Single domain antibodies binding to tetanus neurotoxin
12054540 · 2024-08-06
Assignee
Inventors
Cpc classification
C07K2317/76
CHEMISTRY; METALLURGY
C07K2317/569
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
C07K2317/22
CHEMISTRY; METALLURGY
C07K2317/33
CHEMISTRY; METALLURGY
C07K2317/94
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention relates to single domain antibodies (SDAs) that are capable of binding to tetanus neurotoxin. The invention further relates to polypeptide constructs comprising such an SDA as well as an SDA that is capable of binding to a serum protein, preferably to serum albumin or immunoglobulin. The invention also relates to nucleic acids encoding such SDAs or polypeptide constructs, to pharmaceutical compositions comprising such SDAs or polypeptide constructs, the medical use thereof and to their use in the treatment of tetanus.
Claims
1. A single domain antibody (SDA) capable of binding to tetanus neurotoxin (TeNT), wherein the SDA has an overall amino acid sequence identity of at least 80% with a sequence selected from the group consisting of SEQ ID NO: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 and 26 with the proviso that the amino acid sequence identities of CDR1, CDR2 and CDR3 are at least 90%.
2. The SDA according to claim 1, wherein the SDA has an overall amino acid sequence identity of at least 90% with a sequence selected from the group consisting of SEQ ID NO: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 and 26, with the proviso that the amino acid sequence identities of CDR1, CDR2 and CDR3 are at least 90%.
3. The SDA according to claim 1, wherein the amino acid sequence identities of CDR1, CDR2 and CDR3 are at least 95%.
4. A polypeptide construct comprising at least one SDA capable of binding to TeNT according to claim 1 and at least one SDA capable of binding to a serum protein.
5. The polypeptide construct according to claim 4, wherein the serum protein is serum albumin or an immunoglobulin.
6. The polypeptide construct according to claim 5, wherein the SDA capable of binding to serum albumin has an overall amino acid sequence identity of at least 70% with a sequence selected from the group consisting of SEQ ID NO: 40, 37, 38, 39, 41 and 42, with the proviso that the amino acid sequence identities of CDR1, CDR2 and CDR3 are at least 75%.
7. The polypeptide construct according to claim 5, wherein the immunoglobulin is immunoglobulin G (IgG).
8. The polypeptide construct according to claim 5, wherein the SDA capable of binding to the immunoglobulin has an overall amino acid sequence identity of at least 70% with a sequence selected from the group consisting of SEQ ID NO: 30, 27, 28, 29, 31, 32, 33 and 34, with the proviso that the amino acid sequence identities of CDR1, CDR2 and CDR3 are at least 75%.
9. The polypeptide construct according to claim 4, wherein the polypeptide construct comprises at least two SDAs capable of binding to TeNT wherein each of the at least two SDAs capable of binding to TeNT has an overall amino acid sequence identity of at least 70% with a sequence selected from selection A; SEQ ID NO: 24, or selection B; SEQ ID NO: 25, or selection C; SEQ ID NO: 20, or selection D; SEQ ID NO: 17 or 19 or selection E; SEQ ID NO: 22, 15, 23 or 14, with the proviso that the at least two SDAs do not comprise a sequence from the same selection and with the proviso that the amino acid sequence identities of CDR1, CDR2 and CDR3 are at least 75%.
10. A DNA fragment encoding an SDA according to claim 1 or a polypeptide construct comprising at least one SDA capable of binding to TeNT wherein the SDA has an overall amino acid sequence identity of at least 70% with a sequence selected from the group consisting of SEQ ID NO: 17, 13, 14, 15, 16, 18, 19, 20, 21, 22, 23, 24, 25 and 26 with the proviso that the amino acid sequence identities of CDR1, CDR2 and CDR3 are at least 75% and at least at least one SDA capable of binding to a serum protein.
