Mutant-type RNase R, and preparation method therefor and application thereof
12054759 ยท 2024-08-06
Assignee
Inventors
- Ming Liu (Guangzhou, CN)
- Qiujie CAI (Guangzhou, CN)
- Wanjun ZHANG (Guangzhou, CN)
- Maolei ZHANG (Guangzhou, CN)
Cpc classification
C12N9/22
CHEMISTRY; METALLURGY
C12Q1/6806
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
C12N9/22
CHEMISTRY; METALLURGY
Abstract
The present invention relates to the technical field of molecular biology, and in particular, to a mutant-type RNase R and a preparation method therefor and application thereof. The mutant-type RNase R provided by the present invention is designated RNase R_?M8, an amino acid sequence of which is shown as SEQ ID NO. 5, and a nucleotide sequence encoding the amino acid sequence is shown as SEQ ID NO. 6. Preparation processes of the mutant-type RNase R_?M8 provided by the present invention include vector construction, vector transformation, protein induction expression, bacteria collection, protein purification, activity assay, etc. The mutant-type RNase R provided by the present invention improves the expression yield and salt tolerance of RNase R and is beneficial to meeting diverse RNA sample requirements.
Claims
1. A mutant-type RNase R, wherein an amino acid sequence of the mutant-type RNase R is shown as SEQ ID NO: 5.
2. A nucleic acid encoding the mutant-type RNase R according to claim 1, wherein a nucleotide sequence of the nucleic acid is shown as SEQ ID NO: 6.
3. A method for preparing the mutant-type RNase R according to claim 1, comprising: S1: constructing a vector containing a nucleotide sequence encoding the mutant-type RNase R; S2: transforming the vector obtained in the step S1 to BL21 E. coli cells to obtain an expression strain; S3: culturing expandedly the expression strain obtained in the step S2 and performing protein induction expression; S4: collecting the expandedly cultured expression strain and performing washing and lysis; S5: performing protein purification; and S6: performing protein activity assays.
4. The preparation method according to claim 3, wherein a process of the constructing a vector in the step S1 is as follows: (1) perform amino acid sequence alignment of E. coli-derived wild-type RNase R with RNase R derived from a salt-tolerant (Psychrobacter sp.) strain ANT206, identify amino acid residues having a significant effect on salt tolerance, and perform truncation mutation on the amino acid residues to obtain an amino acid sequence shown as SEQ ID NO: 5; (2) amplify a nucleotide sequence encoding the mutant-type RNase R using a PCR technique with RNase R-F/RNase R_?M8-R and RNase R_?M8-F/RNase R-R as primers respectively and a plasmid containing an E. coli-derived RNase R-WT gene as a template to obtain a PCR product; (3) separate the PCR product obtained in the step (2) by agarose gel electrophoresis and then perform gel cutting and purification to obtain two DNA fragments; (4) subject a pET21a vector after NdeI/XhoI digestion to a homologous recombination reaction with the DNA fragments obtained in the step (3), and gently and uniformly mix a reaction solution with a cloning strain Trans1-T1 Phage Resistant Chemically Competent Cell to obtain a mixed solution; (5) place the mixed solution obtained in the step (4) in a low-temperature ice bath for 3 min, in a water bath at 42? C. for heat shock for 30 s, and then immediately in an ice bath for 2 min, add 200 uL of LB culture solution, spread a mixture thereof on a flat plate containing ampicillin, perform overnight cultivation at 37? C., pick 3 single clones on the next day, and perform sequencing for verification, wherein a sequence of the primer RNase R-F in step (2) is shown as SEQ ID NO: 9, and a sequence of the primer RNase R_?M8-R is shown as SEQ ID NO; 10; a sequence of the primer RNase R_?M8-F is shown as SEQ ID NO: 11; and a sequence of the primer RNase R-R is shown as SEQ ID NO: 12.
5. The preparation method according to claim 4, wherein the low temperature in the step (5) is ?20? C.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(6) The present invention is further explained below with reference to embodiments, but it should be noted that the following embodiments are only used to explain the present invention rather than to limit the present invention, and all technical solutions identical or similar to the present invention fall within the protection scope of the present invention. Where no specific techniques or conditions are noted in the embodiments, operations are performed according to conventional technical methods and content of instrument specifications in the art; and where no manufacturers are noted for reagents or instruments used herein, they are all conventional products that are commercially available.
