GENETICALLY MODIFIED NON-HUMAN ANIMAL WITH HUMAN OR CHIMERIC TFR1
20240268361 ยท 2024-08-15
Inventors
Cpc classification
A01K2207/12
HUMAN NECESSITIES
A01K67/0275
HUMAN NECESSITIES
A01K2217/15
HUMAN NECESSITIES
A01K67/0278
HUMAN NECESSITIES
International classification
Abstract
Provided are genetically modified non-human animals that express a human or chimeric (e.g., humanized) TFR1, and methods of use thereof.
Claims
1. A genetically-modified, non-human animal whose genome comprises at least one chromosome comprising a sequence encoding a human or chimeric TFR1 (Transferrin Receptor Protein 1).
2. The animal of claim 1, wherein the sequence encoding the human or chimeric TFR1 is operably linked to an endogenous regulatory element at the endogenous TFR1 gene locus in the at least one chromosome.
3. The animal of claim 1 or 2, wherein the sequence encoding a human or chimeric TFR1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to human TFR1 (NP_003225.2 (SEQ ID NO: 2)).
4. The animal of claim 1 or 2, wherein the sequence encoding a human or chimeric TFR1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 9.
5. The animal of claim 1 or 2, wherein the sequence encoding a human or chimeric TFR1 comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to amino acids 89-760 of SEQ ID NO: 2.
6. The animal of any one of claims 1-5, wherein the animal is a mammal, e.g., a monkey, a rodent, a mouse, or a rat.
7. The animal of any one of claims 1-6, wherein the animal is a mouse.
8. The animal of any one of claims 1-7, wherein the animal does not express endogenous TFR1 or expresses a decreased level of endogenous TFR1.
9. The animal of any one of claims 1-8, wherein the animal has one or more cells expressing human or chimeric TFR1.
10. The animal of any one of claims 1-9, wherein the animal has one or more cells expressing human or chimeric TFR1, and the expressed human or chimeric TFR1 can interact with human transferrin (Tf) and iron, forming an iron-Tf-TFR1 complex to facilitate iron import.
11. The animal of any one of claims 1-9, wherein the animal has one or more cells expressing human or chimeric TFR1, and the expressed human or chimeric TFR1 can interact with endogenous transferrin (Tf) and iron, forming an iron-Tf-TFR1 complex to facilitate iron import.
12. A genetically-modified, non-human animal, wherein the genome of the animal comprises a replacement of a sequence encoding a region of endogenous TFR1 with a sequence encoding a corresponding region of human TFR1 at an endogenous TFR1 gene locus.
13. The animal of claim 12, wherein the sequence encoding the corresponding region of human TFR1 is operably linked to an endogenous regulatory element at the endogenous TFR1 locus, and one or more cells of the animal expresses a human or chimeric TFR1.
14. The animal of claim 12 or 13, wherein the animal does not express endogenous TFR1 or expresses a decreased level of endogenous TFR1.
15. The animal of any one of claims 12-14, wherein the replaced locus is the extracellular region of TFR1.
16. The animal of any one of claims 12-15, wherein the animal has one or more cells expressing a chimeric TFR1 having a cytoplasmic region, a transmembrane region, and an extracellular region, wherein the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%. 90%, 95%, or 99% identical to the extracellular region of human TFR1.
17. The animal of claim 16, wherein the extracellular region of the chimeric TFR1 has a sequence that has at least 100, 200, 300, 400, 500, 600, 620, 650, 660, 665, 666, 667, 668. 669, 670, 671, or 672 contiguous amino acids that are identical to a contiguous sequence present in the extracellular region of human TFR1.
18. The animal of any one of claims 12-17, wherein the sequence encoding a region of endogenous TFR1 comprises exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19, or a part thereof, of the endogenous TFR1 gene.
19. The animal of claim 18, wherein the animal is a mouse.
20. The animal of any one of claims 12-19, wherein the animal is heterozygous with respect to the replacement at the endogenous TFR1 gene locus.
21. The animal of any one of claims 12-19, wherein the animal is homozygous with respect to the replacement at the endogenous TFR1 gene locus.
22. A method for making a genetically-modified, non-human animal, comprising: replacing in at least one cell of the animal, at an endogenous TFR1 gene locus, a sequence encoding a region of endogenous TFR1 with a sequence encoding a corresponding region of human TFR1.
23. The method of claim 22, wherein the sequence encoding the corresponding region of human TFR1 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19, or a part thereof, of a human TFR1 gene.
24. The method of claim 22 or 23, wherein the sequence encoding the corresponding region of human TFR1 comprises a portion of exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and a portion of exon 19, of a human TFR1 gene.
25. The method of any one of claims 22-24, wherein the sequence encoding the corresponding region of human TFR1 encodes amino acids 89-760 of SEQ ID NO: 2.
26. The method of any one of claims 22-25, wherein the region is located within the extracellular region of TFR1.
27. The method of any one of claims 22-26, wherein the sequence encoding a region of endogenous TFR1 comprises exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19, or a part thereof, of the endogenous TFR1 gene.
28. The method of any one of claims 22-27, wherein the animal is a mouse, and the sequence encoding a region of endogenous TFR1 comprises a portion of exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and a portion of exon 19, of the endogenous TFR1 gene.
29. A non-human animal comprising at least one cell comprising a nucleotide sequence encoding a chimeric TFR1 polypeptide, wherein the chimeric TFR1 polypeptide comprises at least 50 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human TFR1, wherein the animal expresses the chimeric TFR1 polypeptide.
30. The animal of claim 29, wherein the chimeric TFR1 polypeptide has at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 500, at least 550, at least 600, at least 650, at least 660, at least 670, at least 671, or at least 672 contiguous amino acid residues that are identical to the corresponding contiguous amino acid sequence of a human TFR1 extracellular region.
31. The animal of claim 29 or 30, wherein the chimeric TFR1 polypeptide comprises a sequence that is at least 90%, 95%, or 99% identical to amino acids 89-760 of SEQ ID NO: 2.
32. The animal of any one of claims 29-31, wherein the nucleotide sequence is operably linked to an endogenous TFR1 regulatory element of the animal.
33. The animal of any one of claims 29-32, wherein the chimeric TFR1 polypeptide comprises an endogenous TFR1 cytoplasmic region and/or an endogenous TFR1 transmembrane region.
34. The animal of any one of claims 29-33, wherein the nucleotide sequence is integrated to an endogenous TFR1 gene locus of the animal.
35. The animal of any one of claims 29-34, wherein the chimeric TFR1 polypeptide has at least one mouse TFR1 activity and/or at least one human TFR1 activity.
36. A method of making a genetically-modified animal cell that expresses a chimeric TFR1, the method comprising: replacing at an endogenous TFR1 gene locus, a nucleotide sequence encoding a region of endogenous TFR1 with a nucleotide sequence encoding a corresponding region of human TFR1, thereby generating a genetically-modified animal cell that includes a nucleotide sequence that encodes the chimeric TFR1, wherein the animal cell expresses the chimeric TFR1.
37. The method of claim 36, wherein the animal is a mouse.
38. The method of claim 36 or 37, wherein the chimeric TFR1 comprises a cytoplasmic region and/or a transmembrane region of mouse TFR1; and an extracellular region of human TFR1.
39. The method of any one of 36-38, wherein the nucleotide sequence encoding the chimeric TFR1 is operably linked to an endogenous TFR1 regulatory region, e.g., promoter.
40. The animal of any one of claims 1-21 and 29-35, wherein the animal further comprises a sequence encoding an additional human or chimeric protein.
41. The animal of claim 40, wherein the additional human or chimeric protein is programmed cell death protein 1 (PD-1), programmed cell death ligand 1 (PD-L1), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), TNF receptor superfamily member 4 (OX40), lymphocyte-activation gene 3 (LAG3), T-cell immunoglobulin and mucin-domain containing-3 (TIM-3), or CD73.
42. The method of any one of claims 22-28 and 36-39, wherein the animal or mouse further comprises a sequence encoding an additional human or chimeric protein.
43. The method of claim 42, wherein the additional human or chimeric protein is PD-1, PD-L1, CTLA-4, OX40, LAG-3, TIM3, or CD73.
44. A method of determining effectiveness of an anti-TFR1 antibody for the treatment of cancer, comprising: a) administering the anti-TFR1 antibody to the animal of any one of claims 1-21, 29-35, 40, and 41, wherein the animal has a cancer; and b) determining inhibitory effects of the anti-TFR1 antibody to the cancer.
45. The method of claim 44, wherein the cancer comprises one or more cells that express TFR1.
46. The method of claim 44 or 45, wherein the cancer comprises one or more cancer cells that are injected into the animal.
47. The method of any one of claims 44-46, wherein determining inhibitory effects of the anti-TFR1 antibody to the cancer involves measuring the tumor volume in the animal.
48. The method of any one of claims 44-47, wherein the cancer is brain cancer, breast cancer, colon cancer, liver cancer, ovarian cancer, lung cancer, bone cancer, leukemia, and/or lymphoma.
49. A method of determining effectiveness of an anti-TFR1 antibody and an additional therapeutic agent for the treatment of cancer, comprising a) administering the anti-TFR1 antibody and the additional therapeutic agent to the animal of any one of claims 1-21, 29-35, 40, and 41, wherein the animal has a cancer; and b) determining inhibitory effects on the cancer.
50. The method of claim 49, wherein the animal further comprises a sequence encoding a human or chimeric programmed cell death protein 1 (PD-1).
51. The method of claim 49 or 50, wherein the animal further comprises a sequence encoding a human or chimeric programmed death-ligand 1 (PD-L1).
52. The method of any one of claims 49-51, wherein the additional therapeutic agent is an anti-PD-1 antibody or an anti-PD-L1 antibody.
53. The method of any one of claims 49-52, wherein the cancer comprises one or more cancer cells that express TFR1 and/or PD-L1.
54. The method of any one of claims 49-53, wherein the cancer is caused by injection of one or more cancer cells into the animal.
55. The method of any one of claims 49-54, wherein determining inhibitory effects of the treatment involves measuring the tumor volume in the animal.
56. The method of any one of claims 49-55, wherein the animal has brain cancer, breast cancer, colon cancer, liver cancer, ovarian cancer, lung cancer, bone cancer, leukemia, and/or lymphoma.
57. A method of determining delivery efficiency of a therapeutic agent to cross the blood-brain barrier, comprising: a) administering the therapeutic agent to the animal of any one of claims 1-21, 29-35, 40, and 41; and b) determining concentration of the therapeutic agent over time in brain and/or serum of the animal.
58. The method of claim 57, wherein the therapeutic agent comprises an anti-TFR1 antibody or antigen-binding fragment thereof.
59. The method of claim 57, wherein the therapeutic agent is a multi-specific antibody (e.g., a bispecific antibody) targeting TFR1 (e.g., human TFR1) and a second antigen.
60. The method of claim 59, wherein the second antigen is beta-secretase 1 (BACE1) or amyloid beta.
61. The method of any one of claims 57-60, wherein concentration of the therapeutic agent is determined over a period of at least 5 hours, at least 10 hours, at least 15 hours, at least 20 hours, or at least 25 hours.
62. A method of determining effectiveness of an anti-TFR1 antibody for treating a bone disease, comprising: a) administering the anti-TFR1 antibody to the animal of any one of claims 1-21, 29-35, 40, and 41, wherein the animal has the bone disease; and b) determining effects of the anti-TFR1 antibody for treating the bone disease.
63. The method of claim 62, wherein the bone disease is fractures, bone degeneration, arthritis, bone deformities, osteoporosis, and/or necrosis of the femoral head.
64. A method of determining effectiveness of an anti-TFR1 antibody for treating a neurodegenerative disease, comprising: a) administering the anti-TFR1 antibody to the animal of any one of claims 1-21, 29-35, 40, and 41, wherein the animal has the neurodegenerative disease; and b) determining effects of the anti-TFR1 antibody for treating the neurodegenerative disease.
65. The method of claim 64, wherein the neurodegenerative disease is cerebral ischemia, brain injury or, epilepsy, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and/or spinocerebellar ataxia.
66. A method of determining effectiveness of an anti-TFR1 antibody for treating an immune disorder, comprising: a) administering the anti-TFR1 antibody to the animal of any one of claims 1-21, 29-35, 40, and 41, wherein the animal has the immune disorder; and b) determining effects of the anti-TFR1 antibody for treating the immune disorder.
67. The method of claim 66, wherein the immune disorder is allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopeniarpura, autoimmune hemolytic anemia, ulcerative colitis, autologous Immune liver disease, diabetes, pain and/or neurological disorders.
68. A protein comprising an amino acid sequence, wherein the amino acid sequence is one of the following: (a) an amino acid sequence set forth in SEQ ID NO: 1, 2, or 9; (b) an amino acid sequence that is at least 90% identical to SEQ ID NO: 1, 2, or 9; (c) an amino acid sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 1, 2, or 9; (d) an amino acid sequence that is different from the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid; and (e) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one, two, three, four, five or more amino acids to the amino acid sequence set forth in SEQ ID NO: 1, 2, or 9.
69. A nucleic acid comprising a nucleotide sequence, wherein the nucleotide sequence is one of the following: (a) a sequence that encodes the protein of claim 68; (b) SEQ ID NO: 3, 4, 5, 6, 7, or 8; (c) a sequence that is at least 90% identical to SEQ ID NO: 3, 4, 5, 6, 7, or 8; and (d) a sequence that is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3, 4, 5, 6, 7, or 8.
