APPLICATIONS OF P14K INHIBITOR IN INTRACELLULAR PROTEIN MISFOLDING-RELATED DISEASES AND LYSOSOMAL STORAGE DISEASES
20240261250 ยท 2024-08-08
Inventors
- Fude HUANG (Shanghai, CN)
- Wenan Wang (Shanghai, CN)
- Feng Hong (Shanghai, CN)
- Linan Zheng (Shanghai, CN)
- Changping JIAO (Shanghai, CN)
- Luxiang Cao (Shanghai, CN)
- Yuyu Xie (Shanghai, CN)
Cpc classification
A61P29/00
HUMAN NECESSITIES
A61K31/675
HUMAN NECESSITIES
A61K31/495
HUMAN NECESSITIES
A61K31/7068
HUMAN NECESSITIES
A61K31/517
HUMAN NECESSITIES
C07B59/004
CHEMISTRY; METALLURGY
A61K31/5377
HUMAN NECESSITIES
A61K31/7068
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61K2300/00
HUMAN NECESSITIES
A61P1/16
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
A61K31/495
HUMAN NECESSITIES
A61K45/06
HUMAN NECESSITIES
A61K31/675
HUMAN NECESSITIES
A61P25/28
HUMAN NECESSITIES
C12N9/12
CHEMISTRY; METALLURGY
International classification
A61K31/5377
HUMAN NECESSITIES
Abstract
Provided are uses of a PI4KIII? specific inhibitor in preventing or treating intracellular protein misfolding-related diseases, also provided are uses of the PI4KIII? specific inhibitor in preventing or treating lysosomal storage diseases.
Claims
1. A method of preventing or treating a disease or disorder in a subject in need thereof comprising administering to the subject a PI4KIII? specific inhibitor, wherein the disease or disorder is an intracellular protein misfolding-related disease or a lysosomal storage disease.
2. The method of claim 1 wherein the disease or disorder is a lysosomal storage disease.
3. The method of claim 1, wherein the disease or disorder is an intracellular protein misfolding-related disease.
4. The method of claim 1, wherein the PI4KIII? specific inhibitor is an antibody, a small molecule compound, an RNAi molecule, or an antisense nucleic acid.
5-9. (canceled)
10. The method of claim 4, wherein the small molecule compound is selected from phenylarsine oxide or a derivative thereof, G1 or an analog thereof, or A1 or an analog thereof.
11. The method of claim 10, wherein the small molecule compound is phenylarsine oxide or a derivative thereof, wherein the phenylarsine oxide or the derivative thereof has a structure as represented by Formula (I) or a pharmaceutically acceptable salt thereof, ##STR00025## wherein: each R.sub.1 is independently selected from (a) H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C.sub.1-6 alkylsulfuryl, C.sub.1-6 alkyl, C.sub.1-6 cycloalkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, C.sub.1-6 alkylene-NH.sub.2, C.sub.1-6 alkylene-NHC(O)H, As(O), N?NH, N(C.sub.1-6 alkyl)amino, N,N(C.sub.1-6 alkyl).sub.2 amino, NHC(O)H, NHS(O).sub.2H, C(O)OH, OC(O)H, SH, S(O).sub.2H, S(O).sub.2NH.sub.2 or heterocyclyl, and optionally substituted with R.sub.2 or R.sub.3, wherein the R.sub.2 and the R.sub.3 are each independently selected from amino, C.sub.1-6 alkyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, N(C.sub.1-6 alkyl) amino, N-(6-12 membered aryl)amino, N,N(C.sub.1-6 alkyl).sub.2 amino, C.sub.3-6 cycloalkyl, 6-12 membered aryl or 3-12 membered heterocyclyl, and optionally substituted with one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, NHC(O)R.sub.5, C(O)OR.sub.4, 6-12 membered aryl, C.sub.1-6 alkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, 3-6 membered heterocyclyl, C.sub.3-6 cycloalkyl or BnO, R.sub.4 is C.sub.1-6 alkyl, and optionally substituted with one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aryl, C.sub.1-6 alkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, 3-6 membered heterocyclyl, C3-6 cycloalkyl or BnO, and R.sub.5 is selected from H, C.sub.1-6 alkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy or C.sub.1-6 haloalkyl, and/or (b) R.sub.1 on two adjacent carbon atoms forms 5-12 membered cycloalkyl, aryl or heterocyclyl, and is optionally substituted with one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aryl, C.sub.1-6 alkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, 3-6 membered heterocyclyl, C.sub.3-6 cycloalkyl or BnO, wherein n is an integer from 0 to 5.
12. The method of claim 11, wherein n is an integer from 0 to 2, and each of the R.sub.1 is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C.sub.1-6 alkylsulfuryl, C.sub.1-6 alkyl, C.sub.1-6 cycloalkyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, As(O), N(C.sub.1-6 alkyl)amino, N,N(C.sub.1-6 alkyl).sub.2 amino, NHC(O)H or NHS(O).sub.2H, and optionally substituted with the R.sub.2 or the R.sub.3.
13. The use according to method of claim 11, wherein n is an integer from 0 to 2, and each of the R.sub.1 is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, C.sub.1-6 alkylsulfuryl, C.sub.1-6 alkyl, C.sub.1-6 cycloalkyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, As(O), NHC(O)H or NHS(O).sub.2H, and optionally substituted with the R.sub.2 or the R.sub.3.
14. The method of claim 11, wherein n is 1 or 2, each of the R.sub.1 is independently selected from H, halogen, amino, C.sub.1-6 alkylsulfuryl, C.sub.1-6 cycloalkyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, NHC(O)R.sub.2 or NHS(O).sub.2R.sub.3, wherein the R.sub.2 is C.sub.1-6 alkyl and optionally substituted with one 6-12 membered aryl, and the R.sub.3 is 6-12 membered aryl and optionally substituted with one halogen, C.sub.1-6 alkoxy or C.sub.1-6 haloalkyl.
15. The method of claim 14, wherein the R.sub.1 is located at ortho- and/or para-position of As(O).
16. (canceled)
17. The method of claim 10, wherein the small molecule compound is a derivative of phenylarsine oxide selected from the group consisting of the following compounds: ##STR00026## ##STR00027## ##STR00028## ##STR00029## ##STR00030## ##STR00031## ##STR00032## ##STR00033##
18. (canceled)
19. The method of claim 3, wherein the intracellular protein misfolding-related disease is Parkinson's disease, Lewy body dementia, multiple system atrophy, inclusion body myositis, frontotemporal dementia, Huntington's disease, polyglutamine disease, amyotrophic lateral sclerosis, or Prion disease.
20. The method of claim 2, wherein the lysosomal storage disease is sphingolipid metabolism disorder, Niemann-Pick type C, mucopolysaccharidosis, glycogen storage disease, glycoprotein storage disease, lipid storage disease, post-translational modification deficiency, integral membrane protein deficiency disorder, neuronal ceroid lipofuscinosis, or a lysosome-related organelle disorder.
21. (canceled)
22. The method of claim 1, further comprising administering a second agent to a subject in need thereof.
23-27. (canceled)
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
DETAILED DESCRIPTION OF THE INVENTION
[0071] Hereinafter, the present invention will be described in detail according to the embodiments and in conjunction with the accompanying drawings. The above aspects of the present invention and other aspects of the present invention will be apparent from the following detailed description. The scope of the present invention is not limited to the following embodiments.
PI4KIII? Specific Inhibitor
[0072] The term PI4KIII? specific inhibitor as used herein refers to various substances capable of specifically reducing, decreasing or eliminating the transcription or translation of PI4KIII? gene, and/or the activity of PI4KIII? protein. In some embodiments, the PI4KIII? specific inhibitor is capable of reducing the activity of PI4KIII? by at least 5%, 10%, 20%, 40%, 50%, 80%, 90%, 95% or more. As used herein, activity when used in conjunction with an increase or decrease refers to a detected functional activity, which may be present in varying amounts, or in a constant amount but with a varying functional activity.
[0073] As used herein, the activity of PI4KIII? refers to an activity of PI4KIII? protein to phosphorylate phosphatidylinositol (PI) at a specific position (for example, to convert to phosphatidylinositol 4-phosphate (PI4P)). The binding constant of the PI4KIII? specific inhibitor to PI4KIII? protein is at least 2 times of the binding constant of the PI4KIII? specific inhibitor to other non-specific binding proteins. In some embodiments, the PI4KIII? specific inhibitor is capable of preferably recognizing PI4KIII? protein in a complex mixture, including a mixture with other PI4K subtype proteins.
[0074] In some embodiments, the PI4KIII? specific inhibitor inhibits PI4KIII at least 1 time, 2 times, 4 times, 5 times, 10 times, 20 times, 30 times, 50 times, 100 times, 200 times, 500 times, or 10,000 times more than other subtypes of PI4K protein (e.g., PI4K protein, including PI4KII? or PI4KII?). For example, in some embodiments, the PI4KIII? specific inhibitor does not substantially inhibit PI4KII (e.g., PI4KII? or PI4KII?), e.g., IC.sub.50 of the PI4KIII? specific inhibitor is greater than or equal to 10 ?M, 20 ?M, 30 ?M, 40 ?M, 50 ?M, 60 ?M, 80 ?M, 100 ?M, 150 ?M, 200 ?M or 500 ?M.
[0075] In some embodiments, the PI4KIII? specific inhibitor inhibits PI4KIII? at least 1 time, 2 times, 4 times, 5 times, 10 times, 20 times, 30 times, 50 times, 100 times, 200 times, 500 times, or 10,000 times stronger than other subtypes of PI4KIII (e.g., PI4KIII?).
[0076] In some embodiments, IC.sub.50 of PI4KIII? specific inhibitor against PI4KIII? is less than or equal to 100 ?M, 80 ?M, 50 ?M, 30 ?M, 20 ?M, 10 ?M, 5 ?M, 3 ?M, 2 ?M, 1 ?M, 0.5 ?M, 0.2 ?M, 0.1 ?M, 0.05 ?M, 0.02 ?M, 0.01 ?M, 0.005 ?M, 0.002 ?M or 0.001 ?M. In some embodiments, the PI4KIII? specific inhibitor is an antibody, a small molecule compound, an RNAi molecule or an antisense nucleic acid.
