RECOMBINANT MICROORGANISM FOR PRODUCING CARNOSINE, HISTIDINE AND BETA-ALANINE AND METHOD FOR PRODUCING CARNOSINE, HISTIDINE AND BETA-ALANINE BY USING SAME
20240287531 ยท 2024-08-29
Assignee
Inventors
Cpc classification
C12Y204/02017
CHEMISTRY; METALLURGY
C12P13/06
CHEMISTRY; METALLURGY
International classification
C12N9/00
CHEMISTRY; METALLURGY
C12N9/12
CHEMISTRY; METALLURGY
Abstract
Provided is a recombinant microorganism for producing carnosine, histidine and beta-alanine and a method for producing carnosine, histidine and beta-alanine by using same and, more particularly, to: a recombinant microorganism for high production of carnosine, histidine and beta-alanine produced through the redesign of metabolic pathways; a method for producing same; and a method for producing carnosine, histidine and beta-alanine by using same. According to the present invention, in a microorganism capable of producing histidine and beta-alanine, by enhancing the pentose phosphate pathways through the replacement of a pentose phosphate pathway-related operon gene with a highly expressing synthetic promoter and the replacement of a pgi gene with an initiation codon, and inducing enhancement of the production of histidine and beta-alanine through the overexpression of genes on histidine and beta-alanine metabolic pathways, respectively, it is possible to develop a recombinant microorganism for high production of histidine and beta-alanine.
Claims
1-31. (canceled)
32. A recombinant microorganism for high production of carnosine, wherein a pentose phosphate pathway is enhanced; and a mammal-derived carnosine synthase 1 (Carns1) gene is introduced.
33. The recombinant microorganism of claim 32, wherein the recombinant microorganism is additionally enhanced with one or more of an L-histidine biosynthetic pathway and a beta-alanine biosynthetic pathway.
34. The recombinant microorganism of claim 32, wherein the pentose phosphate pathway is enhanced by the replacement of a promoter of an operon-type gene with a highly expressing synthetic promoter, the replacement of an initiation codon of a glucose-6-phosphate isomerase (pgi) gene, or a combination thereof.
35. The recombinant microorganism of claim 34, wherein the highly expressing synthetic promoter is H36 and the initiation codon of the pgi gene is changed from ATG to GTG.
36. The recombinant microorganism of claim 32, wherein the Carns1 gene consists of a nucleotide sequence represented by SEQ ID NO: 22.
37. The recombinant microorganism of claim 33, wherein the histidine biosynthetic pathway is enhanced by the overexpression of a ATP phosphoribosyltransferase (HisG) gene, the overexpression of a GTP pyrophosphokinase (Rel) gene, or a combination thereof.
38. The recombinant microorganism of claim 37, wherein the HisG and Rel genes consist of nucleotide sequences represented by SEQ ID NOs: 13 and 14, respectively.
39. The recombinant microorganism of claim 33, wherein the beta-alanine biosynthetic pathway is enhanced by the overexpression of an aspartate 1-decarboxylase (PanD) gene.
40. The recombinant microorganism of claim 39, wherein the PanD gene consists of a nucleotide sequence represented by SEQ ID NO: 19.
41. The recombinant microorganism of claim 32, wherein the recombinant microorganism is derived from Corynebacterium glutamicum.
42. A recombinant microorganism for high production of histidine, wherein one or more of pentose phosphate pathways and an L-histidine biosynthetic pathway are enhanced.
43. A recombinant microorganism for high production of beta-alanine, wherein one or more of pentose phosphate pathways and a beta-alanine biosynthetic pathway are enhanced.
44. The recombinant microorganism of claim 42, wherein the pentose phosphate pathway is enhanced by the replacement of a promoter of an operon-type gene with a highly expressing synthetic promoter, the replacement of an initiation codon of a glucose-6-phosphate isomerase (pgi) gene, or a combination thereof.
45. The recombinant microorganism of claim 44, wherein the highly expressing synthetic promoter is H36.
46. The recombinant microorganism of claim 44, wherein the initiation codon of the pgi gene is changed from ATG to GTG.
47. The recombinant microorganism of claim 42, wherein the histidine biosynthetic pathway is enhanced by the overexpression of a ATP phosphoribosyltransferase (HisG) gene, the overexpression of a GTP pyrophosphokinase (Rel) gene, or a combination thereof.
