Polynucleotide and method for controlling insect invasion
11505805 · 2022-11-22
Assignee
Inventors
Cpc classification
C12N15/8218
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12N15/82
CHEMISTRY; METALLURGY
A01N25/02
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
Provided are an isolated polynucleotide and a method for controlling insect invasion. The isolated polynucleotide is a plurality of target sequences for controlling target gene c35112 of a coleopteran pest, Monolepta hieroglyphica, comprising: a) a polynucleotide sequence shown as SEQ ID NO: 1; or (b) a polynucleotide sequence having at least 15 or 17 or 19 or 21 contiguous nucleotides of SEQ ID NO: 1, a double-stranded RNA comprising at least one strand complementary to the polynucleotide sequence being capable of inhibiting the growth of coleopteran pests after being ingested by the coleopteran pests; or (c) any one of polynucleotide sequences shown as SEQ ID NO: 3 to SEQ ID NO: 20; or (d) a polynucleotide sequence that hybridizes under stringent conditions to a polynucleotide sequence as defined in (a), (b) or (c).
Claims
1. An isolated nucleic acid for controlling coleopteran insect pest invasion, wherein the isolated nucleic acid comprises a polynucleotide operably linked to a heterologous promoter, wherein the polynucleotide comprises a nucleotide sequence that is at least 99% identical to a fragment of SEQ ID NO: 1 that is at least 139 nucleotides in length and a sequence complementary to the nucleotide sequence, wherein when a coleopteran insect pest ingests a double-stranded RNA encoded by said polynucleotide, the growth of the coleopteran insect pest is inhibited, and wherein the coleopteran insect pest is Monolepta hieroglyphica.
2. The isolated nucleic acid according to claim 1, wherein the isolated nucleic acid further comprises a spacer sequence.
3. The isolated nucleic acid according to claim 2, wherein the spacer sequence is SEQ ID NO: 23.
4. A recombinant vector, comprising the isolated nucleic acid according to claim 1.
5. An interfering ribonucleic acid encoded by the polynucleotide according to claim 1.
6. The interfering ribonucleic acid according to claim 5, wherein the interfering ribonucleic acid comprises at least two silencing elements, and each of the silencing elements comprises a nucleotide sequence that is at least partially complementary to a target sequence in a target gene in the insect pest.
7. The interfering ribonucleic acid according to claim 6, wherein each of the silencing elements comprises a different nucleotide sequence that is complementary to a different target sequence.
8. The interfering ribonucleic acid according to claim 7, wherein the different target sequence is derived solely from the target gene.
9. The interfering ribonucleic acid according to claim 7, wherein the different target sequence is derived from a further target gene different from a target gene comprising SEQ ID NO: 1.
10. The interfering ribonucleic acid according to claim 9, wherein the interfering ribonucleic acid further comprises a spacer sequence.
11. The interfering ribonucleic acid according to claim 10, wherein the spacer sequence is SEQ ID NO:23.
12. A composition for controlling coleopteran insect pest invasion, the composition comprising: (a) at least one interfering ribonucleic acid encoded by the polynucleotide according to claim 1 or (b) a host cell comprising the nucleic acid according to claim 1, and at least one suitable carrier, excipient or diluent, wherein the coleopteran insect pest is Monolepta hieroglyphica.
13. The composition for controlling coleopteran insect pest invasion according to claim 12, wherein the host cell is a bacterial cell.
14. The composition for controlling coleopteran insect pest invasion according to claim 12, wherein the composition is solid, liquid or gel.
15. The composition for controlling coleopteran insect pest invasion according to claim 14, wherein the composition is an insecticidal spray.
16. The composition for controlling coleopteran insect pest invasion according to claim 12, wherein the composition further comprises at least one insecticide, and the insecticide is a chemical insecticide, potato tuber specific protein, Bacillus thuringiensis insecticidal protein, Xenorhabdus ehlersii insecticidal protein, Photorhabdus luminescens insecticidal protein, Bacillus laterosporus insecticidal protein or Bacillus sphaericus insecticidal protein.
17. A method for controlling coleopteran insect pest invasion, comprising contacting a coleopteran insect pest with an effective amount of at least one interfering ribonucleic acid according to claim 5, wherein the coleopteran insect pest is Monolepta hieroglyphica.
18. A method for improving resistance to coleopteran insect pest in a plant, producing a plant for controlling coleopteran insect pest, or protecting a plant from damage caused by coleopteran insect pest, comprising introducing one of the following into the plant: the nucleic acid according to claim 1; a recombinant vector comprising the nucleic acid according to claim 1, or an interfering ribonucleic acid encoded by the polynucleotide according to claim 1; wherein the interfering ribonucleic acid comprises at least one silencing element, wherein the silencing element is a double-stranded RNA region comprising complementary strands which have been annealed, and one strand of which comprises a nucleotide sequence at least partially complementary to a target sequence within a target gene in the coleopteran insect pest, wherein the coleopteran insect pest is Monolepta hieroglyphica.
19. The isolated nucleic acid according to claim 1, wherein the nucleotide sequence comprises SEQ ID NO: 1.
20. The isolated nucleic acid according to claim 1, wherein the polynucleotide sequence comprises one of the polynucleotide sequences selected from the full length sequences of SEQ ID NO: 1 SEQ ID NO: 3 to 20.
21. The interfering ribonucleic acid according to claim 9, wherein the further target gene different from the target gene is derived from the same coleopteran insect pest.
22. The interfering ribonucleic acid according to claim 9, wherein the further target gene different from the target gene is derived from the a different coleopteran insect pest.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
EXAMPLES
(3) The following specific examples further illustrate the technical solution of the polynucleotide and method of the present invention for controlling insect invasion.
Example 1
Determination of Monolepta hieroglyphica Target Sequence
(4) 1. Extraction of Total RNA of Monolepta hieroglyphica
(5) First-instar worms of Monolepta hieroglyphica were used as material, RNA was extracted by the conventional Trizol method, purified by the conventional method, and treated with DNA enzyme to obtain a total RNA sample with a concentration of ≥300 ng/μL, a total amount of ≥6 μg, and an OD 260/280 of 1.8-2.2.