[0077] In some embodiments, the PI4KIII? specific inhibitor is an antibody.
[0078] The term antibody as used herein encompasses any immunoglobulin, monoclonal antibody, polyclonal antibody, multivalent antibody, bivalent antibody, monovalent antibody or antibody that binds a specific antigen. The term antibody herein is intended to encompass conventional four-chain antibodies as well as less conventional antibodies without four chains (e.g., antibodies naturally devoid of light chains).
[0079] One conventional intact antibody is a heterotetramer comprising two heavy (H) chains and two light (L) chains. Heavy chains of mammals may be classified into ? chain, ? chain, ? chain, ? chain and ? chain, and each heavy chain consists of a variable region (VH) and a first constant region, a second constant region and a third constant region (CH1, CH2 and CH3, respectively); and light chains of mammals may be classified into A chain or k chain, and each light chain consists of a variable region (VL) and a constant region. A conventional antibody is Y-shaped, with the neck of the Y-shaped structure consisting of a second constant region and a third constant region of two heavy chains bound by a disulfide bond. Each arm of the Y-shaped structure comprises a variable region and a first constant region of one heavy chain, which binds to a variable region and a constant region of one light chain. The variable regions of the light and heavy chains determine antigen binding. The variable region of each chain contains three hypervariable regions, i.e., complementarity determining regions (CDRs) (the CDRs for the light chain include LCDR1, LCDR2 and LCDR3, and the CDRs for the heavy chain include HCDR1, HCDR2 and HCDR3). The three CDRs are interposed between flanking continuous portions known as framework regions (FRs), which are more highly conserved than the CDRs and form a scaffold to support the hypervariable loops. The constant regions of the heavy and light chains are not associated with antigen binding, but have multiple effector functions.
[0080] In some embodiments of the present invention, the antibody is a full-length antibody or an antigen-binding fragment.
[0081] The term antigen-binding fragment as used herein refers to an antibody fragment formed from the antibody fragment that contains an antibody portion with one or more CDRs but does not have an intact antibody structure. Examples of the antigen-binding fragment include, but are not limited to, an Fab fragment, an Fab fragment, an F(ab)2 fragment, an Fv fragment, a single chain antibody molecules (scFv), an scFv dimer, a camelized single domain antibody and a nanobody. The antigen-binding fragment may bind to the same antigen as the parent antibody.
[0082] The Fab fragment of an antibody refers to the antibody portion that contains one light chain (including a variable region and a constant region) and a variable region and a first constant region of one heavy chain bound by a disulfide bond.
[0083] The Fab fragment refers to an Fab fragment containing part of the hinge region.
[0084] The F(ab)2 fragment refers to a dimer of Fab.
[0085] The Fv fragment of an antibody consists of a variable region of one light chain and a variable region of one heavy chain.
[0086] The single chain antibody molecule or scFv refers to an engineered antibody composed of a light chain variable region and a heavy chain variable region directly connected or connected by a peptide chain. For detailed descriptions, see, e.g., Huston J S et al., Proc Natl Acad Sci USA, 85:5879(1988).
[0087] The scFv dimer refers to a polymer formed from two scFvs.
[0088] The camelized single domain antibody (also referred to as heavy chain antibody or heavy-chain-only antibodies (HCAb)) refers to an antibody that contains two heavy chain variable regions but no light chain. Heavy chain antibodies are originally derived from Camelidae (camels, dromedaries and llamas). Camelized antibodies have all the functions for antigen binding despite the deletion of light chains.
[0089] The nanobody consists of one heavy chain variable region and two constant regions CH2 and CH3 from a heavy chain antibody.
[0090] In some embodiments, the antibody is a monoclonal antibody or a polyclonal antibody.
[0091] In some embodiments, the antibody is a murine antibody, a rabbit antibody, a chimeric antibody, a humanized antibody or a fully human antibody.
[0092] The term fully human as used herein, when applied to an antibody or antigen-binding fragment, means that amino acid sequences of the antibody or antigen-binding fragment correspond to the amino acid sequence of an antibody produced by human or human immune cells or derived from a non-human source, e.g., a transgenic non-human animal utilizing a human antibody library, or other sequences encoding human antibodies.
[0093] The term humanized as used herein, when applied to an antibody or antigen-binding fragment, refers to an antibody or antigen-binding fragment that includes CDRs derived from a non-human animal, FR regions derived from a human, and constant regions derived from a human (when applicable). Because a humanized antibody or antigen-binding fragment has lower immunogenicity, it may be used as a therapeutic agent for human in certain embodiments. In certain embodiments, the non-human animals are mammals (e.g., mice, rats, rabbits, goats, sheep, guinea pigs or hamsters). In certain embodiments, the humanized antibody or antigen-binding fragment consists essentially entirely of human sequences, except for CDR sequences that are non-human.
[0094] The term chimeric as used herein, when applied to an antibody or antigen-binding fragment, refers to having a portion of the heavy and/or light chain derived from one species, with the rest of the heavy and/or light chain derived from an antibody or antigen-binding fragment from different species. In some embodiments, the chimeric antibody can include a constant region derived from a human and a variable region derived from a non-human animal (e.g., a mouse or a rabbit).
[0095] In some embodiments, the antibody described herein is a monospecific antibody, a bispecific antibody or a multispecific antibody.
[0096] In some embodiments, the antibody described herein may be further labeled.
[0097] In some embodiments, the PI4KIII? specific inhibitor is an RNAi molecule.
[0098] The term RNAi molecule as used herein refers to RNA or an analog thereof, which has sufficient sequence complementarity with target RNA to guide RNA interference. In some embodiments, DNA is also included that may be used to generate RNA. RNA interference (RNAi) refers to a sequence-specific or selective process by which a target molecule (e.g., a target gene, a protein or RNA) is down-regulated.
[0099] In some embodiments, the RNAi molecule is capable of reducing expression of PI4KIII?, e.g., knocking down PI4KA gene.
[0100] In some embodiments, the RNAi molecule has [5-GCTGATCTCTACTACACTTCC-3] (SEQ ID NO: 1).
[0101] In some embodiments, the RNAi molecule has [5-GGTTATCACCGGAAATCAATA-3] (SEQ ID NO: 2).
[0102] In some embodiments, the RNAi molecule has [5-GCAACATTATGCTGGACAAGA-3] (SEQ ID NO: 3).
[0103] In some embodiments, the RNAi molecule is 18-100 bases in length.
[0104] In some embodiments, the RNAi molecule is modified to enhance its stability.
[0105] In some embodiments, the RNAi molecule is a small interference RNA (siRNA), a short hairpin RNA (shRNA) or a microRNA (miRNA).
[0106] The term small interference RNA (siRNA) as used herein refers to an RNA molecule, preferably a double-strand molecule, having a length of about 10 to 50 nucleotides, preferably a length of about 15 to 25 nucleotides, more preferably a length of about 17, 18, 19, 20, 21, 22, 23, 24 or 25 nucleotides, and the strand optionally has an overhanging terminus comprising, e.g., 1, 2 or 3 overhanging nucleotides (or nucleotide analogs). siRNA is capable of guiding or mediating degradation of RNA.
[0107] The term short hairpin RNA (shRNA) as used herein refers to an RNA molecule having a stem-loop structure that includes a first region and a second region of complementary sequences, complementarity degree and region direction are sufficient for base pairing to occur between the regions, the first and second regions are linked by a loop region, and the loop results from a lack of base pairing between nucleotides (or nucleotide analogs) in the loop region.
[0108] The term microRNA or miRNA as used herein is a short, naturally occurring, non-coding and single-stranded RNA molecule of about 16-26 nucleotides (nt) in length (e.g., about 16-29 nt, 19-22 nt, 20-25 nt or 21-23 nt), which is typically involved in regulating gene expression in vivo. In eukaryotic cells, the miRNA gene is transcribed by DNA transcriptase II into a primary miRNA (pri-miRNA) that is rapidly processed by ribonuclease III (Drosha) into a precursor miRNA (pre-miRNA), and the pre-miRNA is transported from cell nucleus into cytoplasm, and then recognized and cleaved into mature miRNA by another ribonuclease III (Dicer). Mature miRNA molecules are partially complementary to one or more mRNAs and regulate the expression of proteins. The sequences of known miRNAs may be obtained from published databases, such as the miRBase database (www.mirbase.org), where information is provided including miRNA sequence information, functional annotations, predicted gene targets and the like. In the present invention, miRNA further includes RNA molecules expressed in cells by synthetic plasmids, having a structure and function similar to natural miRNA, and capable of targeting the corresponding mRNA like natural miRNA and preventing its translation into protein.
[0109] In some embodiments, the PI4KIII? specific inhibitor is an antisense nucleic acid.
[0110] The term antisense nucleic acid as used herein includes nucleotides that are fully complementary to a target sequence as well as those nucleotides that have one or more nucleotide mismatches, so long as the antisense nucleic acid is capable of specifically hybridizing to the target sequence. For example, the antisense nucleic acid herein includes a polynucleotide having at least 70% or more, preferably 80% or more, more preferably 90% or more, and even more preferably 95% or more homology over a length of at least 15 consecutive nucleotides. Due to the formation of a hybrid, the transcription of the target gene and/or translation of the target mRNA is reduced or blocked.
[0111] In some embodiments, the PI4KIII? inhibitor is a small molecule compound.
[0112] The term small molecule compound as used herein refers to an organic compound having a molecular weight of less than 3000, 2500, 2000, 1500, 1000 or 500 Daltons, which may be natural or chemically synthesized.