48. The recombinant microorganism of claim 47, wherein the HisG and Rel genes consist of nucleotide sequences represented by SEQ ID NOs: 13 and 14, respectively.
49. The recombinant microorganism of claim 43, wherein the beta-alanine biosynthetic pathway is enhanced by the overexpression of an aspartate 1-decarboxylase (PanD) gene.
50. The recombinant microorganism of claim 49, wherein the PanD gene consists of a nucleotide sequence represented by SEQ ID NO: 19.
51. The recombinant microorganism of claim 42, wherein the recombinant microorganism is derived from Corynebacterium glutamicum.
Description
DESCRIPTION OF DRAWINGS
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
BEST MODE OF THE INVENTION
[0051] The present inventors developed a recombinant microorganism with improved productivities of carnosine, histidine, and beta-alanine by enhancing a pentose phosphate pathway, an L-histidine biosynthetic pathway, and a beta-alanine biosynthetic pathway and introducing a carnosine synthetic pathway through the redesign of metabolic pathways using metabolic engineering technology, and then completed the present invention.
[0052] Hereinafter, the present invention will be described in detail.
[0053] Accordingly, the present invention provides a recombinant microorganism for high production of carnosine, in which a pentose phosphate pathway is enhanced; and a mammal-derived carnosine synthase 1 (Carns1) gene is introduced.
[0054] In the present invention, the recombinant microorganism for high production of carnosine may be additionally enhanced with one or more of a histidine biosynthetic pathway and a beta-alanine biosynthetic pathway.
[0055] In the present invention, the carnosine synthase 1 (Carns1) gene is introduced into the recombinant microorganism to introduce the carnosine synthetic pathway, and the recombinant microorganism for high production of carnosine may continuously produce carnosine from beta-alanine and L-histidine biosynthesized within cells through the action of carnosine synthase produced by the expression of the introduced Carns1 gene.
[0056] In the present invention, the mammal-derived Carns1 gene may preferably be derived from a mouse (Mus musculus) and may consist of a nucleotide sequence represented by SEQ ID NO: 22. At this time, the gene may include a nucleotide sequence having 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95%, 96%, 97%, 98%, and 99% or more of sequence homology with the nucleotide sequence represented by SEQ ID NO: 22.
[0057] In one embodiment of the present invention, in the Corynebacterium recombinant strain in which the pentose phosphate pathway is enhanced and the Carns1 gene is introduced, changes in production of carnosine were compared depending on whether the pentose phosphate pathway was enhanced. As a result, compared to a control strain (Car1) in which the pathway was not enhanced, in a strain (Car2) in which a promoter of an operon gene was replaced with a highly expressing synthetic promoter, the production of carnosine increased about two times. Additionally, it was confirmed that in a Car12 strain, in which the pentose phosphate pathway was further enhanced by changing an initiation codon of a pgi gene in the Car2 strain, the production of carnosine increased about 7 times compared to the control group (see Example 5).
[0058] In another embodiment of the present invention, in the Corynebacterium recombinant strain in which the pentose phosphate pathway was enhanced, after the beta-alanine and/or histidine biosynthetic pathway was further enhanced, the change in carnosine production was measured. As a result, it was confirmed that as compared with the strain in which only the pentose phosphate pathway was enhanced, the carnosine production increased about 7.2 times in a Car13 strain in which the beta-alanine biosynthetic pathway was further enhanced, about 2.4 times in a Car14 strain in which the histidine biosynthetic pathway was further enhanced, and about 10.5 times in a Car15 strain in which the beta-alanine and histidine biosynthetic pathways were enhanced together, which was the highest level (see Example 7).
[0059] Accordingly, the recombinant microorganism for high production of carnosine of the present invention may specifically include recombinant microorganisms in the range to be described below: [0060] i) a recombinant microorganism in which the pentose phosphate pathway is enhanced and the Carns1 gene is introduced; [0061] ii) a recombinant microorganism in which the pentose phosphate pathway and the beta-alanine biosynthetic pathway are enhanced and the Carns1 gene is introduced; [0062] iii) a recombinant microorganism in which the pentose phosphate pathway and the histidine biosynthetic pathway are enhanced and the Carns1 gene is introduced; and [0063] iv) a recombinant microorganism in which the pentose phosphate pathway and the beta-alanine and histidine biosynthetic pathways are enhanced and the Carns1 gene is introduced.