Embodiment 1 Construction of a Mutant-Type RNase R Expression Vector
(7) E. coli-derived wild-type RNase R (amino acid sequence shown as SEQ. NO. 1) was subjected to amino acid sequence alignment with RNase R derived from a salt-tolerant Psychrobacter sp. strain ANT206 (amino acid sequence shown as SEQ. NO. 3) (alignment results shown in
(8) Primers were designed according to mutation points, the sequences of which are as follows: RNase R-F: TAACTTTAAGAAGGAGATATACATATGCATCATCATCATCATCATTCACAAG (SEQ.ID NO.9); RNase R_?M8-R: TGCCGGTTTCAGTGGTGTTGCCCTG (SEQ.NO.10); RNaseR_?M8-F: GCAACACCACTGAAACCGGCATGCTGCAACTGGGTCAGCAC (SEQ. NO.11); RNase R-R: TCAGTGGTGGTGGTGGTGGTGCTCGAGTCACTCTGCCACTTTTTTCTTCG (SEQ.NO.12);
(9) A modified RNase R_?M8 gene (sequence shown as SEQ ID NO. 6) was amplified by PCR, and fragments 1843 bp and 665 bp were amplified respectively with RNase R-F/RNase R_?M8-R and RNase R_?M8-F/RNase R-R as primers respectively and a plasmid containing an E. coli-derived RNase R-WT gene (shown in
(10) After the above PCR product was separated by agarose gel electrophoresis, gel cutting and purification were performed by cutting off gel containing target DNAs and then purifying the DNAs using an agarose gel DNA extraction mini kit (Magen, article number: D2111-03). The two DNA fragments obtained after purification were subjected to a homologous recombination reaction with a pET21a(+) vector after NdeI/XhoI digestion through the Hieff Clone? Plus One Step Cloning Kit (Yesean, article number: 10911ES20). Here, the process of NdeI/XhoI digestion of the pET21a(+) vector was carried out as follows: 30 ?L of a digestion system containing 3 ?g of pET21a(+) plasmids, 3 ?L of 10? FastDigest Green Buffer, 1.5 ?L of FastDigest NdeI, 1.5 ?L of FastDigest XhoI, and H.sub.2O complementing to 30 ?L was prepared and uniformly mixed by vortexing, and then subjected to a reaction at 37? C. for 2 h.
(11) 10 ?L of the reaction solution was gently and uniformly mixed with 50 ?L of cloning strain Trans1-T1 Phage Resistant Chemically Competent Cell (TransGen, article number: CD501-02), a mixture thereof was placed in a low-temperature ice bath for 3 min, in a water bath at 42? C. for heat shock for 30 s, and then immediately in an ice bath for 2 min in order, 200 ?L of LB culture solution was added, and a mixture thereof was spread on a flat plate containing ampicillin. After overnight cultivation at 37? C., 3 single clones were picked on the next day, and sequencing was performed for verification.
(12) The cloned strain whose sequencing result conformed to SEQ NO. 6 was designated RNase R_?M8 (Trans1-T1), inoculated into 500 ?L of LA culture solution, and then subjected to shaking culture at 37? C. for 5 h; 500 ?L of 50% sterile glycerol was added; and a mixture thereof was stored at ?80? C. after uniform mixing.
(13) 10 ?L of the glycerol stock obtained above was inoculated into 5 mL of LA culture solution, overnight shock was performed at 37? C., plasmids were extracted on the next day using Hi Pure Plasmid EF Mini Kit (Magen, article number: P1111-03), and the obtained plasmids were RNase R_?M8-pET21a(+) vectors. 100 ng of RNase R_?M8-pET21a(+) plasmids were used for transforming E. coli BL21 (DE3) by a heat shock method to obtain a protein expression strain RNase R_?M8(BL21(DE3)), and the expression strain was also stored by adding glycerol.
Embodiment 2 Protein Expression
(14) The expression strain RNase R_?M8(BL21(DE3)) obtained in the Embodiment 1 was inoculated into 5 mL of LA culture solution and placed in a 200 rpm shaker at 37? C. for overnight shaking culture.
(15) On the next day, 5 mL of the overnight culture was inoculated into 500 mL of new LA culture solution and cultivated in a 200 rpm shaker at 37? C. for 3 h (OD value: about 0.5), 500 ?L of IPTG (1 M) was added into the culture solution (final concentration: 1 mM), and shaking cultivation was further performed in a 200 rpm shaker at 37? C. for 3 h. The shaken culture was centrifuged at 10,000 g for 5 min to collect bacteria and washed once with 5 mL of sterile PBS.
