HYBRIDOMA CELL LINE FOR SECRETING ANTI-RABIES VIRUS M PROTEIN MONOCLONAL ANTIBODY AND APPLICATION THEREOF

Abstract

The present invention discloses a hybridoma cell line for secreting monoclonal antibody against rabies virus M protein and application thereof, relates to the field of biotechnology. A classification of the hybridoma cell line is named as hybridoma cell line 4A1, and the hybridoma cell line was deposited on Apr. 1, 2019 in the China Center for Type Culture Collection, Wuhan University, Wuhan, China, with a deposit number CCTCC NO: C201947. The monoclonal antibody prepared by the hybridoma cell line has high titer, good specificity and excellent biological characteristics. The present invention identifies the variant antigen epitope recognized by the RABV M protein, the hybridoma cell line can be used to distinguish Flury strain and other RABV strains, prepare kit for detecting rabies virus RABV, detect RABV infection and differential diagnosis vaccine Flury strain and other RABV strains.

Claims

1. A hybridoma cell line for secreting monoclonal antibody against rabies virus M protein, wherein, a classification of a hybridoma cell line is named as hybridoma cell line 4A1 with a deposit number of the hybridoma cell line CCTCC NO: C201947.

2. A use of the hybridoma cell line according to claim 1 for preparing a kit for detecting rabies virus.

3. A monoclonal antibody to rabies virus M protein, wherein, the monoclonal antibody is prepared from the hybridoma cell line according to claim 1.

4. The monoclonal antibody to rabies virus M protein according to claim 3, wherein, an amino acid sequence of the rabies virus epitope recognized by the monoclonal antibody is shown in SEQ ID NO. 1 and SEQ ID NO. 2.

5. A use of the monoclonal antibody according to claim 3 for preparing a kit for detecting rabies virus.

6. A kit for detecting rabies virus, comprising the monoclonal antibody to rabies virus M protein according to claim 3.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0016] FIG. 1 shows specificity of the monoclonal antibody.

[0017] FIG. 2 shows a comparison of the epitopes recognized by the monoclonal antibody in different RABV strains.

[0018] FIG. 3 shows a reactivity of the monoclonal antibody with different strains.

[0019] FIG. 4 shows a reactivity of the monoclonal antibody with different mutant epitopes.

[0020] FIG. 5 shows an immunohistochemistry reaction of a monoclonal antibody.

DETAILED DESCRIPTION OF THE INVENTION

[0021] In the following, the present invention will be further described in conjunction with the embodiments.

Embodiment 1

(First) Establishment of a Hybridoma Cell Line Secreting a Monoclonal Antibody

1. Prokaryotic Expression and Purification of CVS-11 M Protein

[0022] Specific primers were designed based on the nucleotide sequence of the gene encoding M protein (sequence number: ADJ29910.1) of the CVS-11 (Liu Juan, et al. BECN1-dependent CASP2 incomplete autophagy induction by binding to rabies virus phosphoprotein. Autophagy, 2017, 13(4):739-753) strain registered in GenBank. Using the extracted viral RNA reverse transcription product as a template, the M gene of RABV was amplified, and then the M gene was cloned into the pET-28a(+) vector. After the correct sequencing was verified, the competent cell E. coli BL21 (DE3) was transformed, and the recombinant M protein was purified with a Ni-NTA column (purchased from QiAGEN) after induction with IPTG (1 mM) at 37? C. for about 5 hours. The expression and purification of recombinant M protein were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot.

2. Animal Immunization

[0023] Using the above purified M protein as an immunogen, female BALB/c mice aged 6?8 weeks (purchased from Shanghai Xipuer-Bikai Experimental Animal Co., Ltd.) were injected subcutaneously into the back of the mice with dose of 100 ?g recombinant M protein per mouse. For the first immunization, an equal volume of Freund's adjuvant complete (purchased from Sigma) was used to emulsify the antigen, and then every 14 days, Freund's adjuvant incomplete (purchased from Sigma) was used to emulsify the antigen for two booster immunizations. One week after the third immunization, blood was collected from the tail and the serum antibody titer was determined. Mice with serum antibody titer>10.sup.6 were selected and re-boosted the immunization (200 ?g/mouse) by intraperitoneal injection of antigen without adjuvant 3 days before cell fusion.