[0064] In the present invention, the recombinant microorganism for high production of carnosine may be most preferably a recombinant microorganism in which the pentose phosphate pathway and the beta-alanine and histidine biosynthetic pathways are enhanced and the Carns1 gene is introduced.
[0065] In addition, the present invention provides a recombinant microorganism for high production of histidine, in which one or more of pentose phosphate pathways and an L-histidine biosynthetic pathway are enhanced.
[0066] In one embodiment of the present invention, as a result of overexpressing the HisG and/or Rel gene using the recombinant vector in order to enhance the histidine biosynthetic pathway in Corynebacterium glutamicum, it could be seen that the production of histidine increased in a strain (Car7) overexpressing the genes simultaneously, and the histidine production increased at a high level in recombinant strains (Car8 to Car11) in which the pentose phosphate pathway was enhanced alone or in combination of the histidine biosynthetic pathway (see Example 6).
[0067] In addition, the present invention provides a recombinant microorganism for high production of beta-alanine, in which one or more of pentose phosphate pathways and a beta-alanine biosynthetic pathway are enhanced.
[0068] In one embodiment of the present invention, as a result of enhancing the beta-alanine biosynthetic pathway by further overexpressing a PanD gene using a recombinant vector in the Car12 strain in which the pentose phosphate pathway was enhanced and the Carns1 gene was introduced, it was confirmed that the production of beta-alanine increased about 4 times or higher in the Car13 strain (see Example 7).
[0069] Accordingly, in one embodiment of the present invention, the recombinant microorganism may be additionally introduced with a mammal-derived Carns1 gene.
[0070] In the present invention, the recombinant microorganism may preferably be derived from Corynebacterium glutamicum.
[0071] The pentose phosphate pathway (PPP) is also called a phosphogluconate pathway or a hexose monophosphate pathway, and a metabolic pathway of oxidizing glucose 6-phosphate (G-6-P) into pentose phosphate. The pentose phosphate pathway produces NADPH and a pentose derivative, ribose 5-phosphate (R-5-P), which is a precursor for the synthesis of nucleotides. Although the pentose phosphate pathway includes the oxidation of glucose, a main role of the pentose phosphate pathway is anabolism rather than catabolism.
[0072] In the present invention, the pentose phosphate pathway may be enhanced by the replacement existing promoters with a highly expressing synthetic promoter for overexpression of genes consisting of an operon, that is, transaldolase (tkt), transaldolase (tal), glucose-6-phosphate 1-dehydrogenase (zwf), glucose-6-phosphate 1-dehydrogenase (opcA), and 6-phosphogluconolactonase (pgl), ii) the change of a glucose-6-phosphate isomerase (pgi) gene to an initial codon, or a combination thereof.
[0073] In the present invention, the highly expressing synthetic promoter may be H36 consisting of a nucleotide sequence represented by SEQ ID NO: 3, but is not limited thereto as long as the promoter is a synthetic promoter capable of increasing the expression levels of the genes.
[0074] In the present invention, the initiation codon of the pgi gene may be preferably changed from ATG to GTG.
[0075] In the present invention, the histidine biosynthetic pathway may be enhanced by the overexpression of an ATP phosphoribosyltransferase (HisG) gene, the overexpression of a GTP pyrophosphokinase (Rel) gene, or a combination thereof.
[0076] In the present invention, the beta-alanine biosynthetic pathway may be enhanced by the overexpression of an aspartate 1-decarboxylase (PanD) gene.
[0077] The HisG, Rel, and PanD genes may consist of nucleotide sequences represented by SEQ ID NOs: 13, 14, and 19, respectively. At this time, the genes may include nucleotide sequences having 70% or more, preferably 80% or more, more preferably 90% or more, and most preferably 95%, 96%, 97%, 98%, and 99% or more of sequence homology with the nucleotide sequences represented by SEQ ID NOs: 13, 14, and 19.
[0078] Another aspect of the present invention provides a method for producing the recombinant microorganism for high production of carnosine including the following steps: [0079] (a) enhancing pentose phosphate pathways through the replacement of a promoter of an operon-type gene with a highly expressing synthetic promoter, the change of a glucose-6-phosphate isomerase (pgi) gene into an initiation codon, or a combination thereof in microorganisms having glutamic acid productivity; and [0080] (b) introducing a mammal-derived carnosine synthase 1 (Carns 1) gene.