[0113] In some embodiments, the phenylarsine oxide and the derivative thereof have a structure as represented by formula (I) or a pharmaceutically acceptable salt thereof,
##STR00012##
[0114] wherein each R.sub.1 is independently selected from (a) H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C.sub.1-6 alkylsulfuryl, C.sub.1-6 alkyl, C.sub.1-6 cycloalkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, C.sub.1-6 alkylene-NH.sub.2, C.sub.1-6 alkylene-NHC(O)H, As(O), N?NH, N(C.sub.1-6 alkyl)amino, N,N(C.sub.1-6 alkyl).sub.2 amino, NHC(O)H, NHS(O).sub.2H, C(O)OH, OC(O)H, SH, S(O).sub.2H, S(O).sub.2NH.sub.2 or heterocyclyl, and optionally substituted with R.sub.2 or R.sub.3, wherein the R.sub.2 and the R.sub.3 are each independently selected from amino, C.sub.1-6 alkyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, N(C.sub.1-6 alkyl) amino, N-(6-12 membered aryl)amino, N,N(C.sub.1-6 alkyl).sub.2 amino, C.sub.3-6 cycloalkyl, 6-12 membered aryl or 3-12 membered heterocyclyl, and optionally substituted with one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, NHC(O)R.sub.5, C(O)OR.sub.4, 6-12 membered aryl, C.sub.1-6 alkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, 3-6 membered heterocyclyl, C.sub.3-6 cycloalkyl or BnO, R.sub.4 is C.sub.1-6 alkyl, and optionally substituted with one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aryl, C.sub.1-6 alkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, 3-6 membered heterocyclyl, C.sub.3-6 cycloalkyl or BnO, and R.sub.5 is selected from H, C.sub.1-6 alkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy or C.sub.1-6 haloalkyl, and/or [0115] (b) R.sub.1 on two adjacent carbon atoms forms 5-12 membered cycloalkyl, aryl or heterocyclyl, and is optionally substituted with one or more halogen, nitro, cyano, hydroxyl, amino, carbamoyl, 6-12 membered aryl, C.sub.1-6 alkyl, C.sub.2-6 alkynyl, C.sub.2-6 alkenyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, 3-6 membered heterocyclyl, C.sub.3-6 cycloalkyl or BnO, [0116] wherein n is an integer from 0 to 5.
[0117] In some embodiments, n is an integer from 0 to 2, and each of the R.sub.1 is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, carbamoyl, C.sub.1-6 alkylsulfuryl, C.sub.1-6 alkyl, C.sub.1-6 cycloalkyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, As(O), N(C.sub.1-6 alkyl)amino, N,N(C.sub.1-6 alkyl).sub.2 amino, NHC(O)H or NHS(O).sub.2H, and optionally substituted with the R.sub.2 or the R.sub.3.
[0118] In some embodiments, n is an integer from 0 to 2, and each of the R.sub.1 is independently selected from H, halogen, nitro, cyano, hydroxyl, amino, C.sub.1-6 alkylsulfuryl, C.sub.1-6 alkyl, C.sub.1-6 cycloalkyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, As(O), NHC(O)H or NHS(O).sub.2H, and optionally substituted with the R.sub.2 or the R.sub.3.
[0119] In some embodiments, n is 1 or 2, each of the R.sub.1 is independently selected from H, halogen, amino, C.sub.1-6 alkylsulfuryl, C.sub.1-6 cycloalkyl, C.sub.1-6 alkoxy, C.sub.1-6 haloalkyl, NHC(O)R.sub.2 or NHS(O).sub.2R.sub.3, wherein the R.sub.2 is C.sub.1-6 alkyl and optionally substituted with one 6-12 membered aryl, and the R.sub.3 is 6-12 membered aryl and optionally substituted with one halogen, C.sub.1-6 alkoxy or C.sub.1-6 haloalkyl.
[0120] In some embodiments, the R.sub.1 is located at ortho- and/or para-position of As(O).
[0121] In some embodiments, n is 0.
[0122] The term substituted as used herein, when referring to a chemical group, means that one or more hydrogen atoms of the chemical group are removed and substituted with a substituent.
[0123] The term substituent as used herein has general meaning known in the art and refers to a chemical moiety covalently attached to, or fused, where appropriate, to a parent group.
[0124] The term C.sub.n-C.sub.m as used herein represents a range of numbers of carbon atoms, where n and m are integers and the range of numbers of carbon atoms includes the endpoints (i.e., n and m) and each integer point therebetween. For example, C.sub.1-C.sub.6 represents a range of 1 to 6 carbon atoms, including 1 carbon atom, 2 carbon atoms, 3 carbon atoms, 4 carbon atoms, 5 carbon atoms and 6 carbon atoms.
[0125] The term alkyl as used herein, whether used as a part of another term or used alone, refers to a saturated hydrocarbon group, which may be linear or branched. The term C.sub.n-C.sub.m alkyl refers to alkyl having n to m carbon atoms. In certain embodiments, the alkyl group contains 1 to 12, 1 to 8, 1 to 6, 1 to 4, 1 to 3, or 1 to 2 carbon atoms. Examples of the alkyl group include, but are not limited to, chemical groups such as methyl, ethyl, n-propyl, isopropyl, n-butyl, tert-butyl, isobutyl, sec-butyl, 2-methyl-1-butyl, n-pentyl, 3-pentyl, n-hexyl, 1,2,2-trimethylpropyl.
[0126] The term alkenyl as used herein, whether used as a part of another term or used alone, refers to an unsaturated hydrocarbyl group, which may be a linear or branched group having at least one carbon-carbon double bond. In certain embodiments, the alkenyl group contains 2 to 12, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, or 2 to 3 carbon atoms. In certain embodiments, the alkenyl group can also have 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 carbon-carbon double bond. Examples of the alkenyl group include, but are not limited to, chemical groups such as ethenyl, n-propenyl, isopropenyl, n-butenyl, sec-butenyl.
[0127] The term alkynyl as used herein, whether used as a part of another term or used alone, refers to an unsaturated alkynyl group, either linear or branched, having at least one carbon-carbon triple bond. In certain embodiments, the alkynyl group contains 2 to 12, 2 to 10, 2 to 8, 2 to 6, 2 to 5, 2 to 4, or 2 to 3 carbon atoms. In certain embodiments, the alkynyl group can also have 1 to 6, 1 to 5, 1 to 4, 1 to 3, 1 to 2, or 1 carbon-carbon triple bond. Examples of the alkynyl group include, but are not limited to, chemical groups such as ethynyl, propynyl and butynyl.
[0128] The term cycloalkyl as used herein refers to cyclic alkyl consisting of at least 3 atoms. The term n-m membered cycloalkyl refers to cycloalkyl having n to m members forming a ring. Furthermore, the ring may also have one or more double bonds, but does not have a fully conjugated system. In certain embodiments, the cycloalkyl has 3 to 8, 3 to 6, or 4 to 6 carbon atoms forming a ring. Examples of the cycloalkyl include, but are not limited to, cyclopropane, cyclobutane, cyclopentyl and the like.
[0129] The term heterocyclyl as used herein, refers to a cyclic group in which at least one atom in the ring system is a heteroatom and the remaining ring atoms are carbon atoms. The term n-m membered heterocyclyl refers to heterocyclyl having n to m members forming a ring. The term heterocyclyl as used herein includes heteroaryl and heterocycloalkyl. In addition, the ring may also have one or more double bonds. In certain embodiments, the heterocyclyl is saturated heterocycloalkyl. Examples of the heteroatom include, but are not limited to, oxygen, sulfur, nitrogen, phosphorus and the like.
[0130] The term heterocycloalkyl as used herein refers to cycloalkyl in which at least one atom in the ring system is a heteroatom and the remaining ring atoms are carbon atoms. The term n-m membered heterocycloalkyl refers to heterocycloalkyl having n to m members forming a ring. Furthermore, the ring may also have one or more double bonds, but does not have a fully conjugated system. In certain embodiments, the heterocycloalkyl is saturated heterocycloalkyl. Examples of the heteroatom include, but are not limited to, oxygen, sulfur, nitrogen, phosphorus and the like. In certain embodiments, the heterocycloalkyl has 3 to 8, 3 to 6, or 4 to 6 carbon atoms forming a ring. Examples of the heterocycloalkyl include, but are not limited to, azetidine, aziridine, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, thiomorpholine, homopiperazine and the like.
[0131] The term aryl as used herein, whether used as a part of another term or used alone, refers to a mono- or poly-carbocyclic ring system group having alternating double and single bonds between carbon atoms forming a ring. The term C.sub.n-C.sub.m aryl refers to aryl having n to m carbon atoms forming a ring. In certain embodiments, the aryl ring system has 6 to 12, 6 to 10, or 6 to 8 carbon atoms in one or more rings. In certain embodiments, the aryl ring system has 2 or more rings fused together. Examples of the aryl group include, but are not limited to, chemical groups such as phenyl, naphthyl, tetrahydronaphthyl, indanyl, indenyl and the like.
[0132] The term heteroaryl as used herein refers to an aryl group in which at least one ring atom in the aromatic ring is a heteroatom and the remaining ring atoms are carbon atoms. The term n-m membered heteroaryl refers to heteroaryl having n to m members forming a ring. Examples of the heteroatom include, but are not limited to, oxygen, sulfur, nitrogen, phosphorus and the like. In certain embodiments, the heteroaryl can have 5 to 10, 5 to 8, or 5 to 6 members forming a ring. In certain embodiments, the heteroaryl is 5- or 6-membered heteroaryl. Examples of the heteroaryl include, but are not limited to, furyl, thienyl, pyridyl, quinolyl, pyrrolyl, N-lower alkylpyrrolyl, pyridyl-N-oxide, pyrimidinyl, pyrazinyl, imidazolyl, indolyl and the like.
[0133] The term alkoxy as used herein, whether used as a part of another term or used alone, refers to a group as represented by formula O-alkyl. The term C.sub.n-C.sub.m alkoxy means that the alkyl moiety of the alkoxy has n to m carbon atoms. In certain embodiments, the alkyl moiety has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of the alkoxy group include, but are not limited to, chemical groups such as methoxy, ethoxy, propoxy (e.g., n-propoxy and isopropoxy), 1-butoxy and the like.
[0134] The term haloalkyl as used herein, whether used as a part of another term or used alone, refers to a group as represented by formula -alkyl-X, wherein X is a halogen, an atom selected from fluorine, chlorine, bromine and iodine. The term C.sub.n-C.sub.m haloalkyl means that the alkyl moiety of the haloalkyl has n to m carbon atoms. In certain embodiments, the alkyl moiety has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Examples of the haloalkyl group include, but are not limited to, chemical groups such as halomethyl, haloethyl, halopropyl (e.g., n-halopropyl and iso-halopropyl), 1-halobutyl and the like.