Description
DESCRIPTION OF DRAWINGS
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
DETAILED DESCRIPTION
[0045] This disclosure relates to transgenic non-human animal with human or chimeric (e.g., humanized) TFR1, and methods of use thereof.
[0046] Iron is a vital element in several biological processes including oxygen transportation, energy generation/mitochondrial function, as well as DNA synthesis and repair. Within the context of a cancer cell, facilitating DNA synthesis would allow increased proliferation, while increased capacity to repair DNA would aid in repairing DNA damage from the increased mutational burden common among cancer cells. Central proteins in the regulation of iron metabolism are transferrin (Tf) and its receptors. As the main cellular importer of iron, transferrin receptor 1 (TFR1) function is essential to iron related processes and the uptake of Tf-bound iron through TFR1 is the main source of cellular iron import in general.
[0047] As disruption of iron homeostasis may have potentially detrimental consequences to the cell, the expression of TFR1 is tightly regulated. However, TFR1 is overexpressed on many different types of cancer cells, often at levels several-fold higher than normal cells. In fact, TFR1 has been identified as a universal cancer marker. Increased expression of TFR1 correlates with advanced stage and/or poorer prognosis in a number of cancers, e.g., solid cancers such as esophageal squamous cell carcinoma, breast cancer, ovarian cancer, lung cancer, cervical cancer, bladder cancer, osteosarcoma, pancreatic cancers, cholangiocarcinoma, renal cell carcinoma, hepatocellular carcinoma, adrenal cortical carcinoma, and cancers of the nervous system as well as hematopoietic malignancies such as acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), and non-Hodgkin lymphoma (NHL). Therefore, TFR1 is regarded as a potential biomarker and therapeutic target for cancer.
[0048] Furthermore, TfR1 expressed on the endothelial cells of the blood-brain barrier can be used to allow the delivery of large molecules including antibodies into the brain. Some of the TfR1 targeting antibodies have been shown to cross the blood-brain barrier, without interfering with the uptake of iron. The affinity of the antibody-TfR interaction seems to be important determining the success of transcytotic transport over endothelial cells of the blood-brain barrier.
[0049] Experimental animal models are an indispensable research tool for studying the effects of these antibodies (e.g., anti-TFR1 antibodies). Common experimental animals include mice, rats, guinea pigs, hamsters, rabbits, dogs, monkeys, pigs, fish and so on. However, there are many differences between human and animal genes and protein sequences, and many human proteins cannot bind to the animal's homologous proteins to produce biological activity, leading to that the results of many clinical trials do not match the results obtained from animal experiments. A large number of clinical studies are in urgent need of better animal models. With the continuous development and maturation of genetic engineering technologies, the use of human cells or genes to replace or substitute an animal's endogenous similar cells or genes to establish a biological system or disease model closer to human, and establish the humanized experimental animal models (humanized animal model) has provided an important tool for new clinical approaches or means. In this context, the genetically engineered animal model, that is, the use of genetic manipulation techniques, the use of human normal or mutant genes to replace animal homologous genes, can be used to establish the genetically modified animal models that are closer to human gene systems. The humanized animal models have various important applications. For example, due to the presence of human or humanized genes, the animals can express or express in part of the proteins with human functions, so as to greatly reduce the differences in clinical trials between humans and animals, and provide the possibility of drug screening at animal levels.
TFR1
[0050] Transferrin Receptor 1 (TFR1), also known as cluster of differentiation 71 (CD71), is widely expressed and can bind to transferrin (Tf) with high affinity. Human TFR1 is a 90 kDa type II transmembrane glycoprotein consisting of 760 amino acids that is found as a dimer (180 kDa) linked by disulfide bonds on the cell surface. The TFR1 monomer is composed of a large extracellular, C-terminal domain of 671 amino acids containing the Tf-binding site, a transmembrane domain (28 amino acids), and an intracellular N-terminal domain (61 amino acids). The C-terminal extracellular domain contains three N-linked glycosylation sites at asparagine residues 251, 317, and 727 and one O-linked glycosylation site at threonine 104, which are all required for adequate function of the receptor.
[0051] Transferrin (Tf) It is an 80 kDa glycoprotein composed of two 40 kDa subunits, known as the N- and C-lobes that are separated by a short linker sequence. Each subunit is capable of binding to one free ferric iron (Fe.sup.3+) and thus, Tf may have up to two atoms of iron attached. Tf in its iron free form, apo-Tf, binds Fe.sup.3+ with high efficiency in the blood and transports it to the cell surface for internalization through the interaction with TFR1. As a membrane protein regulating iron import, TFR1 is a member of the TFR family that shows nanomolar affinity to transferrin (Tf) bound to Fe.sup.3+. The complex of Tf-TFR1 is internalized through endocytosis mediated by clathrin, and Fe.sup.3+ is disassociated from Tf when pH decreases to 5.5. At this pH, apo-Tf and TFR1 are still associated and recycled to cell surface with physiological pH, so the former is released.
[0052] Iron uptake by transferrin receptor is an important way for cancer cells to absorb iron, thus accumulating evidence has proven that TFR1 participated in tumor onset and progression, and its expression was dysregulated significantly in many cancers. The relationship between TFR1 and cancers has been revealed, rendering TFR1 a valuable pharmaceutical target for intervening with cancers.
[0053] TFR1 expressed on the endothelial cells of the blood-brain barrier is used also in preclinical research to allow the delivery of large molecules including antibodies into the brain. Some of the TFR1 targeting antibodies have been shown to cross the blood-brain barrier, without interfering with the uptake of iron.
[0054] A detailed description of TFR1, Tf, and their functions can be found, e.g., in Candelaria, P. V., et al. Antibodies targeting the transferrin receptor 1 (TfR1) as direct anti-cancer agents. Frontiers in Immunology 12 (2021): 607692; and Shen, Y., et al. Transferrin receptor 1 in cancer: a new sight for cancer therapy. American Journal of Cancer Research 8.6 (2018): 916; each of which is incorporated by reference in its entirety.
[0055] In human genomes, TFR1 gene (Gene ID: 7037) locus has nineteen exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and exon 19 (
TABLE-US-00001 TABLE 1 Human TFR1 NM_003234.4 NP_003225.2 (approximate location) 5224 bp 760 aa (SEQ ID NO: 2) Exon 1 1-260 0 Exon 2 261-319 1-12 Exon 3 320-521 13-79 Exon 4 522-717 80-145 Exon 5 718-867 146-195 Exon 6 868-970 196-229 Exon 7 971-1084 230-267 Exon 8 1085-1183 268-300 Exon 9 1184-1323 301-347 Exon 10 1324-1481 348-399 Exon 11 1482-1601 400-439 Exon 12 1602-1687 440-468 Exon 13 1688-1751 469-489 Exon 14 1752-1819 490-512 Exon 15 1820-1878 513-532 Exon 16 1879-1960 533-559 Exon 17 1961-2182 560-633 Exon 18 2183-2323 634-647 Exon 19 2324-5224 648-760 Cytoplasmic 284-484 1-67 Transmembrane 485-547 68-88 Extracellular 548-2563 89-760 Donor region 548-2566 89-760
[0056] The human TFR1 gene (Gene ID: 7037) is located in Chromosome 16 of the human genome, which is located from 196018694 to 1960821231 of NC_000003.12. The 5 UTR is from 196082043 to 196082090, and from 196077100 to 196077122; Exon 1 is from 196082090 to 196082043; the first intron is from 196082042 to 196077123; Exon 2 is from 196077122 to 196077064; the second intron is from 196077063 to 196075361; Exon 3 is from 196075360 to 196075159; the third intron is from 196075158 to 196074126; Exon 4 is from 196074125 to 196073930; the fourth intron is from 196073929 to 196072153; Exon 5 is from 196072152 to 196072003; the fifth intron is from 196072002 to 196071499; Exon 6 is from 196071498 to 196071396; the sixth intron is from 196071395 to 196069569; Exon 7 is from 196069568 to 196069455; the seventh intron is from 196069454 to 196068131; Exon 8 is from 196068130 to 196068032; the eighth intron is from 196068031 to 196067658; Exon 9 is from 196067657 to 196067518; the ninth intron is from 196067517 to 196065601; Exon 10 is from 196065600 to 196065443; the tenth intron is from 196065442 to 196064429; Exon 11 is from 196064428 to 196064309; the eleventh intron is from 196064308 to 196062940; Exon 12 is from 196062939 to 196062854; the twelfth intron is from 196062853 to 196062646; Exon 13 is from 196062645 to 196062582; the thirteen intron is from 196062581 to 196060248; Exon 14 is from 196060247 to 196060180; the fourteenth intron is from 196060179 to 196058633; Exon 15 is from 196058632 to 196058574; the fifteenth intron is from 196058573 to 196058366; Exon 16 is from 196058365 to 196058284; the sixteenth intron is from 196058283 to 196055302; Exon 17 is from 196055301 to 196055080; the seventeenth intron is from 196055079 to 196053559; Exon 18 is from 196053558 to 196053418; the eighteenth intron is from 196053417 to 196052185; Exon 19 is from 196052184 to 196049284, and the 3UTR is from 196049284 to 196051941, based on transcript NM_003234.4. All relevant information for mouse TFR1 locus can be found in the NCBI website with Gene ID: 7037.
[0057] In mice, TFR1 gene locus has nineteen exons, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and exon 19 (
TABLE-US-00002 TABLE 2 Mouse TFR1 NM_011638.4 NP_035768.1 (approximate location) 4920 bp 763 aa (SEQ ID NO: 1) Exon 1 1-141 0 Exon 2 142-200 1-12 Exon 3 201-402 13-79 Exon 4 403-604 80-147 Exon 5 605-754 148-197 Exon 6 755-857 198-231 Exon 7 868-971 232-269 Exon 8 972-1070 270-302 Exon 9 1071-1210 303-349 Exon 10 1211-1368 350-401 Exon 11 1369-1491 402-442 Exon 12 1492-1577 443-471 Exon 13 1578-1641 472-492 Exon 14 1642-1709 493-515 Exon 15 1710-1768 516-535 Exon 16 1769-1850 536-562 Exon 17 1851-2072 563-636 Exon 18 2073-2213 637-683 Exon 19 2214-4914 684-763 Cytoplasmic 142-359 1-65 Transmembrane 360-428 66-88 Extracellular 429-2453 89-763 Replaced region 429-2456 89-763
[0058] The mouse TFR1 gene (Gene ID: 22042) is located in Chromosome 16 of the mouse genome, which is located from 32427714 to 32451612 of NC_000082.7. The 5 UTR is from 32427738 to 32427854; and from 32431986 to 32432008; Exon 1 is from 32427738 to 32427854; the first intron is from 32427855 to 32431985; Exon 2 is from 32431986 to 32432044; the second intron is from 32432045 to 32433383; Exon 3 is from 32433384 to 32433585; the third intron is from 32433586 to 32434010; Exon 4 is from 32434011 to 32434212; the fourth intron is from 32434213 to 32435566; Exon 5 is from 32435567 to 32435716; the fifth intron is from 32435717 to 32435914; Exon 6 is from 32435915 to 32436017; the sixth intron is from 32436018 to 32437035; Exon 7 is from 32437036 to 32437149; the seventh intron is from 32437150 to 32437450; Exon 8 is from 32437451 to 32437549; the eighth intron is from 32437550 to 32437854; Exon 9 is from 32437855 to 32437994; the ninth intron is from 32437995 to 32439183; Exon 10 is from 32439184 to 32439341; the tenth intron is from 32439342 to 32439992; Exon 11 is from 32439993 to 32440115; the eleventh intron is from 32440116 to 32441874; Exon 12 is from 32441875 to 32441960; the twelfth intron is from 32441961 to 32442189; Exon 13 is from 32442190 to 32442253; the thirteen intron is from 32442254 to 32443186; Exon 14 is from 32443187 to 32443254; the fourteenth intron is from 32443255 to 32443585; Exon 15 is from 32443586 to 32443644; the fifteenth intron is from 32443645 to 32443801; Exon 16 is from 32443802 to 32443883; the sixteenth intron is from 32443884 to 32445366; Exon 17 is from 32445367 to 32445588; the seventeenth intron is from 32445589 to 32447293; Exon 18 is from 32447294 to 32447434; the eighteenth intron is from 32447435 to 32448911; Exon 19 is from 32448912 to 32451612; and the 3UTR is from 32449155 to 32451612; based on transcript NM_011638.4. All relevant information for mouse TFR1 locus can be found in the NCBI website with Gene ID: 22042, which is incorporated by reference herein in its entirety.
[0059]
[0060] TFR1 genes, proteins, and locus of the other species are also known in the art. For example, the gene ID for TFR1 in Rattus norvegicus (rat) is 64678, the gene ID for TFR1 in Felis catus (cat) is 493880, the gene ID for TFR1 in Canis lupus familiaris (dog) is 403703, and the gene ID for TFR1 in Sus scrofa (pig) is 397062. The relevant information for these genes (e.g., intron sequences, exon sequences, amino acid residues of these proteins) can be found, e.g., in NCBI database, which is incorporated by reference herein in its entirety.