3. Cell Fusion

[0024] Using a method of PEG cell fusion. Myeloma cells SP2/0 and BALB/c mouse spleen cells that have been immunized were fully mixed at a ratio of 1:10, and then 1 mL 50% PEG-4000 (purchased from Sigma) preheated to 37? C. was added within 1 min, then it was shaken gently while adding, and then it was allowed to stand for 1 min. Serum-free RPMI-1640 (purchased from Hyclone) medium preheated to 37? C. was added along the tube wall to terminate the fusion reaction. It was required to add 4 mL in the first minute, add 1 mL in the first 30 seconds, and 3 mL in the next 30 seconds; add 11 mL in the second minute, and add to the total volume of 40 mL in the last 3 minutes. After centrifugation at 1000 rpm for 5 min, the supernatant was discarded, and then 30 ml RPMI-1640 incomplete medium was added along the tube wall. The supernatant was centrifuged and discarded again to remove the residual fusion agent PEG as much as possible. A 40 mL of complete medium containing HAT (purchased from Sigma) and 10% FBS (purchased from Gibco) pre-warmed to 37? C. were added along the wall of the 50 mL centrifuge tube, and pipette gently to resuspend the cells. Then the resuspended cells were transferred to a 10 cm cell culture dish, the mixed cells were inoculated at 100 ?L/well into a 96-well cell culture plate with feeder cells, and then the cell culture plate was placed in a cell culture box (purchased from Thermo) at 37? C. and 5% CO.sub.2 for static culture. After 5 days, RPMI-1640 (purchased from Hyclone) medium containing HT (purchased from Sigma) and 10% FBS (purchased from Gibco) was used, and after 10 days, RPMI-1640 medium (purchased from Hyclone) containing 10% FBS (purchased from Gibco). When the fused cells grow to 1/10-? of the bottom of the 96-well plate, the culture supernatant was taken to detect the antibody.

4. Screening of Hybridoma Cells

[0025] The purified M protein was diluted with 0.05 mol/L carbonate buffer (pH 9.6), then an ELISA plate (100 ?L/well) was wrapped with 0.02 mg/mL M protein, and then wrapped at 4? C. overnight (not less than 12 hours), washed with PBST solution 3 times, 5 minutes each time, and dried after the third time. The ELISA plate was blocked with PBS containing 10% skimmed milk powder (200 ?L/well), placed at 37? C. for 1 hour, washed with PBST solution 3 times, 5 minutes each time, and dried after the third time. The supernatant of 14 days after fusion, positive serum of 1:1000 dilution immunized mice and negative serum of 1:1000 dilution immunized mice were added into the corresponding well (100 ?L/well), treated at 37? C. for 1 hour, washed with PBST for 3 times, 5 min each time, and dried after the third time. A 1:10000 diluted horseradish peroxidase (HRP) labeled goat anti-mouse IgG (purchased from KPL) skimmed milk powder was added (100 ?L/well), treated at 37? C. for 1 hour, washed with PBST for 3 times, 5 min each time, and dried after the third time. A substrate TMB-H.sub.2O.sub.2 (100 ?L/well) was added, treated at 37? C. and protected from light for 10 min, and 50 ?L sulfuric acid (2 mol/L) was added to each well to stop the reaction. The microplate reader was zeroed with a blank control, and the OD450 nm value of each well was measured, where P was the OD450 nm value of the sample in the well to be tested, and N was the OD450 nm value of the negative reference serum, so that N?0.1, the ratio of the OD450 nm value of the positive reference serum to the OD450 nm value of the negative reference serum is ?2.1, that is, under the premise that the negative and positive controls were established, the test well with P/N?2.1 was judged as positive, the test well with 2.1>P/N?1.5 was judged as suspicious, and the test well with P/N<1.5 was judged as negative. Finally, the test was repeated after 3 days, and the hybridoma cell lines with positive test results for both times were selected for cloning.