[0135] The term n-membered as used herein, wherein n is an integer, is commonly used with a ring system to describe the number of atoms forming a ring in the ring system. For example, piperidinyl is one example of a 6-membered heterocycloalkyl ring, pyrazolyl is one example of a 5-membered heteroaryl ring, pyridinyl is one example of a 6-membered heteroaryl ring and 1,2,3,4-tetrahydro-naphthalene is one example of 10-membered aryl. The term n- to m-membered as used herein is generally used with a ring system to describe the number of members forming a ring in the ring system, where n and m are integers and the range of members forming a ring includes the endpoints (i.e., n and m) and each integer point therebetween. For example, 3- to 8-membered means a range of 3 to 8 members forming a ring, including 3 members, 4 members, 5 members, 6 members, 7 members and 8 members.
[0136] The term halogen as used herein refers to an atom selected from fluorine, chlorine, bromine and iodine.
[0137] The term cyano as used herein refers to a group as represented by formula CN.
[0138] The term hydroxyl as used herein refers to a group as represented by formula OH.
[0139] The term nitro as used herein refers to a group as represented by formula NO.sub.2.
[0140] The term amino as used herein refers to a group as represented by formula NH.sub.2.
[0141] The term carbamoyl as used herein refers to a group as represented by formula HNCONH.sub.2.
[0142] The term compound as used herein is intended to include all stereoisomers (e.g., enantiomers and diastereomers), geometric isomers, and tautomers of the structures shown.
[0143] The compounds described herein may be asymmetric (e.g., having one or more stereocenters). Unless otherwise indicated, all stereoisomers, such as enantiomers and diastereomers, are intended to be included. Various geometric isomers including olefins, carbon-carbon double bonds and the like may also be present in the compounds described herein, and all such stable isomers have been contemplated herein. Cis- and trans-geometric isomers of the compounds are described herein and may be isolated as mixtures of isomers or as individual isomers.
[0144] The compounds herein also include tautomeric forms of the compounds. Tautomeric forms result from the exchange of a single bond with an adjacent double bond accompanied by the migration of a proton. Tautomeric forms include tautomers of protons in isomeric protonated states with the same chemical formula and total charge. Examples of the proton tautomers include keto-enol pairs, amide-imidic acid pairs, lactam-lactim pairs, enamine-imine pairs and cyclic forms, in which a proton can occupy two or more positions of a heterocyclic system, such as 1H- and 3H-imidazole, 1H-, 2H- and 4H-1,2,4-triazole, 1H- and 2H-isoindole and 1H- and 2H-pyrazole. Tautomeric forms can be in equilibrium or sterically locked into one form by appropriate substitution.
[0145] In certain embodiments, the small molecule compound herein can be obtained by organic synthesis. The compounds herein, including salts, esters, hydrates, or solvates thereof, may be prepared using any of the well known organic synthetic techniques and may be synthesized according to a variety of possible synthetic routes.
[0146] In some embodiments, the small molecule compound described herein is a compound having the following structural formula, including one or more of:
##STR00013## ##STR00014## ##STR00015## ##STR00016## ##STR00017## ##STR00018## ##STR00019## ##STR00020##
[0147] The term phenylarsine oxide (PAO) as used herein refers to a small molecule compound having a specific chemical structure shown as follows:
##STR00021##
[0148] The terms A1 and G1 as used herein are both small molecule compound inhibitors of PI4KIII? protein and have relatively similar structures. The chemical structural formula of A1 is:
##STR00022## [0149] 5-(2-amino-1-(4-(4-morpholinyl)phenyl)-1H-benzimidazol-6-yl)-N-(2-fluorophenyl)-2-methoxy-3-pyridinesulfonamide
[0150] The chemical structural formula of G1 is:
##STR00023## [0151] (aS)-5-(2-amino-4-oxo-3-(2-(trifluoromethyl)phenyl)-3,4-dihydroquinazolin-6-yl)-N-(2,4-difluorophenyl)-2-methoxypyridine-3-sulfonamide.
[0152] The present invention also relates to a derivative of phenylarsine oxide and an analog of A1 or G1, the derivative and the analog can also be used for treating intracellular protein misfolding-related diseases and lysosomal storage diseases, as long as the derivative and the analog has a function of inhibiting the phosphokinase activity of PI4KIII? protein, and a method for preparing such structural analogs have also been disclosed. In some embodiments, the derivative of phenylarsine oxide, A1 or G1 is an analog with a structure similar to phenylarsine oxide, A1 or G1.
Intracellular Protein Misfolding-Related Diseases
[0153] The term intracellular protein misfolding-related disease as used herein refers to a disease characterized by aggregation of abnormally folded proteins in the cytoplasm, and is also diagnosed as a protein aggregation/accumulation or protein misfolding disease. In addition, the term intracellular protein misfolding-related diseases also includes some intracellular inclusion body diseases such as protein inclusion body accumulation disease, in which inclusion body is mainly composed of a core protein aggregated due to folding error and various stress proteins which are involved in response to unfolded proteins and are externally attached.
[0154] Intracellular protein misfolding-related diseases include, but are not limited to, Parkinson's disease (PD), Lewy body dementia (LBD), multiple system atrophy (MSA), inclusion body myositis (IBM), frontotemporal dementia (FTD), Huntington disease (HD), polyglutamine disease (PolyQ), amyotrophic lateral sclerosis (ALS), and Prion disease.
Lysosomal Storage Diseases
[0155] The term lysosomal storage disease as used herein refers to a disease caused by accumulation of some endogenous or exogenous substances in lysosomes due to various causes, including but not limited to lysosome function defects caused by insufficient enzymatic activity in lysosomes, deficiency of activator protein, transporter protein or enzymes for lysosome protein processing and correction, which results in the failure of digestion of corresponding substrates in secondary lysosomes, accumulation of substrates and metabolic disorder, thus leading to storage diseases and the like.
[0156] Lysosomal storage diseases include, but are not limited to, sphingolipid metabolism disorder, mucopolysaccharidosis, glycogen storage disease, glycoprotein storage disease, lipid storage disease, post-translational modification deficiency, integral membrane protein deficiency disorder, neuronal ceroid lipofuscinosis, or lysosome-related organelle disorder. The sphingolipid metabolism disorder includes, but is not limited to, Fabry disease, metabolic disorder skin disease (Farbe disease), Gaucher disease types I, II, III and prenatal death, GM1 gangliosidosis types I, II and III, GM2 gangliosidosis (familial amaurotic idiocy), GM2 gangliosidosis, spheroid leukodystrophy (Krabbe disease), metachromatic leukodystrophy, and Niemann-Pick disease types A and B; mucopolysaccharidosis includes, but is not limited to, Hurler-Scheie syndrome and Scheie syndrome (ML I), Hunt syndrome (MPS II), Sanfilippo syndrome A (MPS IIIA), Sanfilippo syndrome B (MPS IIIB), Sanfilippo syndrome C (MPS IIIC), Sanfilippo syndrome D (MPS IIID), eccentro-osteochondrodysplasia syndrome (MPS IVA), eccentro-osteochondrodysplasia syndrome (MPS IVB), maroteaux-lamy syndrome (Lamy syndrome, MPS VI), Sly disease (MPS VII), and MPS IX; glycogen storage disease includes, but is not limited to, Pompe disease (GSD II); glycoprotein storage disease includes, but is not limited to, ?-mannoside storage disease, ?-mannoside storage disease, fucosidosis, aspartylglucosaminuria, Schindle disease type I (infantile onset neuroaxonal dystrophy), Schindle disease type II (Kanzaki disease), Schindle disease type III (moderate severity), Sialic acid storage disease type I (Cherry-red spot-myoclonus syndrome), Sialic acid storage disease type II (mucopolysaccharidosis I), and galactosialidosis; lipid storage disease includes, but is not limited to, acid lipase deficiency such as Wolfman disease and cholesteryl ester storage disease; post-translational modification deficiency includes, but is not limited to, multiple sulfatase deficiency, Mucolipidosis II a/B (I-cell disease), Mucolipidosis II a/B (Pseudo-Hurler syndrome), and Mucolipidosis III ? (Pseudo-Hurler syndrome variant); integral membrane protein deficiency disorder includes, but is not limited to, Cystinosis, Danon's disease, myoclonus renal failure syndrome, Sialic acid storage disorders such as ISSD, Salla syndrome and moderately severe Salla syndrome, Niemann-Pick disease types C1 and C2, and Mucolipidosis type IV; neuronal ceroid lipofuscinosis include, but is not limited to, ceroid lipofuscinosis type 1 (Haltia-Santavuori syndrome and INCL), neuronal ceroid lipofuscinosis type 2 (Jansky-Bielschowsky syndrome), ceroid lipofuscinosis type 3 (Batten-Spielmeyer-Sjogren syndrome), ceroid lipofuscinosis type 4 (Parry's disease and Kufs types A and B), ceroid lipofuscinosis type 5 (late infant Finnish variant), ceroid lipofuscinosis type 6 (Lake-Cavanagh or Indiana variant), ceroid lipofuscinosis type 7 (Turkish variant), ceroid lipofuscinosis type 8 (northern epilepsy, epileptic intellectual deterioration), ceroid lipofuscinosis type 9, ceroid lipofuscinosis type 10, ceroid lipofuscinosis type 11, ceroid lipofuscinosis type 12, ceroid lipofuscinosis type 13, ceroid lipofuscinosis type 14; and lysosome-related organelle disorder includes, but is not limited to, Hermansky-Pudlak disease type 1, Hermansky-Pudlak disease type 2, Hermansky-Pudlak disease type 3, Hermansky-Pudlak disease type 4, Hermansky-Pudlak disease type 5, Hermansky-Pudlak disease type 6, Hermansky-Pudlak disease type 7, Hermansky-Pudlak disease type 8, Hermansky-Pudlak disease type 9, Griscelli syndrome 1 (Elejalde syndrome), Griscelli syndrome 2, and Ch?diak-Higashi disease.