(6) 2. Isolation of mRNA and Synthesis of cDNA
(7) Magnetic beads with oligo-dT were used to separate mRNA with polyA from the total RNA sample as prepared above, and then the first strand of cDNA was synthesized with random hexamer and Invitrogen's Superscript II reverse transcriptase kit.
(8) 3. Screening of Target Genes
(9) One sample of target gene c35112 of Monolepta hieroglyphica was screened out from the larval library analysis of genes with moderate expression levels and possibly involved in important metabolic pathways, its full-length nucleotide sequence was shown in SEQ ID NO:1, and its amino acid sequence was shown in SEQ ID NO: 2.
(10) 4. Selection of Target Sequence in Target Gene
(11) Eighteen target sequences with different ORF positions and/or different lengths of target gene c35112 were selected, as shown in Table 1:
(12) TABLE-US-00001 TABLE 1 Sequence information of 18 target sequences Target sequence Sequence No. Target sequence 1-r1 SEQ ID NO: 3 Target sequence 2-r2 SEQ ID NO: 4 Target sequence 3-r3 SEQ ID NO: 5 Target sequence 4-r4 SEQ ID NO: 6 Target sequence 5-r5 SEQ ID NO: 7 Target sequence 6-r6 SEQ ID NO: 8 Target sequence 7-r7 SEQ ID NO: 9 Target sequence 8-r8 SEQ ID NO: 10 Target sequence 9-r9 SEQ ID NO: 11 Target sequence 10-r10 SEQ ID NO: 12 Target sequence 11-r11 SEQ ID NO: 13 Target sequence 12-r12 SEQ ID NO: 14 Target sequence 13-r13 SEQ ID NO: 15 Target sequence 14-r14 SEQ ID NO: 16 Target sequence 15-r15 SEQ ID NO: 17 Target sequence 16-r16 SEQ ID NO: 18 Target sequence 17-r17 SEQ ID NO: 19 Target sequence 18-r18 SEQ ID NO: 20
Example 2
Production of dsRNA
(13) By referring to the instructions of MEGAscript RNAi Kit of ThermoFisher Company, the dsRNAs of the above 18 target sequences were synthesized, which are r1-dsRNA to r18-dsRNA; and product sizes were detected by agarose electrophoresis with a mass concentration of 1%, and the concentrations of the above r1-dsRNA to r18-dsRNA were determined by using NanoDrop 2000 (Thermo Scientific), respectively.
Example 3
Identification of Control of Monolepta hieroglyphica by Feeding dsRNA
(14) The separated and purified r1-dsRNA to r18-dsRNA were mixed separately and added evenly into feed at ratios of 50 μg/g feed and 5 μg/g feed (for feed formula, see: Development of an artificial diet for the western corn rootworm, Entomologia Experimentalis et Applicata 105:1-11, 2002.), and thus c35112-r1-50 to c35112-r18-50 feeds and c35112-r1-5 to c35112-r18-5 feeds were obtained respectively, wherein the control group feed CK was added with irrelevant dsRNA (SEQ ID NO: 29) and other conditions were exactly the same. The newly hatched larvae of Monolepta hieroglyphica were fed with the prepared feeds, in which 30 newly hatched larvae with incubation time of no more than 24 hours were placed in each dish, wherein the feeds mixed with dsRNA were changed every two days and fed until the 12th day. Insect mortality was counted every two days from the beginning of feeding. From the beginning of feeding, the expression levels of target genes were measured on Day 0, 4, 8, and 10 by a specific method as follows:
(15) Step 301: the worms that were fed with c35112-r1-50 to c35112-r18-50 feeds and c35112-r1-5 to c35112-r18-5 feeds were collected on Day 0, 4, 8, and 10 respectively, and cryopreservated in liquid nitrogen;
(16) Step 302: the total RNAs of the above-mentioned worms were extracted by using the Trizol method;
(17) Step 303: the total RNAs of the above-mentioned worms were reversely transcribed by using TransGen Biotech ER301-01 to obtain cDNAs;
(18) Step 304: Ubiquitin-C was used as an internal reference gene to perform PCR amplification, and after amplification, 10 uL of the amplified product was subjected to agarose gel electrophoresis with a mass concentration of 1%.
(19) Each treatment in the above experiment was repeated 5 times, and the statistical results were shown in
(20) The results of the target gene expression measurement in
(21) The dsRNA feeding results in Table 2 showed that the dsRNA of target sequences r1-r18 of the target gene c35112 had obvious lethal effects on Monolepta hieroglyphica, and there were almost no surviving larvae in most repeats on Day 12 of feeding.