5. Cloning of Hybridoma Cells

[0026] First, the live cells in the positive wells were stained and counted with trypan blue, and then diluted with RPMI-1640 medium (purchased from Hyclone) containing 10% FBS (purchased from Gibco) into 100 cells/10 mL medium cells suspension, and then the diluted cell suspension was added to a 96-well cell culture plate (100 ?L/well) covered with feeder cells and placed at 37? C. with 5% CO.sub.2 incubator. Observing the formation of cloned cells every day under an optical microscope, at the same time recording the growth of a single clone, and taking the cell supernatant for ELISA detection when the cells grow to 1/10-? of the bottom of the 96-well plate. The monoclonal cells with positive test results were selected and cloned again, until the supernatant of all cell wells from single cloned cell were positive, the wells with the largest OD450 nm value were selected for expansion and culture. Finally, 12 strains hybridoma cells stably secreting RABV-specific monoclonal antibodies were screened from the hybridoma cell bank.

6. Preparing of RABV Monoclonal Antibody

[0027] Female BALB/c mice (purchased from Shanghai Xipuer-Bikai Experimental Animal Co., Ltd.) at the age of 6-8 weeks were intraperitoneally injected with 0.5 ml/mouse sterilized liquid paraffin. After 7 days, the hybridoma cell line (0.5 mL/mouse, containing 2?10.sup.6?5?10.sup.6 hybridoma cells) was injected into the abdominal cavity of the mice. Then after 7-10 days, the abdomen of the mice with obvious bulge was taken to centrifuge at 5000 rpm for 10 min and the supernatant was collected as RABV monoclonal antibody and stored at ?20? C.

(Second) Biological Characteristics of Monoclonal Antibody 4A1

(2) Biological Characteristics of Monoclonal Antibody 4A1

Biological Collection of Monoclonal Antibody 4A1

[0028] Hybridoma cell line 4A1 was deposited in the China Type Culture Collection on Apr. 1, 2019, address: Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: C201947. The classification designation: Hybridoma cell line 4A1.

1. Determination of the Type of Monoclonal Antibody

[0029] The subclass determination was performed using the operating instructions of the monoclonal antibody subclass identification kit (purchased from Thermo). The results showed that the subtype of monoclonal antibody 4A1 was IgG2b?.

2. Determination of Titer and Stability of Monoclonal Antibodies

[0030] The hybridoma cell line 4A1 for secreting monoclonal antibody was continuously cultured and passaged 20 times, cryopreserved in liquid nitrogen and resuscitated. The purified prokaryotic expression of RABV M protein was used as a detection antigen. The indirect ELISA method was used to continuously detect the titer of monoclonal antibody 4A1. The results showed that the ELISA titer of the antibody secreted by hybridoma cells of each generation was basically the same, reaching 10.sup.3-10.sup.4.

3. Specific Identification of Monoclonal Antibodies

[0031] Indirect immunofluorescence test was used to verify the reactivity of monoclonal antibody 4A1 with RABV. BHK-21 cells (purchased from ATCC) were infected with CVS-11 strain, the cell culture medium was sucked and discard after culturing for 48 hours, and ?20? C. pre-cooled methanol-acetone (1:1) fixative, 200 uL/well was added. After 15 minutes of fixation at ?20? C., the fixed solution was discarded, washed with PBS for 3 times, and then dried. Then adding 5% skimmed milk powder (200 uL/well), blocking at 37? C. for 1 hour, washing again with PBST 3 times, then adding monoclonal antibody 4A1 (1:500), incubating at 37? C. for 1 hour, and washing again with PBS 3 times, patting dry and then adding 1:500 diluted FITC-labeled goat anti-mouse IgG antibody (purchased from KPL), incubating at 37? C. for 1 hour, washing 3 times with PBS, and patting dry. Furthermore adding 50 uL of PBS to each well and placing under a fluorescence microscope for observation. The results showed that monoclonal antibody 4A1 produced green fluorescence after reacting with CVS-11 infected BHK-21 cells. While monoclonal antibody 4A1 did not produce green fluorescence after reacting with BHK-21 cells uninfected with CVS-11 strain (see FIG. 1).

