APTAMER DYNAMIC RANGE COMPRESSION AND DETECTION TECHNIQUES
20240287583 ยท 2024-08-29
Inventors
- Andrew Slatter (Cambridge, GB)
- Carlo Randise-Hinchliff (San Diego, CA, US)
- Andrew Price (San Mateo, CA, US)
- Niall Anthony Gormley (Little Chesterfield, GB)
- Andrea Manzo (San Diego, CA, US)
- Nithya Subramanian (Cambridge, GB)
- Fiona Kaper (Solana Beach, CA, US)
- David Jones (Huntingdon, GB)
- Steven Norberg (La Mesa, CA, US)
Cpc classification
C12Q1/6839
CHEMISTRY; METALLURGY
International classification
Abstract
Aptamer detection techniques with dynamic range compression are described that permit removal of a portion of more abundant aptamers in an aptamer-based assay. In an embodiment, a mixture of tagged probes and dummy probes can be used such that the dummy probes bind abundant aptamers and in turn are not captured or amplified for detection in downstream steps. Other techniques are also contemplated, including targeted removal of or cleavage of probes that bind to excess aptamers.
Claims
1. A method of aptamer detection, comprising: contacting analytes of a sample with a plurality of aptamers under conditions that permit analyte-aptamer complexes to form, wherein different aptamers of the plurality of aptamers have specific affinity for respective different analytes of the analytes; and detecting the analytes by detecting aptamers of the analyte-aptamer complexes, wherein detecting an individual aptamer of the plurality of aptamers comprises: contacting the individual aptamer with a mixture of first probes, wherein a first complementary region of each first probe of the mixture hybridizes to a first region of the individual aptamer and wherein only a subset of the first probes in the mixture are coupled to an affinity tag; contacting the individual aptamer with a second probe to hybridize a second complementary region of the second probe to a second region of the individual aptamer and wherein the second probe comprises a nonhybridizing region extending from the complementary region, the nonhybridizing region comprising an identification sequence uniquely identifying for the individual aptamer, wherein the first complementary region and the second complementary region uniquely hybridize to the individual aptamer; capturing a first probe of the mixture via binding of the affinity tag to an affinity tag binder to capture the individual aptamer and the second probe hybridized to the second region of the individual aptamer, wherein the first probe is in the subset coupled to the affinity tag; and detecting the identification sequence of the captured second probe.
2. The method of claim 1, wherein the first region and the second region are spaced apart by at least one nucleotide.
3. The method of claim 1, wherein the affinity tag is biotin and the affinity tag capture molecule is avidin or streptavidin.
4. The method of claim 1, wherein detecting the identification sequence of the captured second probe comprises contacting the captured second probe with primers to generate an amplification product.
5. The method of claim 4, wherein the primers comprise a first primer that binds to a first primer binding region of the nonhybridizing region and a second primer that binds to a second primer binding region of the nonhybridizing region, wherein the first primer binding region and the second primer binding region flank the identification sequence.
6. The method of claim 5, wherein the first primer comprises a first sequencing primer and the second primer comprises a second sequencing primer such that the amplification product comprises the first sequencing primer and the second sequencing primer.
7. The method of claim 4, wherein detecting the identification sequence of the captured second probe comprises sequencing the amplification product.
8. The method of claim 1, further comprising generating a notification related to the individual aptamer based on detecting the identification sequence.
9. The method of claim 1, further comprising separating the captured second probe from the captured first probe and the captured individual aptamer before detecting the identification sequence.
10. The method of claim 1, further comprising ligating an oligonucleotide to an end of the captured second probe and extending the ligated oligonucleotide before detecting the identification sequence.
11. The method of claim 1, further comprising hybridizing a first oligonucleotide and a second oligonucleotide to the captured second probe and extending the first oligonucleotide using the captured second probe as a template to ligate the first oligonucleotide to the second oligonucleotide via extension ligation.
12. The method of claim 11, further comprising separating the ligated first oligonucleotide and second oligonucleotide from the captured second probe using a second affinity tag coupled to the second oligonucleotide.
13. The method of claim 12, further comprising hybridizing a third oligonucleotide to the ligated first oligonucleotide and second oligonucleotide and extending the ligated first oligonucleotide and second oligonucleotide and the hybridized third oligonucleotide to generate first and second complementary strands comprising 5 and 3 adapters for sequencing.
14. The method of claim 1, further comprising cleaving at least a portion of the nonhybridizing region comprising the identification sequence from the captured second probe before detecting the identification sequence.
15. The method of claim 14, further comprising ligating a cleaved portion of the captured second probe to an end of an adapter after the cleaving.
16. The method of claim 1, further comprising removing uncaptured probes before detecting the identification sequence.
17. The method of claim 16, wherein the uncaptured probes comprise probes in the mixture not in the subset, wherein the probes not in the subset are not coupled to the affinity tag.
18. An aptamer detection probe set, comprising: a plurality of different first probe mixtures complementary to respective different aptamers of an aptamer panel, wherein an individual first probe mixture of the plurality of different first probe mixtures comprises: a binding subset of first probes coupled to an affinity tag; a dummy subset of first probes not coupled to the affinity tag, and wherein each probe in the binding subset and the dummy subset of the individual first probe mixture comprises a same binding region that is complementary to a first sequence of an individual aptamer of the aptamer panel; and a plurality of different second probes complementary to the respective different aptamers of the aptamer panel, wherein an individual second probe of the plurality of different second probes comprises a second binding region complementary to a second sequence of the individual aptamer and wherein the individual second probe comprises a nonhybridizing region, the nonhybridizing region comprising an identification sequence uniquely identifying for the individual aptamer.
19. The probe set of claim 18, wherein the identification sequence is nonoverlapping with a sequence of the individual aptamer.
20. The probe set of claim 18, wherein the identification sequence is 20 nucleotides or fewer in length.
21. The probe set of claim 18, wherein the individual second probe comprises a cleavage site disposed between the nonhybridizing region and the second binding region.
22. The probe set of claim 18, wherein the nonhybridizing region comprises primer regions that flank the identification sequence.
23. The probe set of claim 18, wherein the binding subset comprises less than 20% of the individual first probe mixture.
24. The probe set of claim 18, wherein a ratio of the binding subset to the dummy subset is less than 1:1 in the individual first probe mixture.
25. The probe set of claim 18, comprising a second first probe mixture of the plurality of different comprising: a second binding subset of first probes coupled to an affinity tag; a second dummy subset of first probes not coupled to affinity tag, and wherein each probe in the second binding subset and the second dummy subset of the second first probe mixture comprises a same second binding region that is complementary to an second aptamer of the aptamer panel, the second aptamer being different than the individual aptamer and the second binding region being different than the binding region.
26. The probe set of claim 25, wherein a first ratio of the binding subset to the dummy subset in the individual first probe mixture is different than a second ratio of the second binding subset to the second dummy subset in the second first probe mixture.
27. An aptamer detection probe set, comprising: a plurality of different first probe mixtures complementary to respective different aptamers of an aptamer panel, wherein each first probe mixture of the plurality of different first probe mixtures comprises: a binding subset of first probes; a dummy subset of first probes not coupled to affinity tag, and wherein each first probe mixture comprises a binding region that is complementary to an aptamer of the aptamer panel, and wherein the binding region is unique to each first probe mixture such that each first probe mixture binds to a different aptamer of the aptamer panel, wherein each first probe mixture has a different ratio of the binding subset to the dummy subset relative to the other first probe mixtures of the plurality; and a plurality of different second probes complementary to the respective different aptamers of the aptamer panel.
28. The probe set of claim 27, wherein the plurality of different first probe mixtures comprises at least 100 different first probe mixtures.
29. An aptamer detection probe set, comprising: a plurality of different reporter probe mixtures complementary to respective different aptamers of an aptamer panel, wherein an individual reporter probe mixture of the plurality of different reporter probe mixtures comprises: a first subset of reporter probes comprising an amplifiable nonhybridizing region, the nonhybridizing region comprising an identification sequence uniquely identifying for an individual aptamer that is flanked by a first primer region and a second primer region and that is capable of being amplified using primers complementary to or corresponding to the first primer region and the second primer region; and a second subset of reporter probes, and wherein each probe in the first subset and the second subset of the individual reporter probe mixture comprises a same binding region that is complementary to a first sequence of an individual aptamer of the aptamer panel, wherein the individual second probe comprises a nonamplifiable nonhybridizing region that is not capable of being amplified using the primers; and a plurality of different capture probes complementary to the respective different aptamers of the aptamer panel, wherein an individual capture probe of the plurality of different capture probes comprises a second binding region complementary to a second sequence of the individual aptamer and, wherein each capture probe of the plurality is coupled to an affinity tag.
30. The probe set of claim 29, wherein the nonamplifiable nonhybridizing region does not comprise one or both of the first primer region and the second primer region.
31. The probe set of claim 29, wherein the nonamplifiable nonhybridizing region does not comprise the identification sequence.
