OLEAGINOUS YEAST YARROWIA LIPOLYTICA SUR2 MUTANT STRAIN AND METHOD FOR PRODUCING AND SECRETING, ONTO CELL SURFACES, SPHINGOID-BASED PRECURSORS, SPHINGOSINE AND SPHINGOLIPIDS BY USING SAME

20240271081 ยท 2024-08-15

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to an oleaginous yeast Yarrowia lipolytica sur2 mutant strain and a method for producing and secreting, onto cell surfaces, sphingoid-based precursors, sphingosine and sphingolipids by using same. It has been identified that when a ceramidase gene is additionally introduced into a Ylsur2 deficient mutant strain, the secretion and production of dihydrosphingosine and sphingosine are increased and, further, it is has been identified that when a Ylsld1sur2 double mutant strain in which a SLD1 gene is additionally deficient in a Ylsur2 deficient mutant strain is prepared, growth recovery and sphingosine and human-type glucosylceramide secretion and production are increased.

Claims

1. A Yarrowia lipolytica mutant strain in which a SUR2 gene is deleted or expression thereof is suppressed in a Y. lipolytica strain.

2. The Y. lipolytica mutant strain of claim 1, wherein the SUR2 gene is represented by SEQ ID NO: 4.

3. The Y. lipolytica mutant strain of claim 1, wherein the Y. lipolytica mutant strain is a strain deposited under Accession number KCTC 14592BP.

4. The Y. lipolytica mutant strain of claim 1, wherein the Y. lipolytica mutant strain has enhanced secretion and production of dihydrosphingosine or glucosylceramide onto a cell surface.

5. A method of producing dihydrosphingosine or glucosylceramide, comprising culturing the Y. lipolytica mutant strain according to claim 1 in a medium.

6. The method of claim 5, wherein the medium comprises glycerol as a carbon source.

7. The method of claim 5, wherein the method is characterized in that dihydrosphingosine or glucosylceramide are secreted onto a cell surface by means of lipid droplets without additional acetylation process.

8. A Y. lipolytica mutant recombinant strain in which an SLD1 gene encoding ? 8 desaturase is additionally deleted from the Y. lipolytica mutant strain according to claim 1, with enhanced secretion and production of sphingosine or human glucosylceramide onto a cell surface.

9. The Y. lipolytica mutant recombinant strain of claim 8, wherein the SLD1 gene encoding ? 8 desaturase is represented by SEQ ID NO: 12.

10. The Y. lipolytica mutant recombinant strain of claim 8, wherein the human-type glucosylceramide is produced as glucosylceramide GlcCer(d18:1(4E)/16:0(20H)).

11. The Y. lipolytica mutant recombinant strain of claim 8, wherein the Y. lipolytica mutant recombinant strain is a strain deposited under Accession number KCTC 14980BP.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0015] FIG. 1 shows a diagram illustrating a sphingolipid biosynthesis pathway in mammals, plants, and yeasts.

[0016] FIG. 2 shows (A) a schematic diagram for production of a Y. lipolytica ku70 deficient strain and (B) a result of identifying KU70 gene disruption by PCR.

[0017] FIG. 3A shows analysis of amino acid sequences and domains of S. cerevisiae, P. ciferrii, and Y. lipolytica Sur2 proteins, and FIG. 3B shows a schematic diagram of a cassette vector for production of a sur2 deficient strain and a result of identifying the SUR2 gene disruption by PCR.

[0018] FIG. 4A shows growth curves depending on culture medium composition of Y. lipolytica sur2 deficient strains, FIG. 4B shows micrographs of fungus body, and FIG. 4C shows results of analyzing growth under various cell wall weakening conditions and osmotic stress conditions.

[0019] FIG. 5A shows a structure of dihydrosphingosine, FIG. 5B shows a copper sulfate (CuSO.sub.4) detection method of cell surface, cell culture, and cytosol samples to detect dihydrosphingosine produced and secreted by Y. lipolytica sur2 deficient strains, FIG. 5C shows a TLC result analyzed by ninhydrin detection, and FIG. 5D shows a TLC analysis result in which dihydrosphingosine secretion and production efficiency of Y. lipolytica sur2 deficient strains is compared with that of S. cerevisiae sur2 deficient strains and a graph of quantification thereof.

[0020] FIG. 6A shows results of HPLC analysis for dihydrosphingosine extracted from cell surfaces of Y. lipolytica sur2 deficient strains, and FIGS. 6B and 6C show results of LC/MS/MS analysis for dihydrosphingosine extracted from cell surfaces of Y. lipolytica sur2 deficient strains.

[0021] FIG. 7A shows TLC analysis results of glucosylceramide extracted from the cell surface, cell culture media, and cytosol of Y. lipolytica sur2 deficient strains, FIG. 7B shows an LC/MS analysis result for cell surface samples, and FIG. 7C shows TLC analysis results of identifying changes in inositol sphingolipid extracted from the cytosol.

[0022] FIG. 8A shows a diagram of a sphingolipid biosynthesis pathway of a wild-type Y. lipolytica strain, and FIG. 8B shows a diagram of a sphingolipid biosynthesis pathway of a sur2 deficient strain.

[0023] FIG. 9A shows a strategy of amplifying sphingosine production by introducing various forms of ceramidase genes into a Y. lipolytica sur2 deficient strain, and FIGS. 9B and 9C show TLC analysis results.

[0024] FIG. 10A shows analysis of amino acid sequences and domains of Y. lipolytica, C. albicans, and P. pastoris Sld1 proteins, FIG. 10B shows schematic diagrams of a cassette vector for production of a sld1 deficient strain and results of identifying SLD1 gene disruption by PCR in Y. lipolytica, and FIG. 10C shows results of analyzing growth of Y. lipolytica sld1 deficient strain under various cell wall weakening conditions and osmotic stress conditions.