[0061] The present disclosure provides human or chimeric (e.g., humanized) TFR1 nucleotide sequence and/or amino acid sequences. In some embodiments, the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, cytoplasmic region, transmembrane region, and/or extracellular region are replaced by the corresponding human sequence. In some embodiments, a region or portion of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, cytoplasmic region, transmembrane region, and/or extracellular region are replaced by the corresponding human sequence. The term region or portion can refer to at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1000, 1100, 1200, 1300, 1400, 1500, 1600, 1700, 1800, 1900, or 2000 nucleotides, or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 650, 660, or 670 amino acid residues. In some embodiments, the region or portion can be at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identical to exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, cytoplasmic region, transmembrane region, or extracellular region. In some embodiments, a region, a portion, or the entire sequence of mouse exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19 (e.g., a portion of exon 4, exons 5-18, and a portion of exon 19) are replaced by a region, a portion, or the entire sequence of the human exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19 (e.g., a portion of exon 4, exons 5-18, and a portion of exon 19).
[0062] In some embodiments, a region or portion of the cytoplasmic region, transmembrane region, extracellular region, exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19 is deleted.
[0063] In some embodiments, the present disclosure is related to a genetically-modified, non-human animal whose genome comprises a chimeric (e.g., humanized) TFR1 nucleotide sequence. In some embodiments, the chimeric (e.g., humanized) TFR1 nucleotide sequence encodes a TFR1 protein comprising an extracellular region. In some embodiments, the extracellular region described herein is at least 80%, 85%, 90%, 95%, or 100% identical to amino acids 89-760 of SEQ ID NO: 2. In some embodiments, the extracellular region comprises the entire or part of human TFR1 extracellular region. In some embodiments, the genome of the animal comprises a sequence that is at least 80%, 85%, 90%, 95%, or 100% identical to SEQ ID NO: 3, 4, 5, 6, 7, 8, or 10.
[0064] In some embodiments, the genetically-modified non-human animal described herein comprises a sequence encoding a human or humanized TFR1 protein. In some embodiments, the TFR1 protein comprises, from N-terminus to C-terminus, a cytoplasmic region, a transmembrane region, and an extracellular region. In some embodiments, the humanized TFR1 protein comprises a human or humanized cytoplasmic region. In some embodiments, the humanized TFR1 protein comprises an endogenous cytoplasmic region. In some embodiments, the humanized TFR1 protein comprises a human or humanized transmembrane region. In some embodiments, the humanized TFR1 protein comprises an endogenous transmembrane region. In some embodiments, the humanized TFR1 protein comprises a human or humanized extracellular region. In some embodiments, the humanized TFR1 protein comprises an endogenous extracellular region.
[0065] In some embodiments, the genetically-modified non-human animal described herein comprises a human or humanized TFR1 gene. In some embodiments, the humanized TFR1 gene comprises 19 exons. In some embodiments, the humanized TFR1 gene comprises endogenous or humanized exon 1, endogenous or humanized exon 2, endogenous or humanized exon 3, human or humanized exon 4, human or humanized exon 5, human or humanized exon 6, human or humanized exon 7, human or humanized exon 8, human or humanized exon 9, human or humanized exon 10, human or humanized exon 11, human or humanized exon 12, human or humanized exon 13, human or humanized exon 14, human or humanized exon 15, human or humanized exon 16, human or humanized exon 17, human or humanized exon 18, and/or human or humanized exon 19. In some embodiments, the humanized TFR1 gene comprises endogenous or humanized intron 1, endogenous or humanized intron 2, human or humanized intron 3, human or humanized intron 4, human or humanized intron 5, human or humanized intron 6, human or humanized intron 7, human or humanized intron 8, human or humanized intron 9, human or humanized intron 10, human or humanized intron 11, human or humanized intron 12, human or humanized intron 13, human or humanized intron 14, human or humanized intron 15, human or humanized intron 16, human or humanized intron 17, and/or human or humanized intron 18. In some embodiments, the humanized TFR1 gene comprises human or humanized 5 UTR. In some embodiments, the humanized TFR1 gene comprises human or humanized 3 UTR. In some embodiments, the humanized TFR1 gene comprises endogenous 5 UTR. In some embodiments, the humanized TFR1 gene comprises endogenous 3 UTR.
[0066] Thus, in some embodiments, the present disclosure also provides a chimeric (e.g., humanized) TFR1 nucleotide sequence and/or amino acid sequences, wherein in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence are identical to or derived from mouse TFR1 mRNA sequence (e.g., NM_011638.4), mouse TFR1 amino acid sequence (e.g., SEQ ID NO: 1), or a portion thereof (e.g., exon 1, exon 2, exon 3, a portion of exon 4, and a portion of exon 19); and in some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% of the sequence are identical to or derived from human TFR1 mRNA sequence (e.g., NM_003234.4), human TFR1 amino acid sequence (e.g., SEQ ID NO: 2), or a portion thereof (e.g., a portion of exon 4, exons 5-18, and a portion of exon 19).
[0067] In some embodiments, the sequence encoding amino acids 89-763 of mouse TFR1 (SEQ ID NO: 1) is replaced. In some embodiments, the sequence is replaced by a sequence encoding a corresponding region of human TFR1 (e.g., amino acids 89-760 of human TFR1 (SEQ ID NO: 2))
[0068] In some embodiments, the nucleic acids as described herein are operably linked to a promotor or regulatory element, e.g., an endogenous mouse TFR1 promotor, an inducible promoter, an enhancer, and/or mouse or human regulatory elements.
[0069] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that are different from part of or the entire mouse TFR1 nucleotide sequence (e.g., a portion of exon 4, exons 5-18, and a portion of exon 19 of NM_011638.4).
[0070] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as part of or the entire mouse TFR1 nucleotide sequence (e.g., exons 1-3, a portion of exon 4, and a portion of exon 19 of NM_011638.4).
[0071] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is different from part of or the entire human TFR1 nucleotide sequence (e.g., exon 1, exon 2, exon 3, a portion of exon 4, and a portion of exon 19 of NM_003234.4).
[0072] In some embodiments, the nucleic acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 nucleotides, e.g., contiguous or non-contiguous nucleotides) that is the same as part of or the entire human TFR1 nucleotide sequence (e.g., a portion of exon 4, exons 5-18, and portion of exon 19 of NM_003234.4).
[0073] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from part of or the entire mouse TFR1 amino acid sequence (e.g., amino acids 89-763 of NP_035768.1 (SEQ ID NO: 1)).
[0074] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as part of or the entire mouse TFR1 amino acid sequence (e.g., amino acids 1-88 of NP_035768.1 (SEQ ID NO: 1)).
[0075] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is different from part of or the entire human TFR1 amino acid sequence (e.g., amino acids 1-88 of NP_003225.2 (SEQ ID NO: 2)).
[0076] In some embodiments, the amino acid sequence has at least a portion (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, 30, 40, 50, 60, 70, 80, 90, or 100 amino acid residues, e.g., contiguous or non-contiguous amino acid residues) that is the same as part of or the entire human TFR1 amino acid sequence (e.g., amino acids 89-760 of NP_003225.2 (SEQ ID NO: 2)).
[0077] The present disclosure also provides a humanized TFR1 mouse amino acid sequence, wherein the amino acid sequence is selected from the group consisting of: [0078] a) an amino acid sequence shown in SEQ ID NO: 1, 2, or 9; [0079] b) an amino acid sequence having a homology of at least 90% with or at least 90% identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9; [0080] c) an amino acid sequence encoded by a nucleic acid sequence, wherein the nucleic acid sequence is able to hybridize to a nucleotide sequence encoding the amino acid shown in SEQ ID NO: 1, 2, or 9 under a low stringency condition or a strict stringency condition; [0081] d) an amino acid sequence having a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9; [0082] e) an amino acid sequence that is different from the amino acid sequence shown in SEQ ID NO: 1, 2, or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; or [0083] f) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9.
[0084] The present disclosure also provides a humanized TFR1 amino acid sequence, wherein the amino acid sequence is selected from the group consisting of: [0085] a) all or part of amino acids 89-760 of SEQ ID NO: 2; [0086] b) an amino acid sequence have a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to amino acids 89-760 of SEQ ID NO: 2; [0087] c) an amino acid sequence that is different from amino acids 89-760 of SEQ ID NO: 2 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and [0088] d) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to amino acids 89-760 of SEQ ID NO: 2.
[0089] The present disclosure also provides a humanized TFR1 amino acid sequence, wherein the amino acid sequence is selected from the group consisting of: [0090] a) all or part of amino acids 1-88 of SEQ ID NO: 1; [0091] b) an amino acid sequence have a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to amino acids 1-88 of SEQ ID NO: 1; [0092] c) an amino acid sequence that is different from amino acids 1-88 of SEQ ID NO: 1 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and [0093] d) an amino acid sequence that comprises a substitution, a deletion and/or insertion of one or more amino acids to amino acids 1-88 of SEQ ID NO: 1.
[0094] The present disclosure also relates to a TFR1 nucleic acid (e.g., DNA or RNA) sequence, wherein the nucleic acid sequence can be selected from the group consisting of: [0095] a) a nucleic acid sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, or 8, or a nucleic acid sequence encoding a homologous TFR1 amino acid sequence of a humanized mouse TFR1; [0096] b) a nucleic acid sequence that is able to hybridize to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, or 8 under a low stringency condition or a strict stringency condition; [0097] c) a nucleic acid sequence that has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the nucleotide sequence as shown in SEQ ID NO: 3, 4, 5, 6, 7, or 8; [0098] d) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90% with or at least 90% identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9; [0099] e) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence has a homology of at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% with, or at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9; [0100] f) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence is different from the amino acid sequence shown in SEQ ID NO: 1, 2, or 9 by no more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or no more than 1 amino acid; and/or [0101] g) a nucleic acid sequence that encodes an amino acid sequence, wherein the amino acid sequence comprises a substitution, a deletion and/or insertion of one or more amino acids to the amino acid sequence shown in SEQ ID NO: 1, 2, or 9.
[0102] The present disclosure further relates to a TFR1 genomic DNA sequence of a humanized mouse. The DNA sequence is obtained by reverse transcription of the mRNA obtained by transcription thereof is consistent with or complementary to the DNA sequence homologous to the sequence shown in SEQ ID NO: 5 or 8.
[0103] The disclosure also provides an amino acid sequence that has a homology of at least 90% with, or at least 90% identical to the sequence shown in SEQ ID NO: 1, 2, or 9, and has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 1, 2, or 11 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
[0104] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 1, 2, or 9 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
[0105] The disclosure also provides a nucleotide sequence that has a homology of at least 90%, or at least 90% identical to the sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, or 8, and encodes a polypeptide that has protein activity. In some embodiments, the homology with the sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, or 8 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing homology is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
[0106] In some embodiments, the percentage identity with the sequence shown in SEQ ID NO: 3, 4, 5, 6, 7, or 8 is at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99%. In some embodiments, the foregoing percentage identity is at least about 50%, 55%, 60%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 80%, or 85%.
[0107] The disclosure also provides a nucleic acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any nucleotide sequence as described herein, and an amino acid sequence that is at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to any amino acid sequence as described herein. In some embodiments, the disclosure relates to nucleotide sequences encoding any peptides that are described herein, or any amino acid sequences that are encoded by any nucleotide sequences as described herein. In some embodiments, the nucleic acid sequence is less than 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 200, 250, 300, 350, 400, 500, or 600 nucleotides. In some embodiments, the amino acid sequence is less than 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acid residues.
[0108] In some embodiments, the amino acid sequence (i) comprises an amino acid sequence; or (ii) consists of an amino acid sequence, wherein the amino acid sequence is any one of the sequences as described herein.
[0109] In some embodiments, the nucleic acid sequence (i) comprises a nucleic acid sequence; or (ii) consists of a nucleic acid sequence, wherein the nucleic acid sequence is any one of the sequences as described herein.
[0110] To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences. For example, the comparison of sequences and determination of percent identity between two sequences can be accomplished using a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
[0111] The percentage of residues conserved with similar physicochemical properties (percent homology), e.g. leucine and isoleucine, can also be used to measure sequence similarity. Families of amino acid residues having similar physicochemical properties have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). The homology percentage, in many cases, is higher than the identity percentage.
[0112] Cells, tissues, and animals (e.g., mouse) are also provided that comprise the nucleotide sequences as described herein, as well as cells, tissues, and animals (e.g., mouse) that express human or chimeric (e.g., humanized) TFR1 from an endogenous non-human TFR1 locus.
Genetically Modified Animals
[0113] As used herein, the term genetically-modified non-human animal refers to a non-human animal having exogenous DNA in at least one chromosome of the animal's genome. In some embodiments, at least one or more cells, e.g., at least 1%, 2%, 3%, 4%, 5%, 10%, 20%, 30%, 40%, 50% of cells of the genetically-modified non-human animal have the exogenous DNA in its genome. The cell having exogenous DNA can be various kinds of cells, e.g., an endogenous cell, a somatic cell, an immune cell, a T cell, a B cell, an antigen presenting cell, a macrophage, a dendritic cell, a germ cell, a blastocyst, or an endogenous tumor cell. In some embodiments, genetically-modified non-human animals are provided that comprise a modified endogenous TFR1 locus that comprises an exogenous sequence (e.g., a human sequence), e.g., a replacement of one or more non-human sequences with one or more human sequences. The animals are generally able to pass the modification to progeny, i.e., through germline transmission.
[0114] As used herein, the term chimeric gene or chimeric nucleic acid refers to a gene or a nucleic acid, wherein two or more portions of the gene or the nucleic acid are from different species, or at least one of the sequences of the gene or the nucleic acid does not correspond to the wild-type nucleic acid in the animal. In some embodiments, the chimeric gene or chimeric nucleic acid has at least one portion of the sequence that is derived from two or more different sources, e.g., sequences encoding different proteins or sequences encoding the same (or homologous) protein of two or more different species. In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized gene or humanized nucleic acid.