32. The probe set of claim 29, wherein the nonamplifiable nonhybridizing region comprises at least one extension blocker.
33. The probe set of claim 29, wherein the nonamplifiable nonhybridizing region comprises a restriction enzyme site.
34. A method of aptamer detection, comprising: contacting an individual aptamer with reporter probes that hybridize a first region of the individual aptamer, wherein a first subset of the reporter probes comprise an amplifiable nonhybridizing region, the amplifiable nonhybridizing region comprising an identification sequence uniquely identifying for the individual aptamer that is flanked by a first primer region and a second primer region and a second subset comprise a nonamplifiable nonhybridizing region; contacting the individual aptamer with a capture probe, wherein the capture probes hybridize to a second region of the individual aptamer and wherein the capture probe is associated with an affinity tag; capturing the capture probe via binding of the affinity tag to an affinity tag binder to capture the individual aptamer and the reporter probe comprising the amplifiable nonhybridizing region hybridized to the first region of the individual aptamer; and detecting the identification sequence of the captured reporter probe via amplification of the identification sequence.
35. The method of claim 34, wherein detecting the identification sequence of the captured reporter probe comprises contacting the captured reporter probe with primers to generate an amplification product.
36. The method of claim 35, wherein the primers comprise a first primer that binds to a first primer binding region of the nonhybridizing region and a second primer that corresponds to a second primer binding region of the nonhybridizing region, wherein the first primer binding region and the second primer binding region flank the nonhybridizing region.
37. The method of claim 35, wherein detecting the identification sequence of the captured reporter probe comprises sequencing the amplification product.
38. The method of claim 34, wherein reporter probes comprising the nonamplifiable nonhybridizing region hybridized to the first region of the individual aptamer are not detected.
39. A method of aptamer detection, comprising: contacting aptamers with probes that hybridize to respective different aptamers of the aptamers, wherein a complementary region of each probe hybridizes to an individual aptamer of the aptamers and wherein each probe comprises a nonhybridizing region extending from the complementary region, the nonhybridizing region comprising an identification sequence uniquely identifying for each individual aptamer; using an exonuclease to remove excess probes not hybridized to the aptamers; and detecting the identification sequence in the probes after removing the excess probes.
40. A method of aptamer detection, comprising: contacting a first aptamer and a second aptamer with reporter probes, the reporter probes comprising a first subset that hybridize to the first aptamer and a second subset that hybridize to the second aptamer, wherein the reporter probes of the first subset comprise a first nonhybridizing region comprising a first identification sequence uniquely identifying for the first aptamer and a first group capture sequence and wherein the reporter probes of the second subset comprise a second nonhybridizing region comprising a second identification sequence uniquely identifying for the second aptamer and the first group capture sequence; contacting the first aptamer and the second aptamer with capture probes, wherein the capture probes hybridize to the first aptamer or the second aptamer and wherein the capture probes are associated with an affinity tag; capturing the capture probes via binding of the affinity tag to an affinity tag binder to capture the first aptamer and the second aptamer and the reporter probes; generating first oligonucleotides comprising the first identification sequence and the first group capture sequence from the first subset and second oligonucleotides comprising the second identification sequence and the first group capture sequence from the second subset; capturing the first oligonucleotides and the second oligonucleotides using a first group of beads carrying a sequence complementary to the first group capture sequence; and detecting the first identification sequence in the captured first oligonucleotides and the second identification sequence in the second oligonucleotides to detect the first aptamer and the second aptamer.
41. The method of claim 40, comprising contacting a third aptamer with the reporter probes, the reporter probes comprising a third subset comprise a third nonhybridizing region comprising a third identification sequence uniquely identifying for the third aptamer and a second group capture sequence different than the first group capture sequence.
42. The method of claim 41, comprising: generating third oligonucleotides comprising the third identification sequence and the second group capture sequence from the third subset; capturing the third oligonucleotides using a second group of beads carrying a sequence complementary to the second group capture sequence; and detecting the third identification sequence in the captured third oligonucleotides to detect the third aptamer.
43. The method of claim 42, wherein the first group of beads and the second group of beads comprise about a same number of beads.
44. A method of aptamer detection, comprising: contacting an individual aptamer with a first reporter probe that hybridizes to a first region of the individual aptamer, wherein the first reporter probe comprises a first nonhybridizing region, the nonhybridizing region comprising a first identification sequence uniquely identifying for the individual aptamer and with a second reporter probe that hybridize to a second region of the individual aptamer, wherein the second reporter probe comprises a second nonhybridizing region, the second nonhybridizing region comprising a second identification sequence uniquely identifying for the individual aptamer; ligating ends of the first identification sequence and the second identification sequence to one another to generate ligated reporter probes; capturing ligated reporter probes using an affinity tag coupled to the first reporter probe or the second reporter probe; and detecting the first identification sequence and the second identification sequence via amplification of the captured ligated reporter probes to detect the individual aptamer.
45. The method of claim 44, comprising hybridizing a single-stranded oligonucleotide splint to the first reporter probe and the second reporter probe.
46. The method of claim 44, comprising using one or more exonucleases to digest other reporter probes not bound to the individual aptamer or other aptamers.
47. The method of claim 44, comprising using ligase to circularize the captured ligated reporter probes.
48. The method of claim 44, wherein the first reporter probe comprises a first primer region and wherein the second reporter probe comprises a second primer region, and wherein the amplification uses primers complementary to or corresponding to the first primer region and the second primer region.
49. The method of claim 48, wherein the first primer region is positioned between the first identification sequence and a sequence that bind to the aptamer on the first reporter probe.
50. The method of claim 49, wherein the second primer region is positioned between the second identification sequence and a sequence that bind to the aptamer on the second reporter probe.
51. A method of aptamer detection, comprising: contacting analytes of a sample with a plurality of aptamers under conditions that permit analyte-aptamer complexes to form, wherein different aptamers of the plurality of aptamers have specific affinity for respective different analytes of the analytes; and detecting the analytes by detecting aptamers of the analyte-aptamer complexes, wherein detecting an individual aptamer of the plurality of aptamers comprises: contacting the individual aptamer with a mixture of first probes, wherein a first complementary region of each first probe of the mixture is capable of hybridizing to a first region of the individual aptamer and wherein only a subset of the first probes in the mixture are coupled to an affinity tag such that a first probe of the mixture hybridizes to the first region of the individual aptamer; contacting the individual aptamer with a second probe to hybridize a second complementary region of the second probe to a second region of the individual aptamer and wherein the second probe comprises a nonhybridizing region extending from the complementary region, the nonhybridizing region comprising an identification sequence uniquely identifying for the individual aptamer, wherein the first complementary region and the second complementary region uniquely hybridize to the individual aptamer; ligating the first probe hybridized to the first region of the individual aptamer to the second probe hybridized to the second region of the individual aptamer; capturing the first probe via binding of the affinity tag to an affinity tag binder to capture the individual aptamer and the second probe hybridized to the second region of the individual aptamer and ligated to the first probe, wherein the first probe is in the subset coupled to the affinity tag; and detecting the identification sequence of the captured second probe.
52. A method of aptamer detection, comprising: contacting analytes of a sample with a plurality of aptamers under conditions that permit analyte-aptamer complexes to form, wherein different aptamers of the plurality of aptamers have specific affinity for respective different analytes of the analytes; and detecting the analytes by detecting aptamers of the analyte-aptamer complexes, wherein detecting an individual aptamer of the plurality of aptamers comprises: contacting the individual aptamer with a mixture of first probes, wherein a first complementary region of each first probe of the mixture hybridizes to a first region of the individual aptamer and wherein only a subset of the first probes in the mixture are coupled to an affinity tag; contacting the individual aptamer with a second probe to hybridize a second complementary region of the second probe to a second region of the individual aptamer and wherein the second probe comprises a nonhybridizing region extending from the complementary region, the nonhybridizing region comprising an identification sequence uniquely identifying for the individual aptamer, wherein the first complementary region and the second complementary region uniquely hybridize to the individual aptamer; capturing a first probe of the mixture via binding of the affinity tag to an affinity tag binder to capture the individual aptamer and the second probe hybridized to the second region of the individual aptamer, wherein the first probe is in the subset coupled to the affinity tag; generating amplification products from the captured second probe using a primer pair, wherein the primer pair comprises a first primer complementary to a region of the second probe that does not include the second complementary region and that does not include the identification sequence; and sequencing the amplification products.
53. The method of claim 52, wherein the nonhybridizing region of the second probe comprises a first adapter sequence and a second adapter sequence that flank the identification sequence.
54. The method of claim 53, wherein the primer pair comprises sequences complementary to or comprising portions of the first adapter sequence or the second adapter sequence.
55. The method of claim 53, wherein sequencing the amplification products comprises using sequencing primers complementary to or comprising portions of the first adapter sequence or the second adapter sequence.
56. The method of claim 53, wherein the first adapter sequence comprises a first index sequence and the second adapter sequence comprises a second index sequence.
57. The method of claim 52, comprising separating the captured first probe from the first probes in the mixture not coupled to the affinity tag via a wash step.