[0025] FIG. 11A shows a diagram illustrating a sphingolipid biosynthesis pathway of a Y. lipolytica sld1 deficient strain, FIG. 11B shows a TLC analysis result of comparing efficiency in secretion and production of sphingolipid extracted from the cell surface, FIG. 11C shows TLC analysis results of glucosylceramide, and FIG. 11D shows an LC/MS analysis result.

DETAILED DESCRIPTION OF THE INVENTION

[0026] Therefore, the present inventors completed the present disclosure by preparing a mutant strain with deletion of a SUR2 gene to block a biosynthesis pathway for phytosphingosine and phytoceramide in oleaginous yeast Y. lipolytica and established a technique in which dihydrosphingosine, a sphingosine precursor, and glucosylceramide, a sphingosine-based lipid, are secreted and produced onto a cell surface with high efficiency using the mutant strain.

[0027] The present disclosure provides a Y. lipolytica mutant strain with deletion of the SUR2 gene or suppressed expression thereof in a Y. lipolytica strain.

[0028] The SUR2 gene is a gene encoding a dihydrosphingosine C4-hydroxylase and may be represented by SEQ ID NO: 4, but is not limited thereto. On the other hand, an amino acid sequence of the Sur2 protein may be represented by SEQ ID NO: 3.

[0029] More preferably, the Y. lipolytica mutant strain may be a strain (Yarrowia lipolytica sur24) deposited under Accession number KCTC 14592BP.

[0030] More preferably, the Y. lipolytica mutant strain may have enhanced secretion and production of dihydrosphingosine or glucosylceramide onto a cell surface.

[0031] In addition, the present disclosure provides a method of producing dihydrosphingosine or glucosylceramide, including culturing the Y. lipolytica mutant strain in a medium.

[0032] Preferably, the medium may include, but is not limited to, glycerol as a carbon source.

[0033] Preferably, the method allows dihydrosphingosine or glucosylceramide to be secreted onto the cell surface by means of lipid droplets without additional acetylation process.

[0034] In addition, the present disclosure provides a Y. lipolytica mutant recombinant strain in which a gene encoding ceramidase is introduced into the Y. lipolytica mutant strain, with enhanced secretion and production of dihydrosphingosine or sphingosine onto a cell surface.

[0035] Preferably, the gene encoding ceramidase may be a human alkaline ceramidase 1 gene (hACER1) represented by SEQ ID NO: 5, a human alkaline ceramidase 2 gene (hACER2) represented by SEQ ID NO: 6, a human alkaline ceramidase 3 gene (hACER3) represented by SEQ ID NO: 7, a mouse alkaline ceramidase 1 gene (mACER1) represented by SEQ ID NO: 8, an N-fragment deficient human alkaline ceramidase 2 gene (hACER2(N12?)) represented by SEQ ID NO: 9, or a Y. lipolytica ceramidase gene (YIYDC1) represented by SEQ ID NO: 10, but is not limited thereto.

[0036] Amino acid sequences of the human-derived alkaline ceramides hACER1, hACER2, and hACER3, as used herein, may be NCBI accession no. NP_597999.1, NCBI accession no. NP_001010887.2, and NCBI accession no. AAH73853.1, respectively, an amino acid sequence of mouse-derived ceramidase mACER1 may be NCBI accession no. NP_783858.1, and an amino acid sequence of Y. lipolytica-derived ceramidase YIYdc1 may be NCBI accession no. QNP97986.1, but are not limited thereto.

[0037] In addition, the present disclosure provides a method of secreting and producing dihydrosphingosine or sphingosine onto a cell surface, including culturing, in a medium, a Y. lipolytica mutant recombinant strain in which a gene encoding ceramidase is introduced into the Y. lipolytica mutant strain.

[0038] In addition, the present disclosure provides a Y. lipolytica mutant recombinant strain in which an SLD1 gene encoding ?8 desaturase is additionally deleted from a Y. lipolytica mutant strain, with enhanced secretion and production of sphingosine or human glucosylceramide onto the cell surface.

[0039] Preferably, the SLD1 gene encoding ?8 desaturase may be represented by SEQ ID NO: 12, but is not limited thereto. On the other hand, an amino acid sequence of an SLD1 protein may be represented by SEQ ID NO: 11.

[0040] Preferably, the human glucosylceramide may be, but is not limited to, glucosylceramide GlcCer(d18:1(4E)/16:0(2OH)).

[0041] More preferably, the Y. lipolytica mutant recombinant strain may be a strain (Yarrowia lipolytica sld14 sur24) deposited under Accession number KCTC 14980BP.

[0042] In addition, the present disclosure provides a method of secreting and producing sphingosine or human glucosylceramide onto a cell surface, including culturing, in a medium, a Y. lipolytica mutant recombinant strain in which an SLD1 gene encoding ?8 desaturase is additionally deleted from the Y. lipolytica mutant strain.

[0043] Furthermore, using the Y. lipolytica sur2 deficient strain or sld1 sur2 double deficient mutant strain prepared in the present disclosure as a parent strain, it is possible to prepare strains that mass-produce various forms of useful sphingosine-based substances through metabolic engineering.

[0044] Hereinafter, example embodiments will be described in detail to help the understanding of the present disclosure. However, the following example embodiments are merely illustrative of the content of the present disclosure, and the scope of the present disclosure is not limited by the following example embodiments. The example embodiments of the present disclosure are provided to more completely explain the present disclosure to those skilled in the art.