4. Identification of Epitopes Recognized by Monoclonal Antibodies

[0032] The 609 bp sequence (aa1-aa203) of the M protein gene was divided into overlapping fragments, and primers were designed (Table 1). Hind III/Kpn I restriction sites were introduced into upstream and downstream respectively. The amplified and purified target fragment was cloned into the expression vector pET-28a (+) to construct a recombinant plasmid. After that, the competent cell E. coli BL21 (DE3) was transformed, and the recombinant His tag polypeptide and monoclonal antibody were confirmed by Western blot. The positive segment was gradually truncated and expressed to complete the preliminary positioning of the antigen epitope. In order to accurately identify the epitope, primers were designed gradually from the N-terminus and C-terminus of the preliminarily positioned peptides in units of 1 amino acid residue, and BamH I/Xho I restriction sites were introduced upstream and downstream respectively (Table 2). The target fragment was obtained by annealing the upstream and downstream primers, and the target fragment was cloned into the expression vector pGEX-4T-1 to construct a recombinant plasmid, and transformed into competent cells E. coli BL21 (DE3). Western blot was used to detect the reactivity of the induced recombinant GST polypeptide with the monoclonal antibody, and the epitope recognized by the monoclonal antibody was determined to be .sup.25PPYDDD.sup.30 (SEQ ID NO. 1).

TABLE-US-00001 TABLE1 Primersforconfirmationofthelocationofthe epitopesrecognizedbythemonoclonalantibodies Amino acid Primer position name Primersequence(5-3) 1-203 aa MF ggggtaccatgaacgttctacgcaagat(HindIII)(SEQIDNO.4) MR cccaagcttttattctagaagcagagaagag(KpnI)(SEQIDNO.5) 1-107 aa M-BW1F/MF ggggtaccatgaacgttctacgcaagat(HindIII)(SEQIDNO.6) M-BW1R cccaagcttaggtactggagctcctgataaa(KpnI)(SEQIDNO.7) 101-203 aa M-BW2FF ggggtaccttatcaggagctccagtacct(HindIII)(SEQIDNO.8) M-BW2R/MR cccaagcttttattctagaagcagagaagag(KpnI)(SEQIDNO.9) 1-32 aa M-BW3F/MF ggggtaccatgaacgttctacgcaagata(HindIII)(SEQIDNO.10) M-BW3R cccaagcttccacaggtcatcgtcatacgg(KpnI)(SEQIDNO.11) 26-36 aa M-BW4F ggggtaccccgtatgacgatgacctgtggettccacctcct(HindIII) (SEQIDNO.12) M-BW4R cccaagcttaggaggtggaagccacaggtcatcgtcatacgg(KpnI) (SEQIDNO.13) 33-203 aa M-BW5F ggggtacctgacctgtggcttccacctc(HindIII)(SEQIDNO.14) M-BW5R/MR cccaagcttttattctagaagcagagaagag(KpnI)(SEQIDNO.15) 1-17 aa M-BW3.1F/M ggggtaccatgaacgttctacgcaagata(HindIII)(SEQIDNO.16) M-BW3.1R tagggatgaggacactcaaaagcttggg(KpnI)(SEQIDNO.17) 17-32 aa M-BW3.2F ggggtacccaaaagccctctcctgtgt(HindIII)(SEQIDNO.18) M-BW3.2R cccaagcttccacaggtcatcgtcatacgg(KpnI)(SEQIDNO.19)

