011)); (3) RQR8 is a compact combined marker and safety switch for T cells, combining target epitopes from both CD34 (a marker recognized by antibody QBEnd10) and CD20 antigens (extracellular loop mimotopes) presented on a truncated CD8 co-receptor stalk; RQR8 is bound by the pharmaceutical-grade anti-CD20 mAb, rituximab (see Philip et al., Blood 124(8):1255 (2011)); (4) Myc-tagged TCR incorporate a 10-amino acid tag of the human c-Myc protein that is bound by a tag-specific mAb (see Kieback et al., PNAS 105(2):623 (2008)).
[0225] Binding of the respective mAbs to tEGFR, RQR8 or myc-tag provides a target for complement-dependent or antibody-dependent cellular cytotoxicity and elimination of transduced cells. The safety switch molecules were cloned into TCR2 LV constructs upstream of, and operatively associated with, the TCR? and TCR? coding sequences. The TCR? and TCR? sequences were separated by P2A elements from the porcine teschovirus to ensure coordinated gene expression. T cells transduced with iCasp9-HA-1.sup.H TCR, tEGFR-HA-1.sup.H TCR, RQR8-HA-1.sup.H TCR or Myc-tagged HA-1.sup.H-TCR all demonstrated HA-1.sup.H TCR expression and HA-1.sup.H+ target cell recognition similar to recognition by T cells transduced with the HA-1.sup.H TCR alone (
[0226] To test the ability of the safety switches to eliminate T cells, transduced T cells were incubated for 24 hours with the optimal concentration (
Example 5
Design and Selection of a Transgene Construct
[0227] Next, the HA-1.sup.H TCR transgenes incorporating both iCasp9 and the CD8a4M1 co-receptor were analyzed for functionality. To assist in the selection and tracking of transduced T cells, two marker configurations were designed. In one, the minimal CD34 epitope (Q) of the RQR polypeptide was nested into the ?-chain of the HA-1.sup.H TCR. In the other, the RQR polypeptide was incorporated into the ?-chain of the full-length functional CD8 ??M1 co-receptor. Five LV transgene constructs were then created, used to transduce CD8.sup.+ T cells, and compared: (1) iCasp9-HA-1.sup.H TCR2; (2) HA-1.sup.H-TCR2-CD8 co-receptor; (3) iCasp9-HA-1.sup.H TCR2-CD8; (4) iCasp9-HA-1.sup.H TCR2-RQR-CD8; and (5) iCasp9-CD34-HA-1.sup.H TCR2-CD8 (see
[0228] All of the constructs produced T cells that specifically secreted cytokines and killed HA-1.sup.H+, but not HA-1.sup.H? AML cells or fibroblasts, and had similar function (see
Example 6
Clinical-Scale Production and Testing of HA-1.SUP.H .TCR T Cells
[0229] The cellular composition of T cell immunotherapy products can have important downstream effects on the persistence and function of antigen-specific T cells after adoptive T cell transfer (see, e.g., Sommermeyer et al., Leukemia 30(2):492 (2016); see also Wang et al., Blood 117(6):1888 (2011) and Hinrichs et al., PNAS 106*41):17469 (2009)). In general, infusion of antigen-specific T cells derived from younger T cell subsets, including T.sub.N, T memory stem cells (T.sub.SCM) and central memory T cells (T.sub.CM), appears advantageous. In the context of post-HCT T cell immunotherapy, it is also important to consider the potential for GVHD mediated by the native TCR of donor T cells. T.sub.N cause severe GVHD in murine models and depletion of CD45RA+T.sub.N from PBSC grafts reduces the risk of severe and/or chronic GVHD in humans (see, e.g., Bleakley et al., J. Clin. Invest. 125(7):2677 (2015). It is also desirable to include both CD4.sup.+ and CD8.sup.+ cells specific for the same antigen, as CD4.sup.+ T helper cells can enhance anti-tumor CTL responses by enhancing clonal expansion at the tumor site and preventing activation-induced cell death (see, e.g., Giuntoli et al., Clin. Cancer Res. 8(3):922 (2002); see also Kennedy and Celis, J. Immunol. 177(5):2862 (2006)). Therefore, the T cell product (1-2?10.sup.9 PBSC/PBMC) was first depleted of CD45RA.sup.30 T.sub.N cells to minimize the risk of serious GVHD, and depleted of CD14.sup.+ monocytes to optimize LV transduction efficiency, prior to separating CD8.sup.+ and CD4.sup.+ enriched fractions to ensure a consistent CD4:CD8 composition (approx. 3?10.sup.6 cells of each cell type), and stimulating (CD3/CD28 microbeads beads) and transducing the T cells with the iCasp9-HA1 TCR2-RQR-CD8 LV.