[0115] As used herein, the term chimeric protein or chimeric polypeptide refers to a protein or a polypeptide, wherein two or more portions of the protein or the polypeptide are from different species, or at least one of the sequences of the protein or the polypeptide does not correspond to wild-type amino acid sequence in the animal. In some embodiments, the chimeric protein or the chimeric polypeptide has at least one portion of the sequence that is derived from two or more different sources, e.g., same (or homologous) proteins of different species. In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized protein or a humanized polypeptide.
[0116] As used herein, the term humanized protein or humanized polypeptide refers to a protein or a polypeptide, wherein at least a portion of the protein or the polypeptide is from the human protein or human polypeptide. In some embodiments, the humanized protein or polypeptide is a human protein or polypeptide.
[0117] As used herein, the term humanized nucleic acid refers to a nucleic acid, wherein at least a portion of the nucleic acid is from the human. In some embodiments, the entire nucleic acid of the humanized nucleic acid is from human. In some embodiments, the humanized nucleic acid is a humanized exon. A humanized exon can be e.g., a human exon or a chimeric exon.
[0118] In some embodiments, the chimeric gene or the chimeric nucleic acid is a humanized TFR1 gene or a humanized TFR1 nucleic acid. In some embodiments, at least one or more portions of the gene or the nucleic acid is from the human TFR1 gene, at least one or more portions of the gene or the nucleic acid is from a non-human TFR1 gene. In some embodiments, the gene or the nucleic acid comprises a sequence that encodes an TFR1 protein. The encoded TFR1 protein is functional or has at least one activity of the human TFR1 protein or the non-human TFR1 protein, e.g., interacting with transferrin; regulating cellular uptake of iron by endocytosis; and maintaining iron homeostasis.
[0119] In some embodiments, the chimeric protein or the chimeric polypeptide is a humanized TFR1 protein or a humanized TFR1 polypeptide. In some embodiments, at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a human TFR1 protein, and at least one or more portions of the amino acid sequence of the protein or the polypeptide is from a non-human TFR1 protein. The humanized TFR1 protein or the humanized TFR1 polypeptide is functional or has at least one activity of the human TFR1 protein or the non-human TFR1 protein.
[0120] In some embodiments, the cytoplasmic region is human or humanized. In some embodiments, the cytoplasmic region is endogenous. In some embodiments, the transmembrane region is human or humanized. In some embodiments, the transmembrane region is endogenous. In some embodiments, the extracellular region is human or humanized. In some embodiments, the extracellular region is endogenous.
[0121] The genetically modified non-human animal can be various animals, e.g., a mouse, rat, rabbit, pig, bovine (e.g., cow, bull, buffalo), deer, sheep, goat, chicken, cat, dog, ferret, primate (e.g., marmoset, rhesus monkey). For the non-human animals where suitable genetically modifiable embryonic stem (ES) cells are not readily available, other methods are employed to make a non-human animal comprising the genetic modification. Such methods include, e.g., modifying a non-ES cell genome (e.g., a fibroblast or an induced pluripotent cell) and employing nuclear transfer to transfer the modified genome to a suitable cell, e.g., an oocyte, and gestating the modified cell (e.g., the modified oocyte) in a non-human animal under suitable conditions to form an embryo. These methods are known in the art, and are described, e.g., in A. Nagy, et al., Manipulating the Mouse Embryo: A Laboratory Manual (Third Edition), Cold Spring Harbor Laboratory Press, 2003, which is incorporated by reference herein in its entirety.
[0122] In one aspect, the animal is a mammal, e.g., of the superfamily Dipodoidea or Muroidea. In some embodiments, the genetically modified animal is a rodent. The rodent can be selected from a mouse, a rat, and a hamster. In some embodiments, the genetically modified animal is from a family selected from Calomyscidae (e.g., mouse-like hamsters), Cricetidae (e.g., hamster, New World rats and mice, voles), Muridae (true mice and rats, gerbils, spiny mice, crested rats), Nesomyidae(climbing mice, rock mice, with-tailed rats, Malagasy rats and mice), Platacanthomyidae (e.g., spiny dormice), and Spalacidae (e.g., mole rates, bamboo rats, and zokors). In some embodiments, the genetically modified rodent is selected from a true mouse or rat (family Muridae), a gerbil, a spiny mouse, and a crested rat. In some embodiments, the non-human animal is a mouse.
[0123] In some embodiments, the animal is a mouse of a C57BL strain selected from C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL/10Cr, and C57BL/O1a. In some embodiments, the mouse is a 129 strain selected from the group consisting of a strain that is 129P1, 129P2, 129P3, 129X1, 129S1 (e.g., 129S1/SV, 129S1/SvIm), 129S2, 129S4, 129S5, 129S9/SvEvH, 129S6 (129/SvEvTac), 129S7, 129S8, 129T1, 129T2. These mice are described, e.g., in Festing et al., Revised nomenclature for strain 129 mice, Mammalian Genome 10: 836 (1999); Auerbach et al., Establishment and Chimera Analysis of 129/SvEv- and C57BL/6-Derived Mouse Embryonic Stem Cell Lines (2000), both of which are incorporated herein by reference in the entirety. In some embodiments, the genetically modified mouse is a mix of the 129 strain and the C57BL/6 strain. In some embodiments, the mouse is a mix of the 129 strains, or a mix of the BL/6 strains. In some embodiments, the mouse is a BALB strain, e.g., BALB/c strain. In some embodiments, the mouse is a mix of a BALB strain and another strain. In some embodiments, the mouse is from a hybrid line (e.g., 50% BALB/c-50% 12954/Sv; or 50% C57BL/6-50% 129). In some embodiments, the non-human animal is a rodent. In some embodiments, the non-human animal is a mouse having a BALB/c, A, A/He, A/J, A/WySN, AKR, AKR/A, AKR/J, AKR/N, TA1, TA2, RF, SWR, C3H, C57BR, SJL, C57L, DBA/2, KM, NIH, ICR, CFW, FACA, C57BL/A, C57BL/An, C57BL/GrFa, C57BL/KaLwN, C57BL/6, C57BL/6J, C57BL/6ByJ, C57BL/6NJ, C57BL/10, C57BL/10ScSn, C57BL (C57BL/10Cr and C57BL/O1a), C58, CBA/Br, CBA/Ca, CBA/J, CBA/st, or CBA/H background.
[0124] In some embodiments, the animal is a rat. The rat can be selected from a Wistar rat, an LEA strain, a Sprague Dawley strain, a Fischer strain, F344, F6, and Dark Agouti. In some embodiments, the rat strain is a mix of two or more strains selected from the group consisting of Wistar, LEA, Sprague Dawley, Fischer, F344, F6, and Dark Agouti.
[0125] The animal can have one or more other genetic modifications, and/or other modifications, that are suitable for the particular purpose for which the humanized TFR1 animal is made. For example, suitable mice for maintaining a xenograft (e.g., a human cancer or tumor), can have one or more modifications that compromise, inactivate, or destroy the immune system of the non-human animal in whole or in part. Compromise, inactivation, or destruction of the immune system of the non-human animal can include, for example, destruction of hematopoietic cells and/or immune cells by chemical means (e.g., administering a toxin), physical means (e.g., irradiating the animal), and/or genetic modification (e.g., knocking out one or more genes). Non-limiting examples of such mice include, e.g., NOD mice, SCID mice, NOD/SCID mice, IL2R? knockout mice, NOD/SCID/?c.sup.null mice (Ito, M. et al., NOD/SCID/?c.sup.null mouse: an excellent recipient mouse model for engraftment of human cells, Blood 100(9): 3175-3182, 2002), nude mice, and Rag1 and/or Rag2 knockout mice. These mice can optionally be irradiated, or otherwise treated to destroy one or more immune cell type. Thus, in various embodiments, a genetically modified mouse is provided that can include a humanization of at least a portion of an endogenous non-human TFR1 locus, and further comprises a modification that compromises, inactivates, or destroys the immune system (or one or more cell types of the immune system) of the non-human animal in whole or in part. In some embodiments, modification is, e.g., selected from the group consisting of a modification that results in NOD mice, SCID mice, NOD/SCID mice, IL-2R? knockout mice, NOD/SCID/?c.sup.null mice, nude mice, Rag1 and/or Rag2 knockout mice, NOD-Prkdc.sup.scid IL-2r?.sup.null mice, NOD-Rag 1.sup.?/?-IL2rg.sup.?/? (NRG) mice, Rag 2.sup.?/?-IL2rg.sup.?/? (RG) mice, and a combination thereof. These genetically modified animals are described, e.g., in U.S.20150106961, which is incorporated herein by reference in its entirety. In some embodiments, the mouse can include a replacement of all or part of mature TFR1 coding sequence with human mature TFR1 coding sequence.
[0126] Genetically modified non-human animals that comprise a modification of an endogenous non-human TFR1 locus. In some embodiments, the modification can comprise a human nucleic acid sequence encoding at least a portion of a mature TFR1 protein (e.g., at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the mature TFR1 protein sequence). Although genetically modified cells are also provided that can comprise the modifications described herein (e.g., ES cells, somatic cells), in many embodiments, the genetically modified non-human animals comprise the modification of the endogenous TFR1 locus in the germline of the animal.
[0127] Genetically modified animals can express a human TFR1 and/or a chimeric (e.g., humanized) TFR1 from endogenous mouse loci, wherein the endogenous mouse TFR1 gene has been replaced with a human TFR1 gene and/or a nucleotide sequence that encodes a region of human TFR1 sequence or an amino acid sequence that is at least 10%, 20%, 30%, 40%, 50%, 60%, 70&, 80%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the human TFR1 sequence. In various embodiments, an endogenous non-human TFR1 locus is modified in whole or in part to comprise human nucleic acid sequence encoding at least one protein-coding sequence of a mature TFR1 protein.
[0128] In some embodiments, the genetically modified mice express the human TFR1 and/or chimeric TFR1 (e.g., humanized TFR1) from endogenous loci that are under control of mouse promoters and/or mouse regulatory elements. The replacement(s) at the endogenous mouse loci provide non-human animals that express human TFR1 or chimeric TFR1 (e.g., humanized TFR1) in appropriate cell types and in a manner that does not result in the potential pathologies observed in some other transgenic mice known in the art. The human TFR1 or the chimeric TFR1 (e.g., humanized TFR1) expressed in animal can maintain one or more functions of the wild-type mouse or human TFR1 in the animal. For example, human or non-human TFR1 ligands (e.g., transferrin) can bind to the expressed TFR1. Furthermore, in some embodiments, the animal does not express endogenous TFR1. In some embodiments, the animal expresses a decreased level of endogenous TFR1 as compared to a wild-type animal. As used herein, the term endogenous TFR1 refers to TFR1 protein that is expressed from an endogenous TFR1 nucleotide sequence of the non-human animal (e.g., mouse) before any genetic modification.
[0129] The genome of the animal can comprise a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to human TFR1 (NP_003225.2) (SEQ ID NO: 2). In some embodiments, the genome comprises a sequence encoding an amino acid sequence that is at least 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NO: 9.
[0130] The genome of the genetically modified animal can comprise a replacement at an endogenous TFR1 gene locus of a sequence encoding a region of endogenous TFR1 with a sequence encoding a corresponding region of human TFR1. In some embodiments, the sequence that is replaced is any sequence within the endogenous TFR1 gene locus, e.g., exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, 5-UTR, 3-UTR, intron 1, intron 2, intron 3, intron 4, intron 5, intron 6, intron 7, intron 8, intron 9, intron 10, intron 11, intron 12, intron 13, intron 14, intron 15, intron 16, intron 17, intron 18, etc. In some embodiments, the sequence that is replaced is within the regulatory region of the endogenous TFR1 gene. In some embodiments, the sequence that is replaced is exon 4, exon 5, exon 6, exon 6, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, exon 19, or a portion thereof, of an endogenous mouse TFR1 gene locus.
[0131] The genetically modified animal can have one or more cells expressing a human or chimeric TFR1 (e.g., humanized TFR1) having, from N-terminus to C-terminus, a cytoplasmic region, a transmembrane region, and an extracellular region. In some embodiments, the extracellular region comprises a sequence that is at least 50%, 60%, 70%, 80%, 90%, 95%, 99% identical to the extracellular region of human TFR1. In some embodiments, the extracellular region of the humanized TFR1 has a sequence that has at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 620, 650, 660, 665, 666, 667, 668, 669, 670, 671, or 672 amino acids (e.g., contiguously or non-contiguously) that are identical to human TFR1. In some embodiments, the extracellular region of the humanized TFR1 has a sequence that is 5-760 or 10-672 amino acids (e.g., contiguously or non-contiguously). Because human TFR1 and non-human TFR1 (e.g., mouse TFR1) sequences, in many cases, are different, antibodies that bind to human TFR1 will not necessarily have the same binding affinity with non-human TFR1 or have the same effects to non-human TFR1. Therefore, the genetically modified animal having a human or a humanized extracellular region can be used to better evaluate the effects of anti-human TFR1 antibodies in an animal model. In some embodiments, the genome of the genetically modified animal comprises a sequence encoding an amino acid sequence that corresponds to a portion or the entire sequence of exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19 of human TFR1, a portion or the entire sequence of extracellular region of human TFR1, or a portion or the entire sequence of amino acids 89-760 of SEQ ID NO: 2.