<Example 1> Preparation of Yarrowia lipolytica Sur2 Deficient Strain

[0045] 1-1. Preparation of Yarrowia lipolytica Ku70 Strain

[0046] In order to increase an efficiency of homologous recombination (HR)-based genetic manipulation in the Y. lipolytica strain, a mutant strain from which non-homologous end joining (NHEJ) is removed through KU70 gene disruption was produced first. Ku70 and Ku80 together form a Ku heterodimer and bind to the DNA double-stranded cleaved end, which is involved in the non-homologous end joining pathway of DNA repair. With the genome of the Y. lipolytica PO1f (MATA ura3-302 leu2-270 xpr2-322 axp2-deltaNU49 XPR2::SUC2) strain as a template, 5 portion of the KU70 gene was amplified by PCR using Ylku70dNfw and Ylku70dNrv primers listed in Table 1 as well as a promoter ?286 bp site and the open reading frame (ORF) 472 bp of the KU70 gene YALI0C08701g gene (SEQ ID NO: 2), the 3 portion of the KU70 gene was amplified by PCR using Ylku70dCfw and Ylku70dCrv as well as KU70 orf 1555 bp site fw and terminator 480 bp, and the N and C fragments were ligated through additional fusion PCR and introduced into pT-blunt vector to obtain a pTB-ku70dNC vector. Subsequently, the YIURA3 gene with the same specific sequence of 580 bp back and forth was introduced into the MluI site of the pTB-ku70dNC vector to obtain a pTB-ku70dNC-YIURA3 vector. Using pTB-ku70dNC-YIURA3 as a template, the N fragment was obtained using Ylku70dNfw and YIURA3Nrv primers listed in Table 1, the C fragment was obtained using YIURA3Cfw and Ylku70dCrv primers, and the fragments were transduced into the Y. lipolytica PO1f strain to prepare a Ylku70 disrupted strain through homologous recombination in cells (FIG. 2A). The exact disruption of the KU70 gene was detected by PCR after chromosome extraction (FIG. 2B). Subsequently, the Ylku70 deficient strain was cultured in YPD media including 1 mg/ml 5-FOA to recover the URA3 marker that was used for KU70 deletion, and the URA3 gene was induced to be removed (FIG. 2A).

1-2. Preparation of Sur2 Deficient Strain Using Yarrowia lipolytica Ku70 Strain

[0047] The inventors sought to discover a gene (SEQ ID NO: 4) encoding a protein that is 45.6% identical to a S. cerevisiae Sur2 protein in order to block a phytosphingosine biosynthesis pathway in Y. lipolytica, and to disrupt using homologous gene recombination. The Y. lipolytica Sur2 protein showed some structural differences from other yeasts. It had slightly fewer membranous domains than S. cerevisiae and slightly more membranous domains than P. ciferrii, and instead of having KKXX, an ER signal sequence at the C terminus, it had a polyampholyte and polar structure. However, the fatty acid hydroxylase domain was well conserved (FIG. 3A).

[0048] To prepare a Y. lipolytica SUR2 gene disruption cassette, after amplifying 5 portion of the SUR2 gene by PCR using Ylsur2dNfw and Ylsur2dNrv primers listed in Table 1 as well as the SUR2 promoter ?668 bp site and the open reading frame (ORF) 100 bp and amplifying 3 portion of the SUR2 gene by PCR using Ylsur2dCfw and Ylsur2dCrv as well as SUR2 orf 1,011 bp site fw and terminator 639 bp, and then ligating the 5 and 3 portions through fusion-PCR using the MluI-NheI-SalI portion possessed by both the 5 and 3 portions, the pTB-SUR2dNC vector was prepared by introducing into a pT blunt vector. Afterwards, the YILEU2 gene fragment was amplified by PCR and treated with NheI/SalI to ligate with the NheI/SalI-treated pTB-SUR2dNC vector and produce a pTB-SUR2d NC-YILEU2 vector. Afterwards, the cassette was prepared by treating the pTB-SUR2dNC-YILEU2 vector with SpeI/NsiI, and then the Y. lipolytica ku70 deficient strain prepared was transformed to produce the Y. lipolytica sur2 deficient strain (FIG. 3B).

[0049] The primers used in the present disclosure are listed in Table 1.