(22) TABLE-US-00002 TABLE 2 Results of survival rate of dsRNA feeding test of Monolepta hieroglyphica Material No. DAI0 DAI2 DAI4 DAI6 DAI8 DAI10 DAI12 CK-dsRNA 100% ± 0% 100% ± 0% 96% ± 5% 96% ± 5% 92% ± 8% 87% ± 10% 85% ± 12% r1-dsRNA-50 100% ± 0% 98% ± 4% 92% ± 6% 81% ± 11% 58% ± 15% 32% ± 16% 8% ± 10% r1-dsRNA-5 100% ± 0% 100% ± 0% 94% ± 6% 85% ± 9% 75% ± 14% 52% ± 10% 30% ± 16% r2-dsRNA-50 100% ± 0% 100% ± 0% 90% ± 6% 78% ± 8% 47% ± 7% 27% ± 12% 12% ± 6% r2-dsRNA-5 100% ± 0% 98% ± 2% 97% ± 4% 89% ± 6% 72% ± 12% 49% ± 9% 25% ± 15% r3-dsRNA-50 100% ± 0% 98% ± 4% 88% ± 7% 71% ± 10% 45% ± 9% 19% ± 15% 8% ± 5% r3-dsRNA-5 100% ± 0% 100% ± 0% 93% ± 7% 89% ± 7% 77% ± 14% 56% ± 18% 28% ± 10% r4-dsRNA-50 100% ± 0% 97% ± 3% 92% ± 6% 75% ± 8% 50% ± 8% 25% ± 12% 12% ± 8% r4-dsRNA-5 100% ± 0% 98% ± 3% 89% ± 8% 79% ± 10% 70% ± 10% 50% ± 10% 30% ± 15% r5-dsRNA-50 100% ± 0% 100% ± 0% 86% ± 10% 68% ± 15% 35% ± 12% 10% ± 8% 5% ± 5% r5-dsRNA-5 100% ± 0% 100% ± 0% 92% ± 10% 85% ± 15% 65% ± 12% 51% ± 16% 22% ± 10% r6-dsRNA-50 100% ± 0% 98% ± 4% 91% ± 7% 81% ± 9% 46% ± 12% 20% ± 8% 8% ± 6% r6-dsRNA-5 100% ± 0% 100% ± 0% 95% ± 6% 86% ± 12% 70% ± 13% 55% ± 15% 28% ± 10% r7-dsRNA-50 100% ± 0% 94% ± 5% 90% ± 8% 82% ± 8% 67% ± 8% 38% ± 12% 12% ± 8% r7-dsRNA-5 100% ± 0% 100% ± 0% 92% ± 6% 82% ± 12% 67% ± 14% 49% ± 11% 31% ± 14% r8-dsRNA-50 100% ± 0% 100% ± 0% 93% ± 7% 77% ± 6% 55% ± 10% 28% ± 9% 16% ± 5% r8-dsRNA-5 100% ± 0% 100% ± 0% 88% ± 6% 80% ± 10% 65% ± 12% 50% ± 12% 25% ± 15% r9-dsRNA-50 100% ± 0% 98% ± 2% 86% ± 8% 70% ± 10% 50% ± 10% 25% ± 10% 10% ± 10% r9-dsRNA-5 100% ± 0% 100% ± 0% 95% ± 6% 82% ± 8% 59% ± 10% 41% ± 13% 27% ± 12% r10-dsRNA-5O 100% ± 0% 100% ± 0% 88% ± 10% 79% ± 8% 63% ± 11% 50% ± 9% 18% ± 12% r10-dsRNA-5 100% ± 0% 100% ± 0% 96% ± 5% 89% ± 6% 65% ± 10% 52% ± 12% 25% ± 10% r11-dsRNA-50 100% ± 0% 95% ± 6% 86% ± 7% 67% ± 12% 50% ± 12% 32% ± 11% 10% ± 10% r11-dsRNA-5 100% ± 0% 100% ± 0% 96% ± 4% 89% ± 6% 65% ± 10% 52% ± 11% 27% ± 10% r12-dsRNA-50 100% ± 0% 95% ± 7% 81% ± 7% 80% ± 9% 63% ± 14% 33% ± 7% 10% ± 5% r12-dsRNA-5 100% ± 0% 99% ± 1% 83% ± 7% 74% ± 14% 44% ± 8% 41% ± 5% 17% ± 9% r13-dsRNA-50 100% ± 0% 97% ± 4% 81% ± 6% 72% ± 7% 57% ± 14% 30% ± 12% 17% ± 14% r13-dsRNA-5 100% ± 0% 99% ± 2% 82% ± 7% 77% ± 10% 48% ± 6% 43% ± 11% 28% ± 10% r14-dsRNA-50 100% ± 0% 98% ± 2% 94% ± 4% 73% ± 11% 62% ± 9% 31% ± 11% 17% ± 7% r14-dsRNA-5 100% ± 0% 99% ± 1% 89% ± 8% 67% ± 8% 59% ± 12% 45% ± 10% 29% ± 3% r15-dsRNA-50 100% ± 0% 97% ± 2% 81% ± 6% 66% ± 12% 50% ± 12% 38% ± 12% 9% ± 12% r15-dsRNA-5 100% ± 0% 99% ± 1% 82% ± 8% 74% ± 13% 48% ± 7% 46% ± 6% 21% ± 6% r16-dsRNA-50 100% ± 0% 98% ± 3% 92% ± 6% 74% ± 10% 62% ± 14% 27% ± 7% 14% ± 8% r16-dsRNA-5 100% ± 0% 99% ± 1% 81% ± 4% 63% ± 14% 51% ± 12% 47% ± 10% 29% ± 6% r17-dsRNA-50 100% ± 0% 97% ± 2% 90% ± 5% 85% ± 13% 64% ± 9% 25% ± 5% 18% ± 6% r17-dsRNA-5 100% ± 0% 96% ± 5% 85% ± 9% 77% ± 10% 62% ± 8% 41% ± 12% 20% ± 5% r18-dsRNA-50 100% ± 0% 100% ± 0% 85% ± 7% 82% ± 6% 47% ± 13% 31% ± 13% 14% ± 6% r18-dsRNA-5 100% ± 0% 97% ± 4% 85% ± 8% 83% ± 6% 43% ± 13% 36% ± 10% 28% ± 10%
Example 4
Unexpected Technical Effects of Interfering the Expression of Same Gene in Different Insects
(23) Signal recognition particle 54 kDa protein belongs to one of peptide chains in signal recognition particle complex. Its main function is that when the currently secreted protein is exposed from ribosome, the signal recognition particle 54 kDa protein quickly binds to a signal sequence of the presecreted protein, and transfers it to a membrane protein associated with translocation chain. Relevant literature has shown that the interference on the expression of the gene encoding the signal recognition particle 54 kDa protein can have lethal effects on a variety of coleopteran insects; for example, as reported by Julia Ulrich et al. (2015), when the gene encoding the protein in Tribolium castaneum was subjected to RNAi interference by injection way (injection of sequence code iB_00404), it was found that the Tribolium castaneum was almost all dead within 4 days after injection. Further, as reported by Avet-Rochex et al. (2010), when the gene encoding the protein in Drosophila was subjected to RNAi interference by injection (Table 1), the results showed that the Drosophila was almost all dead after injection.