11. The SDA according to claim 1, wherein the amino acid sequence identities of CDR1, CDR2 and CDR3 are 100%.
12. The SDA according to claim 1, wherein the CDR regions are identified according to the IMGT numbering system.
Description
DESCRIPTION OF THE FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
EXAMPLES
(11) 1. Llama Immunization and Phage Display Library Generation
(12) Llamas (Lama glama) (no. 9236 and 9237) were immunized in an identical manner. A commercially available tetanus vaccine (ready to use, tetanus toxoid based) was injected intramuscularly without further adjuvant addition, 1 ml per llama, in the right thigh at 0, 21 and 42 days post primary immunization (DPI). An target antigen mixture of 0.5 mg chrompure horse IgG (Jackson Immunoresearch Laboratories, West Grove, PA), 0.5 mg chrompure dog IgG (Jackson Immunoresearch Laboratories), 0.5 mg horse Alb (Rockland Immunochemicals, Limerick, PA), 0.5 mg dog Alb (Molecular Innovations, Novi, MI) and 8 ?g recombinant tetanus toxin fragment C (rTTC; Reagent Proteins, San Diego, CA) was prepared. In vitro experiments [5] have indicated that fragment C (also designated as Hc or TTC) is responsible for the binding of the tetanus toxin to neurons. The antigen mixture was emulsified with Stimune adjuvant (Thermofisher Scientific, Lelystad, the Netherlands) and injected intramuscularly in the left thigh of each llama at 0 and 21 DPI. An identical mixture of antigens adjuvanted with IMS1312 adjuvant (Seppic, France) was injected intramuscularly in the left thigh of each llama at 42 DPI. Heparinized blood samples (150 ml) were taken at 28 and 49 DPI and peripheral blood lymphocytes (PBLs) were immediately isolated. Blood samples for serum preparation were taken at 0, 28 and 49 DPI.
(13) Total RNA was extracted from PBLs using the RNeasy Maxi kit (Qiagen) and used for preparation of cDNA using dT18 priming and Superscript Ill reverse transcriptase (Invitrogen, Carlsbad, CA). Three PCRs specific for SDAs were performed using primers BOL1192 (AACAGTTAAG CTTCCGCTTG CGGCCGCTAC TTCATTCGTT CCTGAGGAGA CGGT, SEQ ID NO: 1), lam07 (AACAGTTAAG CTTCCGCTTG CGGCCGCGGA GCTGGGGTCT TCGCTGTGGT GCG, SEQ ID NO: 2), and a mixture of primers lam08 (AACAGTTAAG CTTCCGCTTG CGGCCGCTGG TTGTGGTTTT GGTGTCTTGG GTT, SEQ ID NO: 3) and BOL1401 (AACAGTTAAG CTTCCGCTTG CGGCCGCTGG TTGTGGTTGT GGTATCTTGG GTT, SEQ ID NO: 4), all three in combination with primer VH2B (SEQ ID NO: 64) [45]. The resulting PCR fragments were digested with PstI and Notl and inserted into phage display plasmid pRL144 [19]. The ligations were used to transform E. coli TG1 cells (Lucigen, Middleton, WI, USA) by electroporation, resulting in twelve libraries (designated pAL808 to pAL819).
(14) 2. Yeast Production of cAb-TT2 Single Domain Antibody
(15) A single domain antibody (SDA) cAb-TT2 [46] binding to the tetanus holotoxin but not to rTTC was produced in baker's yeast for use in subsequent phage display selection of TeNT binding SDAs. A synthetic gene encoding this SDA as fusion to the yeast invertase signal sequence and 5-leader was generated as Sacl-BstEII fragment. Itwas inserted into plasmid pRL188, resulting in production of the SDA linked to the llama long hinge region, containing a single cysteine and a his6-tag [2]. Such an expression format is especially suitable for SDA immobilization to solid surfaces [3]. The cAb-TT2 SDA was produced in baker's yeast strain SU51 at 150-ml scale, purified by immobilized-metal affinity chromatography (IMAC), and part of the isolated SDA was biotinylated as described earlier [3].
(16) 3. Phage Display Selection of TeNT Binding SDAs
(17) The following reagents were used for phage display selection. Yeast-produced cAb-TT2 is described in the previous example. A tetanus toxin neutralizing mAb TT10 [47, 48] was purchased from the National Institute for Biological Standards and Control (NIBSC; Potters Bar, United Kingdom). Authentic tetanus holotoxin (TeNT) was purchased from List Biological Laboratories (Campbell, CA), rTTC is described in example 1.