TABLE-US-00002 TABLE2 Primersforfinemappingoftheepitopes recognizedbythemonoclonalantibodies Amino acid Primer position name Primersequence(5-3) 24-32aa M-BW3.2.1F cgcccctccgtatgacgatgacctgtgga(SEQIDNO.20) M-BW3.2.1R catggcggggaggcatactgctactggacaccttcga(SEQID NO.21) 24-31aa M-BW3.2.2F gatccgcccctccgtatgacgatgacctgc(SEQIDNO.22) M-BW3.2.2R tcgagcaggtcatcgtcatacggaggggcg(SEQIDNO.23) 24-30aa M-BW3.2.3F gatccgcccctccgtatgacgatgacc(SEQIDNO.24) M-BW3.2.3R tcgaggtcatcgtcatacggaggggcg(SEQIDNO.25) 24-29aa M-BW3.2.4F gatccgcccctccgtatgacgatc(SEQIDNO.26) M-BW3.2.4R tcgagatcgtcatacggaggggcg(SEQIDNO.27) 24-28aa M-BW3.2.5F gatccgcccctccgtatgacc(SEQIDNO.28) M-BW3.2.5R tcgaggtcatacggaggggcg(SEQIDNO.29) 25-32aa M-BW3.2.6F gatcccctccgtatgacgatgacctgtggc(SEQIDNO.30) M-BW3.2.6R tcgagccacaggtcatcgtcatacggaggg(SEQIDNO.31) 26-32aa M-BW3.2.7F gatccccgtatgacgatgacctgtggc(SEQIDNO.32) M-BW3.2.7R tcgagccacaggtcatcgtcatacggg(SEQIDNO.33) 27-32aa M-BW3.2.8F gatcctatgacgatgacctgtggc(SEQIDNO.34) M-BW3.2.8R tcgagccacaggtcatcgtcatag(SEQIDNO.35) 28-32aa M-BW3.2.9F gatccgacgatgacctgtggc(SEQIDNO.36) M-BW3.2.9R tcgagccacaggtcatcgtcg(SEQIDNO.37)

5. Analysis of Monoclonal Antibody Epitope Sequence

[0033] The identified epitope sequence .sup.25PPYDDD.sup.30 (SEQ ID NO. 1) was compared with the amino acid sequence of the M protein of the RABV strain registered by NCBI (FIG. 2), the results showed that the epitope was mainly .sup.25PPDDDD.sup.30 (SEQ ID NO. 2) sequence in RABV strain. After that, the mutation of amino acid P26L and Y27D were detected by Western blot, the results showed that the monoclonal antibody could still react with the mutation of amino acid P26L and Y27D, indicating that the monoclonal antibody 4A1 recognized the epitope of the CVS-11 strain replaced by Y27D, but the antigenicity of epitope was not affected (FIG. 4). At the same time, Western blot test results showed that the M protein monoclonal antibody of the present invention can react with CVS-11 and WT strains, but not with the HEP-Flury strain (purchased from the Chinese Veterinary Microbial Culture Collection and Management Center, deposit number: CVCC AV2013) (FIG. 3). In addition, the monoclonal antibody to N protein of the RABV strain can react specifically with three strains, which showed that the virus infected the cells successfully. Furthermore, through RABV sequence comparison, it was found that the epitope sequence of the HEP-Flury strain was .sup.25PPDGDD.sup.30 (SEQ ID NO. 3), and the .sup.25PPYDDD.sup.30 (SEQ ID NO. 1) epitope was further mutated with amino acid D28G, and Western blot found that the monoclonal antibody 4A1 could not recognize it (FIG. 4). However, the epitope identified in the present invention and Flury and its variant strains undergo amino acid D28G mutation (FIG. 2: HEP-Flury, rHEP5.0-CVSG, LEP-Flury, Flury-LEP-C), which affected the epitope. Therefore, the monoclonal antibody of the present invention can also be used to distinguish Flury and variant strains from other popular RABV strains.