58. The method of claim 57, wherein the wash step comprises six or fewer washes.
59. A sequencing method, comprising: generating sequence data from a sequence library, wherein the sequence library is prepared by: contacting analytes of a sample with a plurality of aptamers under conditions that permit analyte-aptamer complexes to form, wherein different aptamers of the plurality of aptamers have specific affinity for respective different analytes of the analytes; forming a first plurality of aptamer complexes of a first type by hybridizing a reporter probe and a dummy probe to an individual aptamer of the plurality of aptamers, wherein the dummy probe comprises a first complementary region that hybridizes to a first region of the individual aptamer and wherein the reporter probe comprises a second complementary region that hybridizes to a second region of the individual aptamer and a nonhybridizing region extending from the complementary region, the nonhybridizing region comprising an identification sequence uniquely identifying for the individual aptamer; forming a second plurality of aptamer complexes of a second type by hybridizing the reporter probe and a capture probe to the individual aptamer, wherein the capture probe comprises the first complementary region that hybridizes to a first region of the individual aptamer and an affinity tag; separating the second plurality of aptamer complexes from the first plurality via the affinity tag to generate a separated second plurality of aptamer complexes; and amplifying a portion of the reporter probes of the separated second plurality of aptamer complexes to generate the sequence library; identifying the identification sequence in the sequence data; and generating a notification that the individual aptamer is present in the sample based on the identifying.
60. The method of claim 59, wherein the notification is displayed on a display of a sequencing device or a computer in communication with the sequencing device.
61. The method of claim 59, wherein generating sequence data from a sequence library using sequencing primers complementary to or comprising portions of the amplified portions of the reporter probes.
62. The method of claim 59, wherein the sequence library is formed by forming additional pluralities of aptamer complexes of the first type and the second type for the different aptamers of the plurality of aptamers.
63. The method of claim 62, comprising identifying respective identification sequences of the different aptamers in the sequence data and generating notifications that the different aptamers are present in the sample based on the identifying.
64. The method of claim 59, wherein generating the sequence data comprises generating sequence reads comprising the identification sequence using a first sequencing primer and generating sequence reads comprising an index associated with the sample using a second sequencing primer.
65. The method of claim 59, wherein generating the sequence data comprises operating a sequencing device to incorporate dark cycles.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] These and other features, aspects, and advantages of the disclosed embodiments will become better understood when the following detailed description is read with reference to the accompanying drawings in which like characters represent like parts throughout the drawings, wherein:
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042] 17B shows an example split reporter probe technique using a splint, according to an embodiment;
[0043] 17C shows ligation products of a split reporter probe technique;
[0044] 17D shows efficiency of generating ligation products over time of a split reporter probe technique;
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
DETAILED DESCRIPTION
[0064] The following discussion is presented to enable any person skilled in the art to make and use the technology disclosed, and is provided in the context of a particular application and its requirements. Various modifications to the disclosed implementations will be readily apparent to those skilled in the art, and the general principles defined herein may be applied to other implementations and applications without departing from the spirit and scope of the technology disclosed. Thus, the technology disclosed is not intended to be limited to the implementations shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.
[0065] Aptamers are short single stranded nucleic acid molecules (ssDNA or ssRNA) that can bind to their specific target molecules with high affinity. Accordingly, aptamers can be used for multiomic applications, such as proteome characterization of a sample in a high-throughput manner. For assessment of proteins in complex samples in a high-throughput approach, combining aptamers to high-abundancy proteins together with low-abundancy proteins in a single panel is challenging. For example, human serum/plasma contains proteins can differ in concentration by many orders of magnitude, e.g., a 10-log range. Certain aptamer detection platforms can compress the dynamic range of detected proteins. However, even after compression, the dynamic range can nonetheless be relatively large.
[0066] Disclosed herein are techniques to compress a dynamic range of aptamers with positive binding results (e.g., that bind to target molecules in a sample) and that may occur before or in conjunction with an aptamer detection step. The techniques preserve the aptamer binding for low-abundancy proteins that are assessed together with high-abundancy proteins. Further, because low-abundancy proteins may correspond to biomarkers that can be used for diagnostic purposes, the disclosed techniques prevent noise or false negative results of an aptamer-based assay caused by high-abundancy proteins obscuring the results. In addition, reducing the dynamic range can also reduce the amount of total sequencing data required to detect aptamers in a detection assay by reducing the amounts of reads wasted on high-abundance aptamer sequences. In certain embodiments, the disclosed techniques may provide streamlined workflows with reduced equipment burden via reduction in a number of steps (e.g., single hybridization reactions or reduced number of wash steps). The disclosed techniques may include sample preparation steps and/or sample preparations that permit improved aptamer abundance measurement.
[0067]
[0068] Using the conserved sequence of the aptamer 14a, a probe set 20 can be designed that includes first probes 22 that hybridize to a first region 23 of the aptamer 14a (e.g., via complementary sequences) and second probes 24 that hybridize to a second region 25 of the aptamer 14a. The first probes 22 are a mixture of at least two different types of probes, both sharing the ability to hybridize to the first region 23. As illustrated, the mixture includes affinity-tagged probes 28 that include an affinity tag 30 and dummy probes 32 lacking the affinity tag 30. In an embodiment, the affinity-tagged probes 28 and the dummy probes 32 are identical other than the presence or absence of the affinity tag 30. The ratio of the affinity-tagged probes 28 to the dummy probes 32 can be tuned based on the abundancy of the target of the aptamer 14a, as generally discussed herein.
[0069] The workflow includes a step of contacting the aptamers 14a with the probe set 20, e.g., with the first probes 22 and the second probes 24. Because the affinity-tagged probes 28 to the dummy probes 32 of the first probes 22 both have a same binding ability and specificity for the first region 23 of the aptamer 14a, contact of the first probes with the aptamer 14a results in both the affinity-tagged probes 28 and the dummy probes 32 binding. If the affinity-tagged probes 28 are rare (e.g., less than 10% by way of example) within the mixture of first probes 22, most of the aptamer 14a will be bound to dummy probes 32. Further, all of the second probes 24 can be identical to one another. Thus, two different types of tri-molecular complexes are formed for the aptamer 14a. A first type 33 includes the second probe 24 and the dummy probe 32. A second type 34 includes the second probe 24 and the affinity-tagged probe 28. Again, because the first probes 22 are provided as a mixture, the relative ratio of the first type 33 and second type 34 of tri-molecular complex is dependent on the ratio of the affinity-tagged probes 28 to the dummy probes 32 in the first probes 22. The ratio of affinity-tagged probes 28 to the dummy probes 32 can be selected for each aptamer in the assay based on its relative abundance to the other aptamers to compress the dynamic range for downstream detection, e.g., via NGS.
[0070] The workflow also includes a step of separating the first type 33 of tri-molecular complex from the second type 34 of tri-molecular complex via a capture entity. For example, only the second type 34 of tri-molecular complex can be captured using the capture entity, illustrated here as a capture bead 36 coupled to an affinity tag binder 38. However, other arrangements are also contemplated, including column-based, flow-cell based, or substrate-based separation using a capture entity that binds to the affinity tag 30. The unbound first type 33 can be washed or separated, leaving only the second type 34 of tri-molecular complex and its component molecules, the aptamer 14a, the affinity-tagged probe 28, and the second probe 24. In addition, unbound or uncaptured probes of the probe set 20 are also removed. The workflow also includes detection, such as via sequencing, of the second probe 24 or oligonucleotides amplified or otherwise derived from the second probe 24, as a proxy measure of the aptamer 14a as generally discussed herein.
[0071]
[0072] In the illustrated example, the high-abundancy aptamer 14a can be expected to be present at a higher concentration on an aptamer-based assay eluate relative to the low-abundancy aptamer 14b based on, for example, empirical studies or retrospective analysis. Thus, to compress the dynamic range at the downstream detection step, different mixtures of first probes in the probe set 20a, 20b can be used based on the predicted abundancy. For the high-abundancy aptamer 14a, relatively more of the aptamer-bound dummy complexes can be removed via binding to the dummy probe 32a. Thus, the dummy probes 32a can be present in a higher percentage in the first probes 22a. To convert less of the aptamer 14b via dummy binding prior to the detection step, the dummy probes 32b can be present in a relatively lower percentage in the first probes 22b. In one embodiment, the percentage of dummy probes 32b can be 0%. That is, for certain aptamers, the probes 22 can only include tagged probes 28 and include no dummy probes 32. Thus, the ratio of the dummy probes 32 to the affinity-tagged probes 28 can be tuned and can be different for different aptamers 14. In a high-throughput assay, each individual aptamer 14 can be associated with a different ratio of dummy probes 32 to the affinity-tagged probes 28 in an embodiment.