[0081] In the present invention, the production method may further include the overexpression of the HisG (ATP phosphoribosyltransferase) and Rel (GTP pyrophosphokinase) genes, the overexpression of the PanD (Aspartate 1-decarboxylase) gene, or a combination thereof.
[0082] In addition, the present invention provides a method for producing a recombinant microorganism for high production of L-Histidine including enhancing pentose phosphate pathways through the replacement of a promoter of an operon-type gene with a highly expressing synthetic promoter, the change of a glucose-6-phosphate isomerase (pgi) gene into an initiation codon, or a combination thereof in microorganisms having glutamic acid productivity.
[0083] In addition, the method for producing the recombinant microorganism for high production of L-Histidine includes enhancing pentose phosphate pathways through the replacement of a promoter of an operon-type gene with a highly expressing synthetic promoter, the change of a glucose-6-phosphate isomerase (pgi) gene into an initiation codon, or a combination thereof in microorganisms having glutamic acid productivity; and overexpressing one or more of HisG (ATP phosphoribosyltransferase) gene and Rel (GTP pyrophosphokinase) gene.
[0084] In addition, the present invention provides a method for producing a recombinant microorganism for high production of beta-alanine including enhancing pentose phosphate pathways through the replacement of a promoter of an operon-type gene with a highly expressing synthetic promoter, the change of a glucose-6-phosphate isomerase (pgi) gene into an initiation codon, or a combination thereof in microorganisms having glutamic acid productivity.
[0085] In addition, the method for producing the recombinant microorganism for high production of beta-alanine includes enhancing pentose phosphate pathways through the replacement of a promoter of an operon-type gene with a highly expressing synthetic promoter, the change of a glucose-6-phosphate isomerase (pgi) gene into an initiation codon, or a combination thereof in microorganisms having glutamic acid productivity; and overexpressing a PanD (Aspartate 1-decarboxylase) gene.
[0086] In one embodiment of the present invention, the method for producing the recombinant microorganism for high production of beta-alanine may further include introducing a mammal-derived Carns1 (Carnosine synthase 1) gene, preferably expressing both the Carns1 gene and the PanD gene in one recombinant vector.
[0087] The term recombinant microorganism used in the present invention refers to a microorganism in which a genetic material has been recombined by genetic recombinant DNA introduced through genetic recombination technology. The genetic recombinant DNA refers to DNA constructed by combining DNA (carrier) replicable within any cell and heterogeneous DNA in vitro using enzymes, etc.
[0088] In the present invention, preferably, the recombinant microorganism may be a microorganism having glutamic acid productivity, in which the productivity of carnosine, histidine, and beta-alanine is improved through genetic recombination technology, and the microorganism having glutamic acid productivity may be preferably Corynebacterium glutamicum.
[0089] As used in the present invention, the term vector means a DNA construct containing a DNA sequence operably linked to a suitable control sequence capable of expressing DNA in a suitable host. The vector may be a plasmid, a phage particle, or simply, a potential genomic insert. When transformed into the suitable host, the vector may replicate and function independently of a host genome, or may be integrated into a genome itself in some cases. Since the plasmid is the most commonly used form of the current vector, the plasmid and the vector are sometimes used interchangeably in the specification of the present invention.
[0090] For the purposes of the present invention, it is preferred to use plasmid vectors. A typical plasmid vector that may be used for the purpose has a structure including (a) a replication origin that allows efficient replication to contain several to hundreds of plasmid vectors per host cell, (b) an antibiotic resistance gene that allows selection of host cells transformed with a plasmid vector, and (c) a restriction enzyme cleavage site into which a foreign DNA fragment may be inserted. Even if a suitable restriction enzyme cleavage site does not exist, the vector and the foreign DNA may be easily ligated using a synthetic oligonucleotide adapter or linker according to a conventional method.
[0091] As used in the present invention, the term recombinant vector is a recombinant carrier into which a heterologous DNA fragment is inserted, and generally refers to a double-stranded DNA fragment. Here, the heterologous DNA refers to heteromorphous DNA, which is DNA that is not found naturally in a host cell. When the recombinant vector is once present in the host cell, the recombinant vector may replicate independently of host chromosomal DNA and several copies of the vector and its inserted (heterologous) DNA may be produced. Thereafter, the recombinant vector may be transformed or transfected into a host cell.