Drug Administration and Medical Use
[0157] The term pharmaceutically acceptable as used herein refers to those compounds, materials, compositions, and/or dosage forms that are suitable for use in contact with human and animal tissues within the scope of reasonable medical judgment without excessive toxicity, irritation, allergic response, or other problems or complications, and are commensurate with a reasonable benefit/risk ratio. In certain embodiments, pharmaceutically acceptable compounds, materials, compositions, and/or dosage forms refer to those approved by a regulatory agency (e.g., the United States Food and Drug Administration, the National Medical Products Administration of China, or the European Medicines Agency) or listed in a generally recognized pharmacopeia (e.g., U.S. Pharmacopeia, Chinese Pharmacopoeia, or European Pharmacopoeia) for use in animals (more particularly in humans).
[0158] The term subject as used herein may include both humans and non-human animals. Non-human animals include all vertebrates, for example, mammals and non-mammals. The subject can also be livestock animals (e.g., cows, pigs, sheep, chickens, rabbits or horses), or rodents (e.g., rats or mice), or primates (e.g., gorillas or monkeys), or domestic animals (e.g., dogs or cats). The subject may be male or female, or may be of different age. The human subject may be Caucasian, African, Asian, Semitic, or other races, or a hybrid of different races. The human subject may be the elderly, adults, teenagers, children or infants.
[0159] In some embodiments, the subjects described herein are humans or non-human primates.
[0160] The PI4KIII? specific inhibitors disclosed herein can be administered by an administration route well known in the art, such as by injection (e.g., subcutaneous injection, intraperitoneal injection, intravenous injection (including intravenous drip or intravenous infusion), intramuscular injection or intradermal injection) or non-injection (e.g., oral, nasal, sublingual, rectal, or topical administration). In some embodiments, the PI4KIII? specific inhibitor described herein is administered orally, subcutaneously, intramuscularly or intravenously. In some embodiments, the PI4KIII? specific inhibitor described herein is administered orally.
[0161] The term therapeutically effective amount as used herein refers to an amount of a drug that alleviates or eliminates a disease or a symptom of the subject, or that prophylactically inhibits or prevents the onset of a disease or a symptom. A therapeutically effective amount may be an amount of a drug that will alleviate to some extent one or more diseases or symptoms of the subject; an amount of a drug that can partially or completely restore to normal one or more physiological or biochemical parameters associated with the cause of a disease or a symptom; and/or an amount of a drug that may reduce the likelihood of the development of a disease or a symptom. In some embodiments, the term therapeutically effective amount as used herein refers to an amount of a drug that can alleviate or eliminate intracellular protein misfolding-related diseases or lysosomal storage diseases of a subject.
[0162] The therapeutically effective dose of the PI4KIII? specific inhibitor provided herein depends on various factors well known in the art, such as body weight, age, past medical history, current treatment underway, the health status of the object and the strength of drug interactions, allergies, hypersensitivity and side effects, as well as administration routes and disease progression degree. One skilled in the art (e.g., a physician or veterinarian) can lower or raise the dose accordingly to these or other conditions or requirements.
[0163] In some embodiments, the treatment further comprises administering a second agent to a subject in need thereof.
[0164] In some embodiments, the second agent is an agent for treating intracellular protein misfolding-related diseases, including but not limited to Levodopa and Riluzole.
[0165] In some embodiments, the PI4KIII? specific inhibitor is administered prior to, subsequent to or concurrently with the second agent.
[0166] The present application also relates to a method for preventing or treating intracellular protein misfolding-related diseases comprising administering an effective amount of a PI4KIII? specific inhibitor to a subject in need thereof.
[0167] The present application also relates to a method for preventing or treating lysosomal storage diseases comprising administering an effective amount of a PI4KIII? specific inhibitor to a subject in need thereof.
Drug Screening
[0168] The present invention provides a method for screening a drug for preventing or treating intracellular protein misfolding-related diseases, comprising contacting a drug candidate with a PI4KIII? protein or nucleic acid or PI4KIII?, and detecting whether the drug candidate is capable of inhibiting the formation or activity of PI4KIII?.
[0169] The present invention further provides a method for screening a drug for preventing or treating lysosomal storage diseases, comprising contacting a drug candidate with a PI4KIII? protein or nucleic acid or PI4KIII?, and detecting whether the drug candidate is capable of inhibiting the formation or activity of PI4KIII?.
EXAMPLE 1. PROMOTION OF EXOCYTOSIS OF MICROGLIA LYSOSOMES BY PI4KIII? INHIBITORS
1.1 Experimental Animals
[0170] The mice used were wild type (WT) C57BL/6J mice and C57BL/6J mice with heterozygous knockout (KO) of PI4KA. Male PI4KA/mutant mice [Pi4kaGt (RRO073) Byg/+, MMRRC, Cat. #016351, UC Davis Mouse Resource Center (USA)] and wild type C57BL/6 mice backcrossed for more than 5 generations. The resulting Pi4kaGt (RRO073) Byg/+ mice were then used in this study. WT mice were purchased from GemPharmatech Co., Ltd., and all mice were bred at the animal research center of the Institute of Pharmacy, Fudan University (Shanghai, China).
[0171] All mice were kept in standard cages of no more than 5 mice/cage, with no restriction of food and water intake during the 12 hour of light/dark cycle. For mice requiring breeding, no more than one male and two female per cage were kept for breeding.
1.2 Isolation and Culture of Primary Microglia (Complete Medium: MEM+10% FBS)
[0172] a. Isolation and Culture of Mixed Microglia
[0173] Pregnant mice for 18-20 days were anesthetized with anesthetic (1.2% Abamectin injected into abdominal cavity at 0.3 mL/10 g), embryos were collected and placed into a sterilized beaker, the mouth of the beaker was sealed with a thin film glove and transferred to a cell room. Heads were cut, brains were taken off, and the previous steps were consistent with the that of taking primary neuronal cells. The taken brain tissue was placed in a cell culture dish containing Hank's balanced salt solution (HBSS), and then cerebral cortex was separated under an anatomic microscope and placed in HBSS, and meninges and blood vessels attached to the cerebral cortex were peeled off, torn up with forceps, and sucked into a 15 mL EP tube. After the HBSS washing, HBSS was discarded, trypsin was added (the trypsin volume depended on the cell amount, generally 10?trypsin ratio was 1:10), and the mixture was digested at 37? C. for 10 minutes in a CO.sub.2 incubator, then the trypsin was discarded, and FBS (about 20% of the total volume) was added to terminate the digestion reaction for 1.5 to 2 minutes. FBS was carefully pipetted by using a disposable pipette, MEM culture solution was added, the mixture was repeatedly pipetted until the culture solution was suspension containing cells, at this time, the cells were uniformly dispersed in the MEM culture solution without obvious lumps and tissue fragments and sieved by using a 70-micron cell sieve; complete culture medium was added, the cells were uniformly pipetted followed by counting; MEM complete culture medium containing 10% of FBS was added into T25 cell culture flasks, and microglial cells separated from the brain of one fetal mouse were cultured in each one culture flask. The culture flasks were incubated in an incubator with CO.sub.2, and the old culture medium was discarded after overnight and replaced with fresh culture medium; after that, the medium was refreshed every 48 hours, the layered growth of cells was observed after about 10 days, wherein the upper layer with better refractivity was microglia, and the lower layer supporting growth was astrocytes.
b. Separating and Purifying Microglia by Mild Trypsin Digestion Method
[0174] The old culture medium was discarded, PBS was used for washing three times and 5 mL of low-concentration 0.125% trypsin was added for digestion, and the culture flask was observed under an inverted microscope while shaking; the suspension containing the microglia was transferred into a 15 mL centrifuge tube after most of the upper layer cells were detached and centrifuged at the low temperature of 4? C. for 5 minutes at the rotating speed of 1000 g, the supernatant was removed by pipetting, then 2 mL of complete culture medium was added to resuspend the cell precipitate, the cell suspension was mixed well with 0.4% trypan blue solution in a ratio of 9:1, and then the mixture was added dropwise to a blood counting chamber for counting. After counting, the cells were inoculated in a polylysine-coated 35 mm glass-bottom culture dish at a cell count of 1?10.sup.6, and after 30 minutes, the old medium was replaced with a fresh complete medium, the non-completely attached promiscuous cells were removed and the remaining cells were cultured in an incubator with CO.sub.2. The medium was replaced with a fresh complete culture solution 24 hours after purification, and then all of or half of the culture solution was replaced every 2 days. After the primary microglia was cultured for at least 4 hours, the medium was replaced with the serum-free culture medium, and then subsequent experiments were performed.
1.3 Immunol Staining of Microglia Iba1 Antibody
[0175] The Iba1 (Ionized calcium-binding adapter molecule 1) antibody is a specific antibody of microglia and macrophages, can specifically bind to calcium binding protein specifically expressed by the microglia, and is a marker of the microglia in the central nervous system.
[0176] The formulation of 4% (w/v) of PFA: Firstly, 700 mL of water was stirred under magnetic force to accelerate temperature rise, a few drops of IM sodium hydroxide solution was added to assist dissolution after temperature rise, then 40 g of paraformaldehyde (PFA) was added and stirred to be completely dissolved, 100 mL of heated 10?PBS was added to the solution, the volume thereof was made up to 1 L with water, the pH value was adjusted to 8.0, the mixed solution was filtered and aliquoted into 50 mL centrifuge tubes, and the centrifuge tubes were placed in a refrigerator at 4? C. to be stored after being cooled.