TABLE-US-00001 TABLE1 Descrip- Primer Sequence(5.fwdarw.3) tion ku70dNfw gagcggtttgctcgaaaccagt YlKU70 (SEQIDNO:13) dele- ku70dNrv tacagtcgacgcgtgggcgt tion atcgattatcgtcgtctgtgat atagatgattcg (SEQIDNO:14) ku70dCfw cgatacgcccacgcgtcgactg taaggctgagaagaaagtcaag ag (SEQIDNO:15) ku70dCrv gagcggtttgctcgaaaccag (SEQIDNO:16) URA3Nrv cagctcggccagcatgag (SEQIDNO:17) URA3Cfw ccaacctgtgtgcttctctgg (SEQIDNO:18) Ylsur2dNfw cgaccgaaaatgtgcaagcg YlSUR2 (SEQIDNO:19) dele- Ylsur2dNrv acgagctagccgcgcgacgcgt tion cgagtggtggaatggagtgttt g (SEQIDNO:20) Ylsur2dCfw gaacagtcgactggagcttcta cttccgagc (SEQIDNO:21) Ylsur2dCrv catgcgtcctctcctccacgat tc (SEQIDNO:22) LEU2fw cgcgcggctagctcgtcgcctg agtcatcatttat (SEQIDNO:23) LEU2rv gctccagtcgactgttcggaaa tcaacggatgctc (SEQIDNO:24) Scsur2dNfw tcaccccgcgtccttcttcggg ScSUR2 cagtcgcgcttttctccggctt dele- ctgcggaaattgaagctctaat tion ttgtgagtttag (SEQIDNO:25) Scsur2dCrv ctcatcagttttcgaagatttc aagaaagtccgaagaacattta agaccttttcaattcaattcat cattttttttttattctt (SEQIDNO:26) TEF1pfw ccggaattcagagaccgggttg hACER1 gcggcgt expres- (SEQIDNO:27) sion TEF1p(h1) tgcgaagatcgaaggcattttg rv aatgattcttatactcagaagg aaatgc (SEQIDNO:28) hACER1fw gagtataagaatcattcaaaat gccttcgatcttcgcataccaa tc (SEQIDNO:29) hACER1rv atcaccggcaaactatctgtct aacaatccttgtcatctccccg aa (SEQIDNO:30) XPR2t(h1) ggggagatgacaaggattgtta fw gacagatagtttgccggtgata attctctta (SEQIDNO:31) XPR2trv ctagtctagaggggggctagcc acgggcatctcacttgcgc (SEQIDNO:32) TEF1p(h2) caccaatgaggtgctcccattt hACER2 rv tgaatgattcttatactcagaa expres- ggaaatgc sion (SEQIDNO:33) hACER2fw gagtataagaatcattcaaaat gggagcacctcattggtgg (SEQIDNO:34) hACER2rv atcaccggcaaactatctgtct aggtaatcttaacgctgctctt tttgttag (SEQIDNO:35) XPR2t(h2) agagcagcgttaagattaccta fw gacagatagtttgccggtgata attctctta (SEQIDNO:36) TEF1p(h2?) cagtccacctcagacgacattt hACER2 rv tgaatgattcttatactcagaa (12?) ggaaatgc expres- (SEQIDNO:37) sion hACER2 gagtataagaatcattcaaaat (12?)fw gtcgtctgaggtggactgg (SEQIDNO:38) hACER2 caccggcaaactatctgtctag (12?)rv gtaatcttaacgctgctctttt tg (SEQIDNO:39) XPR2t(h2?) gagcagcgttaagattacctag fw acagatagtttgccggtgata attctctta (SEQIDNO:40) TEF1p(h3) cgatctgcggcgggggccattt hACER3 rv tgaatgattcttatactcagaa expres- ggaaatgc sion (SEQIDNO:41) hACER3fw gagtataagaatcattcaaaat ggcccccgccgcagatcg (SEQIDNO:42) hACER3rv atcaccggcaaactatctgtct agtgttttcgaagaggttcaaa gagaatc (SEQIDNO:43) XPR2t(h3) ctttgaacctcttcgaaaacac fw tagacagatagtttgccggtga taattctctta (SEQIDNO:44) TEF1p(m1) tccagggacgtgcattttgaat mACER1 rv gattcttatactcagaaggaaa expres- tgc sion (SEQIDNO:45) mACER1fw gagtataagaatcattcaaaat gcacgtccctggaacgag (SEQIDNO:46) mACER1rv atcaccggcaaactatctgtct aacagttcttatcattttcctg gatctc (SEQIDNO:47) XPR2t(m1) ggaaaatgataagaactgttag fw acagatagtttgccggtgataa ttctctta (SEQIDNO:48) TEF1p gggattcctccaggtagcattt YIYDC1 (YDC1)rv tgaatgattcttatactcagaa expres- ggaaatgcttaacg sion (SEQIDNO:49) YIYDC1fw gagtataagaatcattcaaaat gctacctggaggaatcccatac c (SEQIDNO:50) YIYDC1rv atcaccggcaaactatctgtct agttgtgatggttaacaga (SEQIDNO:51) XPR2t ctgttaaccatcacaactagac (YDC1)fw agatagtttgccggtgataatt ctcttaac (SEQIDNO:52) YISLD1dNfw atgcagacggataggtggtggg YISLD1 (SEQIDNO:53) dele- YISLD1dNrv ctcaagctggacaactggctcg tion atggtagctacttacgcgatcg tagggccagctg (SEQIDNO:54) YISLD1dCfw ccatcgatgaatgcgctagcat cccggtcgacgtgactgtgagc gacatcttcg (SEQIDNO:55) YISLD1dCrv cggctaaccagaaacggtccta tc (SEQIDNO:56) *Underlined: restriction enzyme

[0050] The strains produced in the present disclosure are listed in Table 2.

TABLE-US-00002 TABLE 2 Source/ Strain Description Reference Y. lipolytica PO1f MATA ura3-302 leu2-270 ATCC xpr2-322 axp2- MYA-2613 deltaNU49 XPR2::SUC2 Ylku70 ? MATA ura3-302 leu2-270 This study xpr2-322 axp2-deltaNU49 XPR2::SUC2 ku70:tc S. cerevisiae BY4742 MAT a his3A1 leu2A0 Open lys2A0 ura3A0 Biosystems Ylsur2 ? MATA ura3-302 leu2-270 This study xpr2-322 axp2-deltaNU49 XPR2::SUC2 ku70::tc sur 2::YlLEU2 Scsur2 ? MAT? his3A1 leu2A0 This study lys2A0 ura3A0 sur2::ScURA3 hACER1/Ylsur2 ? pIMR53-hACER1/Ylsur2? This study hACER2/Ylsur2 ? pIMR53-hACER2/Ylsur2? This study hACER2(12 ?)/Ylsur2 ? pIMR53-hACER2(12?)/Ylsur2? This study hACER3/Ylsur2 ? pIMR53-hACER3/Ylsur2? This study mACER1/Ylsur2 ? pIMR53-mACER1/Ylsur2? This study YlYDC1/Ylsur2 ? pIMR53-YlYDC1/Ylsur2? This study Ylsld1 ? MATA ura3-302 leu2-270 This study xpr2-322 axp2-deltaNU49 XPR2::SUC2 ku70::tc sld1::YIURA3 Ylsld1 ? sur2 ? MATA ura3-302 leu2-270 This study xpr2-322 axp2-deltaNU49 XPR2::SUC2 ku70::tc sur 2::YlLEU2 sld1::YlURA3