(18) The twelve libraries were used for phage rescue using helper phage VCSM13 and phage display selections were performed as described earlier [49]. However, a procedure was used that was modified in the following ways: 96-well ELISA plates were used for selection rather than immunotubes [50] lower phage amounts of about 10.sup.?10 transducing units (TU) were used in each panning trypsin was used for elution of phage [74] phage libraries of the three isotypes (hinge primers) were pooled.
(19) Furthermore, selections were done with simultaneous phage ELISAs to monitor the different panning procedures and decide which panning tests should be further used.
(20) The phage display libraries were screened in two rounds of phage display selection of SDAs binding to directly coated TeNT or rTTC.
(21) Furthermore selections were done on TeNT captured with cAb-TT2 SDA or with mAb TT10.
(22) Occasionally, different antigens were used in the second phage display round as compared to the first round.
(23) ELISAs to detect binding to directly coated antigens of soluble SDAs present in tenfold diluted E. coli culture supernatants employing a mouse mAb anti-myc tag PO-conjugate for SDA detection were done as described earlier [19]. However, TeNT and rTTC were coated at 1 ?g/ml using PBS buffer whereas cAb-TT2 was coated at 1 ?g/ml in 50 mM carbonate/bicarbonate buffer (pH 9.6). Only the absorbance values of the SDA clones that were finally also expressed in yeast are reported.
(24) For identifying individual TeNT binders eight 96-well plates were inoculated with individual clones from the second panning round and induced for production of soluble SDA in 96-well plates as described earlier [49]. Different antigens and 10-fold dilutions of E. coli supernatants containing the soluble SDA were used in the ELISAs. All clones were screened in ELISAs on directly coated TeNT and rTTC, on cAb-TT2 captured TeNT.
(25) In addition, all clones were screened in a GT1b-TeNT binding inhibition ELISA to detect SDAs inhibiting toxinreceptor interaction. The TeNT-GT1b inhibition ELISA is most suitable for comparing the toxin binding and neuron binding blocking capacity of different SDAs, because it is not dependent on for example biotinylation efficiency, accessibility of epitope tags and denaturation due to coating procedure.
(26) The GT1 b-TeNT inhibition ELISA was done according to [8]. 96-well polystyrene plates were coated with 10 ?g/ml GT1b ganglioside from bovine brain (Sigma Aldrich, St Louis, MO) in methanol at 100 ?l/well by overnight incubation at room temperature (RT). During the overnight incubation the methanol evaporates completely. All subsequent incubations were done in PBS containing 0.5% BSA and 0.05% Tween-20 for 1 hr at RT after manual washing plates with PBS. 1 ?g/ml TeNT (List Biological Laboratories) was pre-incubated with SDAs, E. coli culture supernatants or mAbs in 100 ?l/well in a separate 96-well polystyrene ELISA plate and incubated for 1 hr at RT. Then 90 ?l of these samples was transferred to the GT1b-coated plates and incubated for 1 hr at RT. Plates were then incubated with 100 ?l/well 1000-fold diluted llama 9237 serum of 49 DPI. Bound llama IgG was detected with goat anti-llama IgG-PO conjugate (Bethyl Laboratories, Montgomery, TX). Bound PO was detected by staining with TMB. The reaction was stopped with sulfuric acid and the absorbance at 450 nm was measured with a spectrophotometer.