[0092] As used in the present invention, the term transformation means that DNA is introduced into a host so that the DNA is an extrachromosomal factor or replicable by chromosomal integration completion. Of course, it should be understood that all of the vectors do not exhibit functions equally in expressing the DNA sequences of the present invention. Likewise, all of the hosts do not exhibit functions equally for the same expression system. However, those skilled in the art may make appropriate selections among various vectors, expression control sequences, and hosts without departing from the scope of the present invention without undue experimental burden. For example, in selecting the vectors, the host needs to be considered, which is because the vectors need to replicate therein. The copy number of the vector, the ability to control the copy number, and the expression of other proteins encoded by the corresponding vector, such as antibiotic markers, need also to be considered.
[0093] The transformation or transfection may be used with various techniques commonly used to introduce exogenous nucleic acids (DNA or RNA) into prokaryotic or eukaryotic host cells, such as electroporation, calcium phosphate precipitation, DEAE-dextran transfection or lipofection, etc., but is not limited thereto and may be appropriately selected and used by those skilled in the art.
[0094] As well-known in the art, in order to increase the expression level of a transfected gene in the host cell, the corresponding gene needs to be operably linked to transcriptional and translational expression control sequences that exhibit the functions in the selected expression host. Preferably, the expression control sequence and the corresponding gene are included in one recombinant vector including both a bacterial selection marker and a replication origin. When the host cell is the eukaryotic cell, the recombinant vector needs to further contain an expression marker useful in the eukaryotic expression host.
[0095] In the present invention, the preferred host cell may be a prokaryotic cell, and preferably the prokaryotic host cell may include C. glutamicum ATCC 13826, C. glutamicum ATCC 13032, C. glutamicum 13059, C. glutamicum ATCC 14067, C. glutamicum ATCC. 13761, C. glutamicum ATCC 13058, C. glutamicum ATCC 13745, etc., but is not limited thereto. Also, E. coli strains such as E. coli DH5a, E. coli JM101, E. coli TOP10, E. coli K12, E. coli W3110, E. coli X1776, E. coli XL1-Blue (Stratagene), E. coli B, and E. coli BL21 and strains included in other prokaryotic species and genera may be used.
[0096] Yet another aspect of the present invention provides a method for producing carnosine including culturing the recombinant microorganism for high production of carnosine.
[0097] Further, the present invention provides a method for producing L-Histidine including culturing the recombinant microorganism for high production of histidine.
[0098] Further, the present invention provides a method for producing beta-alanine including culturing the recombinant microorganism for high production of beta-alanine.
[0099] In the present invention, conditions for culturing such as a temperature, an environment, a medium, a culture container, etc. are not specifically limited as long as the conditions allow for the growth of the recombinant microorganism according to the present invention, preferably recombinant Corynebacterium glutamicum, and the culturing may be performed for an appropriate time by setting and applying appropriate conditions according to the corresponding recombinant microorganism, a type of material to be produced and an amount to be obtained by those skilled in the art.
[0100] In one embodiment of the present invention, a recombinant strain (Car15) in which the pentose phosphate pathway, the beta-alanine synthetic pathway, and the histidine synthetic pathway were enhanced and the carnosine synthetic pathway was introduced was culture on an agar plate in a standing incubator, first and second pre-cultured in a shake flask, and then subjected to fed-batch fermentation for 48 hours. As a result, it was confirmed that the production of carnosine was further increased two times or higher compared to the case of only the flask culture with the same strain.
[0101] Accordingly, in the present invention, the culturing of the carnosine producing strain may preferably be performed through fed-batch fermentation, but is not limited thereto and may be appropriately selected and applied by those skilled in the art.
[0102] As used in the present invention, the term fed-batch fermentation is a type of liquid culture among methods of culturing microorganisms and is a fed-batch method classified according to a supply method of a substrate. Specifically, the substrate concentration in the culture medium may be arbitrarily controlled by a culture method for intermittently supplying the medium. Since the substrate is added at an appropriate rate and not leaked, the substrate may be freely controlled by maintaining a balance between the amount of substrate to be supplied and the amount consumed by the microorganisms. In the present invention, the fermentation process was performed at 30? C. and 200 to 400 rpm, and pH 6.8 was maintained until the end of culture, but specific conditions are not limited to the above range.
MODES OF THE INVENTION
[0103] Hereinafter, preferred examples will be proposed in order to help in understanding of the present invention. However, the following Examples are just provided to more easily understand the present invention, and the contents of the present invention are not limited by the following Examples.