<Example 2> Analysis of Growth Features of Yarrowia lipolytica Sur2 Deficient Strain

[0051] In order to identify the growth pattern according to the carbon source type and medium composition of the Y. lipolytica sur2 deficient strain (Ylsur24) produced in Example 1, comparative analysis was conducted with Ylku704/PO1f, a parent strain of Ylsur24. The strain culture medium pre-cultured in 2 ml of YPD medium was inoculated with OD.sub.600=0.1 in 25 ml of YPD or GB medium and cultured in a mixed culture machine at 28? C. and 220 rpm, and the growth curve graph was obtained by measuring the OD.sub.600 value at regular intervals. As a result, compared to the WT strain, which showed the highest value of OD.sub.600 at about 36 hours of YPD culture, the Ylsur2 deficient strain showed the highest OD.sub.600 value at 72 hour, which is about twice as long. In other words, it was determined that the growth pattern of the Ylsur2 deficient strain had a long lag phase and logarithmic growth phase, thereby taking a relatively long time to reach the stationary phase. In addition, it was found that when cultured in the GB medium including 8% glycerol rather than glucose as a carbon source, the time to reach the plateau was shortened, overcoming the growth difference with wild-type strains to some extent (FIG. 4A).

[0052] In addition, micrographs obtained by culturing in YPD medium for 24 hours showed that the Ylsur2 deficient strain grew in the hyphae form at a much higher proportion than the parent strain (FIG. 4B).

[0053] In order to investigate the weak portions of the intracellular structure of the Y lipolytica sur2 deficient strain, the growth patterns were identified under various YPD medium conditions including inducers of temperature stress)(30?39? C.), cell wall and osmotic stress (NaCl, SDS, CFW (=Fluorescent Brightener 28), caffeine), and antibiotics. As a result of smearing onto the YPD plate and grown for 4 days, it was found that the Ylsur2 deficient strain seemed to become very sensitive to temperature, as its growth was stunted from 30? C. and barely grew above 33? C. In addition, it was found that it became highly sensitive to osmotic pressure and cell wall stress, and growth was reduced even under medium conditions including hygromycin B, a protein synthesis inhibitor. This is thought to be the result of the weakening of cell membranes due to abnormal production of sphingolipids, making the cell wall vulnerable to various stresses and also having antibiotic substances easily penetrate into the cell. However, resistance was also shown in some media including caffeine, one of the cell wall stress conditions, and zeocin, an inducer of DNA double-strand separation (FIG. 4C).

<Example 3> Identification of Secretion and Production of Dihydrosphingosine of Y. lipolytica Sur2 Deficient Strain onto Cell Surface by TLC Analysis

[0054] Due to hydrophobicity, sphingolipid components are clustered on the surface of the cell rather than being secreted out of the medium. Therefore, in order to collect the sphingolipids clustered on the cell surface, cell pellets were collected after culture, 10 ml of methanol was added per 1 g, and sonication was performed for 30 minutes. Afterwards, the sample dissolved in 10 ml of methanol was concentrated 10 times to 1 ml through drying, and the final cell surface sample was obtained. For the cell culture medium (supernatant) sample, the supernatant separated by centrifugation of the strain culture medium was mixed with the same amount of chloroform:methanol (2:1, v/v), and the centrifuged lower layer was used. In the case of cytosol samples, the remaining cell pellets were released in chloroform:methanol:water (20:10:1, v/v) after collecting the cell surface sample, and the cells were disrupted with a beadbeater, lyophilized, and dissolved in methanol. All samples were prepared by drying in the same way and concentrating with 1 ml of methanol.

[0055] Samples extracted from TLC silica gel 60 plates were dropped by 10 ul each and developed using a non-polar solvent consisting of chloroform:methanol:ammonia water (18:2:1). After development, the copper sulfate (CuSO4) detection method was used to analyze the overall lipid changes, and the ninhydrin solution was used to identify the sphingoid bases, among which dihydrosphingosine (FIG. 5A). After development, the completely dried TLC plate was soaked in a solution of copper sulfate and ninhydrin and then completely dried and burned at 200? C. for detection. The detection solution used was dissolved in 8% sulfuric acid in case of 10% copper sulfate, and 0.2% ninhydrin was dissolved in ethanol. For comparison, it was developed together with sphingosine, dihydrosphingosine, and phytosphingosine standard products.

[0056] As a result of TLC analysis using copper sulfate detection method, it was possible to detect dihydrosphingosine in all cell surface, culture supernatant, and cytosol samples of Ylsur2 deficient strains. This may be interpreted as the accumulation of dihydrosphingosine due to deletion in the SUR2 gene, which is responsible for phytosphingosine synthesis, and the fact that dihydrosphingosine is detected not only in cytosol but also in cell surface and culture supernatant samples indicates that it may be secreted by means of lipid droplets (FIG. 5B).

[0057] In this experiment, in order to identify only the pure sphingoid base, also used was a ninhydrin detection method that may react with the amino group (NH.sub.2) on serine, which is the basic backbone of sphingolipids. Through the result that the dihydrosphingosine band identified by the copper sulfate detection method was also determined by the ninhydrin detection method, it was redetermined that the substance is the spingoid base itself, that is, dihydrosphingosine with no substance attached to the amino group (NH.sub.2) of sphingolipid (FIG. 5C). From these results, it may be inferred that dihydrosphingosine accumulates in the Y. lipolytica sur2 deficient strain, and a large amount thereof is secreted to the cell surface and medium.