(27) For the determination of the SDA (purified by streaking, single colony picked) sequence DNA fragments for sequence analysis were obtained by PCR on E. coli TG1 cells with primers MPE25 (TTTCTGTATGGGGTTTTGCTA, SEQ ID NO: 6) and MPE26 (GGATAACAATTTCACACAGGA, SEQ ID NO: 7). Sequence analysis was done using the BigDye Terminator v1.1 Cycle Sequencing Kit and an automated AB13130 DNA sequencer (Applied Biosystems, Nieuwerkerk a/d IJssel, The Netherlands). Purified PCR fragment was used as template in combination with primers MPE25 and RevSeq (TCACACAGGAAACAGCTATGAC, SEQ ID NO: 8). All sequences were determined from two reactions. All sequence interpretation was done based on the translated SDA sequence. The PstI site used for SDA cloning overlaps with amino acids 4 and 5 of the mature SDA. Therefore, the sequence QVQ (amino acids 1-3) that is encoded by the phage display vector used was appended to the SDA N-terminus. SDAs were aligned according to IMGT numbering system [51] of the mature SDA encoding region, ending at sequence VTVSS. SDAs were classified into subfamilies as done earlier [52]. Subfamily C indicates conventional like SDA, lacking the FR2 residues that are typical of SDAs. Such SDAs are often produced at lower levels. Subfamily 1, 2 and 3 designated SDAs indicate three genuine SDA subfamilies. Subfamily X indicates SDAs that are not classifiable. SDAs were also classified into CDR3 groups based on having identical CDR3 length and at least 65% sequence identity in CDR3. SDA sequences were also inspected for the presence of potential N-glycosylation sites (Asn-X-Ser/Thr, where X is any amino acid except Pro). Clones selected for yeast expression lacked such N-glycosylation sites.
(28) Table 2 shows fourteen TeNT binding SDA clones that start with SVT followed by a number. Two SDAs, SVT02 and SVT03, that were selected on cAb-TT2 or mAb TT10 captured TeNT, respectively, did bind to cAb-TT2 captured TeNT but did not bind to directly coated TeNT or rTTC and did not inhibit GT1b-TeNT interaction as the absorbance measured was comparable to that observed with E. coli culture supernatants that do not contain a SDA (Table 2). These SDAs probably bind to a TeNT epitope whose conformation is affected by passive adsorption to polystyrene, resulting in reduced antigenicity as is earlier observed with other antigens [3, 53]. A further twelve SDAs, of which eleven SDAs were selected on directly coated TeNT or rTTC, did bind to both directly coated and captured TeNT, to directly coated rTTC and did inhibit TeNT-GT1b interaction (Table 2). Three SDAs, SVT05, SVT06 and SVT08 only show partial inhibition of GT1b-TeNT interaction as the absorbance values are decreased from about 1.3 in samples without SDA to 0.72-0.99.
(29) The sequences of the fourteen SVT SDAs form seven CDR3 groups indicated by letters A to G (
(30) All three SDA clones from CDR3 group B contain an unusual insertion of the amino acid sequence VEDG at position 50a-50d. This is in the middle of the FR2 region, adjacent to residue Arg 50 (Kabat position 45) that is often mentioned in SDA literature as the most typical amino acid substitution of SDAs. Conventional SDAs normally contain a Leu at IMGT position 50 that makes hydrophobic contact with the VL domain. SDAs most often have an Arg at IMGT position 50. This substitution renders the former VL interface more hydrophilic [1]. It is most likely that the insertion of the hydrophilic residues D (Asp) and E (Glu) of the VEDG insertion also render the FR2 region more hydrophilic. Partly because of these acidic residues the predicted isoelectric point (IEP) of these clones is low. A low IEP is more often observed with SDAs and is associated with increased solubility of SDAs [54]. Of note is also that the CDR2 and CDR3 regions are quite long. A long CDR3 is quite commonly observed with SDAs [1, 52]. A long CDR2 is less common, and presumably arises due to somatic hypermutation [55].
(31) Clones SVT13 and SVT22 that form CDR3 group D have a Cys at IMGT position 55 and a Cys in CDR3 that most likely form an additional disulphide bond that is typical of subfamily 3 SDAs [52].
(32) Although the CDR3 sequences are clearly homologous, SVT13 and SVT22 are highly diverse and show 32 amino acid differences.
(33) The single clone SVT05 from CDR3 group G has a very long CDR2 of 17 residues (see discussion above for CDR3 group B) and a low IEP.
(34) 4. Phage Display Selection of IgG Binding SDAs Phage display selection of IgG binding SDAs was essentially done as described in the previous example using directly coated IgG from dog or horse. To select for SDAs binding to both dog and horse IgG the second round panning was not only done on IgG of the same species origin, but also on IgG of the other species.
(35) For identifying individual IgG binders six 96-well plates were inoculated with individual clones from the second panning round and induced for production of soluble SDA in 96-well plates [49]. All clones were screened for binding to directly coated IgG of different species and Fab and Fc fragments in ELISA as previously described [19]. Horse and dog IgG antigens are described in example 1. Horse IgG Fc was from Fitzgerald Industries (Tompkinsville, KY) and dog Fab was from Rockland Immunochemicals.