(24) Based on the above-mentioned literature reports and high sequence homology, the gene encoding the protein in Monolepta hieroglyphica was screened, and the sequence M1 as shown in SEQ ID NO: 30 at the corresponding position was selected according to the sequences injected in Tribolium castaneum and Drosophila; the sequence M2 as shown in SEQ ID NO:31 at non-corresponding position was also selected. The method of feeding dsRNA (50 μg/g feed ratio) in Example 3 of the present invention was used to identify the control ability to Monolepta hieroglyphica. As shown in Table 3, the experimental results showed that neither the sequence M1 at corresponding position nor the sequence M2 at non-corresponding position had obvious lethal effect on Monolepta hieroglyphica, which was basically the same as the control. Similar experimental results were confirmed in WO 2018/026770, in which after obtaining the transcription group, RNAi lethal genes of Nematodes and Drosophila were used for verification, that was, according to the known lethal genes in Nematodes and Drosophila, the corresponding gene in corn rootworm was subjected to RNAi interference, and basically no obvious lethal effect was observed. In summary, the technical effects of interfering the expression of same gene in different insects are unpredictable, and are not necessarily related to the technical effects of known interference and sequence homology.
(25) TABLE-US-00003 TABLE 3 Lethality rate results of dsRNA feeding test of Monolepta hieroglyphica Material No. DAI4 DAI6 DAI8 DAI10 DAI12 DAI14 CK-dsRNA 96% ± 6% 85% ± 9% 75% ± 16% 71% ± 16% 69% ± 13% 69% ± 14% M1-dsRNA-50 98% ± 3% 92% ± 6% 89% ± 7% 83% ± 9% 69% ± 15% 63% ± 18% M2-dsRNA-50 91% ± 8% 88% ± 10% 84% ± 11% 76% ± 13% 69% ± 15% 67% ± 17%
Example 5
Construction of Plant Expression Vector
(26) Two expression cassettes were synthesized according to the sequence of p35S-RX-tNos-p35S-Hpt-tNos (X was 1-18), and were ligated to a plant expression vector by using EcoR V and BamH I, and the resultant vectors are named as DBNR35112CX (X was 1-18), wherein the schematic diagram of DBNR35112C1 vector was shown in
(27) The recombinant expression vector DBNR35112C1 was transformed into E. coli T1 competent cells by the heat shock method, in which the heat shock conditions were: 50 μL of E. coli T1 competent cells, 10 μL of plasmid DNA (recombinant expression vector DBNR35112C1), 42° C. water bath for 30 s; 37° C. shaking culture for 1 h (shaking on a shaker at 100 rpm); then cultured at 37° C. for 12 h on a LB solid plate containing 50 mg/L Kanamycin (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, agar 15 g/L, adjusted to pH 7.5 with NaOH), the white colonies were picked and cultured overnight at 37° C. in a LB liquid medium (tryptone 10 g/L, yeast extract 5 g/L, NaCl 10 g/L, Kanamycin 50 mg/L, adjusted to pH 7.5 with NaOH). The plasmids were extracted by alkaline method: the bacterial solution was centrifuged at 12000 rpm for 1 min, the supernatant was discarded, and the precipitated bacterial cells were suspended with 100 μL of ice-precooled Solution I (25 mM Tris-HCl, 10 mM EDTA (ethylenediaminetetraacetic acid), 50 mM glucose, PH8.0); 200 μL of newly prepared Solution II (0.2M NaOH, 1% SDS (sodium dodecyl sulfate)) was added, the tube was inverted 4 times for mixing, and placed on ice for 3-5 min; 150 μL of ice-cooled Solution III (3M potassium acetate, 5M acetic acid) was added, mixed thoroughly immediately, and placed on ice for 5-10 min; after centrifugation for 5 min at a temperature of 4° C. and a rotation speed of 12000 rpm, 2 volumes of absolute ethanol was added to the supernatant, evenly mixed, and stood at room temperature for 5 minutes; centrifugation was carried out for 5 minutes at a temperature of 4° C. and a rotation speed of 12000 rpm, the supernatant was discarded, the precipitate was washed with ethanol with a concentration (V/V) of 70%, and dried in the air; 30 μL of TE (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) containing RNase (20 μg/mL) was added to dissolve the precipitate; digestion of RNA was carried out in a water bath at 37° C. for 30 minutes; stored at −20° C. for later use. The extracted plasmids were sequenced and identified by PCR, and the results showed that the recombinant expression vector DBNR35112C1 was constructed correctly.
(28) The recombinant expression vectors DBNR35112C2 to DBNR35112C18 were constructed according to the above method, and their vector structures were: Kan: kanamycin gene; RB: right border; pr35S: cauliflower mosaic virus 35S (SEQ ID NO: 21); RX: rX nucleotide sequence (rX was the target sequence X of target gene c35112, X was 2 to 18)+spacer sequence (SEQ ID NO: 23)+the reverse complement of rX nucleotide sequence; tNos: nopaline synthase gene terminator (SEQ ID NO: 24); Hpt: hygromycin phosphotransferase gene (SEQ ID NO: 25); LB: left border, the recombinant expression vectors DBNR35112C2 to DBNR35112C18 were transformed into E. coli T1 competent cells by the heat shock method, and plasmids were extracted by the alkaline method.
Example 6
Transformation of Agrobacterium with Recombinant Expression Vector
(29) The correctly constructed recombinant expression vectors DBNR35112C1 to DBNR35112C18 were transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA, CAT: 18313-015) by the liquid nitrogen method, in which the transformation conditions were: 100 μL of Agrobacterium LBA4404, 3 μL of plasmid DNA (recombinant expression vector); placed in liquid nitrogen for 10 minutes, 37° C. warm water bath for 10 minutes; the transformed Agrobacterium LBA4404 was inoculated into LB test tube at a temperature of 28° C. and a rotate speed of 200 rpm for 2 h, coated on a LB plate containing 50 mg/L Rifampicin and 100 mg/L Kanamycin until positive monoclone was grown, the monoclone culture was picked and its plasmid was extracted, the recombinant expression vectors DBNR35112C1 to DBNR35112C18 were subjected to enzyme digestion using restriction enzymes EcoR V and BamH I to perform enzyme digestion verification, and the results showed that the structures of the recombinant expression vectors DBNR35112C1 to DBNR35112C18 were completely correct.
Example 7
Production of Transgenic Maize Plants
(30) According to the conventional Agrobacterium infection method, immature embryos of aseptically cultured maize variety Z31 (Z31) were co-cultured with the transformed Agrobacterium described in Example 6 to transfer the T-DNA (including RX nucleotide sequence, promoter sequence of cauliflower mosaic virus 35S gene, Hpt gene and Nos terminator sequence) of the recombinant expression vectors DBNR35112C1 to DBNR35112C18 as constructed in Example 5 into the maize genome, thereby obtaining maize plants transferred with RX nucleotide sequence (X was 1-18); and wild-type maize plants were used as control at the same time.