[0073] In embodiments, the ratio of the dummy probes 32 to the affinity-tagged probes 28 in the mixture of first probes 22 can be more than more than 100,000:1, more than 10,000:1, more than 1000:1, more than 100:1, more than 20:1, more than 10:1, more than 5:1, more than 2:1, about 1:1, less than 1:2, or less than 1:5. In an embodiment, the mixture of first probes 22 only includes dummy probes 32 or affinity-tagged probes 28, and no other probe types. In embodiments, the dummy probes 32 are at least 25%, at least 50%, at least 75%, or at least 90% of the mixture of first probes 22. In an embodiment, the mixture of first probes 22 only includes dummy probes 32 or affinity-tagged probes 28, and no other probe types. In an embodiment, the first probes 22 only include affinity-tagged probes 28 and do not include any dummy probes 32. For example, for very low abundancy proteins, it may not be desirable to lose any aptamer 14 via removal.
[0074] In a high-throughput assay, each individual aptamer 14 can be associated with a different ratio of dummy probes 32 to the affinity-tagged probes 28 in an embodiment such that each individual aptamer 14 has a unique ratio relative to other aptamers 14 used together in a panel or assay. In an embodiment, certain groups of aptamers 14 all associated with an approximate abundancy range can have a same ratio of dummy probes 32 to the affinity-tagged probes 28 relative to one another. In embodiments, for a high-throughput assay, at least 3 different ratios of dummy probes 32 to the affinity-tagged probes 28 are present for a group of at least 1000 different aptamers 14. In embodiments, at least 5, 10, 50, 100, or more different ratios of dummy probes 32 to the affinity-tagged probes 28 are present for aptamers 14 of an assay.
[0075] The workflow includes the step of contacting the aptamers 14a, 14b with the probe sets 20a, 20b e.g., with the first probes 22a, 22b and the second probes 24a, 24b. It should be understood that the first probes 22a, 22b have binding ability and specificity for the different first regions 23a, 23b, and, therefore, have different nucleic acid sequences. Similarly, the second probes 24a, 24b have binding ability and specificity for the different second regions 25a, 25b and, therefore, have different nucleic acid sequences. Contact with the probe sets 20a, 20b causes formation of tri-molecular complexes of the first type 33a, 33b and the second type 34a, 34b. Thus, in the illustrated example, because of the different ratios of dummy probes 32 to the affinity-tagged probes 28 in the first probes 22a, 22b relative to one another, different ratios of the first type 33a, 33b of tri-molecular complex and the second type 34a, 34b of tri-molecular complex are formed between the different aptamers 14a, 14b. Because aptamer 14a is more abundant, a greater percentage of the first type 33a can be formed and, subsequently, removed, at the capture step using the affinity tag 30 and the capture entity, e.g., the capture bead 36 and affinity tag binder 38. The affinity tag 30 can be a same tag for all affinity-tagged probes 28, permitting capture of all of the second typed 34 of tri-molecular complexes in a same manner.
[0076] It should be understood that, in embodiments, for the high-abundancy aptamer 14a, even if the majority of the complex formation is of the first type 33a such that at least 50%, at least 75%, or at least 90% is removed, the high-abundancy aptamer 14a may nonetheless be present in greater amounts at detection, simply due to the higher overall starting concentration relative to the low-abundancy aptamer 14b. That is, 1% of the high-abundancy aptamer 14a may be greater than 100% of the low abundancy aptamer 14b. However, the disclosed techniques can compress the dynamic range by one log, two logs, or more based on tuning of the ratios or other techniques as discussed herein.
[0077] The disclosed techniques include workflow in which tri-molecular complexes are formed, and an affinity-tagged probe 28 used to capture the aptamer 14 is separate from a second probe 24 that is detected.
[0078]
[0079] The first region 23 and the second region 25 can be contiguous or adjacent to one another, e.g., with zero nucleotide separation. A contiguous arrangement of the first probe 22 and the second probe 24 may facilitate workflows in which the first probe 22 and the second probe 24 are ligated to one another, e.g., directly ligated at respective ends, subsequent to aptamer binding. In an embodiment, the first probe 22 and/or the second probe 24 may include matched overhangs or may be blunt end, depending on the desired ligation protocol. Ligation of the first probe 22 to the second probe 24 can provide the advantage of reducing variance of melting temperatures between the sets of different probes used in a workflow and can also avoid the need for Tm enhanced probes. Further, ligation can facilitate higher stringency washes for greater background removal and/or a reduced number of washes for streamlined workflow. In an embodiment, a ligation-based approach may also contribute to dynamic range compression. For example, the first probe 22 and/or the second probe 24 may be provided as a mixture with dummy probes. In an embodiment, the second probe 24 may be provided as a mixture including both a ligatable version that includes a 5 phosphate for ligation and a nonligatable version, having a same sequence and aptamer binding capability as the ligatable version, but without the available 5 phosphate. The ratio of the nonligatable version and the ligatable version may be tuned based on aptamer abundance. Highly abundant aptamers may be provided with a probe mixture having less of the ligatable version in the mixture relative to aptamers of lower abundance. After ligation to available ligatable version, the melting temperature and binding of the ligated product would be higher. Thus, higher stringency washes would result in retention of the ligated product and loss of the non-phosphorylated but bound nonligatable version. In one embodiment, the ligated probes can be protected and separated from nonligated reporter probes 24 with a 5 affinity reagent such as biotin bound to streptavidin on the beads, and free probes can be digested using an exonuclease, as discussed in
[0080] The second probe also includes a nonhybridizing region 64 that extends away from the second complementary region 62 and that does not hybridize to the aptamer 14. Thus, the sequence of the nonhybridizing region 64 can be selected to avoid substantial complementarity with a sequence of the aptamer 14. The nonhybridizing region 64 can be used for detection as a proxy for the aptamer 14. Accordingly, the nonhybridizing region 64 can include a bar code or identification sequence 68 that is unique to the individual aptamer 14. Thus, different aptamers 14 are associated with respective different identification sequences 68 that are all different from one another and are uniquely identifying. In an embodiment, uniquely identifying sequences are uniquely identifying while accounting for barcode errors (e.g., a 1-2 nucleotide sequence error) during sequencing. Further, the identification sequence 68 may be designed such that the identification sequence 68 is different from the aptamer sequence.
[0081] To facilitate detection, the nonhybridizing region 64 can include a first primer region 70 and a second primer region 72 that flank the identification sequence 68 such that amplification of the nonhybridizing region 64 using primers 74, 76, to generate amplification products 80 as generally discussed herein, will amplify the identification sequence 68 to permit detection of the aptamer 14. In an embodiment, the amplification is part of preparation of a sequencing library for sequencing.
[0082] Because the nonhybridizing region 64 is single-stranded, the first primer region 70 can represent a primer binding site that is a reverse complement of a first primer 74, while the second primer region 72 can correspond to the sequence of a second primer 76 that binds to an amplified strand generated from the first primer 74.
[0083]
[0084]
[0085] A nonhybridizing region 64 can include a minimum sequence of just the primer regions 70, 72 flanking the identification sequence to introduce an adapter sequence, such as examples of sequences, or their complements, for primer 1 and primer 2 used in Illumina? sequencing preparations, A14, B15, during amplification. In other embodiments, universal capture primer sequences and/or sample index sequences can be incorporated into oligonucleotides generated from the reporter probes 24, such as via amplification and/or ligation and extension. Certain arrangements that include indexes may incorporate a custom or bridged primer during sequencing to accommodate the different indexes. Other embodiments may include custom options for sequencing libraries using single reads from surface P5 for example, or for adding dark sequencing by synthesis cycles where common sequences exist in adapter regions.
[0086] The adapter sequences A14-ME, ME, B15-ME, ME, A14, B15, and ME are provided below:
TABLE-US-00001 A14-ME: (SEQIDNO:1) 5-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3 B15-ME: (SEQIDNO:2) 5-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3 ME: (SEQIDNO:3) 5-phos-CTGTCTCTTATACACATCT-3 A14: (SEQIDNO:4) 5-TCGTCGGCAGCGTC-3 B15: (SEQIDNO:5) 5-GTCTCGTGGGCTCGG-3 ME: (SEQIDNO.:6) AGATGTGTATAAGAGACAG
[0087] The primer region or primer binding region can include a region having the sequence of a universal Illumina? capture primer or a region specifically hybridizing with a universal Illumina? capture primer. Universal Illumina? capture primers include, e.g., P5 5-AATGATACGGCGACCACCGA-3 ((SEQ ID NO: 7)) or P7 (5-CAAGCAGAAGACGGCATACGA-3 (SEQ ID NO: 8)), or fragments thereof. A region specifically hybridizing with a universal Illumina? capture primer can include, e.g., the reverse complement sequence of the Illumina? capture primer P5 (anti-P5: 5-TCGGTGGTCGCCGTATCATT-3 (SEQ ID NO: 9) or P7 (anti-P7: 5-TCGTATGCCGTCTTCTGCTTG-3 (SEQ ID NO:10)), or fragments thereof.