(36) Only the absorbance values of the SDA clones that were finally also expressed in yeast are reported. For this purpose IgG binding clones that bind to the respective antigens of both dog and horse, and preferably even more species were preferentially selected. Furthermore, clones that bind to Fab fragments were preferentially selected. These SDAs are most suited for therapeutic applications since interference with binding to the neonatal Fc (Brambell) receptor involved in IgG half-life is not expected for Fab binding SDAs and since the multispecies recognition makes it unlikely that allotypic IgG variation could cause failure to recognize the IgG in a particular individual animal.
(37) Table 3 shows eight IgG binding SDA clones that start with SVG followed by a number. The background absorbance value using E. coli culture supernatant without SDA on horse IgG is 0.26, which is considerably higher than on other IgG samples. This could indicate binding of horse IgG to the peroxidase-conjugate used. The maximal absorbance in the ELISA between the different SDAs is also highly variable, presumably because the antigen used for coating is not a pure protein but a mixture of different IgGs of different isotypes and with different variable domains. SDAs SVG03 and SVG24 bind to Fc fragment from horse but not to Fab fragment from dog or horse. SDA SVG23 binds only to dog IgG. Since it does not bind dog Fab it presumably binds dog Fc. SVG03 binds to IgG from horse but not to IgG from dog, human, swine, bovine or guinea pig. SVG24 binds to dog, horse and swine IgG but not to human, bovine and guinea pig IgG. Thus, the three Fc specific SDAs also have a species specificity. SDAs SVG06, SVG07, SVG13, SVG18 and SVG19 bind to Fab fragment from dog and horse but not to horse Fc fragment. They bind to IgG of all six aforementioned species. Thus, the five Fab specific SDAs also have much broader species specificity.
(38) Sequence analysis was done as described in the previous example. The eight clones selected for yeast production (
(39) Most SDAs are similar to human VH3 family VHs. However SVG07 is more similar to human VH4 family VHs. Such SDAs were earlier observed [57]. For reference two VH4 family SDAs isolated from camels (sdAb-31 and sdAb-32) are included in the SDA alignment (
(40) 5. Phage Display Selection of Alb Binding SDAs
(41) Phage display selection of Alb binding SDAs was essentially done as described in the previous examples using directly coated Alb from dog or horse described in example 1. To select for SDAs binding to both dog and horse Alb the second round panning was not only done on Alb of the same species origin, but also on Alb of the other species.
(42) For identifying individual Alb binders two 96-well plates were inoculated with individual clones from the second panning round and induced for production of soluble SDA in 96-well plates [49]. All clones were screened for binding to directly coated Alb of dog, horse and human in ELISA as previously described [19]. Human Alb was from a commercial supplier (Jackson Immunoresearch Laboratories).
(43) Only the absorbance values of the SDA clones that were finally also expressed in yeast are shown. For this purpose Alb binding clones that bind to the respective antigens of both dog and horse were preferentially selected. Table 4 shows six Alb binding clones that start with SVA followed by a number. None of the SDAs bind to human Alb. All SDAs bind to horse Alb. SDA SVA07 does not bind to dog Alb whereas SDAs SVA02, SVA04, SVA06, SVA12 and SVA16 do bind to dog Alb. Thus five SDAs binding both dog and horse Alb were obtained.