(31) For the Agrobacterium-mediated maize transformation, briefly, immature embryos were isolated from corn, and the immature embryos were contacted with Agrobacterium suspension, wherein Agrobacterium was capable of delivering the RX nucleotide sequence to at least one of the immature embryo's cells (Step 1: Infection step). In this step, the immature embryos were preferably immersed in the Agrobacterium suspension (OD 660=0.4 to 0.6, infection medium (MS salt 4.3 g/L, MS vitamin, casein 300 mg/L, sucrose 68.5 g/L, glucose 36 g/L, acetosyringone (AS) 40 mg/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, pH5.3)) to start inoculation. The immature embryos were co-cultured with Agrobacterium for a period of time (3 days) (Step 2: Co-cultivation step). Preferably, the immature embryos were placed on a solid medium (MS salt 4.3 g/L, MS vitamins, casein 300 mg/L, sucrose 20 g/L, glucose 10 g/L, acetosyringone (AS) 100 mg/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, agar 8 g/L, pH5.8) after the infection step. After this co-cultivation stage, there could be an optional “recovery” step. In the “recovery” step, a recovery medium (MS salt 4.3 g/L, MS vitamins, casein 300 mg/L, sucrose 30 g/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, plant gel 3 g/L, pH 5.8) contained at least one antibiotic (cephalosporin) that was known to inhibit the growth of Agrobacterium, and no selection agent for plant transformant was added (Step 3: Recovery step). Preferably, the immature embryos were cultured on a solid medium containing antibiotic but no selective agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated immature embryos were cultured on a medium containing a selection agent (hygromycin) and the growing transformed callus was selected (Step 4: Selection step). Preferably, the immature embryos were cultured on a solid medium (MS salt 4.3 g/L, MS vitamins, casein 300 mg/L, sucrose 30 g/L, hygromycin 50 mg/L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg/L, plant gel 3 g/L, pH5.8) containing a selection agent, thereby resulting in the selective growth of transformed cells. Then, the callus was regenerated into a plant (Step 5: Regeneration step). Preferably, the callus grown on the medium containing the selection agent was cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate the plant.
(32) The screened resistant callus was transferred to the MS differentiation medium (MS salt 4.3 g/L, MS vitamins, casein 300 mg/L, sucrose 30 g/L, 6-benzylaminopurine 2 mg/L, hygromycin 50 mg/L, plant gel 3 g/L, pH5.8), and cultured at 25° C. for differentiation. The differentiated seedlings were transferred to the MS rooting medium (MS salt 2.15 g/L, MS vitamins, casein 300 mg/L, sucrose 30 g/L, indole-3-acetic acid 1 mg/L, plant gel 3 g/L, PH5.8), cultured at 25° C. to a height of about 10 cm, then moved to a greenhouse and cultivated until fruition. In the greenhouse, the cultivation was performed at 28° C. for 16 hours and then at 20° C. for 8 hours per day.
Example 8
Production of Transgenic Soybean Plants
(33) According to the conventional Agrobacterium infection method, the cotyledonary node tissue of sterilely cultured soybean variety Zhonghuang 13 was co-cultured with the transformed Agrobacterium described in Example 6 to transfer the T-DNA (including RX nucleotide sequence, cauliflower mosaic virus 35S gene promoter sequence, Hpt gene and Nos terminator sequence) of the recombination expression vectors DBNR35112C1 to DBNR35112C18 into the soybean genome, thereby obtaining soybean plants transferred with RX nucleotide sequence (X is 1-18); and wild-type soybean plants were used as control at the same time.
(34) For the Agrobacterium-mediated soybean transformation, briefly, mature soybean seeds were germinated in soybean germination medium (B5 salt 3.1 g/L, B5 vitamin, sucrose 20 g/L, agar 8 g/L, pH5.6), the seeds were inoculated on germination medium and cultivated under the following conditions: temperature was 25±1° C.; photoperiod (light/dark) was 16/8 h. After 4 to 6 days of germination, aseptic soybean seedlings with enlarged cotyledon nodes in bright green were selected, the hypocotyls 3-4 mm below the cotyledon nodes were cut off, the cotyledons were cut longitudinally, then apical buds, lateral buds and seed roots were removed. Scalpel back was used to wound the cotyledon node, and the wounded cotyledon node tissue contacted with Agrobacterium suspension, wherein the Agrobacterium could transfer the RX nucleotide sequence to the wounded cotyledon node tissue (Step 1: Infection step). In this step, the cotyledon node tissue was preferably immersed in the Agrobacterium suspension (OD 660=0.5 to 0.8, infection medium (MS salt 2.15 g/L, B5 vitamin, sucrose 20 g/L, glucose 10 g/L, acetylsyringone (AS) 40 mg/L, 2-morpholineethanesulfonic acid (MES) 4 g/L, zeatin (ZT) 2 mg/L, pH5.3) to start inoculation. The cotyledon node tissue and Agrobacterium were co-cultured for a certain period (3 days) (Step 2: Co-cultivation step). Preferably, after the infection step, the cotyledon node tissue was placed in a solid medium (MS salt 4.3 g/L, B5 vitamin, sucrose 20 g/L, glucose 10 g/L, 2-morpholineethanesulfonic acid (MES) 4 g/L, zeatin 2 mg/L, agar 8 g/L, pH 5.6). After this co-cultivation stage, there could be an optional “recovery” step. In the “recovery” step, recovery medium (B5 salt 3.1 g/L, B5 vitamins, 2-morpholineethanesulfonic acid (MES) 1 g/L, sucrose 30 g/L, zeatin (ZT) 2 mg/L, agar 8 g/L, cephalosporin 150 mg/L, glutamic acid 100 mg/L, aspartic acid 100 mg/L, pH 5.6) contained at least one antibiotic (cephalosporin) that is known to inhibit the growth of Agrobacterium, and no selective agent for plant transformant was added (Step 3: Recovery step). Preferably, the regenerated tissue mass of the cotyledon node was cultured on a solid medium with antibiotic but no selective agent to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the regenerated tissue mass of the cotyledon node was cultured on a medium containing a selection agent (hygromycin) and the growing transformed callus was selected (Step 4: Selection step). Preferably, the regenerated tissue mass of the cotyledon node was cultured on a screening solid medium with selective agent (B5 salt 3.1 g/L, B5 vitamin, 2-morpholineethanesulfonic acid (MES) 1 g/L, sucrose 30 g/L, 6-benzylaminopurine (6-BAP) 1 mg/L, agar 8 g/L, cephalosporin 150 mg/L, glutamic acid 100 mg/L, aspartic acid 100 mg/L, hygromycin 50 mg/L, pH 5.6), resulting in selective growth of the transformed cell. Then, the transformed cell was regenerate to a plant (Step 5: Regeneration step); preferably, the regenerated tissue mass of the cotyledon node grown on the medium containing the selection agent was cultured in solid media (B5 differentiation medium and B5 rooting medium) to regenerate the plant.