[0088] A conserved primer region can additionally or alternatively include a region having the sequence of an Illumina? sequencing primer, or fragment thereof, or a region specifically hybridizing with an Illumina? sequencing primer, or fragment thereof. Illumina? sequencing primers include, e.g., SBS3 (5-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3 (SEQ ID NO: 11)) or SBS8 (5-CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3 (SEQ ID NO: 12)). A region specifically hybridizing with an Illumina? sequencing primer, or fragment thereof, can include, e.g., the reverse complement sequence of the Illumina? sequencing primer SBS3 (anti-SBS3: 5-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3 (SEQ ID NO: 13)) or SBS8(anti-SBS8:
[0089] 5-AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG-3 (SEQ ID NO: 14)), or fragments thereof. The incorporation of sequencing primer sequences in the reporter probes may be either directly or via subsequent amplification, ligation, or other sequencing library preparation steps.
[0090] In an embodiment, the disclosed amplification products 80 may include amplification products that differ from one another based on different identification sequences 68 but that have conserved or universal primer regions 70, 72. In this manner, a single primer set can be used to amplify reporter probes 24 that have variable identification sequences 68. Provided herein are library preparation kits that include primers 74, 76 that are capable of generating the amplification products 80 from the reporter probes 24 to generate sequencing libraries. The sequence of the primers 74, 76 is based on the sequencing of the first primer binding region 70 and the second primer binding region 72. However, it should be understood that these arrangements are by way of example, and the primer regions 70, 72 for primer binding may be selected to be compatible with other library preparations.
[0091] In an embodiment, the sequencing may use Illumina? NGS primers. The following primers are shown by way of example.
TABLE-US-00002 Read1 (SEQIDNO:15) 5TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG3 Read2 (SEQIDNO:16) 5GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG PairedEndRead (SEQIDNO:17) 15ACACTCTTTCCCTACACGACGCTCTTCCGATCT PairedEndRead2 (SEQIDNO:18) 5CGGTCTCGGCATTCCTGCTGAACCGCTC TTCCGATCT Index1Read (SEQIDNO:19) 5CAAGCAGAAGACGGCATACGAGAT[i7] GTCTCGTGGGCTCGG Index2Read (SEQIDNO:20) 5AATGATACGGCGACCACCGAGATCTAC AC[i5]TCGTCGGCAGCGTC
[0092] It should be understood that the index read primers may be designed to include the particular index sequence associated with a particular sample in an aptamer-based assay. Thus, the index primers may have a nucleotide region, shown as i5 or i7, that varies in sequence between different samples of a multiplexed sample. Other samples in the run can be prepared with primers that include their respective indexes. Accordingly, certain sequence reads may be obtained with universal primers while other sequence reads are obtained with primers or a mix of primers that are specific to indexes of one or more samples in a multiplexed reaction.
[0093] In an embodiment, unique molecular identifiers (UMIs) may be incorporated onto the reporter probes 24, e.g., via ligation. UMIs are short sequences used to uniquely tag each molecule in a sample library to provide error correction and reduce sequencing bias.
[0094]
[0095] Example sequencing techniques based on amplification products 80 of the reporter probes of
[0096] Lack of ME sequences, as in Option 3, may involve nonstandard sequencing. In the illustrated example, the index information as well as the identification sequence can be obtained from a single sequence read using a p5 primer by way of example. However, certain cycles are run as dark cycles, e.g., chemistry only in which no images are taken and/or analyzed. Accordingly, certain sequencing embodiments may be used in conjunction with specific operating instructions for a sequencing device, as discussed with respect to
[0097]
[0098]
[0099]
[0100]
[0101] Adapters for sequencing or other assays may be added in subsequent ligation and/or PCR steps. Relatively longer reporters may include integral adapters, but may be more expensive, less pure, and/or, if too long, less feasible to synthesize due to lower yields. Accordingly, in certain embodiments, adapter incorporation via direct or indirect ligation steps may be used to modify a relatively shorter reporter probe 24 that participates in aptamer binding but that does not include the adapter sequences (e.g., index sequences, primer binding sequences, functional sequences). The disclosed adapter ligation techniques may be used in conjunction with the dynamic range compression workflows as provided herein, e.g., using dummy probes or reporters. Further, in certain embodiments, the disclosed adapter ligation techniques as discussed herein may be PCR-free workflows that avoid thermocycling. In an embodiment, a PCR-free workflow provides an advantage of reduced potential amplicon contamination and removing the requirement for separate areas for pre and post PCR working.
[0102]
[0103] Once captured, uncaptured components are removed, and the nonhybridizing region 64 can be cleaved to expose a 5 end. The cleavage may be mediated by cleavage of a U base by uracil-DNA glycosylase. After cleaving, the 5 adapter 94 ligation can be facilitated by a by a 5 splint 97 that, when hybridized, forms a partially double-stranded ligation region, and the 3 adapter 96 ligation can be facilitated by a 3 splint 98 that forms a partially double-stranded ligation region at the 3 end. The illustrated dotted arrow is a polymerase extension from B15 that copies the index using a template i7, to add the index complement to the reporter via extension. The extension could include extension to copy completely the p7 without ligation entirely by extending from the B15 end, or may add the p7 to allow for extension-ligation. The polymerase may be a non-strand displacing and without 5-3 exonuclease activity. In an embodiment, an Illumina extension ligation mix is used. After ligation, and denaturation of the splints 97, 98, the remaining oligonucleotide can be amplified for detection as generally discussed herein.
[0104]
[0105] Once captured, the reporter probe 24 and aptamers 14 can be eluted from the capture entity and the capture probe 28. In this workflow, the reporter probe 24 carries a first region 100 that corresponds to a portion of a 5 adapter sequence and a second region 102 that correspond to a portion of a 3 adapter sequence. The full 5 and 3 adapter sequences may represent respective end adapter sequences that, when present, permit oligonucleotides to be used as part of a sequencing library for NGS sequencing that, in embodiments, may be used to sequencing the identification sequence 68 as part of aptamer detection. In the illustrated workflow, rather having the reporter probe 24 carry the full 5 and 3 adapter sequences, the reporter probe carries only part of these sequences and is relatively shorter. For example, the total reporter probe length may be about 70 nucleotides in one example. In embodiments, the reporter probe 24 can be between 50-80 nucleotides. The full 5 and 3 sequences are incorporated onto the ends via extension ligation as illustrated.
[0106] As illustrated, oligonucleotide 110, carrying a first region complement 111, and oligonucleotide 120, carrying a second region complement 122, hybridizes to the reporter probe 24. The oligonucleotide 110 includes an adapter region 124 that does not hybridize to the reporter probe 24, e.g., is not complementary to the complementary region 62. The oligonucleotide 112 includes an adapter region 130 that does not hybridize to the reporter probe 24 and an affinity tag 30. This hybridization may occur after elution of aptamers from aptamer beads. The oligonucleotide 112 can be extended in a 3 direction using the identification sequence 68 as a template and ligated to the oligonucleotide 110. In addition, the reporter probe 24 can be extended in a 3 direction using the adapter region 130 as a template. Thus, the extended reporter probe 24 and the extension ligated oligonucleotides 110, 112 form a partially double-stranded structure that does not hybridize to the complementary region 62. In this manner, the complementary region 62 can be eliminated from the downstream products without a cleavage step, in contrast to the workflow in
[0107] The retained extension ligated oligonucleotide 132 can undergo an additional extension after a wash step (e.g., a hot wash, NaOH, or other denaturant) using a hybridized oligonucleotide 136 as a template. The oligonucleotide 136 hybridizes via a complement region 140 to the adapter region 124. The oligonucleotide 136 also includes a 5 adapter region 142. In embodiments, the extended hybridized oligonucleotide 136 can be extended and ligated to a hybridized p7 oligo (not shown) that can be hybridized to the retained extension ligated oligonucleotide 132. The workflow can include 3 extension of the retained extension ligated oligonucleotides 132 using the 5 adapter region 142 as a template and 3 extension of the hybridized oligonucleotide 136 using the extension ligated oligonucleotide 132 as a template.
[0108] The oligonucleotides 110, 112 used in the extensions or extension ligation can be universal oligonucleotides that hybridize to any captured (e.g., aptamer-bound) reporter probe 24 via universal regions carried on the reporter probe 24. The oligonucleotide 136 hybridizes to the universal adapter region 124. Thus, the extension ligation oligonucleotide reagents can be used across the panel for aptamer detection.
[0109] An optional second capture step can separate the extended oligonucleotide 136 from the extended oligonucleotide 132. Both oligonucleotides 132,136 include full 5 and 3 adapters for NGS sequencing or their complements. While the starting reporter probe 24 is shorter (e.g., about 70 nucleotides in one example), the generated product of the extension ligation workflow is longer. In an embodiment, the oligonucleotides 132,136 may be at least 25%, at least 50%, or at least 100% longer than the starting reporter probe 24. The illustrated workflow can be performed with or without subsequent amplification steps in embodiments.