[0177] The separated and purified microglia were seeded into a 12-well plate paved with a cover glass coated by PDL, when the cell confluence reached about 70%, the culture medium was discarded and PBS was used for washing three times (5 minutes for each time), the PBS was discarded, 4% (w/v) of PFA was used for fixation at 4? C. for 20 minutes and PBS was used for washing three times (5 minutes for each time), and then 0.2% (w/v) of Triton X-100-PBS was used for permeabilization at room temperature for 5 minutes and PBS was used for washing three times (5 minutes for each time). The fixed cells were blocked by incubation with 10% BSA (PBS) for 1 hour at room temperature and washed twice with PBS. The cell slide was placed in a dark box and incubated overnight at 4? C. with anti-Iba1 antibody, washed three times with PBS (5 minutes for each time). Fluorescence-labeled secondary antibody was added and incubated in the dark for 1 hour at room temperature, and PBS was used for washing four times (5 minutes for each time). Anti-fluorescence quenching mounting solution containing DAPI dye was added, the cover glass was reversely buckled on the glass slide, and the cell slide was sealed with transparent nail polish and placed in a dark box for assay. The primary antibody was diluted at 1:500, and the secondary antibody was diluted at 1:1000.
[0178] 3 fluorescence pictures were randomly selected and the entire picture was analyzed using Image-pro-plus software. The red spot was the number of positive cells, the blue spot was the total number of nuclei, and the positive cell rate was calculated. Calculation formula: Positive cell rate (%)=the number of positive stained cells/total number of nuclei?100%. The purity of the purified microglia in the experiment was >95% after the positive cell rate was calculated, and the purified microglia can be used for subsequent experiments.
1.4 Fluorescent Staining and Living-Cell Imaging
[0179] Primary microglia requiring live-cell imaging were inoculated in a glass-bottom culture dish, and the old culture medium was replaced with a serum-free culture medium for overnight culture before the experiment. 1 mM Lyso Tracker Red DND-99 was diluted to 50 nM in MEM complete medium containing 10% FBS; after the old culture medium was replaced with the loading solution containing the fluorescent probe, the culture dish was placed in a CO.sub.2 incubator for incubation for 30 minutes to stain lysosomes of the living cells, and intracellular ATP was stained with Quinacrine diluted to 100 nM in complete medium. Fluorescence pictures were taken with a Nikon inverted microscope (Nikon Eclipse Ti-E, Japan) using a Plan Apo 60?1.40-fold oil lens as objective lens, real-time live cell imaging was performed by continuous laser scanning, wherein the emission of Lyso Tracker was 561 nm, and the emission of Quinacrine was 488 nm. High-concentration PAO mother liquor was added into a cell culture medium in a spotting manner to enable the final concentration of the PAO mother liquor in the culture medium to be 100 nM, timing was performed from the 0.sup.th second of PAO addition in spotting, a fluorescence image was collected every 10 seconds by time lapse shooting, wherein the total shooting time was 500 seconds, and fluorescence image analysis was performed by using Volocity software (PerkinElmer). The laser power used in the time lapse shooting was reduced as much as possible (<1%) to avoid possible fluorescent bleaching.
1.5 Treatment of Cells by PI4KIII? Inhibitor
[0180] Primary microglia were treated with phenylarsine oxide (PAO) which was a specific inhibitor of PI4KIII? at a low concentration. Primary microglia cultures were incubated with PAO at concentrations of 0, 25 or 100 nM diluted with complete medium for 1 hour, respectively, and then cell samples were collected for lysosomal exocytosis imaging or culture solution was collected for determining ATP concentration in extracellular fluid. Microglia were treated with MEM culture solution containing 10% FBS without PAO as a control experiment.
1.6 Determination of ATP Concentration in Cell Culture Solution
[0181] The content of ATP in extracellular fluid was determined by bioluminescence method using a luciferase reporter experiment. Microglia were starved in serum-free MEM medium overnight. In order to prevent ATP hydrolysis, the ATP hydrolase inhibitor Dipyridamole (10 ?M) was added to the medium throughout the experiment. 0, 25, 100 nM of PI4KIII? inhibitor PAO was added to the medium, respectively, and the medium was collected after incubation for 0, 4, 6, 8, 15, 30, and 60 minutes, respectively. 50 ?L of the ATP assay mixture containing luciferase-luciferin buffer was added to an opaque white 96-well plate, the plate was allowed to stand for two minutes to consume ATP in the wells, and then 50 ?L of the sample was added to the wells. The luminescence value of the solution was measured using a Varioskan Flash (Thermo Fisher Scientific) multifunctional microplate reader. A standard curve was obtained from the luminescence value of the standard ATP sample, and the content of ATP in the sample was obtained by reference to a standard equation. Data were presented as mean?SEM of at least 3 experiments per group. Statistical data analysis was performed using one-way ANOVA analysis.
1.7 Determination of Total Protein Content in Cells
[0182] Old cell culture medium was aspirated and PBS buffer was added for washing 3 times, PBS was discarded, and RIPA lysate containing 1% protease inhibitor (100 ?L/well in 12-well plate) was added, the plate was placed on ice for lysis for 30 minutes, and then the cells at the bottom of the wells were scraped with a cell scraper and placed in a 1.5 mL centrifuge tube, followed by centrifugation at 15000 rpm for 30 minutes at 4? C. to collect supernatant and determine the total protein content therein. A working solution and a standard solution were formulated according to the requirements of the specification, the sample and the working solution were added into a 96-well plate in a ratio of 1:8, that is, 25 ?L of the sample, BSA standard solution and 200 ?L of the working solution were added into each well, the mixture was uniformly mixed on a flat plate oscillator for 30 seconds, then the well plate was covered with an aluminum foil and incubated for 30 minutes at 37? C., and the absorbance at 562 nm of the well plate was measured after the well plate was cooled to room temperature. The total intracellular protein concentration can be calculated from a standard curve.
1.8 Statistical Analysis
[0183] Data processing was analyzed using GraphPad Prism 5 software. One-way ANOVA analysis was used for treatment, mean?SEM, p<0.03 indicates that there was a statistical difference.
1.9 Promotion of Decrease of Microglial Lysosomal Fluorescence Intensity by Inhibiting PI4KIII?
[0184] The purity of the purified microglia in the experiment was >95% after the positive cell rate was calculated, and the purified microglia can be used for subsequent experiments.
[0185] For cultured microglia (from C57B6 or PI4KA.sup.?/+ mutant mice, respectively), 1 mM LysoTracker Red DND-99 was diluted to 50 nM, and after the old culture medium was replaced with the loading solution containing the fluorescent probe, the culture dish was incubated for 30 minutes to stain lysosomes of the living cells. After the primary microglia cell cultures were cultured with PAO at 100 nM concentration or culture medium for 1 hour, fluorescence imaging was performed (
[0186]
1.10 Decrease of Lysosomal Fluorescence in Microglia by BPB
[0187] In order to further validate this kiss-and-run fusion format, a membrane-impermeable fluorescence quencher, bromophenol blue (BPB), was introduced at a working concentration of 1 mM. BPB can diffuse rapidly through the fusion pore formed during the kiss-and-run process to quench residual fluorescence on the leaflets inside the lysosome membrane. Primary microglia without any treatment could undergo regular exocytosis, allowing a small amount of BPB to enter the cell, while when PI4KIII? enzyme activity was inhibited, a large amount of BPB entered inner lobe of lysosome through the fusion pore produced in the kiss-and-run process, causing a brief quenching of intracellular lysosomal fluorescence (
[0188]
1.11 Recovery/Increase of Microglial Lysosomal Fluorescence Caused by Dispersion of BPB Out from Lysosomes
[0189] In addition, when incubation was performed in BPB solution for 1 hour, BPB entered cells through conventional exocytosis to reach a limited concentration, so that lysosomal fluorescence was quenched; at this time, down-regulation of PI4KIII? enabled kiss-and-run fusion of the lysosomes with the cytoplasmic membrane, and BPB diffused out of the lysosomes before the lysosomal dye dissociated; at this time, the lysosomal fluorescence that was temporarily quenched re-emitted (
[0190]
1.12 Promotion of Extracellular ATP Secretion of Microglial Lysosomes by PI4KIII? Inhibitor
[0191] It has been reported in literature that extracellular ATP played an important role in promoting the fusion of lysosomes with cytoplasmic membranes, and it had been verified that a large amount of ATP accumulated in microglia (Dou Y, Wu H J, Li H Q, et al. Microglial migration mediated by ATP-induced ATP release from lysosomes [J]. Cell Research, 2012, 22(6): 1022-1033; Imura Y, Moriza W A Y, Komatus R, et al. Microglia release ATP by exocytosis [J]. Glia, 2013, 61(8): 1320-1330; Zhang Z, Chen G, Zhou W, et al. Regulated ATP release from astrocytes through lysosome exocytosis [J]. Nature Cell Biology, 2007, 9(8): 945-953). Inhibition of PI4KIII? promoted kiss-and-run fusion of microglial lysosomes with the cell membrane, so as to release ATP from the lysosomes. The ATP was released extracellularly to further promote the fusion of lysosomes with cell membrane, so as to release the cell degradation products and cytotoxic substances in lysosomes, such as ? amyloid. In order to verify accumulation and release of ATP in lysosomes, the present invention used 100 nM Quinacrine to label intracellular ATP (
[0192] In
EXAMPLE 2. PROMOTION OF EXOCYTOSIS OF NEURONAL LYSOSOMES BY PI4KIII? INHIBITORS
2.1 Isolation and Culture of Primary Hippocampus Neuronal Cells
[0193] Pregnant mice for 18-20 days were anesthetized with anesthetic (1.2% Abamectin injected into abdominal cavity at 0.3 mL/10 g), embryos were collected and placed into a sterilized beaker, the mouth of the beaker was sealed with a thin film glove and transferred to a cell room. The head was cut, the brain was taken, the taken brain tissue was placed in a cell culture dish containing DMEM high-glucose culture medium, and then hippocampus was separated under an anatomic microscope and placed in DMEM high-glucose culture medium, and meninges and blood vessel attached to hippocampus were peeled off, torn up with forceps, and sucked into a 12-well plate. After DMEM high-glucose medium was added for rinse thoroughly, the DMEM high-glucose medium was carefully aspirated by a micropipette, and then the plate was added with 1 mL of 0.125% trypsin, and placed in an incubator with carbon dioxide at 37? C. for gentle digestion for 8 minutes; the plate was taken out every 4 minutes and shaken to ensure uniform digestion, the trypsin was carefully aspirated and discarded, and fetal bovine serum (FBS) (about 20% of the total volume) was added to stop the digestion reaction for 1.5-2 minutes. The FBS was carefully aspirated, and inoculum (DMEM-HG), was added, pipetted 10 times and then allowed to stand for 2 minutes; free single cells were in the supernatant, lumps were deposited on the bottom, the supernatant was transferred to an ice-bath culture dish, and the deposited lumps were discarded after the above operations were repeated three times. The cells were counted after the cells were pipetted uniformly, each well of the blood counting plate needed to be counted, and if the cells were not uniformly distributed, the cells needed to be counted again. After counting was completed, inoculum was added to uniformly pipette cells, and the cells were seeded in a cell culture plate (typically 6-well plate at 1*10.sup.5 cells/well, and so on, the number of cells were increased as appropriate if transfection was required). The plate was placed in an incubator with CO.sub.2 for incubation for 4 hours, then the old medium was replaced with the neurobasal culture medium, the liquid in the plate was slightly shaken during medium replacement, and the plate was washed with inoculum at 37? C. to detach loosely attached vascular cells. Thereafter, half of the medium was changed every two days, and culture was performed in vitro for 10 days (DIV10) for subsequent experiments.