EXAMPLES
Example 1. Construction of Recombinant Strain with Enhanced Pentose Phosphate Pathway
[0104] 1-1. Obtaining of Strain Replaced with Synthetic Promoter
[0105] The present inventors attempted to replace a natural promoter with a H36 promoter as a highly expressing synthetic promoter for overexpression of related genes consisting of an operon, that is, transketolase (tkt), transaldolase (tal), glucose-6-phosphate 1-dehydrogenase (zwf), glucose-6-phosphate dehydrogenase assembly protein (OpcA), and 6-phosphogluconolactonase (pgl) in order to develop a Corynebacterium strain with an enhanced pentose phosphate pathway, and to this end, constructed an integration vector as shown in
[0106] Specifically, in order to construct the vector, a left arm sequence of 587 bp (SEQ ID NO: 1) was obtained through PCR amplification using forward and reverse primers(tkt LA F (EcoR1) and tkt LA R (Xma1)) including a restriction enzyme sequence from the genomic DNA of Corynebacterium glutamicum ATCC 13032. In addition, a right arm of 600 bp (SEQ ID NO: 2) was additionally obtained from the left arm through PCR amplification using forward and reverse primers(tkt RA F(Xba1) and tkt RA R(Sal1)). Subsequently, in order to replace the natural promoter, a H36 promoter of 74 bp (SEQ ID NO: 3) was additionally obtained through PCR amplification using forward and reverse primers(H36 BamH1 F and H36 Xba1 R) including the restriction enzyme sequence. Thereafter, in order to construct a pK19mobsacB-H36 vector of
1-2. Additional Obtaining of Strain with Changed Initiation Codon of Pgi Gene
[0107] In the Corynebacterium strain in which the pentose phosphate pathway was enhanced by replacing the promoter through Example 1-1, in order to further enhance the pathway, it was attempted to change the initiation codon of the pgi gene to gtg using a CRISPR system.
[0108] For this purpose, a pJYS2::crRNA-pgi vector illustrated in
TABLE-US-00001 TABLE1 Target Direction Sequence(5-3) SEQIDNO: tktLA Forward ATATGAATTCTTAAGTTGTGAGTCCTTAT 5 Reverse ATACCCGGGCAATCTTAAGTCTGGGA 6 tktRA Forward ATATCTAGATTGACCACCTTGACGCTGTCACCTG 7 Reverse ATAGTCGACCAGCTGCTGGGTGCCAGCGA 8 H36 Forward ATAGGATCCTCTATCTGGTGCCCTAAACG 9 Reverse ATATCTAGACATGCTACTCCTACCAACCA 10 crRNApgi Forward CTAGGTATAATGGATCGAATTTCTACTGTTGTAGATATGGCGGACATT 11 Reverse TTTATTTAAATGGATCTGGGTGGTCGAAATGTCCGCCATATCTACAAC 12
Example 2. Construction of Recombinant Strain with Enhanced Histidine Biosynthetic Pathway
[0109] The present inventors used a method for introducing HisG and Rel genes to the Corynebacterium strain with the enhanced pentose phosphate pathway prepared in Example 1, in order to additionally enhance the histidine synthetic pathway. To this end, pMT_tac::HisG, pMT_tac::Rel, and pMT_tac::HisG-Rel, which were recombinant vectors for transformation of Corynebacterium glutamicum overexpressing HisG, Rel, HisG, and Rel shown in
[0110] Specifically, for the construction of pMT_tac::HisG, PCR was performed using forward and reverse primers(HisG F (Cla1) and HisG R (BamH1)) containing the corresponding restriction enzyme sequence of the pMT_tac vector from the genomic DNA of Corynebacterium glutamicum, and as a result, a HisG gene of 846 bp (SEQ ID NO: 13) was obtained. In addition, for the construction of pMT_tac::Rel, PCR was performed using forward and reverse primers(Rel F(Sma1) and Rel R (Xma1)) containing the corresponding restriction enzyme sequence of the pMT_tac vector from the genomic DNA of Corynebacterium glutamicum, and as a result, a Rel gene of 2283 bp (SEQ ID NO: 14) was obtained. The forward primer for constructing the pMT_tac::Rel was inserted with a ribosome binding site (RBS) sequence (AAGGAGATATAG), which was a specific sequence complementarily binding to the ribosome required for translation of the gene to help the translation of the Rel gene after the translation of the HisG gene was completed.