[0110]
[0111]
[0112] Once captured, the reporter probe 24 and aptamers 14 can be eluted from the capture entity and the capture probe 28. Multiple oligonucleotide hybridizations form a complex to permit extension ligation of full adapter sequences. The reporter probe 24 includes the first region 100 that corresponds to a portion of a 5 adapter sequence and the second region 102 that correspond to a portion of a 3 adapter sequence. As illustrated, oligonucleotide 150, carrying a first region complement 112, and oligonucleotide 152, carrying a second region complement 153, both hybridize to the reporter probe 24. In addition, the oligonucleotide 150 includes an adapter region 155 that does not hybridize to the reporter probe 24, e.g., is not complementary to the complementary region 62, and that carries an internal affinity tag 30. The oligonucleotide 152 includes an adapter region 156 that does not hybridize to the reporter probe 24 and that serves as an extension template. An oligonucleotide 158 hybridizes to the adapter region 155, and an oligonucleotide 160 hybridizes to the oligonucleotide 150 via a region 162. The oligonucleotide 158 acts as a split for ligation of the oligonucleotide 150 and the oligonucleotide 160. In the complex, oligonucleotides 152, 150, 160 can be ligated via extension to form oligonucleotide 166.
[0113] The oligonucleotide 166 can be captured via the affinity tag 30, and used as a template for extension of the hybridized oligonucleotide 158. The multiple extensions, e.g., using T4 polynucleotide kinase, permit addition of full 5 and 3 adapters. As discussed with respect to
[0114]
[0115] The first reporter probe 170 carries a first identification sequence 176, and the second reporter probe 172 carries a second identification sequence 178. Similarly, the aptamer binding regions are also split between the probes. The first reporter probe 170 carries a first aptamer binding region 182 and a first primer site 183 positioned between the first aptamer binding region 182 and the first identification sequence 176. The second reporter probe 172 carries a second aptamer binding region 184 and a second primer site 185 positioned between the second aptamer binding region 185 and the second identification sequence 178. The primer sites are shown as truncated or partial adapter sequences (A14 and B15). It should be understood that additional adapter sequences may also be included in the split probes or may be introduced by amplification and/or ligation as generally discussed herein.
[0116] Binding of the first reporter probe 170 and the second reporter probe 172 to the aptamer 14 creates a trimolecular complex, and one of the first reporter probe 170 or the second reporter probe 172 can carry an affinity tag 30, shown as being on the first reporter probe 170 by way of example. The identification sequences and primer sites are carried on nonhybridizing portions of the reporter probes 170, 172. Dynamic range compression can be achieved for split probes by using a mixture that includes a dummy probe (e.g., a dummy first probe 170 or dummy second probe 172) without the affinity tag 30 for certain aptamers 14. As discussed herein, the selected ratio of the dummy to the affinity tag-carrying probe can be tuned based on aptamer abundancy.
[0117] The identification sequence 68 can be assembled by ligating the ends of the first reporter probe 170 and the second reporter probe 172, e.g., using a single-stranded ligate, e.g., CircLigase. A 5 phosphate and adjacent 3 OH of the probes 170, 172 are ligated together such that the first identification sequence 176 and the second identification sequence 178 are contiguous. The ligated strand can be separated using the affinity tag 30. Any dummy reporter probes 170 and unligated second reporter probes 172 will not be retained. While unligated reporter probes 170 will also be captured, an amplification step using the first primer site 183 and the second primer site 185 ensures that only ligated pairs will generate amplification products. To eliminate false positives from nonspecific or undesired binding, the technique can require a matched pair for the identification sequences 176, 178. That is, the identification sequence 176 and identification sequence 178 can both be identifying for the aptamer 14, and the technique can require a positive sequence match, as assessed using acquired sequencing data from a sequencing device, for both identification sequences 176, 178 before verifying detection of the aptamer 14.
[0118]
[0119]
[0120]
[0121]
[0122] In certain embodiments, the reporter probes and resultant ligation, extension, or amplification products as discussed herein, e.g., as in
[0123]
[0124] The mix or relative rations of active reporter 202 to inactive dummy reporters 210 may be as generally discussed with respect to capture probe mixtures.
[0125]
[0126]
[0127] The presence of the RE site facilitates cleavage using the appropriate RE. The RE site can be conserved across all aptamers 14 such that only a single RE treatment is required to cleave the nonhybridizing region 64. The cleavage site may be specific for ss DNA cleavage. In such embodiments, the cleavage may occur after capture with the capture probe 28 and before amplification. In other embodiments, the cleavage may occur after amplification using a double-stranded RE. In such cases, the RE site is retained during amplification. The cleaved probes 24 are, thus, unavailable for downstream sequencing and, therefore achieve the dynamic range compression by not being sequenced after amplification. In an embodiment, the null region can differ from the RE site by only a single base substitution to minimize amplification bias between dummy (with RE site) and active (null site, no RE site) probes.
[0128]
[0129]
[0130] The oligonucleotides 252 of a relatively high abundance group 270 may all include a same group capture sequence 260 associated with the high abundancy group 270. It should be understood that, in cases where the oligonucleotides 252 are double-stranded, the oligonucleotides 252 of a relatively high abundancy group 270 may all include either the same group capture sequence 260 or a reverse complement of the group capture sequence 260. Similarly, if the oligonucleotides 252 are double-stranded, the oligonucleotides 252 of all three groups may all include either the universal adapter sequences 256, 258 or reverse complements thereof. As illustrated, a mix of different identification sequences 68 may be present within each group such that the group 270 includes different identification sequences 68a, 68b, 68c that correspond to different aptamers 14a, 14b, 14c that are designated as high abundance. Similarly, the group 272 includes different identification sequences 68d, 68e, 68f that correspond to different aptamers 14d, 14e, 14f that are designated as medium abundance. The low abundance group 274 may also include a mix of different identification sequences 68. In an embodiment, a particular identification sequence 68 is assigned to only one group, such that the identification sequence 68a is only present in the high abundancy group 270 and is only associated with the group capture sequence 260.
[0131] After performing the aptamer-based assay and generating the input library 250 from reporter probes 24 bound to aptamers 14 with positive binding events for components of the sample as generally discussed herein, the input library 250 is contacted with different beads 280 of a bead pool 290. The bead pool 290 can include different bead groups 300, 302, 304 with respective different complement regions 310, 312, 314 that are complementary to the bead capture sequences 260, 262, 264. Thus, the oligonucleotides 252 of the high abundancy group 270 that include the bead capture sequence 260 are captured by hybridization to a single-stranded complement region 310 present only in a first bead group 300. Oligonucleotides 252 of the medium abundancy group 272 that include the bead capture sequence 262 are captured by a complement region 312 present only in a second bead group 302, and oligonucleotides 252 of the low abundancy group 274 that include the bead capture sequence 264 are captured by a complement region 314 present only in a second bead group 304. As noted, where the oligonucleotides are double-stranded, only one strand may include the relevant bead capture sequence. Thus, capture may occur after denaturing the oligonucleotides 252 to permit binding to single-stranded complement regions. Once bound, the beads 280 including captured oligonucleotides 252 can be detected as discussed herein. In embodiments, the beads 280 can be designed to generally capture a same amount of oligonucleotides per bead 280 such that each bead group captures about a same amount. However, in certain embodiments, the capture amount per bead 280 for a particular bead group or the number of beads per group may be adjusted to further adjust the concentration of captured oligonucleotides 252 associated with particular aptamers 14.
[0132] Different group capture sequences can be incorporated into each reporter probe 24 to permit bead-based capture via hybridization to complementary regions immobilized on the beads 280. If, in contrast, a single common bead capture sequence were used for the entire input library 250, the high abundancy group 270 would tend to be captured in greater proportion on the available beads 280 based on the relatively greater proportion of the oligonucleotides 252 of the high abundancy group 270 within the library 250. By using separate sets of beads 280, dynamic range compression between low abundancy and high abundancy can be achieved. While three separate abundancy groups with corresponding bead groups are illustrated, it should be understood that more or fewer groups are contemplated. In addition, the number of different aptamers 14 and associated identification sequences 68 assigned to each individual group capture sequence may be selected to be one, two, three, ten, 100, 500, or more. In an embodiment, the number of identification sequences 68 assigned to each group may be different. For example, the high abundancy group 270 may include fewer different identification sequences relative to the medium 272 or low abundancy group 274. In addition, the illustrated embodiment may be used alone or in combination with other dynamic range compression techniques as discussed herein (e.g., dummy probes) that may be used to adjust relative abundancies of oligonucleotides 252 of the input library 250. Further, while the workflow is discussed in the context of beads, the capture techniques may be used with surfaces such as flow cells or other substrate.
[0133]
[0134]
[0135] Once captured on beads, a wash step is performed to separate the beads from unbound elements, which include reporter probes 24 that are not complexed with any aptamer as well as dummy complexes that may include reporter probes 24 complexed with a dummy probe with no affinity tag. After the separation, the sample proceeds to sequence library preparation steps, shown as a ligation to PCR reaction. However, other preparation workflows are also contemplated, such as direct amplification, step out PCR, or other amplification and/or ligation preparations as discussed herein. The end products of the workflow include oligonucleotide fragments that can then be sequenced as part of a sequencing reaction to generate sequence data.