2.2 Promotion of Decrease of Lysosomal Fluorescence Intensity of Neuronal Cells by Inhibiting PI4KIII?
[0194] Primary hippocampal neurons were isolated from the hippocampus of WT embryonic mice, and PI4KIII? drug inhibition was performed on the primary neuronal cells, and lysosomal changes in the drug treated wild-type neuronal cells and non-drug treated wild-type neuronal cells were compared, respectively (
[0195]
EXAMPLE 3. INHIBITION OF DECREASE IN INTRACELLULAR ?-SYNUCLEIN PROTEIN LEVELS BY PI4KIII? INHIBITORS
3.1 Culture of PC12, SH-SY5Y Cell Lines
[0196] The PC12 complete culture system was prepared by adding 10% HS and 5% FBS into high-glucose DMEM; and SH-SY5Y complete culture system was prepared by adding 15% FBS in high-glucose DMEM.
3.2 Immunofluorescent Staining of PC12 and SH-SY5Y Cells
[0197] After the cell culture systems were treated by the drug, the following operations was performed, fixation: treating with 4% PFA for 30 minutes; permeabilization: treating with 0.1% Triton-X for 15 minutes; and blocking: blocking with 10% donkey serum for 1 hour; primary antibody: mouse anti-?-synuclein; secondary antibody: anti-Mouse Alex 555.
3.3 ?-Synuclein ELISA Assay
[0198] 50 ul Hu ?-synuclein Detection Antibody solution was added to each well (except for chromogen blanks empty, that is, blank colorimetric well), 50 ul sample and standard curve regent (prepared in the following figure) were added to each well (except for chromogen blanks empty), and gentle shaking was performed for homogeneous mixing, and a film was used for covering wells and incubation was performed overnight at 4? C.; after the wells were fully washed four times with 100 ul of 1? Wash buffer, each well was added with 100 ul of Anti-Rabbit IgG HRP except the chromogen blanks empty, a film was used for covering wells and incubation was performed for 30 minutes at room temperature, and the wells were fully washed four times with 1? Wash buffer again; each well was added with 100 ?L of Stabilized Chromogen, the solution turned blue, and the wells were incubated for 30 minutes at room temperature in a dark place; and each well was added with 100 ?L of Stop Solution. The mixture was mixed uniformly by gentle shaking, the solution turned yellow, and read was performed with a microplate reader (wavelength: 450 nm).
3.4 Treatment of Cells by PI4KIII? Inhibitor
[0199] PC12 or SY cell culture systems: 10% HS+5% FBS+high-glucose DMEM, culturing to 40-60% culture dishes, and Fugene HD transfection reagent was used to transfect ?-synuclein over-expression plasmid. After 24 hours of culture, starvation culture was performed for 24 hours (serum was removed), and the culture system was changed to the normal culture system, and Lyso-tracker was added for treatment for 30 minutes, followed by fresh culture medium replacement and PAO treatment. PAO treated group: Immunocytochemical staining was performed after treatment for 10 minutes at 25 nM, 50 nM, 100 nM.
3.5 Determination of Cell Viability by Thiazolyl Blue (MTT) Assay
[0200] The drug was administrated for treatment for 12 hours, MTT at a final concentration of 05. mg/mL was added, the culture solution was aspirated after 4 hours of incubation, 100 ?L of DMSO was added to dissolve the adsorbed MTT, and the absorbance value was read after 15 minutes of shaking.
3.6 Plasmid Transfection
[0201] The information of the ?-synuclein over-expression plasmid was as follows:
TABLE-US-00001 (SEQIDNO:4) ATGGATGTATTCATGAAAGGACTTTCAAAGGCCAAGGAGGGAGTTGTGG CTGCTGCTGAGAAAACCAAACAGGGTGTGGCAGAAGCAGCAGGAAAG ACAAAAGAGGGTGTTCTCTATGTAGGCTCCAAAACCAAGGAGGGAGTG GTGCATGGTGTGGCAACAGTGGCTGAGAAGACCAAAGAGCAAGTGACA AATGTTGGAGGAGCAGTGGTGACGGGTGTGACAGCAGTAGCCCAGAAG ACAGTGGAGGGAGCAGGGAGCATTGCAGCAGCCACTGGCTTTGTCAAA AAGGACCAGTTGGGCAAGAATGAAGAAGGAGCCCCACAGGAAGGAAT TCTGGAAGATATGCCTGTGGATCCTGACAATGAGGCTTATGAAATGCCT TCTGAGGAAGGGTATCAAGACTACGAACCTGAAGCCTAA
[0202] The ?-synuclein ELISA Kit was purchased from Thermo Fisher Scientific (Catalog No. KHB0061). Fugene HD transfection reagent was purchased from Promega (Beijing) Biotech Co., Ltd. (Catalog No. E2311); and ?-synuclein monoclonal antibody (Mouse monoclone) was purchased from Sigma-Aldrich (Shanghai, Catalog No. S5566).
3.7 PAO Inhibition of Cell Death or Apoptosis Caused by Over-Expression of ?-Synuclein in SH-SY5Y Cells
[0203] The hallmark cytopathological feature of Parkinson's disease patients is the occurrence of protein aggregation dominated by misfolded ?-synuclein proteins. These aggregated proteins are thought to cause cytotoxicity because they cannot be cleared in time. The present invention transfected SH-SY5Y cell line with ?-synuclein over-expression (?-syn-OE) plasmid, and after 24 hours, PAO treatment was given for 12 hours. Cell viability rate was then determined for each group by MTT assay and compared to the ?-syn-OE group (
[0204] After One-way ANOVA analysis, the results show as follows:
3.8 Promotion of ?-Synuclein Secretion by PAO Series Compounds
[0205] The present invention further assayed the characteristic of PAO for promoting the secretion or excretion of ?-synuclein. The cultured PC12 and SH-SY5Y cell lines were transfected with ?-synuclein over-expression plasmids by using Fugene HD transfection reagents, respectively, the old culture system was replaced with a complete culture system after starvation treatment was performed for 24 hours, meanwhile, the compound PAO or PAO derivative p-methyl phenyl arsine oxide was used for treatment for 4 hours, and the ?-synuclein level in the supernatant of the cell culture solution was determined by ELISA.
[0206] The PAO derivative p-methyl phenyl arsine oxide has the following chemical formula:
##STR00024##
[0207]
3.9 Promotion of Decrease in Intracellular ?-Synuclein Protein Levels by PAO
[0208] The present invention firstly performed PAO treatment on cells, and then determined the intracellular ?-synuclein protein level by an ELISA method and Western blot. The cell culture and drug treatment manner were the same as above. In
EXAMPLE 4. PROMOTION OF SECRETION OF HTT AND SOD1 PROTEINS BY PI4KIII? INHIBITORS
4.1 SOD1 ELISA Assay
[0209] 100 ul of the diluted standard curve regent, blank control and sample were added to the corresponding well of the assay well plate. The plate was covered with a film and incubated at 37? C. for 2 hours; the liquid in each well was discarded, and each well was added with 100 ul Detection Reagent A Working Solution and the plate was covered with a film and incubated at 37? C. for 1 hour; the supernatant was discarded, and each well was washed 3 times with 1? Wash buffer for 2 minutes each time with as no liquid residue as possible; each well was added with 100 ul Detection Reagent B Working Solution and the plate was covered with a film and incubated at 37? C. for 1 hour; the washing operation was repeated 5 times; and each well was added with 90 ?L of Substrate Solution and the plate was covered with a film and incubated for 20 minutes at 37? C. in the dark. The solution turned blue; 50 ?L of Stop Solution was added to each well, the mixture was mixed uniformly by gently shaking, the solution turned yellow, and read was performed with a microplate reader as soon as possible (absorption wavelength: 450 nm).
4.2 Human Huntington ELISA Assay
[0210] 50 ul of the diluted standard curve regent, blank control and sample were added to the corresponding well of the assay well plate; and 50 ul of Detection A Working Solution was immediately added to each well. After gently shaking for mixing uniformly, the plate was covered with a film and incubated at 37? C. for 1 hour; the liquid in each well was removed, the supernatant was discarded, and each well was washed 3 times with 1? Wash buffer for 2 minutes each time with as no liquid residue as possible; 100 ul of Detection Reagent B Working Solution was added to each well. The plate was covered with a film and incubated for 45 minutes at 37? C., and the washing operation was repeated 5 times; and each well was added with 90 ul of Substrate Solution. the plate was covered with a new film and incubated for 10-20 minutes at 37? C. in the dark; and 50 ul of Stop Solution was added to each well, the mixture was mixed uniformly by gently shaking, the solution turned yellow, and read was performed with a microplate reader immediately (absorption wavelength: 450 nm).
4.3 Transfection Reagents
[0211] The transfection PC12 cell line was transfected with either HTT (1-586aa) (HTT (1-586aa) over-expression plasmid was capable of expressing the N-end of HTT protein which was an important part for HTT protein shuttling) or SOD1 over-expression plasmid using Fugene HD transfection reagent.