[0058] In order to determine that the secretion and production of dihydrosphingosine in Y. lipolytica sur2 deficient strains is a unique phenomenon of this strain unlike other yeasts, the efficiencies in secretion of dihydrosphingosine onto cell surfaces of Saccharomyces cerevisiae and Y. lipolytica were compared and analyzed. The sample extraction method and TLC analysis method are the same as in Example 3, and ninhydrin solution was used for detection. As a result of TLC analysis, no dihydrosphingosine was found on the cell surface and culture supernatant of the S. cerevisiae sur2 deficient strain, indicating that dihydrosphingosine is secreted and produced specifically in the Y. lipolytica sur2 deficient strain (FIG. 5D).

<Example 4> Determination of Secretion and Production of Dihydrosphingosine in Y. lipolytica Sur2 Deficient Strain Through HPLC and LC/MS/MS Analysis

[0059] HPLC analysis was performed using the cell surface sphingolipid sample used in Example 3. As a result of analyzing the Cosmosil packed column 5C18-PAQ, 4.1ID x 250 mm column (40? C.) and MeOH:water:ammonia (80:19.5:0.5) mobile phase at a rate of 0.5 ml/min with a 210 mM UV detector, the bands were detected in the Y. lipolytica sur2 deficient strain at the same location as the dihydrosphingosine standard product (FIG. 6A). On the other hand, the results of LC/MS/MS analysis also showed that the substance produced in the Y. lipolytica sur2 deficient strain is identical to the dihydrosphingosine standard product (FIG. 6B and FIG. 6C).

[0060] Therefore, the dihydrosphingosine-secreting and producing yeast strain developed in the present disclosure is expected to be used as a host for the cell surface mass production of sphingolipids, which is emerging as an effective alternative to complex intracellular extraction methods in terms of productivity and simplicity in separation and purification.

<Example 5> Identification of Glucosylceramide and Inositol Sphingolipid Biosynthesis in Y. lipolytica Sur2 Deficient Strain by TLC Analysis

[0061] In order to analyze the overall changed lipid components in the Y. lipolytica sur2 deficient strain, it was intended to identify glucosylceramide and inositol sphingolipid, which are substances at the final stage of the sphingolipid synthesis pathway. Sample preparation was the same as in Example 3, and TLC analysis was performed. In order to detect glucosylceramide, the component of the development solvent was changed, development was performed with chloroform:methanol:acetic acid:water (20:3.5:2.5:0.7, v/v), and after moistening in the detection solution, drying was performed completely, followed by a reaction at 80? ? C. The detection solution is dissolved in 0.1 g of orcinol per 45 ml of sulfuric acid:water:ethanol (5:13:27), which is one of the detection methods used to identify glycosides and glycolipids in TLC analysis, and it reacts with glucose in glucosylceramide and appears as a purple band on the TLC plate. For comparison, GlcCer(d18:1(4E)/16:0) and GlcCer (d18:2(4E,8E)/16:0(2OH)) were used for the standard products.

[0062] As a result of TLC analysis, a band consistent with the GlcCer(d18:2(4E,8E)/16:0(2OH)) standard product appeared in the cell surface samples of the wild-type Y. lipolytica strain and the sur2 deficient strain, and the bands were slightly darkened in the Ylsur2 deficient strain. In addition, bands were shown only in the Ylsur2 deficient strain at a position similar to that of the GlcCer (d18:1(4E)/16:0) standard product (FIG. 7A).

[0063] As a result of performing LC/MS analysis using the cell surface samples with the amount highest of glucosylceramide identified, highest amount of GlcCer(d18:2(4E,8E)(9Me)/16:0(2OH)) was present in both the wild-type strain and the Y. lipolytica sur2 deficient strain, with approximately a threefold increase in the Ylsur2 deficient strain. In addition, GlcCer(d18:2(4E)/16:0(2OH)), which was identified in both WT and Ylsur2 deficient strains, it was found that very small amounts exist compared to GlcCer(d18:2(4E,8E)(9Me)/16:0(2OH)). The bands consistent with the GlcCer(d18:1(4E)/16:0) standard product identified in FIG. 7A were too small to be determined by LC/MS analysis (FIG. 7A and FIG. 7B).

[0064] Next, an additional TLC analysis was performed to identify inositol sphingolipid, another final sphingolipid present in Y. lipolytica. Sample preparation and TLC analysis methods were based on S. Tanaka and M. Tani. (2018). The cell pellets of the strains cultured for 8 hours in YPD were recovered and reacted with 350 ul of ethanol/water/diethyl ether/pyridine/15 M ammonia (15:15:5:1:0.018, v/v) at 65? C. for 15 minutes, and then the supernatant was separated, thoroughly dried, and then reacted using 130 ul of monomethylamine (40% in methanol)/water (10:3, v/v) at 53? C. for 1 hour to remove unnecessary phospholipids. The well-dried samples were then prepared by dissolving in 60 ul of chloroform/methanol/water (5:4:1, v/v). Samples extracted from wild-type strains and Ylsur2 deficient strains were dropped into TLC silica gel 60 plates by 15 ul and developed using a solvent consisting of chloroform:methanol:4.2M ammonia (9:7:2, v/v). For comparison, the wild-type S. cerevisiae strain (BY4742) used in the referenced paper was analyzed together. After deployment, copper sulfate (CuSO4) detection method was used for identification, and the differentiation of IPC, MIPC, and M(IP)2C was inferred from the analysis results of the Saccharomyces cerevisiae strain. As a result of TLC analysis, the wild-type Y. lipolytica strain was mainly identified as B type (t18:0/24:0) with phytosphingosine base as the basic backbone or C type (t18:0/24:0(2OH)) with a hydroxyl group attached to the fat chain, while the A type (d18:0/24:0) with the dihydrosphingosine base and the B type (d18:0/24:0(2OH)) with the hydroxyl group attached to the fat chain were also slightly detected since phytosphingosine is not produced at all in the case of the Y. lipolytica sur2 deficient strain (FIG. 7C).