(44) Sequence analysis was done as described in the previous examples. The six clones selected for yeast production (
(45) 6. Yeast Production of Novel SDAs Isolated by Phage Display
(46) Fourteen SVT SDAs (Table 2), eight SVG SDAs (Table 3) and six SVA SDAs (Table 4) were produced by secretory yeast expression. For this purpose the SDA encoding regions were amplified by PCR from the phage display plasmids (examples 3-5) and cut with PstI and BstEII for ligation with similarly cut pUR4585 plasmid. pUR4585 is a yeastE. coli shuttle vector suitable for expression of SDAs C-terminally fused to the c-myc and his6 tags. SDAs produced in this manner are indicated by the suffix L. Plasmids derived from pUR4585 encoding such SDAs are indicated by the name of the SDA and the prefix p in addition to the suffix L. In addition three mutant SVT SDAs with mutations in the FR4 region to increase yeast production level were produced (see example 3 and [11]): SDA SVT15L-3FW4M is a derivative of SVT15L containing mutations K120Q, 1122T and L123Q SDA SVT20L-L123Q is a derivative of SVT20L containing mutation L123Q SDA SVT34L-L123Q is a derivative of SVT34L containing mutation L123Q These mutations were introduced by producing synthetic PstI-BstEII fragments containing these mutations and subsequent insertion into plasmid pUR4585. The BstEII site used for subcloning is a site that is highly conserved in FR4, but lacking in some SDAs. This was the case with SVT16, SVT20, SVT25 and SVT34. Therefore this site was silently introduced into these four authentic SDAs as well as SVT20L-L123Q and SVT34L-L123Q by producing synthetic PstI-BstEII fragments and subsequent insertion into pUR4585. All yeast expression plasmids were sequence verified as described in example 3, but using purified plasmid DNA as template in combination with primers BOL1166 (ATGATGCTTTTGCAAGCCTTC, SEQ ID NO: 9) and BOL1188 (TTCAGATCCTCTTCTGAGATGAG, SEQ ID NO: 10). The pUR4585-derived plasmid encoding SVT29 encoded a silent A to G mutation on position 60 after the PstI site (CCTGTCGAGCCTACG (SEQ ID NO: 11) mutated to CCTGTCGGGCCTACG (SEQ ID NO: 12)) that was ignored since it was silent.
(47) pUR4585-derived plasmids were introduced into Saccharomyces cerevisiae strain W303-1a (ATCC number 208352; MATa, ade2-1, ura3-1, his3-11, trp1-1, leu2-3, leu2-112, can1-100) by selection for the auxotrophic leu2 marker. Plasmids pSVT13L, pSVT15L, pSVT20L and pSVT34L were also introduced into strain SU51, which is more commonly used for SDA production [19, 58]. Yeast culture for SDA production and purification of SDA from spent culture supernatant by IMAC was done as described earlier [19, 58]. Purified SDAs were concentrated and the buffer exchanged to phosphate buffered saline (PBS) by use of Amicon Ultra 3-kDa molecular weight cut off centrifugal concentration devices (Millipore, Bedford, MA). The SDA concentration was determined using the Biorad (Hercules, CA) protein assay and a bovine IgG standard. From these stocks a sample was biotinylated with Sulfo-NHS-LC-biotin (Pierce, Rockford, IL) with a weight ratio of protein to biotin of 5. Mouse mAbs, horse and dog Alb and IgG and TeNT were biotinylated in a similar manner.
(48) Based on the yield of purified SDA the yeast secreted SDA production level per liter culture volume was also determined (Table 5). SDAs were primarily produced in baker's yeast strain W303-1a, however, for comparison of yeast production levels four SVT SDAs were also produced in strain SU51 [58]. The increase in production level using strain SU51 varied from 2.5-fold to 13.6-fold dependent on the nature of the SDA. The mutant SDAs containing various FR4 mutations were produced at 2.6-fold to 5.2-fold higher levels as compared to the wildtype SDAs (Table 5), consistent with earlier findings [11].
(49) The low production level of SVG07L of 0.15 mg/L could be related to this SDA being similar to human VH4 gene family SDAs. It was earlier suggested that conventional-like SDAs (subfamily C in Table 5) are produced at low levels [61]. However, three conventional-like SDAs, SVG06L, SVG13L and SVG19L are produced at reasonably high levels of at least 1.59 mg/L (Table 5).