[0132] In some embodiments, the genome of the genetically modified animal comprises a portion of exon 4, exons 5-18, and a portion of exon 19 of human TFR1 gene. In some embodiments, the portion of exon 4 includes at least 50, 70, 100, 130, 150, 160, 165, 166, 167, 168, 169, 170, 180, 190, or 196 nucleotides. In some embodiments, the portion of exon 19 includes at least 100, 200, 220, 230, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 250, 270, 300, 500, 700, 1000, 1300, 1500, 1700, 2000, 2200, 2500, 2700, 2900, or 2901 nucleotides. In some embodiments, the genome of the genetically modified animal comprises about 20-63430, about 20-22158, about 20-5224, or about 20-2016 nucleotides (contiguous or non-contiguous nucleotides) of human TFR1 gene sequence.
[0133] In some embodiments, the non-human animal can have, at an endogenous TFR1 gene locus, a nucleotide sequence encoding a chimeric human/non-human TFR1 polypeptide, wherein a human portion of the chimeric human/non-human TFR1 polypeptide comprises a portion of human TFR1 extracellular domain, and wherein the animal expresses a functional TFR1 on a surface of a cell of the animal. The human portion of the chimeric human/non-human TFR1 polypeptide can comprise an amino acid sequence encoded by a portion of exon 4, exons 5-18, and/or a portion of exon 19 of human TFR1. In some embodiments, the human portion of the chimeric human/non-human TFR1 polypeptide can comprise a sequence that is at least 80%, 85%, 90%, 95%, or 99% identical to amino acids 89-760 of SEQ ID NO: 2. In some embodiments, the cytoplasmic region includes a sequence corresponding to the entire or part of amino acids 1-65 of SEQ ID NO: 1. In some embodiments, the transmembrane region includes a sequence corresponding to the entire or part of amino acids 66-88 of SEQ ID NO: 1.
[0134] In some embodiments, the non-human portion of the chimeric human/non-human TFR1 polypeptide comprises transmembrane and/or cytoplasmic regions of an endogenous non-human TFR1 polypeptide.
[0135] Furthermore, the genetically modified animal can be heterozygous with respect to the replacement at the endogenous TFR1 locus, or homozygous with respect to the replacement at the endogenous TFR1 locus.
[0136] In some embodiments, the humanized TFR1 locus lacks a human TFR1 5-UTR. In some embodiment, the humanized TFR1 locus comprises an endogenous (e.g., mouse) 5-UTR. In some embodiments, the humanization comprises an endogenous (e.g., mouse) 3-UTR. In appropriate cases, it may be reasonable to presume that the mouse and human TFR1 genes appear to be similarly regulated based on the similarity of their 5-flanking sequence. As shown in the present disclosure, humanized TFR1 mice that comprise a replacement at an endogenous mouse TFR1 locus, which retain mouse regulatory elements but comprise a humanization of TFR1 encoding sequence, do not exhibit pathologies. Both genetically modified mice that are heterozygous or homozygous for humanized TFR1 are grossly normal.
[0137] The present disclosure further relates to a non-human mammal generated through the method mentioned above. In some embodiments, the genome thereof contains human gene(s).
[0138] In some embodiments, the non-human mammal is a rodent, and preferably, the non-human mammal is a mouse.
[0139] In some embodiments, the non-human mammal expresses a protein encoded by a humanized TFR1 gene.
[0140] In addition, the present disclosure also relates to a tumor bearing non-human mammal model, characterized in that the non-human mammal model is obtained through the methods as described herein. In some embodiments, the non-human mammal is a rodent (e.g., a mouse).
[0141] The present disclosure further relates to a cell or cell line, or a primary cell culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; the tissue, organ or a culture thereof derived from the non-human mammal or an offspring thereof, or the tumor bearing non-human mammal; and the tumor tissue derived from the non-human mammal or an offspring thereof when it bears a tumor, or the tumor bearing non-human mammal.
[0142] The present disclosure also provides non-human mammals produced by any of the methods described herein. In some embodiments, a non-human mammal is provided; and the genetically modified animal contains the DNA encoding human or humanized TFR1 in the genome of the animal.
[0143] In some embodiments, the non-human mammal comprises the genetic construct as described herein (e.g., gene construct as shown in
[0144] In some embodiments, the expression of human or humanized TFR1 in a genetically modified animal is controllable, as by the addition of a specific inducer or repressor substance. In some embodiments, the specific inducer is selected from Tet-Off System/Tet-On System, or Tamoxifen System.
[0145] Non-human mammals can be any non-human animal known in the art and which can be used in the methods as described herein. Preferred non-human mammals are mammals, (e.g., rodents). In some embodiments, the non-human mammal is a mouse.
[0146] Genetic, molecular and behavioral analyses for the non-human mammals described above can performed. The present disclosure also relates to the progeny produced by the non-human mammal provided by the present disclosure mated with the same or other genotypes.
[0147] The present disclosure also provides a cell line or primary cell culture derived from the non-human mammal or a progeny thereof. A model based on cell culture can be prepared, for example, by the following methods. Cell cultures can be obtained by way of isolation from a non-human mammal, alternatively cells can be obtained from the cell culture established using the same constructs and the standard cell transfection techniques. The integration of genetic constructs containing DNA sequences encoding human TFR1 protein can be detected by a variety of methods.
[0148] There are many analytical methods that can be used to detect exogenous DNA, including methods at the level of nucleic acid (including the mRNA quantification approaches using reverse transcriptase polymerase chain reaction (RT-PCR) or Southern blotting, and in situ hybridization) and methods at the protein level (including histochemistry, immunoblot analysis and in vitro binding studies). In addition, the expression level of the gene of interest can be quantified by ELISA techniques well known to those skilled in the art. Many standard analysis methods can be used to complete quantitative measurements. For example, transcription levels can be measured using RT-PCR and hybridization methods including RNase protection, Southern blot analysis, RNA dot analysis (RNAdot) analysis. Immunohistochemical staining, flow cytometry, Western blot analysis can also be used to assess the presence of human or humanized TFR1 protein.
Vectors
[0149] The present disclosure relates to a targeting vector, comprising: a) a DNA fragment homologous to the 5 end of a region to be altered (5 arm), which is selected from the TFR1 gene genomic DNAs in the length of 100 to 10,000 nucleotides; b) a desired/donor DNA sequence encoding a donor region; and c) a second DNA fragment homologous to the 3 end of the region to be altered (3 arm), which is selected from the TFR1 gene genomic DNAs in the length of 100 to 10,000 nucleotides.
[0150] In some embodiments, a) the DNA fragment homologous to the 5 end of a conversion region to be altered (5 arm) is selected from the nucleotide sequences that have at least 90% homology to the NCBI accession number NC_000082.7; c) the DNA fragment homologous to the 3 end of the region to be altered (3 arm) is selected from the nucleotide sequences that have at least 90% homology to the NCBI accession number NC_000082.7.
[0151] In some embodiments, a) the DNA fragment homologous to the 5 end of a region to be altered (5 arm) is selected from the nucleotides from the position 32429794 to the position 32434036 of the NCBI accession number NC_000082.7; c) the DNA fragment homologous to the 3 end of the region to be altered (3 arm) is selected from the nucleotides from the position 32449155 to the position 32453445 of the NCBI accession number NC_000082.7.
[0152] In some embodiments, the length of the selected genomic nucleotide sequence in the targeting vector can be more than about 3 kb, about 4 kb, about 5 kb, about 6 kb, about 7 kb, about 8 kb, about 9 kb, about 10 kb, about 15 kb, about 20 kb, about 21 kb, about 22 kb, about 23 kb, about 24 kb, or about 25 kb.
[0153] In some embodiments, the region to be altered is exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19 of TFR1 gene (e.g., a portion of exon 4, exons 5-18, and a portion of exon 19 of mouse TFR1 gene).
[0154] The targeting vector can further include one or more selectable markers, e.g., positive or negative selectable markers. In some embodiments, the positive selectable marker is a Neo gene or Neo cassette. In some embodiments, the negative selectable marker is a DTA gene.
[0155] In some embodiments, the sequence of the 5 arm is shown in SEQ ID NO: 3; and the sequence of the 3 arm is shown in SEQ ID NO: 4.
[0156] In some embodiments, the sequence is derived from human (e.g., 196051942-196074099 of NC_000003.12). For example, the target region in the targeting vector is a part or entirety of the nucleotide sequence of a human TFR1, preferably exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19 of the human TFR1. In some embodiments, the nucleotide sequence of the humanized TFR1 encodes the entire or the part of human TFR1 protein with the NCBI accession number NP_003225.2 (SEQ ID NO: 2).
[0157] The disclosure also relates to a cell comprising the targeting vectors as described above.
[0158] In addition, the present disclosure further relates to a non-human mammalian cell, having any one of the foregoing targeting vectors, and one or more in vitro transcripts of the construct as described herein. In some embodiments, the cell includes Cas9 mRNA or an in vitro transcript thereof.
[0159] In some embodiments, the genes in the cell are heterozygous. In some embodiments, the genes in the cell are homozygous.
[0160] In some embodiments, the non-human mammalian cell is a mouse cell. In some embodiments, the cell is a fertilized egg cell. In some embodiments, the cell is an embryonic stem cell.
Methods of Making Genetically Modified Animals
[0161] Genetically modified animals can be made by several techniques that are known in the art, including, e.g., nonhomologous end-joining (NHEJ), homologous recombination (HR), zinc finger nucleases (ZFNs), transcription activator-like effector-based nucleases (TALEN), and the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas system. In some embodiments, homologous recombination is used. In some embodiments, CRISPR-Cas9 genome editing is used to generate genetically modified animals. Many of these genome editing techniques are known in the art, and is described, e.g., in Yin et al., Delivery technologies for genome editing, Nature Reviews Drug Discovery 16.6 (2017): 387-399, which is incorporated by reference in its entirety. Many other methods are also provided and can be used in genome editing, e.g., micro-injecting a genetically modified nucleus into an enucleated oocyte, and fusing an enucleated oocyte with another genetically modified cell.
[0162] Thus, in some embodiments, the disclosure provides replacing in at least one cell of the animal, at an endogenous TFR1 gene locus, a sequence encoding a region of an endogenous TFR1 with a sequence encoding a corresponding region of human or chimeric TFR1. In some embodiments, the replacement occurs in a germ cell, a somatic cell, a blastocyst, or a fibroblast, etc. The nucleus of a somatic cell or the fibroblast can be inserted into an enucleated oocyte.
[0163]
[0164] Thus, in some embodiments, the methods for making a genetically modified, humanized animal, can include the step of replacing at an endogenous TFR1 locus (or site), a nucleic acid encoding a sequence encoding a region of endogenous TFR1 with a sequence encoding a corresponding region of human TFR1. The sequence can include a region (e.g., a part or the entire region) of exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19 of a human TFR1 gene. In some embodiments, the sequence includes a portion of exon 4, exons 5-18, and a portion of exon 19 of a human TFR1 gene (e.g., nucleic acids 548-2566 of NM_003234.4). In some embodiments, the region is located within the extracellular region of TFR1 (e.g., amino acids 89-760 of SEQ ID NO: 2; or amino acids 89-763 of SEQ ID NO: 1). In some embodiments, the endogenous TFR1 locus is exon 1, exon 2, exon 3, exon 4, exon 5, exon 6, exon 7, exon 8, exon 9, exon 10, exon 11, exon 12, exon 13, exon 14, exon 15, exon 16, exon 17, exon 18, and/or exon 19 of mouse TFR1. In some embodiments, the sequence includes a portion of exon 4, exons 5-18, and a portion of exon 19 of mouse TFR1 gene (e.g., nucleic acids 429-2456 of NM_011638.4).
[0165] In some embodiments, the methods of modifying a TFR1 locus of a mouse to express a chimeric human/mouse TFR1 peptide can include the steps of replacing at the endogenous mouse TFR1 locus a nucleotide sequence encoding a mouse TFR1 with a nucleotide sequence encoding a human TFR1, thereby generating a sequence encoding a chimeric human/mouse TFR1.
[0166] In some embodiments, the nucleotide sequence encoding the chimeric human/mouse TFR1 can include a first nucleotide sequence encoding a cytoplasmic region and a transmembrane region of mouse TFR1; and a second nucleotide sequence encoding an extracellular region of human TFR1.
[0167] In some embodiments, the nucleotide sequences as described herein do not overlap with each other (e.g., the first nucleotide sequence and the second nucleotide sequence do not overlap). In some embodiments, the amino acid sequences as described herein do not overlap with each other.
[0168] The present disclosure further provides a method for establishing a TFR1 gene humanized animal model, involving the following steps: [0169] (a) providing the cell (e.g. a fertilized egg cell) based on the methods described herein; [0170] (b) culturing the cell in a liquid culture medium; [0171] (c) transplanting the cultured cell to the fallopian tube or uterus of the recipient female non-human mammal, allowing the cell to develop in the uterus of the female non-human mammal; [0172] (d) identifying the germline transmission in the offspring genetically modified humanized non-human mammal of the pregnant female in step (c).
[0173] In some embodiments, the non-human mammal in the foregoing method is a mouse (e.g., a C57BL/6 mouse).
[0174] In some embodiments, the non-human mammal in step (c) is a female with pseudopregnancy (or false pregnancy).
[0175] In some embodiments, the fertilized eggs for the methods described above are C57BL/6 fertilized eggs. Other fertilized eggs that can also be used in the methods as described herein include, but are not limited to, FVB/N fertilized eggs, BALB/c fertilized eggs, DBA/1 fertilized eggs and DBA/2 fertilized eggs.