[0230] The transduced cells were flow-sorted using HA-1.sup.H/HLA-A2 multimers and CD34 mAb 4-5 days later, and cultured in G-Rex flasks using REP (Rapid Expansion Protocol) comprising OKT3 cells, PBMC, HA-1.sup.+LCL, and IL-2. The CD4.sup.+ and CD8+HA-1.sup.HTCR memory T cells expanded efficiently, with an average 2000-fold expansion (
[0231] The expanded CD8.sup.+ and CD4.sup.+HA-1.sup.H TCR T cells retained their ability to specifically kill and secrete cytokines in response to stimulation with HA-1.sup.H-pulsed cells (
Example 7
Clinical Study Using the HA-1.SUP.H .T Cell Therapy Product
[0232] A feasibility and safety study is conducted using the HA-1.sup.H cell therapy product described in Example 5 (CD8.sup.+ and CD4.sup.+ memory T cells transduced with pRRLSIN iC9-HA-1.sup.H-TCR2-RQR-CD8; abbreviated hereafter as HA-1.sup.H TCR LV). The patient sample comprises children, adolescents and adults with recurrent leukemia (AML, ALL, another acute leukemia, or CML). Specifically, patients aged 0-70 are enrolled into two age groups of approximately 12 subjects each: one group aged ?16 years, and one group aged <16 years. group. All patients express HLA-A*0201 and have the HA-1(H) genotype (RS_1801284: A/G, A/A). The patients also have an adult donor for HCT who is adequately HLA-matched by institutional standards, and are currently undergoing or have previously undergone allogeneic HCT for AML, ALL, another type of acute leukemia, or chronic myeloid leukemia.
[0233] Bone marrow samples are taken subsequent to a suspected relapse. Patients then generally receive lymphodepleting chemotherapy (fludarabine) prior to infusion with the T cell product. Thereafter, patients are administered a single dose of HA-1.sup.H TCR LV-T cells (approx. 1:1 CD4.sup.+:CD8.sup.+ T.sub.M) when three critera are satisfied: (1) there is evidence of recurrent or refractory disease after HCT; (2) HA-1.sup.H TCR T cells have been generated; and (3) lymphodepleting chemotherapy has been administered (if indicated). HA-1.sup.H TCR LV-T cells are administered by infusion (as rapidly as tolerated through a central venous catheter via gravity or a syringe pump) according to the dosage schedule provided in Table 2.
TABLE-US-00002 TABLE 2 Clinical Dosing Schedule Dose level Dose (HA-1.sup.H TCR T cells) ?1 Up to 3 ? 10.sup.5/kg 0 Up to 1 ? 10.sup.6/kg 1 Up to 3 ? 10.sup.6/kg Starting dose 2 Up to 10 ? 10.sup.6/kg 3 Up to 30 ? 10.sup.6/kg
[0234] At least 1-2 subjects ?16 y.o. are treated prior to treatment of a subject in the younger cohort. In each age group (?16 and <16 years old), patients are treated in cohorts of three or more patients at one of five dose levels of HA-1.sup.H TCR T cells, starting at dose level 1 (3?10.sup.6 HA-1.sup.H TCR T cells/kg). A 28-day period between administration of the investigational agent to consecutive subjects within each age group is observed. Bone marrow samples are taken at days 4, 18, and 32 following infusion of the T cell product. Other aspects of the study include monitoring: the in vivo persistence of transferred HA-1.sup.H TCR T cells in peripheral blood; the ability of HA-1.sup.H TCR T cells to migrate to bone marrow; the function of HA-1.sup.H TCR T cells before and, if possible, after adoptive T cell transfer; whether infusion of HA-1.sup.H TCR T cells is followed by a reduction of leukemia burden; whether infusion of HA-1.sup.H TCR T cells is followed by a reduction of recipient hematopoietic chimerism; and whether infusion of HA-1.sup.H TCR T cells is followed by the appearance or recurrence of signs or symptoms of graft-versus-host disease (GVHD).
[0235] U.S. Provisional Patent Application No. 62/399,291, filed Sep. 23, 2016, to which the present application claims priority, is hereby incorporated herein by reference in its entirety.
[0236] The various embodiments described above can be combined to provide further embodiments. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications and publications to provide yet further embodiments.
[0237] These and other changes can be made to the embodiments in light of the above-detailed description. In general, in the following claims, the terms used should not be construed to limit the claims to the specific embodiments disclosed in the specification and the claims, but should be construed to include all possible embodiments along with the full scope of equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.