(35) The screened resistant tissue mass was transferred to the B5 differentiation medium (B5 salt 3.1 g/L, B5 vitamins, 2-morpholineethanesulfonic acid (MES) 1 g/L, sucrose 30 g/L, zeatin (ZT) 1 mg/L, agar 8 g/L, cephalosporin 150 mg/L, glutamic acid 50 mg/L, aspartic acid 50 mg/L, gibberellin 1 mg/L, auxin 1 mg/L, hygromycin 50 mg/L, PH5.6), cultured at 25° C. for differentiation. The differentiated seedlings were transferred to the B5 rooting medium (B5 salt 3.1 g/L, B5 vitamins, 2-morpholineethanesulfonic acid (MES) 1 g/L, sucrose 30 g/L, agar 8 g/L, cephalosporin 150 mg/L, indole-3-butyric acid (IBA) 1 mg/L), cultured in rooting medium at 25° C. to a height of about 10 cm, moved to a greenhouse and cultivated until fruition. In the greenhouse, cultivation was carried out at 26° C. for 16 hours and then at 20° C. for 8 hours per day.
Example 9
Verification of Transgenic Maize and Soybean Plants by TaqMan
(36) About 100 mg of the leaves of the maize plants transferred with RX nucleotide sequences (X was 1 was 18) as samples were separately taken, and their genomic DNAs were extracted with DNeasy Plant Maxi Kit of Qiagen, respectively, and the copy numbers of the RX nucleotide sequences were determined by detecting the copy number of Hpt gene by Taqman probe fluorescence quantitative PCR method. At the same time, wild-type maize plants were used as control, and subjected to the detection and analysis according to the above methods. The experiment was repeated 3 times and the average value was taken.
(37) The specific method for detecting the copy number of Hpt gene was as follows:
(38) Step 901: 100 mg of each of the leaves of the maize plant transferred with RX nucleotide sequence and the wild-type maize plant was separately taken, and ground into a homogenate with liquid nitrogen in a mortar respectively, and 3 repeats were taken for each sample;
(39) Step 902: the genomic DNA of the above-mentioned sample was extracted by using DNeasy Plant Mini Kit of Qiagen, and the product manual thereof was referred to for the specific method;
(40) Step 903: NanoDrop 2000 (Thermo Scientific) was used to measure the genomic DNA concentration of the above sample;
(41) Step 904: the genomic DNA concentration of the above sample was adjusted to the same concentration value, and the range of the concentration value was 80 to 100 ng/μL;
(42) Step 905: the Taqman probe fluorescence quantitative PCR method was used to identify the copy number of the sample, the identified sample with known copy number was used as a standard product, and the wild-type maize plant sample was used as control, 3 repeats were taken for each sample, and the average value thereof was taken; the sequences of the primers and probes for fluorescence quantitative PCR were:
(43) the following primers and probes were used to detect the Hpt nucleotide sequence:
(44) Primer 1: cagggtgtcacgttgcaaga as shown in SEQ ID NO: 26 in the sequence listing;
(45) Primer 2: ccgctcgtctggctaagatc as shown in SEQ ID NO: 27 in the sequence listing;
(46) Probe 1: tgcctgaaaccgaactgcccgctg as shown in SEQ ID NO: 28 in the sequence listing;
(47) the PCR reaction system was:
(48) TABLE-US-00004 JumpStart ™ Taq ReadyMix ™ (Sigma) 10 μL 50× primer/probe mixture 1 μL Genomic DNA 3 μL Water (ddH.sub.2O) 6 μL
(49) the 50× primer/probe mixture contained 45 μL of each primer at a concentration of 1 mM, 50 μL of probe at a concentration of 100 μM, and 860 μL of 1× TE buffer, and was stored in a centrifuge tube at 4° C.
(50) The PCR reaction conditions were:
(51) TABLE-US-00005 Step Temperature Time 911 95° C. 5 min 912 95° C. 30 s 913 60° C. 1 min 914 returned to step 712, repeated for 40 cycles
(52) The data was analyzed using SDS2.3 software (Applied Biosystems).
(53) By analyzing the experimental results of the copy number of the Hpt gene, it was confirmed that the RX nucleotide sequences had been integrated into the chromosome of the tested maize plants, respectively, and single-copy transgenic maize plants had been obtained from the maize plants transferred with the RX nucleotide sequences (X was 1-18).
(54) According to the above method of using TaqMan to verify transgenic maize plants, the transgenic soybean plants were detected and analyzed. By analyzing the experimental results of the copy number of the Hpt gene, it was confirmed that the RX nucleotide sequences had been integrated into the chromosome of the tested soybean plants, and single-copy transgenic soybean plant had been obtained from the soybean plants transferred with the RX nucleotide sequences (X was 1-18).
Example 10
Identification of Insecticidal Effects of Transgenic Maize on Monolepta hieroglyphica
(55) The maize plants transformed with the RX nucleotide sequences (X was 1-18) were tested for insect resistance effect on Monolepta hieroglyphica.