(50) 7. Antigen Binding of Yeast-Produced SVA SDAs Binding of SVA SDAs to Alb from different species was analysed in ELISA by coating antigens to plates and detecting them primarily with unlabelled SDAs employing the myc tag for SDA detection. ELISAs were essentially performed as described in example 3. Purified serum albumins were coated at a concentration of 5 ?g/ml. The source of horse and dog Alb is described in example 1. Bovine Alb and chicken ovalbumin were from Sigma Aldrich, human albumin from Jackson Immunoresearch Laboratories and mouse, sheep and swine albumin from Antibodies Online (Beijing, CN). Cat albumin was captured from 500-fold diluted normal cat serum (Agrisera Antibodies, V?nn?s, Sweden) on plates coated with 1000-fold diluted immunoaffinity adsorbed goat anti-cat Alb IgG (Antibodies Online). Then plates were incubated with twofold SDA dilution series starting at 1 ?g/ml SDA concentration over twelve wells. SDAs were detected using 0.5 ?g/ml of anti-myc clone 9E10 mAb peroxidase conjugate (Roche Applied Science). Absorbance data were evaluated using an Excel? spreadsheet template (Microsoft Corporation, Redmond, USA to calculate the maximal A450 value. A four-parameter logistic curve was fitted to absorbance and SDA concentrations to interpolate the Effective Concentration (EC) resulting in an absorbance value of 0.2 for each SDA in each ELISA.
(51) Negative controls without antigen coating, without SDA or with an aspecific SDA (SVT06L) all resulted in absorbance values below 0.15 (Table 6). Absorbance values above 0.15 were considered indicative of Alb binding. Clones SVA12L and SVA16L bind to horse and dog Alb with high (>1) absorbance values. SVA12L also binds swine Alb with high and cat Alb with lower absorbance values. Cat Alb was captured from normal serum with a coated polyclonal antibody. As a result the observed lower absorbance value does not necessarily indicate less efficient binding to cat Alb as compared to Alb from other species. Indeed in example 18 (Table 28), it is shown that SVA12L and SVA06L bind with very similar affinity to Feline Alb (commercially available). Furthermore, there (example 18) it is shown that SVA12L and SVA06L bind with similar affinity to Equine and Canine Alb. A competition assay (ELISA) showed that SVA06L and SVA12L recognize different epitopes (data not shown).
(52) Both SVA12L and SVA16L titrate in ELISA to low SDA concentrations of about 10 ng/ml. SVA02L, SVA04L, SVA06L and SVA07L also bind to several Alb species, but often with lower absorbance values and higher SDA titres than SVA12L and SVA16L. SVA02L and SVA06L also bind to mouse AIb.
(53) None of the SDAs bind to human, sheep, bovine or chicken Alb. The ELISA binding of the yeast-produced SVA SDAs is consistent with the binding of the corresponding SDA produced in E. coli (Example 5; Table 4) with one notable exception: clone SVA04L does not bind dog Alb whereas its E. coli produced counterpart bound dog Alb with the high absorbance value of 1.533. This could be due to the E. coli produced clone not being monoclonal but rather representing a mixture of two clones producing different SDAs. Since the yeast-produced SDA is clonal and more elaborately tested as SDA dilution series rather than in a single well results based on yeast-produced SDA are more reliable.
(54) Clone SVA12L was selected for development of multimeric SDAs (see example 14, 15, 16, 17 and 18) since it binds to both horse, dog, swine and cat Alb and is efficiently produced in yeast (3.85 mg/L using strain W303-1a). SVA12L does not bind to mouse Alb in ELISA and therefore is unlikely to confer half-life elongation in mice (example 17). SVA06L is the candidate suitable for SDA half-life elongation in mice.
(55) 8. Antigen Binding of Yeast-Produced SVG SDAs
(56) Binding of eight yeast-produced SVG SDAs to IgG of different species origin and antibody fragments Fab, F(ab).sub.2 and Fc of some species was analysed in a similar manner as described in the previous example. The source of several IgGs and fragments thereof is described in example 4. Mouse, cat, sheep, bovine and guinea pig gamma globulin (GG) as well as horse F(ab).sub.2 fragment was obtained from Jackson Immunoresearch Laboratories. Dog Fc fragment was obtained from Rockland Immunochemicals. The results are described in Table 7. Three ELISAs contained a relatively high background presumably due to cross reaction of the mouse anti-myc mAb PO-conjugate with the coated antigens (footnote b in Table 7). Therefore, the absorbance values in these ELISAs were background subtracted (footnote b in Table 7). Background subtracted absorbance values above 0.2 were considered indicative of antigen binding.