[0176] Fertilized eggs can come from any non-human animal, e.g., any non-human animal as described herein. In some embodiments, the fertilized egg cells are derived from rodents. The genetic construct can be introduced into a fertilized egg by microinjection of DNA. For example, by way of culturing a fertilized egg after microinjection, a cultured fertilized egg can be transferred to a false pregnant non-human animal, which then gives birth of a non-human mammal, so as to generate the non-human mammal mentioned in the methods described above.
[0177] In some embodiments, methods of making the genetically modified animal comprises modifying the coding frame of the non-human animal's TFR1 gene, e.g., by inserting a nucleotide sequence (e.g., cDNA sequence) encoding human or humanized TFR1 protein immediately after the endogenous regulatory element of the non-human animal's TFR1 gene. For example, one or more functional region sequences of the non-human animal's TFR1 gene can be knocked out, or inserted with a sequence, such that the non-human animal cannot express or expresses a decreased level of endogenous TFR1 protein. In some embodiments, the coding frame of the modified non-human animal's TFR1 gene can be all or part of the nucleotide sequence from exon 1 to exon 19 of the non-human animal's TFR1 gene.
[0178] In some embodiments, methods of making the genetically modified animal comprises inserting a nucleotide sequence encoding human or humanized TFR1 protein and/or an auxiliary sequence after the endogenous regulatory element of the non-human animal's TFR1 gene. In some embodiments, the auxiliary sequence can be a stop codon, such that the TFR1 gene humanized animal model can express human or humanized TFR1 protein in vivo, but does not express non-human animal's TFR1 protein. In some embodiments, the auxiliary sequence includes WPRE (WHP Posttranscriptional Response Element) and/or poly A.
Methods of Using Genetically Modified Animals
[0179] Replacement of non-human genes in a non-human animal with homologous or orthologous human genes or human sequences, at the endogenous non-human locus and under control of endogenous promoters and/or regulatory elements, can result in a non-human animal with qualities and characteristics that may be substantially different from a typical knockout-plus-transgene animal. In the typical knockout-plus-transgene animal, an endogenous locus is removed or damaged and a fully human transgene is inserted into the animal's genome and presumably integrates at random into the genome. Typically, the location of the integrated transgene is unknown; expression of the human protein is measured by transcription of the human gene and/or protein assay and/or functional assay. Inclusion in the human transgene of upstream and/or downstream human sequences are apparently presumed to be sufficient to provide suitable support for expression and/or regulation of the transgene.
[0180] In some cases, the transgene with human regulatory elements expresses in a manner that is unphysiological or otherwise unsatisfactory, and can be actually detrimental to the animal. The disclosure demonstrates that a replacement with human sequence at an endogenous locus under control of endogenous regulatory elements provides a physiologically appropriate expression pattern and level that results in a useful humanized animal whose physiology with respect to the replaced gene are meaningful and appropriate in the context of the humanized animal's physiology.
[0181] Genetically modified animals that express human or humanized TFR1 protein, e.g., in a physiologically appropriate manner, provide a variety of uses that include, but are not limited to, developing therapeutics for human diseases and disorders, and assessing the toxicity and/or the efficacy of these human therapeutics in the animal models.
[0182] In various aspects, genetically modified animals are provided that express human or humanized TFR1, which are useful for testing agents that can decrease or block the interaction between TFR1 and TFR1 ligands (e.g., transferrin) or the interaction between TFR1 and anti-human TFR1 antibodies, testing whether an agent can increase or decrease the immune response, and/or determining whether an agent is an TFR1 agonist or antagonist. The genetically modified animals can be, e.g., an animal model of a human disease, e.g., the disease is induced genetically (a knock-in or knockout). In various embodiments, the genetically modified non-human animals further comprise an impaired immune system, e.g., a non-human animal genetically modified to sustain or maintain a human xenograft, e.g., a human solid tumor or a blood cell tumor (e.g., leukemia, lymphoma, or a B or T cell tumor). In some embodiments, the anti-TFR1 antibody blocks or inhibits the TFR1-related signaling pathway.
[0183] In some embodiments, the anti-TFR1 antibody described herein can block the interaction between TFR1 and transferrin, thereby inhibiting iron import, e.g., by endocytosis. In some embodiments, the anti-TFR1 antibody described herein can block the interaction between TFR1 and gamma-aminobutyric acid receptor-associated protein (GABARAP) or human homeostatic iron regulator protein (HFE).
[0184] In some embodiments, the genetically modified animals can be used for determining effectiveness of an anti-TFR1 antibody for the treatment of cancer. The methods involve administering the anti-TFR1 antibody (e.g., anti-human TFR1 antibody) to the animal as described herein, wherein the animal has a tumor; and determining inhibitory effects of the anti-TFR1 antibody to the tumor. The inhibitory effects that can be determined include, e.g., a decrease of tumor size or tumor volume, a decrease of tumor growth, a reduction of the increase rate of tumor volume in a subject (e.g., as compared to the rate of increase in tumor volume in the same subject prior to treatment or in another subject without such treatment), a decrease in the risk of developing a metastasis or the risk of developing one or more additional metastasis, an increase of survival rate, and an increase of life expectancy, etc. The tumor volume in a subject can be determined by various methods, e.g., as determined by direct measurement, MRI or CT. In addition, a delicate balance is required for these antibodies, as TFR1 is also expressed on many other cells. Thus, it is important that the humanized TFR1 functions in a largely similar way as compared to the endogenous TFR1, so that the results in the humanized animals can be used to predict the efficacy or toxicity of these therapeutic agents in the human. In some embodiments, the anti-TFR1 antibody can directly target cancer cells expressing TFR1, e.g., by inducing complement mediated cytotoxicity (CMC) or antibody dependent cellular cytoxicity (ADCC) to kill the cancer cells.
[0185] In some embodiments, the tumor comprises one or more cancer cells (e.g., human or mouse cancer cells) that are injected into the animal. In some embodiments, the anti-TFR1 antibody prevents transferrin from binding to TFR1. In some embodiments, the anti-TFR1 antibody does not prevent transferrin from binding to TFR1.
[0186] In some embodiments, the genetically modified animals can be used for determining whether an anti-TFR1 antibody is a TFR1 agonist or antagonist. In some embodiments, the methods as described herein are also designed to determine the effects of the agent (e.g., anti-TFR1 antibodies) on TFR1, e.g., whether the agent can stimulate immune cells or inhibit immune cells (e.g., T cells, B cells, or NK cells), whether the agent can increase or decrease the production of cytokines, whether the agent can activate or deactivate immune cells (e.g., T cells, B cells, or NK cells), whether the agent can cross blood-brain barrier; whether the agent can upregulate the immune response or downregulate immune response, and/or whether the agent can induce complement mediated cytotoxicity (CMC) or antibody dependent cellular cytoxicity (ADCC). In some embodiments, the genetically modified animals can be used for determining the effective dosage of a therapeutic agent for treating a disease in the subject, e.g., cancer.
[0187] The inhibitory effects on tumors can also be determined by methods known in the art, e.g., measuring the tumor volume in the animal, and/or determining tumor (volume) inhibition rate (TGI.sub.TV). The tumor growth inhibition rate can be calculated using the formula TGI.sub.TV (%)=(1-TVt/TVc)?100, where TVt and TVc are the mean tumor volume (or weight) of treated and control groups.
[0188] In some embodiments, the anti-TFR1 antibody is designed for treating various cancers. As used herein, the term cancer refers to cells having the capacity for autonomous growth, i.e., an abnormal state or condition characterized by rapidly proliferating cell growth. The term is meant to include all types of cancerous growths or oncogenic processes, metastatic tissues or malignantly transformed cells, tissues, or organs, irrespective of histopathologic type or stage of invasiveness. The term tumor as used herein refers to cancerous cells, e.g., a mass of cancerous cells. Cancers that can be treated or diagnosed using the methods described herein include malignancies of the various organ systems, such as affecting lung, breast, thyroid, lymphoid, gastrointestinal, and genito-urinary tract, as well as adenocarcinomas which include malignancies such as most colon cancers, renal-cell carcinoma, prostate cancer and/or testicular tumors, non-small cell carcinoma of the lung, cancer of the small intestine and cancer of the esophagus. In some embodiments, the agents described herein are designed for treating or diagnosing a carcinoma in a subject. The term carcinoma is art recognized and refers to malignancies of epithelial or endocrine tissues including respiratory system carcinomas, gastrointestinal system carcinomas, genitourinary system carcinomas, testicular carcinomas, breast carcinomas, prostatic carcinomas, endocrine system carcinomas, and melanomas. In some embodiments, the cancer is renal carcinoma or melanoma. Exemplary carcinomas include those forming from tissue of the cervix, lung, prostate, breast, head and neck, colon and ovary. The term also includes carcinosarcomas, e.g., which include malignant tumors composed of carcinomatous and sarcomatous tissues. An adenocarcinoma refers to a carcinoma derived from glandular tissue or in which the tumor cells form recognizable glandular structures. The term sarcoma is art recognized and refers to malignant tumors of mesenchymal derivation.
[0189] In some embodiments, the cancer described herein is lymphoma, non-small cell lung cancer, cervical cancer, leukemia, ovarian cancer, nasopharyngeal cancer, breast cancer, endometrial cancer, colon cancer, rectal cancer, gastric cancer, bladder cancer, glioma, lung cancer, bronchial cancer, bone cancer, prostate cancer, pancreatic cancer, liver and bile duct cancer, esophageal cancer, kidney cancer, thyroid cancer, head and neck cancer, testicular cancer, glioblastoma, astrocytoma, melanoma, myeloproliferation abnormal syndromes, and sarcomas. In some embodiments, the leukemia is selected from acute lymphocytic (lymphoblastic) leukemia, acute myeloid leukemia, myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma, plasma cell leukemia, and chronic myelogenous leukemia. In some embodiments, the lymphoma is selected from Hodgkin's lymphoma and non-Hodgkin's lymphoma, including B-cell lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone B-cell lymphoma, T-cell lymphoma, and Waldenstrom macroglobulinemia. In some embodiments, the sarcoma is selected from the group consisting of osteosarcoma, Ewing sarcoma, leiomyosarcoma, synovial sarcoma, soft tissue sarcoma, angiosarcoma, liposarcoma, fibrosarcoma, rhabdomyosarcoma , and chondrosarcoma. In a specific embodiment, the tumor is breast cancer, ovarian cancer, endometrial cancer, melanoma, kidney cancer, lung cancer, or liver cancer.
[0190] In some embodiments, the cancer described herein is a solid cancer (e.g., esophageal squamous cell carcinoma, breast cancer, ovarian cancer, lung cancer, cervical cancer, bladder cancer, osteosarcoma, pancreatic cancers, cholangiocarcinoma, renal cell carcinoma, hepatocellular carcinoma, adrenal cortical carcinoma), a cancer of the nervous system, or hematopoietic malignancies (e.g., acute lymphoblastic leukemia (ALL), chronic lymphocytic leukemia (CLL), or non-Hodgkin lymphoma (NHL)).
[0191] In some embodiments, the TFR1 antibody is designed for treating brain cancer, breast cancer, colon cancer, liver cancer, ovarian cancer, lung cancer, bone cancer, leukemia, and/or lymphoma.
[0192] In some embodiments, the anti-TFR1 antibody is designed for treating various autoimmune diseases, including rheumatoid arthritis, Crohn's disease, systemic lupus erythematosus, ankylosing spondylitis, inflammatory bowel diseases (IBD), ulcerative colitis, or scleroderma. In some embodiments, the anti-TFR1 antibody is designed for treating various immune disorders, including allergy, asthma, and/or atopic dermatitis. Thus, the methods as described herein can be used to determine the effectiveness of an anti-TFR1 antibody in inhibiting immune response. In some embodiments, the immune disorders described herein is allergy, asthma, myocarditis, nephritis, hepatitis, systemic lupus erythematosus, rheumatoid arthritis, scleroderma, hyperthyroidism, idiopathic thrombocytopeniarpura, autoimmune hemolytic anemia, ulcerative colitis, autoimmune liver disease, diabetes, pain and/or neurological disorders, etc.
[0193] In some embodiments, the anti-TFR1 antibody is designed for treating various bone diseases, e.g., fractures, bone degeneration, arthritis, bone deformities, osteoporosis, and/or necrosis of the femoral head. In some embodiments, the anti-TFR1 antibody is designed for treating various neurodegenerative diseases, e.g., cerebral ischemia, brain injury or, epilepsy, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and/or spinocerebellar ataxia.
[0194] The present disclosure also provides methods of determining toxicity of an antibody (e.g., anti-TFR1 antibody). The methods involve administering the antibody to the animal as described herein. The animal is then evaluated for its weight change, red blood cell count, hematocrit, and/or hemoglobin. In some embodiments, the antibody can decrease the red blood cells (RBC), hematocrit, or hemoglobin by more than 20%, 30%, 40%, or 50%. In some embodiments, the animals can have a weight that is at least 5%, 10%, 20%, 30%, or 40% smaller than the weight of the control group (e.g., average weight of the animals that are not treated with the antibody).
[0195] In some embodiments, the genetically modified animals described herein can be used for determining effectiveness of an anti-TFR1 antibody for treating a disease or a condition. In some embodiments, the disease or condition is related to iron uptake or iron-related metabolism. The methods can involve administering the anti-TFR1 antibody (e.g., anti-human TFR1 antibody) to the animal as described herein; and determining effects of the anti-TFR1 antibody on the disease or condition.