(56) Step 1001: 10 plants of each of single-copy DBNR35112C1 to DBNR35112C18 maize transformation events (RX-M) identified as positive by taqman and 3 plants of maize transformation event (NGM1) identified as negative by taqman were selected respectively; the wild-type maize plant was used as control (CK1) at the same time; and they were planted in a greenhouse to three-leaf stage;
(57) Step 1002: the materials described in Step 1001 were taken, the third tender leaf from each seedling was taken, cut into 1×2 cm to remove leave blade of main vein, and the leave blade was tiled in a petri dish covered with moisturizing filter paper;
(58) Step 1003: 10 newly hatched larvae of Monolepta hieroglyphica with an incubation time of no more than 24 hours were placed in each petri dish, and the lid of petri dish was closed, the petri dish was placed into a bioassay box with moisturizing gauze at bottom, and the bioassay box was placed in a bioassay chamber with a temperature of 24±2° C., a D/L of 24/0, and a humidity of 70-80% (i.e., “bioassay”);
(59) Step 1004: considering that the newly hatched larvae of Monolepta hieroglyphica were weak and prone to mechanical damage, the petri dish was kept as still as possible on the day of inoculation and the first day after inoculation;
(60) Step 1005: from Day 2 of inoculation, the number of surviving Monolepta hieroglyphica was counted from outside the petri dish every day until the end of Day 16; the surviving Monolepta hieroglyphica in the petri dish were transferred to a petri dish with fresh leaves every 2 days, and the experimental results were shown in Table 4.
(61) TABLE-US-00006 TABLE 4 Experimental results of feeding Monolepta hieroglyphica with leaves of maize transformation events Material Survival rate of Monolepta hieroglyphica every 2 days after bioassay No. DAI2 DAI4 DAI6 DAI8 DAI10 DAI12 DAI14 DAI16 CK1 100% ± 0% 91% ± 4% 92% ± 6% 89% ± 5% 82% ± 10% 78% ± 9% 76% ± 12% 72% ± 10% NGM1 100% ± 0% 96% ± 0% 92% ± 4% 88% ± 4% 83% ± 13% 80% ± 10% 78% ± 11% 75% ± 9% R1-M 100% ± 0% 97% ± 4% 98% ± 2% 78% ± 8% 64% ± 12% 41% ± 11% 32% ± 12% 20% ± 11% R2-M 100% ± 0% 96% ± 5% 92% ± 4% 84% ± 6% 66% ± 11% 42% ± 10% 33% ± 9% 43% ± 10% R3-M 100% ± 0% 97% ± 4% 87% ± 6% 75% ± 8% 63% ± 14% 47% ± 14% 33% ± 8% 21% ± 12% R4-M 100% ± 0% 93% ± 4% 87% ± 8% 81% ± 6% 65% ± 13% 66% ± 12% 41% ± 10% 28% ± 10% R5-M 100% ± 0% 95% ± 3% 88% ± 8% 76% ± 12% 62% ± 10% 45% ± 10% 31% ± 9% 25% ± 10% R6-M 100% ± 0% 99% ± 1% 96% ± 3% 87% ± 8% 65% ± 15% 69% ± 9% 52% ± 10% 21% ± 11% R7-M 100% ± 0% 91% ± 5% 93% ± 4% 77% ± 10% 62% ± 14% 66% ± 12% 54% ± 10% 22% ± 13% R8-M 100% ± 0% 99% ± 2% 92% ± 5% 77% ± 11% 72% ± 10% 49% ± 10% 36% ± 9% 27% ± 10% R9-M 100% ± 0% 100% ± 0% 98% ± 2% 88% ± 9% 72% ± 13% 53% ± 11% 30% ± 10% 26% ± 9% R10-M 100% ± 0% 99% ± 2% 99% ± 1% 85% ± 10% 67% ± 14% 62% ± 12% 52% ± 10% 26% ± 10% R11-M 100% ± 0% 98% ± 2% 92% ± 5% 84% ± 9% 73% ± 12% 67% ± 10% 38% ± 12% 33% ± 15% R12-M 100% ± 0% 94% ± 4% 90% ± 7% 86% ± 10% 68% ± 10% 49% ± 9% 44% ± 9% 33% ± 10% R13-M 100% ± 0% 100% ± 0% 94% ± 4% 75% ± 10% 60% ± 12% 57% ± 10% 39% ± 10% 27% ± 10% R14-M 100% ± 0% 97% ± 2% 87% ± 6% 86% ± 12% 61% ± 15% 52% ± 12% 36% ± 12% 18% ± 12% R15-M 100% ± 0% 92% ± 5% 90% ± 6% 77% ± 12% 69% ± 12% 59% ± 10% 45% ± 9% 25% ± 10% R16-M 100% ± 0% 96% ± 2% 89% ± 5% 77% ± 11% 75% ± 14% 66% ± 11% 51% ± 9% 26% ± 9% R17-M 100% ± 0% 92% ± 3% 91% ± 4% 89% ± 9% 71% ± 13% 64% ± 12% 37% ±10% 21% ± 10% R18-M 100% ± 0% 93% ± 4% 90% ± 5% 84% ± 10% 75% ± 10% 41% ± 10% 58% ± 12% 24% ± 9%
(62) The experimental results in Table 4 showed that the maize plants transformed with the RX nucleotide sequences (X was 1 to 18) had good inhibitory effect on Monolepta hieroglyphica, and the survival rate of Monolepta hieroglyphica on Day 16 (survival rate=number of surviving insects/number of tested insects) was about 30%.
Example 11
Identification of Insecticidal Effects of Transgenic Soybeans on Monolepta hieroglyphica
(63) The soybean plants transformed with the RX nucleotide sequences (X was 1 to 18) were tested for insect resistance to Monolepta hieroglyphica.