[0136] In an embodiment, the workflow can include only a single wash step after bead capture and before amplification and/or ligation steps. In other embodiments, two, three or more wash steps are contemplated.
[0137]
[0138]
[0139]
[0140] The sequencing device 500 may be one-channel a detection device, in which only two of four nucleotides are labeled and detectable for any given image. For example, thymine may have a permanent fluorescent label, while adenine uses the same fluorescent label in a detachable form. Guanine may be permanently dark, and cytosine may be initially dark but capable of having a label added during the cycle. Accordingly, each cycle may involve an initial image and a second image in which dye is cleaved from any adenines and added to any cytosines such that only thymine and adenine are detectable in the initial image but only thymine and cytosine are detectable in the second image. Any base that is dark through both images in guanine and any base that is detectable through both images is thymine. A base that is detectable in the first image but not the second is adenine, and a base that is not detectable in the first image but detectable in the second image is cytosine. By combining the information from the initial image and the second image, all four bases are able to be discriminated using one channel.
[0141] In the depicted embodiment, the sequencing device 500 includes a separate sample processing device 502 and an associated computer 504. However, as noted, these may be implemented as a single device. Further, the associated computer 504 may be local to or networked or otherwise in communication with the sample processing device 502. In the depicted embodiment, the biological sample may be loaded into the sample processing device 502 on a sample substrate 510, e.g., a flow cell or slide, that is imaged to generate sequence data. For example, reagents that interact with the biological sample fluoresce at particular wavelengths in response to an excitation beam generated by an imager 512 and thereby return radiation for imaging. For instance, the fluorescent components may be generated by fluorescently tagged nucleic acids that hybridize to complementary molecules of the components or to fluorescently tagged nucleotides that are incorporated into an oligonucleotide using a polymerase. As will be appreciated by those skilled in the art, the wavelength at which the dyes of the sample are excited and the wavelength at which they fluoresce will depend upon the absorption and emission spectra of the specific dyes. Such returned radiation may propagate back through the directing optics. This retrobeam may generally be directed toward detection optics of the imager 512.
[0142] The imager detection optics may be based upon any suitable technology, and may be, for example, a charged coupled device (CCD) sensor that generates pixilated image data based upon photons impacting locations in the device. However, it will be understood that any of a variety of other detectors may also be used including, but not limited to, a detector array configured for time delay integration (TDI) operation, a complementary metal oxide semiconductor (CMOS) detector, an avalanche photodiode (APD) detector, a Geiger-mode photon counter, or any other suitable detector. TDI mode detection can be coupled with line scanning as described in U.S. Pat. No. 7,329,860, which is incorporated herein by reference. Other useful detectors are described, for example, in the references provided previously herein in the context of various nucleic acid sequencing methodologies.
[0143] The imager 512 may be under processor control, e.g., via a processor 514, and the sample receiving device 502 may also include I/O controls 516, an internal bus 518, non-volatile memory 520, RAM 522 and any other memory structure such that the memory is capable of storing executable instructions, and other suitable hardware components that may be similar to those described with regard to
[0144] The processor 514, 524 may be programmed to assign individual sequencing reads to a sample based on the associated index sequence or sequences according to the techniques provided herein. In particular embodiments, based on the image data acquired by the imager 512, the sequencing device 500 may be configured to generate sequencing data that includes base calls for each base of a sequencing read. Further, based on the image data, even for sequencing reads that are performed in series, the individual reads may be linked to the same location via the image data and, therefore, to the same template strand. In this manner, index sequencing reads may be associated with a sequencing read of an insert sequence before being assigned to a sample of origin. The processor 514, 524 may also be programmed to perform downstream analysis on the sequences corresponding to the inserts for a particular sample subsequent to assignment of sequencing reads to the sample.
[0145] In certain embodiments, the I/O controls 516, 526 may be configured to receive user inputs that automatically select sequencing parameters based on the reporter probes 24 and the associated sequence library preparation techniques. For example, in cases where custom primers or dark cycles are incorporated into the sequencing run, the sequencing device can select from preprogrammed operating instructions and/or receive user inputs to cause the sequencing device to operate according to the desired sequence parameters. In an embodiment, the user input may be a selection of a sequence library preparation kit or reading a barcode or identifier of a sequence library preparation kit.
[0146] In embodiments of the disclosed techniques, aptamer detection may be based on a presence of the uniquely identifying identification sequence 68 for an individual aptamer in sequencing data generated by the sequencing device 500. Accordingly, in an embodiment, the sequencing device 500 may perform analysis of sequence reads to identify one or more identification sequences 68 for a panel of aptamers. Based on the identified aptamers, a notification or report of positive aptamer identification may be generated. In an embodiment, the notification is provided on the display 534 or communicated via the communications circuitry 527 to a remote device or a cloud server.
[0147] As used herein, an aptamer may refer to a non-naturally occurring nucleic acid that has specific binding affinity for a target molecule. The binding of the aptamer to the target molecule can result in catalytically changing the target molecule, reacting with the target molecule in a way that modifies or alters the target molecule or the functional activity of the target molecule, covalently attaching to the target molecule (as in a suicide inhibitor), and facilitating the reaction between the target molecule and another molecule. In one embodiment, the target molecule is a three dimensional chemical structure, other than a polynucleotide, that binds to the aptamer through a mechanism which is predominantly independent of Watson/Crick base pairing or triple helix binding. In an embodiment, the aptamer is not a nucleic acid having the known physiological function of being bound by the target molecule.
[0148] Aptamers include nucleic acids that are identified from a candidate mixture of nucleic acids. A specific binding affinity of an aptamer for its target may refer to aptamer binding to its target generally with a much higher degree of affinity than it binds to other, non-target, components in a mixture or sample. Different aptamers may have either the same number or a different number of nucleotides. Aptamers may be DNA or RNA and may be single stranded, double stranded, or contain double stranded regions. The aptamers discussed herein can be used in any diagnostic, imaging, high throughput screening or target validation techniques or procedures or assays for which aptamers, oligonucleotides, antibodies and ligands, without limitation can be used.
[0149] Aptamers as disclosed herein may be used in aptamer-based assays, such as those disclosed in U.S. Pat. Nos. 7,855,054 and 7,964,356 and U.S. Publication Nos. US/2011/0136099 and US/2012/0115752. In one example, a panel of aptamers to different target molecules is provided attached to a solid support. The attachment of the aptamers to the solid support is accomplished by contacting a first solid support with the aptamer/s and allowing the releasable first tag included on the aptamer to associate, either directly or indirectly, with an appropriate first capture agent that is attached to or part of the first solid support. A test sample is then prepared and contacted with the immobilized aptamers that have a specific affinity for their respective target molecules, which may or may not be present in the sample. If the test sample contains the target molecule(s), an aptamer-target affinity complex will form in the mixture with the test sample. In addition to aptamer-target affinity complexes, uncomplexed aptamer will also be attached to the first solid support. The aptamer-target affinity complex and uncomplexed aptamer that has associated with the probe on the solid support is then partitioned from the remainder of the mixture, thereby removing free target and all other uncomplexed matter in the test sample (sample matrix); i.e., components of the mixture not associated with the first solid support. This partitioning step is referred to herein as the Catch-1 partition (see definition below). Following partitioning the aptamer-target affinity complex, along with any uncomplexed aptamer, is released from the first solid support using a method appropriate to the particular releasable first tag being employed.
[0150] In one embodiment, aptamer-target affinity complexes bound to the solid support are treated with an agent that introduces a second tag to the target molecule component of the aptamer-target affinity complexes. In one embodiment, the target is a protein or a peptide, and the target is biotinylated by treating it with NHS-PEO4-biotin. The second tag introduced to the target molecule may be the same as or different from the aptamer capture tag. If the second tag is the same as the first tag, or the aptamer capture tag, free capture sites on the first solid support may be blocked prior to the initiation of this tagging step. In this exemplary embodiment, the first solid support is washed with free biotin prior to the initiation of target tagging. Tagging methods, and in particular, tagging of targets such as peptides and proteins are described in U.S. Pat. No. 7,855,054.
[0151] Partitioning is completed by releasing of uncomplexed aptamers and aptamer-target affinity complexes from the first solid support. In one embodiment, the first releasable tag is a photocleavable moiety that is cleaved by irradiation with a UV lamp under conditions that cleave ?90% of the first releasable tag. In other embodiments, the release is accomplished by the method appropriate for the selected releasable moiety in the first releasable tag. Aptamer-target affinity complexes may be eluted and collected for further use in the assay or may be contacted to another solid support to conduct the remaining steps of the assay.