[0111] Thereafter, in order to construct a recombinant vector expressing each gene, the genes amplified through PCR and the pMT-tac vector were treated with the restriction enzyme, subjected to the ligation reaction, and then introduced into the E. Coli DH5a strain and the Corynebacterium glutamicum strain and transformed. In addition, in order to introduce the Rel gene into the constructed pMT-tac::HisG vector, the pMT-tac::HisG vector was treated with the restriction enzyme, and then a ligation reaction was performed to produce a pMT_tac::HisGRel vector expressing both HisG and Rel. The constructed vector was introduced into the E. Coli DH5a strain and the Corynebacterium glutamicum strain and transformed, and the primer sequences used in the experiment were shown in Table 2 below.
TABLE-US-00002 TABLE2 Gene Direction Sequence(5-3) SEQIDNO: HisG Forward ATAATCGATATGTTGAAAATCGCTGTCCC 15 Reverse ATAGGATCCCTAGATGCGGGCGATGC 16 Rel Forward ATACCCGGGAAGGAGATATAGATGAGTCTGGAGCGCAACAC 17 Reverse ATAGCGGCCGCCTAGCCACCCGAGGTCAC 18
Example 3. Construction of Recombinant Strain with Enhanced Pentose Phosphate Pathway and Beta-Alanine Biosynthetic Pathway
[0112] The present inventors constructed a vector for overexpressing a PanD gene according to the following process, in order to construct a strain in which a beta-alanine pathway was enhanced additionally in the Corynebacterium strain with the enhanced pentose phosphate pathway produced in Example 1.
[0113] Specifically, a PanD gene (SEQ ID NO: 19) was obtained through PCR amplification using forward and reverse primers (PanD F (EcoR1): 5-GGTACCGAGCTCGAATTATGCTGCGCACCATCCT-3 (SEQ ID NO: 20), and PanD R (EcoR1): 5-AAAACGACGGCCAGTGGAATTCTAAATGCTTCTCGACGTCAAAAGC-3 (SEQ ID NO: 21)) from the genomic DNA of Corynebacterium glutamicum. Next, in order to construct a recombinant vector overexpressing the PanD gene, a pEKEx2 vector was treated with a restriction enzyme, subjected to a ligation reaction through Gibson assembly, and then introduced into the E. Coli DH5a strain and the Corynebacterium glutamicum strain and transformed.
Example 4. Construction of Recombinant Strain Introduced with Carnosine Biosynthetic Pathway
[0114] The present inventors attempted to introduce a mammal-derived Carns1 gene to introduce the carnosine biosynthetic pathway into the Corynebacterium glutamicum strain or the recombinant Corynebacterium strains constructed in Examples 1 to 3. For this purpose, the Carns1 gene was amplified through PCR using forward and reverse primers (Carns1 F(Sal1): 5-ATAGTCGACATGTGCTTGGCAAAGCAGAAG-3 (SEQ ID NO: 23), Carns1 R(EcoR1): 5-ATAGAATTCCTATTTGAAATGAGACAGGAAATGGGCAAC-3 (SEQ ID NO: 24)) from the pCMV-SPORT6::Carns1 vector purchased from the Korea Human Gene Bank (SEQ ID NO: 22). Next, in order to construct a recombinant vector overexpressing the Carns1 gene illustrated in
Example 5. Confirmation of Changes in Production of Histidine and Carnosine Through Enhancement of Pentose Phosphate Pathway
[0115] The present inventors attempted to confirm the production of histidine and carnosine in the strain with the enhanced pentose phosphate pathway constructed in Example 1, and introduced a carnosine production pathway according to the method of Example 4 for the production of carnosine. Thereafter, the recombinant strain with the enhanced pentose phosphate pathway and the transformed strain with the enhanced pentose phosphate pathway and the introduced carnosine production pathway were cultured for 48 hours under conditions of 30? C. and 200 rpm in a 250 ml shaking conical flask containing 50 ml of a CGAF medium.