(64) Step 1101: 10 plants of each of single-copy DBNR35112C1 to DBNR35112C18 soybean transformation events (RX-S) identified as positive by taqman and 3 plants of soybean transformation event (NGM2) identified as negative by taqman were selected respectively; the wild-type soybean plant was used as control (CK2) at the same time; they were planted in a greenhouse to three true leaves were grown;
(65) Step 1102: the materials described in Step 1101 were taken, a piece of true leaf of about 2×2 cm was taken from each seedling, and tiled in a petri dish covered with moisturizing filter paper;
(66) Step 1103: 15 newly hatched larvae of Monolepta hieroglyphica with an incubation time of no more than 24 hours were placed in each dish, and the lid of petri dish was closed, the petri dish was placed into a bioassay box with moisturizing gauze at bottom, and the bioassay box was placed in a bioassay chamber with a temperature of 24±2° C., a D/L of 24/0, and a humidity of 70-80%;
(67) Step 1104: considering that the newly hatched larvae of Monolepta hieroglyphica were weak and prone to mechanical damage, the petri dish was kept as still as possible on the day of inoculation and the first day after inoculation;
(68) Step 1105: from Day 2 of inoculation, the number of surviving Monolepta hieroglyphica was counted from outside the petri dish every day until the end of Day 16; the surviving Monolepta hieroglyphica in the petri dish were transferred to a petri dish with fresh true leaves every 2 days, and the experimental results were shown in Table 5.
(69) TABLE-US-00007 TABLE 5 Experimental results of feeding Monolepta hieroglyphica with leaves of soybean transformation events Material Survival rate of Monolepta hieroglyphica every 2 days after bioassay No. DAI2 DAI4 DAI6 DAI8 DAI10 DAI12 DAI14 DAI16 CK2 100% ± 0% 91% ± 4% 91% ± 5% 88% ± 5% 82% ± 10% 78% ± 9% 78% ± 12% 75% ± 8% NGM2 100% ± 0% 96% ± 0% 92% ± 4% 88% ± 4% 85% ± 10% 81% ± 9% 75% ± 10% 73% ± 8% R1-S 100% ± 0% 98% ± 3% 87% ± 5% 83% ± 9% 74% ± 6% 65% ± 8% 43% ± 10% 25% ± 6% R2-S 100% ± 0% 99% ± 1% 87% ± 4% 79% ± 8% 69% ± 8% 56% ± 10% 44% ± 9% 18% ± 11% R3-S 100% ± 0% 96% ± 5% 87% ± 6% 81% ± 10% 70% ± 16% 62% ± 10% 47% ± 12% 23% ± 12% R4-S 100% ± 0% 97% ± 3% 86% ± 8% 79% ± 9% 74% ± 12% 56% ± 9% 44% ± 8% 20% ± 14% R5-S 100% ± 0% 100% ± 0% 87% ± 9% 82% ± 8% 67% ± 9% 50% ± 10% 41% ± 10% 24% ± 9% R6-S 100% ± 0% 99% ± 2% 93% ± 7% 83% ± 8% 71% ± 9% 60% ± 12% 38% ± 6% 21% ± 12% R7-S 100% ± 0% 99% ± 2% 89% ± 8% 85% ± 6% 79% ± 10% 64% ± 8% 39% ± 10% 27% ± 9% R8-S 100% ± 0% 96% ± 3% 90% ± 6% 83% ± 8% 79% ± 10% 54% ± 8% 46% ± 9% 25% ± 12% R9-S 100% ± 0% 96% ± 4% 87% ± 8% 80% ± 9% 76% ± 8% 58% ± 6% 54% ± 6% 20% ± 18% R10-S 100% ± 0% 96% ± 3% 88% ± 9% 85% ± 11% 78% ± 6% 65% ± 10% 30% ± 12% 27% ± 12% R11-S 100% ± 0% 96% ± 2% 89% ± 8% 84% ± 12% 79% ± 5% 50% ± 9% 49% ± 8% 21% ± 10% R12-S 100% ± 0% 97% ± 1% 85% ± 10% 78% ± 9% 65% ± 9% 59% ± 11% 42% ± 10% 27% ± 10% R13-S 100% ± 0% 95% ± 3% 92% ± 8% 83% ± 8% 74% ± 10% 63% ± 10% 42% ± 11% 27% ± 14% R14-S 100% ± 0% 98% ± 2% 90% ± 8% 84% ± 7% 66% ± 9% 52% ± 8% 38% ± 12% 20% ± 9% R15-S 100% ± 0% 96% ± 3% 94% ± 6% 78% ± 6% 69% ± 10% 57% ± 9% 44% ± 12% 16% ± 11% R16-S 100% ± 0% 95% ± 4% 86% ± 10% 87% ± 7% 80% ± 12% 59% ± 10% 40% ± 9% 22% ± 15% R17-S 100% ± 0% 99% ± 1% 94% ± 9% 83% ± 6% 75% ± 10% 66% ± 9% 41% ± 13% 20% ± 13% R18-S 100% ± 0% 97% ± 3% 92% ± 8% 89% ± 4% 82% ± 9% 52% ± 7% 44% ± 8% 34% ± 12%
(70) The experimental results in Table 5 showed that the soybean plants transformed with the RX nucleotide sequences (X was 1 to 18) had good inhibitory effect on Monolepta hieroglyphica, and the survival rate of Monolepta hieroglyphica on Day 16 (survival rate=number of surviving insects/number of tested insects) was 35% or less.
Example 12
Composition
(71) The pesticidally acceptable carrier formula of dsRNA (1 L system): 50 mM NaHPO.sub.4 (pH7.0), 10 mM β-mercaptoethanol, 10 mM EDTA, 0.1% (mass fraction) sodium cetyl sulfonate, 0.1% (mass fraction) polyethylene glycol octyl phenyl ether, added with H.sub.2O to make up to 1 L.
(72) The above formula was a buffer formula, and it was only needed to directly add any purified dsRNA into the buffer, as long as the final concentration met the requirement, such as 50 mg/L. It could also be prepared as a concentrated formulation as needed.
(73) In summary, the present invention discloses for the first time the target gene c35112 and its target sequence for the control of coleopteran insect pest Monolepta hieroglyphica, and the transgenic plants (maize and soybean) are obtained by RNAi technology; the transgenic plants are introduced with dsRNA sequence formed by the target sequence and can control the invasion of Monolepta hieroglyphica, they are efficient and specific and can avoid risk such as that Monolepta hieroglyphica generates resistance to Bt toxin proteins. At the same time, they have good environmental compatibility, convenience and low cost.
(74) Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred examples, those of ordinary skill in the art should understand that the technical solutions of the present invention can be subjected to modifications or equivalent replacements without departing from the spirit and scope of the technical solutions of the present invention.