[0152] In one embodiment, a second partition is performed (referred to herein as the Catch-2 partition, see definition below) to remove free aptamer. As described above, in one embodiment, a second tag used in the Catch-2 partition may be added to the target while the aptamer-target affinity complex is still in contact with the solid support used in the Catch-0 capture. In other embodiments, the second tag may be added to the target at another point in the assay prior to initiation of Catch-2 partitioning. The mixture is contacted with a solid support, the solid support having a capture element (second) adhered to its surface which is capable of binding to the target capture tag (second tag), preferably with high affinity and specificity. In one embodiment, the solid support is magnetic beads (such as DynaBeads MyOne Streptavidin C1) contained within a well of a microtiter plate and the capture element (second capture element) is streptavidin. The magnetic beads provide a convenient method for the separation of partitioned components of the mixture. Aptamer-target affinity complexes contained in the mixture are thereby bound to the solid support through the binding interaction of the target (second) capture tag and the second capture element on the second solid support. The aptamer-target affinity complex is then partitioned from the remainder of the mixture, e.g. by washing the support with buffered solutions, including buffers comprising organic solvents including, but not limited to glycerol.
[0153] Aptamers are then selectively eluted from aptamer-target complexes with buffers comprising chaotropic salts from the group including, but not limited to sodium perchlorate, lithium chloride, sodium chloride and magnesium chloride. Aptamers retained on Catch-2 beads by virtue of aptamer/aptamer interaction are not eluted by this treatment.
[0154] In another embodiment, the aptamer released from the Catch-2 partition is detected and optionally quantified by detection methods as discussed herein, such as via next generation sequencing techniques. For example, via amplification and/or sequencing of probes that bind to the eluted aptamers. In certain embodiments, the detection includes detection results that provide relative and/or estimated absolute concentrations of detected aptamers. The detection results may include a notification or output of a positive or negative detection result or a relative concentration or estimated concentration for a particular aptamer ID or a particular target of the aptamer.
[0155] In certain embodiments of the disclosure, the disclosed probes of the probe set 20 can include one or more conserved regions, such as a conserved primer region, e.g., a first conserved primer region and a second conserved primer region. A conserved region is conserved between at least some other probes of the probe set 20 such that the conserved region has an identical or similar nucleotide sequence as compared between the probes. For example, for a given second probe 24, all probes 24 can have a same first conserved primer region and a second conserved primer region. In this manner, primers based on the first conserved primer region and the second conserved primer region can be used to amplify any captured probes 24.
[0156] One or more probes as discussed herein may include an identification sequence that can include one or more nucleotide sequences that can be used to identify one or more specific aptamers. The identification sequence can be an artificial sequence. The identification sequence can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides. In some embodiments, the identification sequence comprises at least about 10, 20, 30, 40, 50, 60, 70 80, 90, 100 or more consecutive nucleotides. In some embodiments, at least a portion of the identification sequence in a probes is different.
[0157] One or more probes as discussed herein may include an affinity tag. Affinity tags can be useful for a variety of applications, for example the bulk separation of target nucleic acids hybridized to hybridization tags. As used herein, the term affinity tag and grammatical equivalents can refer to a component of a multi-component complex, wherein the components of the multi-component complex specifically interact with or bind to each other. For example an affinity tag can include biotin or poly-His that can bind streptavidin or nickel, respectively. Other examples of multiple-component affinity tag complexes are listed, for example, U.S. Patent Application Pub. No. 2012/0208705, U.S. Patent Application Pub. No. 2012/0208724 and Int. Patent Application Pub. No. WO 2012/061832, each of which is incorporated by reference in its entirety.
[0158] The disclosed embodiments provide a different primers and probes. Probes and/or primers of the disclosed embodiments are designed to be complementary to a target sequence (either the target sequence of the sample or to other probe sequences), such that hybridization of the target sequence and the probes of the present invention occurs. As outlined below, this complementarity need not be perfect; there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence. Thus, by substantially complementary herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions.
[0159] A variety of hybridization conditions may be used in the present invention, including high, moderate and low stringency conditions. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5-10? C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30? C. for short probes (e.g. 10 to 50 nucleotides) and at least about 60? C. for long probes (e.g. greater than 50 nucleotides).
[0160] In certain embodiments, probe contacting steps may be run under stringency conditions which allows formation of the hybridization complex only in the presence of target. Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration, pH, organic solvent concentration, etc. The size of the primer nucleic acid may vary, as will be appreciated by those in the art, in general varying from 5 to 500 nucleotides in length. Primers may be between 10 and 100, between 15 and 50, and from 10 to 35 depending on the use and amplification technique.
[0161] The disclosed techniques are directed to dynamic range compression in one or more applications, such as for analysis of an eluate of an aptamer-based assay. The dynamic range compression may include one or more amplification steps that can be part of sequencing library preparation that may oligonucleotide adapters to reporter probes for downstream sequencing. The adapters may be attached to the target polynucleotide in any other suitable manner. In some embodiments, the adapters are introduced in a multi-step process, such as a two-step process, involving ligation of a portion of the adapter to the target polynucleotide having a universal primer sequence. The second step includes extension, for example by PCR amplification, using primers that include a 3 end having a sequence complementary to the attached universal primer sequence and a 5 end that contains other sequences of an adapter. By way of example, such extension may be performed as described in U.S. Pat. No. 8,053,192, which is hereby incorporated by reference in its entirety. Additional extensions may be performed to provide additional sequences to the 5 end of the resulting previously extended polynucleotide.
[0162] In some embodiments, the adapter may be ligated to the reporter probes. Any suitable adapter may be attached to a target polynucleotide, such as a reporter probe, via any suitable process, such as those discussed herein. The adapter can include a library-specific index tag sequence (e.g., i5, i7). The index tag sequence may be attached to the target polynucleotides from each library before the sample is immobilized for sequencing. The index tag is not itself formed by part of the target polynucleotide, but becomes part of the template for amplification. The index tag may be a synthetic sequence of nucleotides which is added to the target as part of the template preparation step. Accordingly, a library-specific index tag is a nucleic acid sequence tag which is attached to each of the target molecules of a particular library, the presence of which is indicative of or is used to identify the library from which the target molecules were isolated. Preferably, the index tag sequence is 20 nucleotides or less in length. For example, the index tag sequence may be 1-10 nucleotides or 4-6 nucleotides in length. A four nucleotide index tag gives a possibility of multiplexing 256 samples on the same array, a six base index tag enables 4,096 samples to be processed on the same array. The adapters may contain more than one index tag so that the multiplexing possibilities may be increased.
[0163] The adapters may include any other suitable sequence in addition to the index tag sequence. For example, the adapters may include universal extension primer sequences, which are typically located at the 5 or 3 end of the adapter and the resulting polynucleotide for sequencing. The universal extension primer sequences may hybridize to complementary primers bound to a surface of a solid substrate. The complementary primers include a free 3 end from which a polymerase or other suitable enzyme may add nucleotides to extend the sequence using the hybridized library polynucleotide as a template, resulting in a reverse strand of the library polynucleotide being coupled to the solid surface. Such extension may be part of a sequencing run or cluster amplification.
[0164] In some embodiments, the adapters include one or more universal sequencing primer sequences. The universal sequencing primer sequences may bind to sequencing primers to allow sequencing of an index tag sequence, a target sequence, or an index tag sequence and a target sequence. In some embodiments, the disclosed reporter probes, e.g., reporter probe 24, may include a sequencing adaptor or sequencing adaptor site, that is to say a region that comprises one or more sites that can hybridize to a primer. In some embodiments, a sequence can include at least a first primer site useful for amplification, sequencing, and the like.
[0165] After adapter incorporation, the disclosed reporter probes may be sequenced. In one example, the sequencing may be via Illumina's sequencing-by-synthesis and reversible terminator-based sequencing chemistry. Illumina's sequencing technology relies on the attachment of fragmented genomic DNA to a planar, optically transparent surface on which oligonucleotide anchors are bound. Template DNA is end-repaired to generate 5-phosphorylated blunt ends, and the polymerase activity of Klenow fragment is used to add a single A base to the 3 end of the blunt phosphorylated DNA fragments. This addition prepares the DNA fragments for ligation to oligonucleotide adapters, which have an overhang of a single T base at their 3 end to increase ligation efficiency. The adapter oligonucleotides are complementary to the flow-cell anchors. Under limiting-dilution conditions, adapter-modified, single-stranded template DNA is added to the flow cell and immobilized by hybridization to the anchors. Attached DNA fragments are extended and bridge amplified to create an ultra-high density sequencing flow cell with hundreds of millions of clusters, each containing ?1,000 copies of the same template. In one embodiment, the randomly fragmented genomic DNA is amplified using PCR before it is subjected to cluster amplification. Alternatively, an amplification-free genomic library preparation is used, and the randomly fragmented genomic DNA is enriched using the cluster amplification alone. The templates are sequenced using a robust four-color DNA sequencing-by-synthesis technology that employs reversible terminators with removable fluorescent dyes. High-sensitivity fluorescence detection is achieved using laser excitation and total internal reflection optics. Sequence are aligned against a truth table or stored correlations between aptamer identity and identification sequences using specially developed data analysis pipeline software.
[0166] This written description uses examples to enable any person skilled in the art to practice the disclosed embodiments, including making and using any devices or systems and performing any incorporated methods. The patentable scope is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.