4.4 Plasmid Transfection
[0212] The following plasmids were purchased from Obio Technology (Shanghai) Corp., Ltd: [0213] 1) Gene name: HTT (1-586aa); GenBank ID:NM_002111; [0214] 2) Gene name: SOD1, gen ID: 6647.
[0215] Human Superoxide Dismutase 1, Soluble (SOD1) ELISA Kit was purchased from Signalway Antibody LLC. (SAB, Catalog No. EK16688); Human Huntington (HTT) ELISA Kit was purchased from Signalway Antibody LLC. (SAB, Catalog No. EK2869).
4.5 Promotion of Secretion of HTT and SOD1 Proteins by PI4KIII? Inhibitors
[0216] In neurological diseases, the HTT and SOD1 proteins are also closely related to the development of various neurological diseases, with Huntington disease is related to HTT proteins and amyotrophic lateral sclerosis is related to SOD1 proteins. The PC12 cell line was transfected with either HTT (1-586aa) (HTT (1-586aa) over-expression plasmid was capable of expressing the N-end of HTT protein which was an important part for HTT protein shuttling) or SOD1 over-expression plasmid using Fugene HD transfection reagent; after being cultured for 24 hours, starvation treatment was performed for 24 hours, and then the system was replaced with a normal culture system, compound PAO was used for treatment for 4 hours, and the levels of HTT protein and SOD1 protein in the supernatant of cell culture fluid were determined through ELISA. The results showed that the 25 nM, 50 nM, 75 nM, and 100 nM PAO treated groups significantly promoted HTT protein secretion in the PC12 cell line compared to the HTT OE group (
EXAMPLE 5. ALLEVIATION OF CBE-INDUCED LYSOSOMAL AGGREGATION BY INHIBITING PI4KIII?
5.1 Alleviation of CBE-Induced Cytotoxicity by PAO Promoting Lysosomes
[0217] Gaucher disease is a common type of lysosome storage disease (LSD). Specifically, because of the activity deficiency of acid ?-glucosidase or glucocerebrosidase (GCase) in the body caused by the gene mutation of glucocerebrosidase, the substrate glucocerebroside of glucocerebrosidase is stored in macrophage lysosome of various organs including liver, spleen, bone, lung and even brain, so that the affected tissue and organ have pathological changes, and multiple organs are affected and become progressively aggravated clinically. Conduritol B Epoxide (CBE) is a commonly used inhibitor of ?-glucosidase, and CBE is used herein to examine the regulation of Gaucher disease by PAO.
[0218] The following concentrations of CBE were added to the cultured SH-SY5Y cell line, respectively: 1.5 ?M, 3 ?M, 6.25 ?M, 12.5 ?M, 25 ?M, 50 ?M and 100 ?M, and after 72 hours of treatment cell viability was determined. The results showed that cell death or apoptosis caused by 50 ?M and 100 ?M of CBE treatment for 72 hours was significantly different compared to the control group (ctrl) (
5.2 Promotion of Lysosomal Release and Reduction of Intracellular Accumulation of Multiple GlcCer by PAO
[0219] Because PAO could induce lysosomal release, the present invention combined PAO and CBE to test whether PAO could affect lysosomal release. Lysosome tracker (LysoTracker) was added to label lysosomes after SH-SY5Y cells were treated with 100 ?M CBE for 72 hours. The results showed that the number of Lyso Tracker-labeled positive cells in the 100 ?M CBE-treated group was significantly increased compared to that of the negative control group (
[0220] PAO reduced accumulation of glucosylceramide (GlcCer) in CBE-treated cells. The fundamental defects of GD are the lack of activity of glucocerebrosidase that primarily mediates the breakdown of glucocerebroside into glucose and GlcCer, and thus the storage of substrates such as GlcCer occurs in cells from GD patients or CBE treated cells. In order to further explore whether PAO has an effect on GlcCer storage in SH-SY5Y cell model, we measured GlcCer content of different side chains within cells by LC-MS assay. The results showed that the concentration of GlcCer of various side chains in cells treated with 100 ?M CBE was much higher than that in the control group (ctrl), and the concentration of GlcCer in the 100 ?M CBE and 50 nM PAO co-treated group decreased as compared to the group treated with 100 ?M CBE (
[0221] Compounds A1 and G1 are also specific inhibitors of PI4KIII?. SH-SY5Y was treated with 100 ?M CBE for 72 hours, then Lysosome tracker (Lyso-tracker) was added to label lysosomes; after 30 minutes, 50 nM or 75 nM A1 or G1 was given for treatment for 10 minutes. The results showed that the number of Lyso-tracker labeled positive cells in the 100 ?M CBE-treated group was significantly increased compared to the negative control group, and treatment with 50 nM and 75 nM A1 or G1 for 10 minutes resulted in fewer Lyso-tracker labeled positive cells as compared to 100 ?M CBE treatment (
5.3 Promotion of Lysosomal Exocytosis or Reduction of Lysosomal Storage by Knockdown of P14K?
[0222] Previous studies showed that PAO at low concentrations (<5 ?M) acted mainly on phosphatidylinositol 4-kinase PI4KIII?, and in order to further explore the role of PAO target PI4KIII? in lysosomal storage diseases and protein misfolding-related diseases, we designed shRNA interfering lentiviral vectors (with green fluorescent protein GFP expression sequence) against the gene sequence PI4K? encoding PI4KIII? protein. The results for Western blot assay showed that 48 hours after transfection of SH-SY5Y cells with three shRNA interfering lentiviral vectors against PI4K?, the interfering sequences sh1, sh2 and sh3 significantly reduced the expression level of PI4KIII? in the treated group (
EXAMPLE 6. PROMOTION OR ACTIVATION OF AUTOPHAGY AND ACTIVATION OF AUTOPHAGIC FLUX BY INHIBITING PI4KIII?
[0223] Previous studies showed that ALP was blocked during development of lysosomal storage diseases such as GD. After SH-SY5Y cells were treated by CBE for 48 hours, PAO or mTOR inhibitor Rapamycin (RAPA) (as positive control) with different concentrations was added respectively, incubated for 24 hours, and subjected to Western blot assay or immunofluorescence assay, and the effect of compounds such as PAO on autophagy-lysosome pathway was researched by observing common markers to ALP. The markers LC3B and p62 common to ALP were detected, and western blot assay showed: in the SH-SY5Y cell model constructed by CBE, PAO dose-dependently promoted LC3B protein expression and inhibited p62 protein level, indicating that PAO activated the ALP pathway and activated autophagic flux (
[0224] ALP pathway marker LC3B was detected on SH-SY5Y cells treated with shRNA interfering lentiviral vector, and the results showed: compared with the sh-ctrl group, LC3B protein levels were significantly increased after knockdown of PI4K? (
EXAMPLE 7. DECREASE OF INTRACELLULAR CHOLESTEROL ACCUMULATION IN NIEMANN-PICK TYPE C (NPC) BY INHIBITING PI4KIII? (FIG. 16)
[0225] U18666A, an inhibitor of intracellular cholesterol transport, is often used to construct a cell model of Niemann-Pick Type C (NPC).
1 Cell Culture and Compound Treatment
[0226] SH-SY5Y cells were cultured in a complete medium of high-glucose DMEM plus 15% FBS in an incubator at 37? C., 5% CO.sub.2. When the cells were 70% confluent, 10 ?M U18666A (purchased from Absin Bioscience Inc., Cat. No: abs819512) was added and d5PAO and PAO at different depths were added according to the grouping, and cultured for 24 hours.
2 Filipin Staining
[0227] 1) The culture medium in the 24-well plate was discarded, the plate was added with 1 mL PBS buffer and left to stand for 1 minute, the liquid in the 24-well plate was discarded, and the above steps were repeated 2 times;
[0228] 2) 1 mL of 4% paraformaldehyde was added into each well and fixation was performed at room temperature for 30 minutes;
[0229] 3) 4% paraformaldehyde in the 24-well plate was discarded, 1 mL PBS buffer was added and the 24-well plate was slightly shaken for 1 minute, the liquid in the 24-well plate was discarded, and the above steps were repeated 2 times;
[0230] 4) 1 mL of 1.5 mg/mL glycine solution was added to each well, and the plate was incubated at room temperature for 10 minutes;
[0231] 5) the liquid in the 24-well plate was discarded, and 1 mL of 50 ug/mL Filipin staining solution (purchased from Sigma-Aldrich, Catalog No: SAE0087) was added, and incubation was performed for 1 hour at room temperature in the dark;
[0232] 6) the liquid in the 24-well plate was discarded, 1 mL PBS buffer was added and the 24-well plate was slightly shaken for 1 minute, the liquid in the 24-well plate was discarded, and the above steps were repeated 2 times;
[0233] 7) the glass slide was taken, 5 microliters of a mounting medium (containing DAPI) were added dropwise on the center of the glass slide, the cell slide was taken, dried, and covered on the glass slide with the side with the cells facing downwards to ensure that the cell slide was fully contacted with the mounting medium, and the cells were incubated for 30 minutes at room temperature in the dark.
[0234] 8) Observation was performed by using a laser confocal microscope.
Experimental Results
[0235] SH-SY5Y cells were treated with 10 ?M U18666A, incubated for 24 hours with PAO at different concentrations added according to the grouping, and observed after Filipin staining. Immunofluorescence staining results indicated that the Filipin staining fluorescence intensity in the 10 ?M U18666A-alone treated group was enhanced as compared to the control group (ctrl), suggesting that the 10 ?M U18666A treatment resulted in an increase in the amount of cholesterol bound to Filipin, i.e., cholesterol storage. The Filipin staining fluorescence intensity in the 10 ?M U18666A and 35 nM, 70 nM PAO co-treated group decreased as compared to the 10 ?M U18666A-alone treated group (
[0236] It will be apparent to those skilled in the art that, although specific embodiments of the present invention have been described herein for purposes of illustration, various modifications may be made without deviating from the spirit and scope of the present invention. Therefore, the detailed description of embodiments and examples of the present invention should not be construed as limiting the scope of the present invention. The present invention is not limited except as by the appended claims. All documents cited herein are incorporated by reference in their entirety.