[0065] Therefore, based on the TLC and LC/MS results of cell surface samples, the sphingolipid biosynthesis pathway of wild-type Y. lipolytica and sur2 deficient strains is summarized as follows (FIG. 8).

[0066] In the case of the wild-type Y. lipolytica strain, most of the inositol sphingolipids are synthesized while having phytoceramides as the backbone, and all types of IPC and MIPC (t18:0/24:0 (20H), C type) have been found in the LC/MS results, suggesting that most of them have a structure with a hydroxyl group (OH) attached to the fatty acid chain due to Scs7. In addition, it was determined that glucosylceramide is secreted onto a cell surface in a relatively larger amount than inositol sphingolipid, and dihydrosphingosine is synthesized as the basic backbone. Afterwards, A4 desaturase (Des1), ?-hydroxylase (Scs7), A8 desaturase (Sld1), and C9 methyltransferase (Mts1) may act to synthesize ceramides of various structures. Finally, glucosylceramide is synthesized by glucosylceramide synthase (Hsx11), and the GlcCer (d18:2(4E,8E)(9Me)/16:0(2OH)) structure produced by the action of all the aforementioned enzymes is present in the highest proportion (FIG. 8A).

[0067] On the other hand, in the case of the Y. lipolytica sur2 deficient strain, it may be seen that the deletion of the SUR2 gene, which is responsible for the synthesis of phytosphingosine, would lead to synthesis of MIPC (d18:0/24:0, A type) with dihydrosphingosine as the backbone. On the other hand, considering that a large amount of glucosylceramide is secreted onto the cell surface compared to wild-type strains, it may be inferred that a large amount of dihydrosphingosine is accumulated due to the deletion of the SUR2 gene, and thus the synthesis of glucosylceramide having the same as the basic backbone also increases (FIG. 8B).

<Example 6> Amplification of Sphingosine Biosynthesis Through Overexpression of Ceramidase Genes in Y. lipolytica Sur2 Deficient Strain

[0068] In the Y. lipolytica sur2 deficient strain, the ceramidase gene derived from humans and mice was additionally expressed to amplify sphingosine biosynthesis from ceramide (FIG. 9A). The genes encoding three types of human-derived alkaline ceramides ACER1, ACER2, and ACER3 and the mouse-derived ceramidase ACER1, which are known to produce sphingosine from ceramides, were synthesized through codon optimization in Y. lipolytica. The human-derived alkaline ceramidase genes hACER1 (SEQ ID NO: 5), hACER2 (SEQ ID NO: 6), and hACER3 (SEQ ID NO: 7), the mouse-derived ceramidase gene mACER1 (SEQ ID NO: 8), the human-derived alkaline ceramidase 2 gene hACER2 (N12?) (SEQ ID NO: 9) having 12 amino acids removed from the N terminal to induce expression of endoplasmic reticulum, and the DNA fragment having information on the ceramidase gene YIYDC1 (SEQ ID NO: 10) derived from Y. lipolytica were prepared by ligating via PCR and fusion PCR with TEF/promoter and XPR2 terminator using the primers listed in Table 1, and then introduced into the pIMR53 CEN vector to prepare pIMR53-hACER1, pIMR53-hACER2, pIMR53-hACER2(124), pIMR53-hACER3, pIMR53-mACER1, and pIMR53-YIYDC.

[0069] Each vector was introduced into the Ylsur2 deficient strain to produce hACER1 Ylsur2 ?, hACER2 Ylsur2 ?, hACER2(N12?)/Ylsur2 ?, hACER3/Ylsur2 ?, mACER2/Ylsur2 ?, and YIYDC1/Ylsur2 ? strains (Table 2). Each strain was treated with methanol to be 10 ml/g in pellet samples cultured in SC-U medium for 4 days, and the supernatant obtained by centrifugation was subjected to sonication for 30 minutes to be used for TLC analysis. As a result, the production of dihydrosphingosine as well as sphingosine increased in all strains that were introduced with ceramidase (FIG. 9B). However, TLC for analyzing glucosylceramide showed a decrease in glucosylceramide only in the YIYDC1/Ylsur2 ? strain (FIG. 9C). Although the accumulation of sphingoid precursors is not more dominant in the Y. lipolytica ceramidase overexpressing strains than other ceramidase overexpressing strains, analysis indicates that the ability to decompose ceramides to produce sphingosine and dihydrosphingosine is more predominant.

<Example 7> Preparation of Yarrowia lipolytica Sld1 Deficient Strain and Analysis of Growth Features

[0070] In order to amplify the sphingosine biosynthesis pathway in the Y. lipolytica sur2 deficient strain, the SLD1 gene (SEQ ID NO: 12) encoding the A8 desaturase protein was intended to be additionally disrupted using homologous gene recombinant techniques. The Y. lipolytica Sld1 protein showed slight structural differences, with low complexity and coiled coil structures, unlike Candida albicans and Pichia pastoris. However, cytochrome B5-like heme/steroid binding, fatty acid desaturase, histidine box, and membrane domains were well conserved (FIG. 10A).