Embodiment 3 Protein Purification
(16) 40 mL of equilibrium wash buffer (50 mM of phosphate, 500 mM of NaCl, 20 mM of imidazole, 0.05% Tween 20, 10% Glycerol, pH 8.0) was added to the bacteria collected in the Embodiment 2, vortexing was performed until the bacteria were sufficiently resuspended, the centrifuge tube was fixed in an ice water bath and an ultrasonic probe was inserted 1-2 cm below the liquid level to conduct ultrasonic treatment (75% power, ultrasonic treatment for 4 s at an interval of 6 s, 10 min in total) until the bacteria solution was clear and transparent, the bacterial solution was centrifuged at 18,000 g at 4? C. for 60 min, and a supernatant (i.e., RNase R_?M8 protein lysis buffer) was transferred to a new centrifuge tube.
(17) Protein purification was performed using a protein purification system (Unique AutoPure, Inscinstech):
(18) Ni-NTA column purification: after the system tube and the Ni-NTA column (BBI, article number: C600792, specification of 1 mL) were flushed with DEPC treated water, the column was equilibrated with the equilibrium wash buffer. The sample was loaded at a flow rate of 0.8 mL/min, the heteroprotein was washed with the equilibrium wash buffer, and finally, an elution buffer (50 mM of phosphate, 500 mM of NaCl, 500 mM of imidazole, 0.05% Tween 20, 10% Glycerol, pH 8.0) was used for eluting and collecting the target protein.
(19) Concentration with an ultrafiltration tube: the target protein collected above was appropriately concentrated to 2 mL using an ultrafiltration tube (Millipore, UFC805024, 50K MWCO) and a refrigerated centrifuge.
(20) Desalting with a desalting column: after the system tube and the desalting column (GE, article number 29048684, specification of 5 mL) were flushed with DEPC treated water, the column was equilibrated with 2? storage buffer without glycerol (100 mM Tris-HCl (pH 7.5), 200 mM of NaCl, 0.2 mM of EDTA, 2 mM of DTT, 0.2% Triton? X-100). The sample was drawn and injected with a disposable syringe into a quantitative loop in a manual loading mode, and then passed through the column at a flow rate of 2 mL/min; the sample was collected when a protein peak appeared and sample collection was stopped when a salt peak appeared.
(21) The desalted enzyme solution was added to an equal volume of glycerol, and a mixture thereof was gently and uniformly mixed by inverting and then stored in a refrigerator at ?20? C. after centrifugation for a short time. Specific RNase R expression and purification conditions are shown in
Embodiment 4 Protein Quantification
(22) The obtained RNase R was subjected to SDS-PAGE simultaneously with different masses of BSA. Coomassie brilliant blue G250 staining was adopted after electrophoresis, photographs were taken after de-staining, and gray analysis was performed using Quantity One software. A standard curve was drawn with the Y axis representing gray values and the X axis representing BSA sample loading mass (shown in
(23) Table 1 Comparison of Yield between Wild-type RNase R and Mutant-type RNase R
(24) TABLE-US-00001 Enzyme Yield(?g) RNase R_WT 2020 RNase R_?M8 2735
Embodiment 5 Preparation of Reaction Substrate
(25) 1) A gene synthesis method was used for synthesizing primers required for PCR, with the sequences as follows: Linear_RNA1/2-F: 5 TAATACGACTCACTATAGGGAAAAAAGGAGGTTTTAGTCTAGGGAAAGTC ATTCA 3 (SEQ NO.13); Linear_RNA1-R:5TTGAAAAAATCATGAGATTTTCTCTCTTA 3 (SEQ NO.14); Linear_RNA2-R:5GGGAAAAAATCATGAGATTTTCTCTCTTA 3 (SEQ NO.15);
(26) 2) A DNA template was synthesized using PCR.
(27) With a plasmid containing a circ-ACE2 RNA sequence as a template, PCR amplification was performed using Linear_RNA1/2-F (SEQ NO.13) and Linear_RNA1-R(SEQ NO.14); after the PCR product was separated by agarose gel electrophoresis, gel cutting was performed for recovery to obtain a template DNA1, and the PCR amplification process here also employed the KOD One? PCR Master Mix-Blue-(TOYOBO, article number: KMM-201) kit for system preparation and was conducted under the following conditions: denaturation at 98? C. for 10 s, annealing at 58? C. for 5 s, extension at 68? C. for 1 s. and a cycle number of 40.
(28) With a plasmid containing circ-ACE2 RNA sequence as a template, PCR amplification was performed using Linear_RNA1/2-F (SEQ NO.13) and Linear_RNA2-R (SEQ NO.15) (the same process as that of DNA1); after the PCR product was separated by agarose gel electrophoresis, gel cutting was performed for recovery to obtain a template DNA2.