6. Immunohistochemistry of Monoclonal Antibodies

[0034] C57BL/6 mice aged 6-8 weeks (purchased from Shanghai Xipuer-Bekay Laboratory Animal Co., Ltd.) were intracranially infected with 30 uL CVS-11 strain (10.sup.5TCID.sub.50/mL) and HEP-Flury strain, when the symptoms were obvious, the mice were anesthetized with 2.5% avertin (purchased from sigma), and then the brains were taken. The same volume of DMEM was intracranially injected as a blank control.

[0035] (1) Fixation and embedding: fixed with 4% paraformaldehyde for 24 hours, then dehydrated and transparent with alcohol, then immersed in paraffin for embedding, and finally sectioned.

[0036] (2) Paraffin wax was deparaffinized to water after sectioning: putting the sections in xylene I for 15 minutes, xylene II for 15 minutes, xylene III for 15 minutes, absolute ethanol I for 5 minutes, and absolute ethanol II for 5 minutes, 85% alcohol for 5 minutes, 75% alcohol for 5 minutes, and finally washing with distilled water.

[0037] (3) Antigen retrieval: placing the tissue section in a retrieval box filled with citric acid antigen retrieval buffer (pH 6.0) (purchased from Fuzhou Maixin Biotechnology Development Company), and placing it in a microwave oven for 5 minutes at medium heat, and stopping the fire for 5 minutes, and turning to low heat for 10 minutes for antigen retrieval. During this process, the buffer should be prevented from over-evaporating, and the film should not be dried. After natural cooling, the slides were washed 3 times in PBS (pH 7.4) for 5 min each time.

[0038] (4) Blocking endogenous peroxidase: putting the slices in 3% hydrogen peroxide solution, incubating at room temperature for 25 min in the dark, and then washing the slides in PBS (pH 7.4) for 3 times, 5 min each time.

[0039] (5) Serum blocking: dropping 3% BSA (purchased from Servicebio) into the histochemistry circle to evenly cover the tissue, and blocking for 30 min at room temperature.

[0040] (6) Adding the primary antibody: First the blocking solution was gently shaken off, and the primary antibody (monoclonal antibody of the present invention) diluted 1:500 was dropped on the CVS-11 strain, HEP-Flury strain and DMEM infected brain tissue sections. The sections were placed flat in a wet box and incubated overnight at 4? C. (a small amount of water was added to the wet box to prevent the antibody from evaporating). Among them, the HEP-Flury strain infected brain tissue slices were used as a positive control. The slices used the serum of HEP-Flury infected mice as the primary antibody.

[0041] (7) Adding secondary antibody: Slides were washed in PBS (pH 7.4) for 3 times and 5 min each time. After the sections were dried slightly, HRP-labeled goat anti-mouse IgG (purchased from KPL) was added dropwise to cover the tissue in the circle, and incubated at room temperature for 50 min.

[0042] (8) DAB color development: The slides were washed 3 times in PBS (pH 7.4) and 5 min each time. After the slices were dried slightly, adding freshly prepared DAB color developing solution (purchased from Fuzhou Maixin Biotechnology Development Company) was added into the circle, controlling the color development time under the microscope, and the positive was brown-yellow, and finally washing the slices with tap water to stop the color development.

[0043] (9) Re-staining nucleus: Hematoxylin re-stained the nucleus for about 3 minutes, and then washing with tap water. After the hematoxylin differentiation solution differentiated for a few seconds, washing with tap water again, and waiting until the hematoxylin blue solution returns to blue. Finally washing again with running water.

[0044] (10) Dehydration and mounting: putting the slices in 75% alcohol for 5 minutes, 85% alcohol for 5 minutes, absolute ethanol I for 5 minutes, absolute alcohol II for 5 minutes, and xylene I for 5 minutes to make the slices dehydrated and transparent. Then taking the slices out of xylene to dry a little, and finally covering the slices with neutral gum.

[0045] (11) Perform microscopic examination: the results of image acquisition and analysis showed that the hematoxylin-stained cell nucleus was blue, and the positive expression of DAB was brown, which indicated that the monoclonal antibody could label the RABV virus in the infected brain tissue (FIG. 5).