[0196] In some embodiments, the genetically modified animals described herein can be used for determining delivery efficiency of a therapeutic agent to cross the blood-brain barrier. The methods can involve administering the therapeutic agent (e.g., comprising an anti-TFR1 antibody or antigen-binding fragment thereof; or an anti-TFR1 bispecific or multi-specific antibody or antigen-binding fragment thereof) to the animal, and determining concentration of the therapeutic agent over time (e.g., pharmacokinetics) in brain and/or serum of the animal. In some embodiments, the therapeutic agent comprises an anti-TFR1 antibody or antigen-binding fragment thereof. In some embodiments, an agent is linked to the anti-TFR1 antibody or antigen-binding fragment thereof (e.g., the C-terminal of the anti-TFR1 antibody). In some embodiments, the anti-TFR1 bispecific or multi-specific antibody or antigen-binding fragment thereof can also target a second antigen. In some embodiments, the second antigen is a protein implicated in Alzheimer's disease (e.g., BACE1 or amyloid beta).
[0197] In some embodiments, the genetically modified animals described herein can be used for determining efficacy of a therapeutic agent to treat a disease in the central nervous system. The methods can involve administering the therapeutic agent (e.g., comprising an anti-TFR1 antibody or antigen-binding fragment thereof; or an anti-TFR1 bispecific or multi-specific antibody or antigen-binding fragment thereof) to the animal, and determining the effects of the agent on the disease.
[0198] In some embodiments, upon administration, the anti-TFR1 antibody concentration (e.g., any of the monospecific, bispecific, or multi-specific anti-TFR1 antibodies or antigen-binding fragments thereof described herein) is at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% higher than that of a control antibody (e.g., human IgG) in the brain of the animal. In some embodiments, upon administration, the anti-TFR1 antibody concentration (e.g., any of the monospecific, bispecific, or multi-specific anti-TFR1 antibodies or antigen-binding fragments thereof described herein) is less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, less than 50%, less than 45%, less than 40%, less than 35%, less than 30%, less than 25%, or less than 20% of that of a control antibody (e.g., human IgG) in the serum of the animal. In some embodiments, the concentration of the therapeutic agent described herein (e.g., any of the monospecific, bispecific, or multi-specific anti-TFR1 antibodies or antigen-binding fragments thereof described herein) is determined over a period of at least 5 hours, at least 10 hours, at least 15 hours, at least 20 hours, or at least 25 hours. At a specific time point (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 hours after administration), a ratio of the antibody concentration in the brain versus the antibody concentration in the serum can be calculated. In some cases, the ratio is at least 0.5, at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, or at least 20 for the therapeutic agent described herein (e.g., any of the monospecific, bispecific, or multi-specific anti-TFR1 antibodies or antigen-binding fragments thereof described herein). In some embodiments, the ratio for the therapeutic agent described herein is at least 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, or 100-fold as compared to the ratio for a control antibody (e.g., human IgG).
[0199] The present disclosure also relates to the use of the animal model generated through the methods as described herein in the development of a product related to an immunization processes of human cells, the manufacturing of a human antibody, or the model system for a research in pharmacology, immunology, microbiology and medicine.
[0200] In some embodiments, the disclosure provides the use of the animal model generated through the methods as described herein in the production and utilization of an animal experimental disease model of an immunization processes involving human cells, the study on a pathogen, or the development of a new diagnostic strategy and/or a therapeutic strategy.
[0201] The disclosure also relates to the use of the animal model generated through the methods as described herein in the screening, verifying, evaluating or studying the TFR1 gene function, human TFR1 antibodies, drugs for human TFR1 targeting sites, the drugs or efficacies for human TFR1 targeting sites, the drugs for immune-related diseases and antitumor drugs.
[0202] In some embodiments, the disclosure provides a method to verify in vivo efficacy of TCR-T, CAR-T, and/or other immunotherapies (e.g., T-cell adoptive transfer therapies). For example, the methods include transplanting human tumor cells into the animal described herein, and applying human CAR-T to the animal with human tumor cells. Effectiveness of the CAR-T therapy can be determined and evaluated. In some embodiments, the animal is selected from the TFR1 gene humanized non-human animal prepared by the methods described herein, the TFR1 gene humanized non-human animal described herein, the double- or multi-humanized non-human animal generated by the methods described herein (or progeny thereof), a non-human animal expressing the human or humanized TFR1 protein, or the tumor-bearing or inflammatory animal models described herein. In some embodiments, the TCR-T, CAR-T, and/or other immunotherapies can treat the TFR1-associated diseases described herein. In some embodiments, the TCA-T, CAR-T, and/or other immunotherapies provides an evaluation method for treating the TFR1-associated diseases described herein.
Genetically Modified Animal Model With two or more Human or Chimeric Genes
[0203] The present disclosure further relates to methods for generating genetically modified animal model with two or more human or chimeric genes. The animal can comprise a human or chimeric TFR1 gene and a sequence encoding an additional human or chimeric protein.
[0204] In some embodiments, the additional human or chimeric protein can be programmed cell death protein 1 (PD-1), programmed cell death ligand 1 (PD-L1), cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), TNF receptor superfamily member 4 (OX40), lymphocyte-activation gene 3 (LAG3), T-cell immunoglobulin and mucin-domain containing-3 (TIM-3), or CD73.
[0205] The methods of generating genetically modified animal model with two or more human or chimeric genes (e.g., humanized genes) can include the following steps: [0206] (a) using the methods of introducing human TFR1 gene or chimeric TFR1 gene as described herein to obtain a genetically modified non-human animal; [0207] (b) mating the genetically modified non-human animal with another genetically modified non-human animal, and then screening the progeny to obtain a genetically modified non-human animal with two or more human or chimeric genes.
[0208] In some embodiments, in step (b) of the method, the genetically modified animal can be mated with a genetically modified non-human animal with human or chimeric PD-1, PD-L1, CTLA-4, OX40, LAG-3, TIM3, or CD73. Some of these genetically modified non-human animal are described, e.g., in PCT/CN2018/110069, PCT/CN2017/090320, PCT/CN2017/099574, PCT/CN2017/099577, PCT/CN2017/099575, PCT/CN2017/110435, PCT/CN2019/127084, PCT/CN2017/110494, and PCT/CN2019/119793; each of which is incorporated herein by reference in its entirety.
[0209] In some embodiments, the TFR1 humanization is directly performed on a genetically modified animal having a human or chimeric PD-1, PD-L1, CTLA-4, OX40, LAG-3, TIM3, or CD73 gene.
[0210] As these proteins may involve different mechanisms, a combination therapy that targets two or more of these proteins thereof may be a more effective treatment. In fact, many related clinical trials are in progress and have shown a good effect. The genetically modified animal model with two or more human or humanized genes can be used for determining effectiveness of a combination therapy that targets two or more of these proteins, e.g., an anti-TFR1 antibody and an additional therapeutic agent for the treatment of cancer. The methods include administering the anti-TFR1 antibody and the additional therapeutic agent to the animal, wherein the animal has a tumor; and determining the inhibitory effects of the combined treatment to the tumor. In some embodiments, the additional therapeutic agent is an antibody that specifically binds to PD-1, PD-L1, CTLA-4, OX40, LAG-3, TIM3, or CD73. In some embodiments, the additional therapeutic agent is an anti-CTLA4 antibody (e.g., ipilimumab), an anti-PD-1 antibody (e.g., nivolumab), or an anti-PD-L1 antibody.
[0211] In some embodiments, the animal further comprises a sequence encoding a human or humanized PD-1, a sequence encoding a human or humanized PD-L1, or a sequence encoding a human or humanized CTLA-4. In some embodiments, the additional therapeutic agent is an anti-PD-1 antibody (e.g., nivolumab, pembrolizumab), an anti-PD-L1 antibody, or an anti-CTLA-4 antibody. In some embodiments, the tumor comprises one or more tumor cells that express CD80, CD86, PD-L1, and/or PD-L2.
[0212] In some embodiments, the combination treatment is designed for treating various cancer as described herein, e.g., melanoma, non-small cell lung carcinoma (NSCLC), small cell lung cancer (SCLC), bladder cancer, prostate cancer (e.g., metastatic hormone-refractory prostate cancer), advanced breast cancer, advanced ovarian cancer, and/or advanced refractory solid tumor. In some embodiments, the combination treatment is designed for treating metastatic solid tumors, NSCLC, melanoma, B-cell non-Hodgkin lymphoma, colorectal cancer, and multiple myeloma. In some embodiments, the combination treatment is designed for treating melanoma, carcinomas (e.g., pancreatic carcinoma), mesothelioma, hematological malignancies (e.g., Non-Hodgkin's lymphoma, lymphoma, chronic lymphocytic leukemia), or solid tumors (e.g., advanced solid tumors). In some embodiments, the combination treatment is designed for treating breast cancer, colon cancer, cervical cancer, fibrosarcoma, liver cancer, lung cancer, non-small cell lung cancer (NSCLC), melanoma, ovarian cancer, renal cancer, skin cancer, plasmacytoma, lymphoma, and/or leukemia.
[0213] In some embodiments, the methods described herein can be used to evaluate the combination treatment with some other methods. The methods of treating a cancer that can be used alone or in combination with methods described herein, include, e.g., treating the subject with chemotherapy, e.g., campothecin, doxorubicin, cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, adriamycin, ifosfamide, melphalan, chlorambucil, bisulfan, nitrosurea, dactinomycin, daunorubicin, bleomycin, plicomycin, mitomycin, etoposide, verampil, podophyllotoxin, tamoxifen, taxol, transplatinum, 5-flurouracil, vincristin, vinblastin, and/or methotrexate. Alternatively or in addition, the methods can include performing surgery on the subject to remove at least a portion of the cancer, e.g., to remove a portion of or all of a tumor(s), from the patient.
EXAMPLES
[0214] The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.
Materials and Methods
[0215] The following materials were used in the following examples.
[0216] DraIII, EcoRV, and AseI restriction enzymes were purchased from NEB (Catalog numbers: R3510V, R3195V, and R0101M, respectively).
[0217] C57BL/6 mice and Flp transgenic mice were purchased from the China Food and Drugs Research Institute National Rodent Experimental Animal Center.
[0218] Purified anti-mouse CD16/32 Antibody was purchased from BioLegend (Catalog number: 101302).
[0219] Brilliant Violet 510? anti-mouse CD45 Antibody was purchased from BioLegend (Catalog number: 103138).
[0220] PerCP/Cy5.5 anti-mouse TCR? Antibody was purchased from BioLegend (Catalog number: 109228).
[0221] FITC anti-Mouse CD19 Antibody was purchased from BioLegend (Catalog number: 115506).
[0222] Brilliant Violet 605? anti-mouse TER-119/Erythroid Cells Antibody was purchased from BioLegend (Catalog number: 116239).
[0223] PE anti-mouse CD43 Antibody was purchased from BioLegend (Catalog number: 143205).
[0224] APC anti-human CD43 Antibody was purchased from BioLegend (Catalog number: 343205).
[0225] APC anti-human CD71 Antibody was purchased from BioLegend (Catalog number: 334107).
[0226] Zombie NIR? Fixable Viability Kit was purchased from BioLegend (Catalog number: 423106).
[0227] Brilliant Violet 605? anti-mouse TER-119/Erythroid Cells Antibody was purchased from BioLegend (Catalog number: 116239).
[0228] PE anti-mouse CD71 Antibody was purchased from BioLegend (Catalog number: 113807).
Example 1: Generation of Mice With Humanized TFR1 Gene
[0229] The genome of a non-human animal (e.g., a mouse) can be modified to include a nucleic acid sequence encoding all or a part of a human TFR1 protein, such that the genetically modified non-human animal can express a human or humanized TFR1 protein. The mouse TFR1 gene (NCBI Gene ID: 22042, Primary source: MGI: 98822, UniProt ID: Q62351) is located at 32427714 to 32451612 of chromosome 16 (NC_000082.7), and the human TFR1 gene (NCBI Gene ID: 7037, Primary source: HGNC: 117631, UniProt ID: P02786) is located at 196018694 to 196082123 of chromosome 3 (NC_000003.12). The mouse TFR1 transcript is NM_011638.4, and the corresponding protein sequence NP_035768. 1 is set forth in SEQ ID NO: 1. The human TFR1 transcript is NM_003234.4, and the corresponding protein sequence NP_003225.2 is set forth in SEQ ID NO: 2. Mouse and human TFR1 gene loci are shown in
[0230] All or part of nucleotide sequences encoding human TFR1 protein can be introduced into the mouse endogenous TFR1 locus, so that the mouse expresses human or humanized TFR1 protein. Specifically, under the control of the mouse TFR1 gene regulatory element, a nucleotide sequence encoding human TFR1 protein was used to replace the corresponding mouse sequence using gene-editing techniques, to obtain a humanized TFR1 gene locus as shown in
[0231] As shown in the schematic diagram of the targeting strategy in
[0232] The targeting vector also includes an antibiotic resistance gene for positive clone screening (neomycin phosphotransferase gene, or Neo), and two Frt recombination sites flanking the antibiotic resistance gene, that formed a Neo cassette. The connection between the 5 end of the Neo cassette and the human sequence was designed as:
TABLE-US-00003 (SEQIDNO:6) 5-TAGCCTCCTTTAGAATTTTAACCTTAGAAGATTAGCATTAGCCAAT TGCATCTGGCGAATCGGACCCACAAGAGCACTGAGGTCGGAAGTTCCTA TTCTCTAGAAA-3,
wherein the C in sequence ATTAGC is the last nucleotide of the human sequence, and the C in sequence CAATT is the first nucleotide of the Neo cassette. The connection between the 3 end of the Neo cassette and the human sequence was designed as:
TABLE-US-00004 (SEQIDNO:7) 5-TCATCAGTCCAGGATACATAGATTACCACAACTCCGAGCCTGGTTC TCAGCATTCTTTTTTCCTTACTCTGCTATAGAAA-3,
wherein the last C in sequence CGAGC is the last nucleotide of the Neo cassette, and the C in sequence CTGGT is the first nucleotide of the human sequence. In addition, a coding gene with a negative selectable marker (a gene encoding diphtheria toxin A subunit (DTA)) was also constructed downstream of the 3 homologous arm of the targeting vector. The mRNA sequence of the engineered mouse TFR1 after humanization and its encoded protein sequence are shown in SEQ ID NO: 8 and SEQ ID NO: 9, respectively.