(29) 1) In Vitro Synthesis of Linear RNA Using T7 RNA Polymerase
(30) Linear_RNA1 (SEQ NO.7) with two complementary and paired ends but 2 bases protruding from the 3 end was synthesized by in vitro transcription using DNA1 as the template and TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific, article number: K0441) to serve as the target RNA in an RNase R specific digestion reaction.
(31) Linear_RNA2 (SEQ NO.8) with two fully complementary and paired ends was synthesized by in vitro transcription using DNA2 as the template and TranscriptAid T7 High Yield Transcription Kit (Thermo Scientific, article number: K0441) to serve as a control RNA in an RNase R specific digestion reaction.
(32) The above RNA synthesis and purification methods are as follows:
(33) (1) Synthesis of RNA by in vitro transcription. Linear_RNA1 and Linear_RNA2 were synthesized using DNA1 and DNA2 as templates respectively. As shown in Table 2, the reaction system was prepared in order and a reaction was allowed at 37? C. for 2 h after gentle and uniform mixing.
(34) TABLE-US-00002 TABLE 2 Reaction System for In Vitro Transcription Component Usage amount DEPC treated water Complementing to 20 ?L 5 ? TranscriptAid Reaction Buffer 4 ?L ATP, Tris buffered 100 mM* 2 ?L UTP, Tris buffered 100 mM* 2 ?L GTP, Tris buffered 100 mM* 2 ?L CTP, Tris buffered 100 mM* 2 ?L DNA1 or DNA2 1 ?g TranscriptAid Enzyme Mix 2 ?L
(35) (2) After the reaction was completed, 2 ?L of DNase I (RNase-free, 1 U/?L DNA) was added to 20 ?L of the system and a reaction was allowed at 37? C. for 15 min after uniform mixing, and then the DNA template was digested.
(36) (3) The product obtained in the step (2) was transferred to an RNase-free centrifuge tube of 1.5 mL, 1 mL of Trizol was added for RNA purification, and the subsequent operation was the same as that of extracting RNA from cells with Trizol.
(37) (4) The obtained RNA was dissolved by adding an appropriate amount of DEPC treated water, and a mixture thereof was stored in a freezer at ?80? C. after concentration determination.
Embodiment 6 Assay of RNase R Activity and Salt Tolerance
(38) 1) 10? reaction buffers with different concentrations of NaCl were prepared as shown in Table 3
(39) TABLE-US-00003 TABLE 3 10 ? Reaction Buffers with Different Concentrations of NaCl. Mark number Formulation of of reaction reaction buffer 10 ? buf1 200 mM Tris-HC1 (pH 8.0), 1000 mM KC1, 1 mM 10 ? buf2 500 mM NaCl, 200 mM Tris-HCl (pH 8.0), 1000 mM 10 ? buf3 1000 mM NaCl, 200 mM Tris-HCl (pH 8.0), 1000 mM 10 ? buf4 1500 mM NaCl, 200 mM Tris-HCl (pH 8.0), 1000 mM 10 ? buf5 2000 mM NaCl, 200 mM Tris-HCl (pH 8.0), 1000 mM 10 ? buf6 3000 mM NaCl, 200 mM Tris-HCl (pH 8.0), 1000 mM
(40) 2) As shown in Table 4, in a 20 ?L system, 3 ?g of Linear_RNA1 or Linear_RNA2 was used as the substrate, the reaction buffers with different concentrations of NaCl were added respectively, and the mutant-type RNase R(RNase R_?M8) was finally added; a reaction was allowed at 37? C. for 15 min after uniform mixing; heat inactivation was performed at 70? C. for 10 min; and the reaction solution was stored in an ice box. The wild-type RNase R (RNase R_WT) was used in the above test as a control. 3 ?L of 2?RNA Loading Dye (NEB, article number: B0363A) was added to 3 ?L of the reaction solution for 1.5% agarose gel electrophoresis. The results are shown in
(41) TABLE-US-00004 TABLE 4 RNase R Reaction System Component Usage amount DEPC treated water Complementing to 20 ?L RNA 3 ?g 10 ? buf1/2/3/4/5/6 2 ?L RNase R(1 ?g/?L) 0.5 ?L
(42) It should be noted that although the above embodiments have been described, those skilled in the art may make additional changes and modifications to these embodiments once they know the basic inventive concepts. Therefore, the foregoing description is merely illustrative of the embodiments of the present invention and is not intended to limit the protection scope of the present invention. Any equivalent structure or process variations based on the specification of the present invention, or direct or indirect application of these embodiments to other related technical fields all fall within the protection scope of the present invention.