[0071] To prepare the Y. lipolytica SLD1 gene disruption cassette, the 5 portion of the SLD1 gene including the SLD1 promoter ?869 bp site and the open reading frame (ORF) 152 bp were amplified by PCR, the 3 portion of the SLD1 gene including the ORF 1,582 bp site and the terminator 955 bp were amplified by PCR, and the 5 and 3 portions were ligated by fusion-PCR using the ClaI-NheI-SalI portion which is possessed both by 5 and 3 portions, and then introduced into the pT blunt vector to prepare a pTB-SLD1dNC vector. The YIURA3 gene fragment was then amplified by PCR, treated with ClaI/NheI, and ligated to the ClaI/NheI-treated pTB-SLD1dNC vector to prepare a pTB-SLD1dNC-YIURA3(TcR) vector. Afterwards, the cassette was prepared by treating the pTB-SLD1dNC-YIURA3 (TcR) vector with HindIII/NsiI, and the prepared wild-type Y. lipolytica strain and sur2 deficient strain were transformed to produce the Y. lipolytica sld1 deficient strain (Ylsld1?) and sld1 sur2 double deficient strain (Ylsld1 ? sur2?) (FIG. 10B).

[0072] To investigate the growth features of the Y. lipolytica sld1 deficient strain, it was cultured under YPD medium conditions including inducers of temperature stress (20?35? C.) and osmotic stress (NaCl, Sorbitol, KCl), inducers of ER stress (Tunicamycin, DTT), and inducers of cell wall stress (Caffeine, SDS, CFW, Congo red, Hygromycin B). As a result of growing for 3 days after dropping onto YPD plates, it was observed that the Ylsld1 deficient strain showed slightly reduced growth even under normal culture conditions and even more stunted growth under temperature stress conditions compared to wild-type strains. In addition, the Ylsld1 deficient strain showed increased susceptibility to Congo red and hygromycin B, which cause cell wall stress, but was also resistant to caffeine-containing media. This feature is considered to be the result of the weakening of cell membranes due to abnormal production of sphingolipids, making the cell wall vulnerable to various stresses to allow antibiotic substances with large molecular weights to easily penetrate into the cells. In contrast, the Ylsld1 sur2 double deficient strain showed a slight recovery in growth compared to the Ylsur2 deficient strain and increased resistance under the stress condition medium. However, further increased sensitivity was shown in some media including KCl and hygromycin B. This is thought to be the result in that the instability caused by the structural changes in the cell membrane due to excessive accumulation of dihydrosphingosine with the deletion of SUR2 was somewhat stabilized by the additional SLD1 deletion to recover the growth (FIG. 10C).

<Example 8> Identification of Secretion and Production of Sphingosine and Glucosylceramide of Yarrowia lipolytica Sld1 Deficient Strain onto Cell Surface Through TLC and LC/MS Analysis

[0073] In order to analyze the overall changed lipid components in the Y. lipolytica sld1 deficient strain and the sld1 sur2 double deficient strain, it was intended to identify pure sphingoid bases and glucosylceramides, which are substances at the final stage of the sphingolipid synthesis pathway. Sample preparation was the same as in Example 3, and TLC analysis was performed. As a result of TLC analysis, compared to the Y. lipolytica sur2 deficient strain (Ylsur2 ?), productivity of dihydrosphingosine was reduced in the Y. lipolytica sld1 sur2 double deficient strain (Ylsld1 ? sur2?) (FIG. 11A). In addition, compared to the Ylsur2 deficient strain, productivity of the final form of glucosylceramide GlcCer(d18:2(4E,8E)9Me/16:0(2OH)) was reduced, and a new type of glucosylceramide bands (red arrows) were generated. The new glucosylceramide has a more similar structure to the human glucosylceramide because it lacks the C8 double band and the C9 methylation formula (FIG. 11B).

[0074] For further analysis, as a result of performing LC/MS analysis, it was found that production of sphingadiene (Sd) of the Y. lipolytica sld1 sur2 double deficient strain was blocked, productivity of sphingosine (So) was increased by the decreased amount of sphingadiene, and the amount of dihydrosphingosine was also reduced compared to the sur2 deficient strain. In addition, both the Y. lipolytica sld1 deficient strain and the sld1 sur2 double deficient strain showed a decrease in the amount of glucosylceramide GlcCer (d18:2(4E, 8E)9Me/16:0(2OH)) compared to the control wild-type strain and the Ylsur2 deficient strain, respectively, and an increase in the productivity of glucosylceramide GlcCe (d18:1(4E)/16:0(2OH)) using ceramide from which the C8 double bond generation process by Sld1 and C9 methylation process by Mts1 were omitted, instead (FIG. 11C).

[0075] Therefore, based on the TLC and LC/MS results of cell surface samples, the sphinglipid biosynthesis pathway of the Ylsld1 ? sur2 ? strain is summarized as follows (FIG. 11D). In the case of dihydrosphingosine that was increased by the deletion of SUR2, it may be seen that an amount of dihydrosphingosine was slightly reduced due to the increase in the ceramide metabolism pathway based on the sphingosine backbone due to the additional deletion of SLD1, and sphingosine was increased as the production pathway for sphingadiene was blocked. In addition, by blocking the formation of a double bond in the eighth sphingosine in the sphingolipid, the amount of the conventional glucosylceramide GlcCer (d18:2(4E, 8E)/16:0(2OH)) was reduced, and a new form of glucosylceramide GlcCer (d18:1(4E)/16:0(2OH)), which has a structure closer to human, was produced as the main glucosylceramide (FIG. 11D). This suggests that the Y. lipolytica SLD1 gene deletion does not completely block the pathway of glucosylceramide production from the ceramide, but rather that glucose may be attached through a different bypass pathway, resulting in the production of finally restructured glucosylceramide.

[0076] Having described in detail the specific part of the present disclosure above, it will be apparent to those skilled in the art that the specific description is merely preferred example embodiments and the scope of the present disclosure is not limited thereby. Accordingly, the substantial scope of the present disclosure will be defined by the appended claims and their equivalents.