[0233] The targeting vector was constructed, e.g., by restriction enzyme digestion and ligation. The constructed targeting vector sequences were preliminarily confirmed by restriction enzyme digestion, and then verified by sequencing. Embryonic stem cells of C57BL/6 mice were transfected with the correct targeting vector by electroporation. The positive selectable marker genes were used to screen the cells, and the integration of exogenous genes was confirmed by PCR (PCR primers are shown in the table below) and Southern Blot.
TABLE-US-00005 TABLE3 PCRprimersequencesandtargetfragmentlength Primernameand Target SEQIDNO Primersequence(5-3) fragmentsize PCR-F1(SEQIDNO:10) AGCTAGTGCTGAAGAGTAAGAGCCT 4626bp PCR-R1(SEQIDNO:11) CACTTGATGGTGCCGGTGAAGTCTG PCR-F2(SEQIDNO:12) GCTCGACTAGAGCTTGCGGA 5416bp PCR-R2(SEQIDNO:13) GGTGTCTGTGAGCTGCCTCACTTG
[0234] Specifically, after mouse embryonic stem cells were transfected with targeting vectors, the clones identified as positive by PCR were then verified by Southern Blot (cell DNA was digested with DraIII, EcoRV, and AseI, respectively, and hybridized with three probes) to screen out correct positive clone cells. The restriction enzymes, probes, and the size of target fragments are shown in the table below. The Southern Blot detection results are shown in
TABLE-US-00006 TABLE 4 Enzymes and probes used in Southern Blot Restriction Wild-type fragment Recombinant fragment emzyme Probe size size DraIII A Probe 15.4 kb EcoRV A Probe 17.2 kb AseI Neo (3) 12.9 kb
[0235] The following primers were used for Southern Blot identification:
[0236] A Probe:
TABLE-US-00007 AProbe-F: (SEQIDNO:14) 5-GGTGAGAAGAAACTAAACTATGCCA-3, AProbe-R: (SEQIDNO:15) 5-TCTGGTTCACCCAGGTTAGAGC-3;
[0237] Neo Probe:
TABLE-US-00008 NeoProbe-F: (SEQIDNO:18) 5-GGATCGGCCATTGAACAAGAT-3, NeoProbe-R: (SEQIDNO:19) 5-CAGAAGAACTCGTCAAGAAGGC-3
[0238] The positive clones that had been screened (black mice) were introduced into isolated blastocysts (white mice), and the resulted chimeric blastocysts were transferred to a culture medium for short-term culture and then transplanted to the fallopian tubes of the recipient mother (white mice) to produce the F0 chimeric mice (black and white). The F2 generation homozygous mice were obtained by backcrossing the F0 generation chimeric mice with wild-type mice to obtain the F1 generation mice, and then breeding the F1 generation heterozygous mice with each other. The positive mice were also bred with the Flp transgenic mice to remove the positive selectable marker genes (schematic diagram shown in
[0239] The genotype of the TFR1 gene humanized mice can be verified by PCR using primers shown in the table below. The identification results of exemplary F1 generation mice (Neo cassette removed) are shown in
TABLE-US-00009 TABLE5 PCRprimersequencesandtargetfragmentlength Primernameand Targetfragment SEQIDNO Primersequence(5-3) size(bp) WT-F(SEQIDNO:20) AGTAAGACAAGGTGTGCACCCATGT WT:420 WT-R(SEQIDNO:21) TCAGGACTGAACTTGGGAAGTTGAG WT-F(SEQIDNO:20) AGTAAGACAAGGTGTGCACCCATGT Mut:319 Mut-R(SEQIDNO:22) ATATAAGCGACGTGCTGCAGGGAAG Frt-F(SEQIDNO:23) AGGCCGGTCTCGAACTCCCAACC Mut:313 Frt-R(SEQIDNO:24) GAGCCACTGTACCCAGCCAGCTGAT Flp-F2(SEQIDNO:25) GACAAGCGTTAGTAGGCACATATAC Mut:325 Flp-R2(SEQIDNO:26) GCTCCAATTTCCCACAACATTAGT
[0240] The results indicate that genetically engineered mice with a humanized TFR1 gene can be constructed using the methods described herein. The mice can be stably passaged without random insertions.
[0241] Expression of humanized TFR1 protein in positive mice can be confirmed, e.g., by flow cytometry or fluorescence-activated cell sorting (FACS). Specifically, one 7-week-old female C57BL/6 wild-type mouse and one 7-week-old female TFR1 gene humanized heterozygous mouse were selected. Bone marrow tissues were collected after euthanasia by cervical dislocation, and the cells were stained with Purified anti-mouse CD16/32 Antibody (an anti-mouse CD16/32 antibody); Brilliant Violet 510? anti-mouse CD45 Antibody (an anti-mouse CD45 antibody); PerCP/Cy5.5 anti-mouse TCR? Antibody (an anti-mouse TCR? antibody); FITC anti-Mouse CD19 Antibody (an anti-mouse CD19 antibody); Brilliant Violet 605? anti-mouse TER-119/Erythroid Cells Antibody (an anti-mouse TER-119 antibody); PE anti-mouse CD43 Antibody (an anti-mouse CD43 antibody); APC anti-human CD43 Antibody (hCD43-PE; an anti-human CD43 antibody); PE anti-mouse CD71 Antibody (mTFR1; an anti-mouse TFR1 antibody); and APC anti-human CD71 Antibody (hTFR1; an anti-human TFR1 antibody), followed by flow cytometry detection.
[0242] The results showed that 50.6% of B cells (characterized by mCD45+mCD19+) in the spleen of the C57BL/6 mouse were mTFR1 positive (characterized by mCD45+mCD19+mTFR1+), and 0.20% were hTFR1 positive (characterized as mCD45+mCD19+hTFR1+). In the spleen of the TFR1 gene humanized heterozygous mouse, 32.9% of B cells were mTFR1 positive (characterized by mCD45+mCD19+mTFR1+) and 11.3% were hTFR1 positive (characterized by mCD45+mCD19+hTFR1+). The results showed that expression of mouse TFR1 but not humanized TFR1 was detected in wild-type mouse splenocytes; whereas expression of both mouse TFR1 and humanized TFR1 were detected in the TFR1 gene humanized heterozygous mouse in vivo. The above experimental results indicate that TFR1 can be expressed normally in TFR1 gene humanized mice.
[0243] F2 generation TFR1 gene humanized homozygous mice were obtained by cross-breeding F1 generation heterozygous mice. Transcription of mRNA in TFR1 gene humanized homozygous mice was detected by RT-PCR. Specifically, one 7-week-old female C57BL/6 wild-type mouse and one TFR1 gene humanized homozygous mouse (generated using the methods described herein) were selected. Mouse splenocytes were collected after euthanasia by cervical dislocation. Cellular RNA was extracted according to the instructions of the TRIzol? kit. The extracted cellular RNA was then reverse transcribed into cDNA, and then detected by RT-PCR using the primers shown below. As shown in
[0244] The following primers were used in RT-PCR detection:
TABLE-US-00010 PCR-F1: (SEQIDNO:27) 5-CTCTGCTTTGCAGCTATTGCAC-3, PCR-R1: (SEQIDNO:28 5-CAGGATTCTCCACCAGGTAAACA-3; PCR-F2: (SEQIDNO:29) 5-GTTCGAGAGTCACCACGCTGAG-3, PCR-R2: (SEQIDNO:30) 5-GGCAACCCTGATGACTGAGATG-3; GAPDH-F: (SEQIDNO:16) 5-TCACCATCTTCCAGGAGCGAGA-3, GAPDH-R: (SEQIDNO:17) 5-GAAGGCCATGCCAGTGAGCTT-3.
[0245] Similar methods using flow cytometry as described above can be used to verify the expression of humanized TFR1 protein in TFR1 gene humanized homozygous mice. Specifically, one 7-week-old female C57BL/6 wild-type mouse and one 7-week-old female TFR1 gene humanized homozygous mouse were selected. Bone marrow tissues were collected after euthanasia by cervical dislocation, and the cells were stained with Purified anti-mouse CD16/32 Antibody (an anti-mouse CD16/32 antibody); Brilliant Violet 605? anti-mouse TER-119/Erythroid Cells Antibody (an anti-mouse TER-119 antibody); PE anti-mouse CD71 Antibody (mTFR1; an anti-mouse TFR1 antibody); and APC anti-human CD71 Antibody (hTFR1; an anti-human TFR1 antibody), followed by flow cytometry detection. The results showed that 14.2% of erythroid cells (characterized by mTer119+) in the bone marrow of C57BL/6 mouse were mTFR1 positive (characterized by mTer119+mTFR1+), and 0.087% were hTFR1 positive (characterized by mTer119+hTFR1+). In the bone marrow of the TFR1 gene humanized homozygous mouse, 0.04% of erythroid cells were mTFR1 positive and 10.1% were hTFR1 positive. The results indicate that the TFR1 gene humanized mice generated using the methods described herein can successfully express humanized TFR1 protein in vivo.
[0246] Further, leukocytes and T cells in the spleen, lymph nodes, and peripheral blood of wild-type C57BL/6 mice and TFR1 gene humanized homozygous mice were collected for immuno-phenotyping detection by flow cytometry. Routine blood tests and biochemical tests were also performed. The results showed that the percentages of leukocyte subtypes (including B cells, T cells, NK cells, CD4+T cells, CD8+T cells, granulocytes, dendritic cells (DC cells), macrophages, monocytes) and T cell subtypes (including CD4+T cells, CD8+T cells, and Treg cells), as well as the routine blood tests and biochemical tests in each tissue sample of the TFR1 gene humanized homozygous mice were basically the same as those detected in C57BL/6 wild-type mice. The results indicate that humanization of TFR1 gene did not significantly affect the differentiation of leucocytes and T cells, development, and distribution of leukocytes and T cells in spleen, lymphoid tissue and peripheral blood in mice.
Example 2: Pharmacokinetics (PK) Detection of Anti-Human TFR1 Antibodies in Mice
[0247] The PK process of anti-human TFR1 antibodies in mouse brain tissue and serum was detected as follows. TFR1 gene humanized homozygous mice were selected and randomly placed into a control group and a treatment group. The control group mice were injected with 10 mg/kg of control human IgG1 (hIgG), and the treatment group mice were injected with an equal molar amount (10.9 mg/kg) of an anti-human TFR1 antibody Ab through tail vein. Mouse brain tissue and serum samples were collected, and the concentration of anti-human TFR1 antibody Ab in mouse brain tissue and serum samples was measured by ELISA using an anti-human Fc antibody. As shown in
Example 3: In Vivo Efficacy Verification
[0248] The TFR1 gene humanized mice generated herein can be used to evaluate the efficacy of modulators targeting human TFR1. For example, the TFR1 gene humanized homozygous mice described herein can be subcutaneously inoculated with mouse colon cancer cells MC38. When the tumor grows to about 100 mm.sup.3, the mice are randomly placed into a control group and several treatment groups based on tumor size. The treatment group mice can be randomly selected and administered with drugs (e.g., antibodies) targeting human TFR1, and the control group mice can be administered with an equal volume of saline. Tumor volume and body weight of the mice can be measured, and the results can be used to effectively evaluate the in vivo safety and efficacy of drugs, e.g., by comparing changes of tumor volume and body weight of the mice.
Example 4: Generation of Double- or Multi-Gene Humanized Mice
[0249] The TFR1 gene humanized mice generated using the methods described herein can also be used to generate double- or multi-gene humanized mouse models. For example, in Example 1, the embryonic stem (ES) cells for blastocyst microinjection can be selected from mice comprising other genetic modifications such as modified (e.g., human or humanized) PD-1, PD-L1, CTLA-4, OX40, LAG3, TIM3, and/or CD73 genes. Alternatively, embryonic stem cells from humanized TFR1 mice described herein can be isolated, and gene recombination targeting technology can be used to obtain double-gene or multi-gene-modified mouse models of TFR1and other gene modifications. In addition, it is also possible to breed the homozygous or heterozygous TFR1 gene humanized mice obtained by the methods described herein with other genetically modified homozygous or heterozygous mice, and the offspring can be screened. According to Mendel's law, it is possible to generate double-gene or multi-gene modified heterozygous mice comprising modified (e.g., human or humanized) TFR1 gene and other genetic modifications. Then the heterozygous mice can be bred with each other to obtain homozygous double-gene or multi-gene modified mice. These double-gene or multi-gene modified mice can be used for in vivo validation of gene regulators targeting human TFR1 and other genes.
OTHER EMBODIMENTS
[0250] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.