[0116] As a result, as illustrated in
[0117] In addition, as a result of measuring the production of carnosine, it was confirmed that in a strain (13032 pEKEx2::Carns1; Car1) in which Carns1 was introduced in a control group (Car0) in which the pentose phosphate pathway was not enhanced, about 1.9 mg/L of carnosine was synthesized, and in a strain (Ptkt to H36 13032 pEKEx2::Carns1; Car3) in which Carns1 was introduced in the strain (Car2) in which the pentose phosphate pathway was enhanced, 3.9 mg/L of carnosine of about 2 times was synthesized. Additionally, in a recombinant strain (Ptkt to H36 pgi(gtg) Carns1; Car12) in which the pentose phosphate pathway was further enhanced and Carns1 was introduced through the change of the pgi initiation codon in addition to the change into the highly expressing synthetic promoter H36, as shown in
Example 6. Confirmation of Increased Histidine Production Through Enhancement of Histidine Biosynthetic Pathway
[0118] The present inventors constructed a recombinant strain in which the histidine biosynthetic pathway was additionally enhanced by overexpressing HisG, Rel, or HisG and Rel according to the method of Example 2 in the strain with the enhanced pentose phosphate pathway obtained in Example 1, and then measured the production of histidine. All transformed strains were cultured for 48 hours under conditions of 30? C. and 200 rpm in a 250 ml shaking conical flask containing 50 ml of a CGAF medium.
[0119] As a result, as shown in
Example 7. Confirmation of Increased Carnosine Production Through Enhancement of Beta-Alanine and/or Histidine Biosynthetic Pathway
[0120] The present inventors measured and compared the productions of histidine, beta-alanine, and carnosine in a recombinant strain (Ptkt to H36 pgi(gtg) Carns1; Car12) in which a pentose phosphate pathway was enhanced and a carnosine synthetic pathway was introduced by introducing Carns1; a recombinant strain (Ptkt to H36 pgi(gtg) Carns1 panD; Car13) in which a pentose phosphate pathway and a beta-alanine synthetic pathway were enhanced and a carnosine synthetic pathway was introduced; a recombinant strain (Ptkt to H36 pgi(gtg) Carns1 HisGRel; Car14) in which a pentose phosphate pathway and a histidine synthetic pathway were enhanced and a carnosine synthetic pathway was introduced; and a recombinant strain (Ptkt to H36 pgi(gtg) Carns1 panD HisGRel; Car15) in which a pentose phosphate pathway and beta-alanine and histidine synthetic pathways were enhanced and a carnosine synthetic pathway was introduced, respectively. The transformants were cultured for 48 hours under conditions of 30? C. and 200 rpm in a 250 ml shaking conical flask containing 50 ml of a CGAF medium.
[0121] As a result, as illustrated in
[0122] From the result, it could be seen that it was possible to increase the production of carnosine to the highest level by enhancing the pentose phosphate pathway, the histidine synthetic pathway and the beta-alanine synthetic pathway and introducing the carnosine synthetic pathway.
Example 8. Confirmation of Increased Carnosine Production Through Fed-Batch Culture
[0123] The present inventors found a method for further increasing the carnosine production in the recombinant strain (Car15) in which the pentose phosphate pathway, the histidine synthetic pathway and the beta-alanine synthetic pathway were enhanced and the carnosine synthetic pathway was introduced, which was confirmed to produce the carnosine in the highest level in Example 7.
[0124] To this end, based on previous research results of the present inventors, the strain was cultured by fed-batch culture to increase the production of carnosine. Specifically, before the fed-batch culture, the Car15 strain was cultured in a standing incubator for 24 hours under a condition of 30? C. on a BHISG agar plate, and then first pre-cultured for 24 hours under conditions of 30? C. and 200 rpm in a 100 ml shaking conical flask containing 20 ml of a preculture medium (10 g yeast extract, 10 g peptone, 2 g urea, 2.5 g NaCl, 40 g glucose and 0.1 mg biotine per liter). Next, for the second preculture, the cultured strain was inoculated into a 250 ml shaking conical flask containing 50 ml of the preculture medium of the same composition as above, and then cultured for 24 hours under conditions of 30? C. and 200 rpm. Thereafter, for fed-batch culture, the cultured strain was cultured in a fermenter containing a 2 L CGAF medium under conditions of 30? C. and 200 to 400 rpm for 48 hours, and the pH was maintained at 6.8.
[0125] Thereafter, as a result of measuring the production of carnosine in the fed-batch cultured Car15 strain, as may be seen in
[0126] The aforementioned description of the present invention is used for exemplification, and it can be understood by those skilled in the art that the present invention can be easily modified in other detailed forms without changing the technical spirit or requisite features of the present invention. Therefore, it should be appreciated that the embodiments described above are illustrative in all aspects and are not restricted.