(57) The ELISA binding of the yeast produced SVG SDAs is consistent with the binding of the corresponding SDA produced in E. coli (example 4) with two exceptions. Firstly, yeast-produced SDA SVG07L binds only to dog IgG whereas the corresponding E. coli produced SDA bound to IgG of all species analysed. Possibly this can partly be explained by the arbitrary cut off value of A450=0.2 chosen for binding being too high. Secondly, the yeast-produced clone SVG24L does not bind to swine IgG whereas its E. coli produced counterpart did. This could again be due to the arbitrary cut off value of A450=0.2 chosen for binding being too high. Alternatively, such binding of E. coli produced clones could also result from these clones not being monoclonal. Such an artefact is not likely for the yeast-produced SDAs. Thus, the data of the ELISA binding of the yeast-produced SDAs are more reliable.
(58) SDAs SVG06L and SVG13L bind to Fab fragments and IgG of all species analysed except chicken when a background subtracted absorbance value above 0.2 is taken as indicative of antigen binding. The absorbance value of 0.164 on chicken IgG of SVG13 probably represents binding to chicken IgG since most other SDAs have absorbance values below 0.08 in this ELISA. SDA SVG19L shows considerable sequence similarity to SDA SVG13L (Example 4) and shows a binding pattern similar to SVG13L, but it does not bind with 0.2 absorbance values above background to mouse, sheep and swine IgG. SVG03L is specific for horse Fc and SVG23L for dog Fc fragment. SVG24L recognizes predominantly horse and dog Fc.
(59) SDA SVG13L is most suitable for development of multimeric SDAs since it binds to Fab and IgG of all species analysed and is well produced (non-optimised) in yeast (1.6 mg/L).
(60) SDA SVG06L is also suitable for development of multimeric SDAs since it binds to Fab and IgG of all species analysed except chicken and is also well produced (non-optimised) in yeast (1.8 mg/L).
(61) 9. Species Specificity of IqG Binding SDAs
(62) The binding in ELISA to IgGs from various species of four porcine IgG-binding SDAs (VI-clones) isolated earlier [19] was compared with SDA SVG13L that reacts with IgGs of most species. ELISAs were done as described in example 8. The results (Table 8) show that SDAs VI-4L, VI-8L, VI-11L and VI-14L do not bind to bovine, cat, dog, mouse and human IgG. Possibly they do bind to sheep IgG since the maximal absorbance is slightly increased above background without SDA. SDA VI-11L in addition binds to horse IgG. However, in all instances, SVG13L yields much higher absorbance values on IgG from all species except swine IgG. On swine IgG on the contrary, all VI clones yield higher absorbance values than SVG13L.
(63) 10. Antigen Binding of Yeast-Produced SVT SDAs
(64) Several yeast-produced SDAs and six anti-TeNT mAbs were analysed for antigen binding in ELISA in a similar manner as described for SVA and SVG SDAs. The anti-TeNT mAbs were obtained from different suppliers. Their origin and information provided by the supplier about TeNT neutralization in mouse bioassay or antigen binding in Western blot is described in Table 9. Part of these mAbs was biotinylated as described in example 6.
(65) The binding of unlabelled SDAs or mAbs to directly coated TeNT, rTTC or polystyrene plates without antigen coating as well as to TeNT that was captured by passively adsorbed cAb-TT2 SDA was analysed. See examples 1 and 3 for such antigen coating procedures. These plates were then incubated with dilution series of unlabelled SDAs or mAbs and further processed as described in example 7, but using a 2000-fold diluted rabbit anti-mouse immunoglobulin PO conjugate (Dako, Glostrup, Denmark) for detection of mouse mAbs and without titrating the SDAs on rTTC-coated plates. Furthermore the binding of biotinylated SDAs or mAbs to directly coated TeNT and cAb-TT2 captured TeNT was analysed in a similar manner using 0.5 ?g/ml streptavidin-PO conjugate (Jackson Immunoresearch Laboratories) for SDA detection. Finally, the GT1b-TeNT interaction inhibition of unlabelled SDAs or mAbs was analysed as described in example 3 using twofold dilution series of SDAs or mAbs over 11 wells starting at a concentration of 1 ?g/ml SDA or 10 ?g/ml mAb.
(66) The results are described in Table 10. Absorbance values on plates without specific TeNT antigen coating were below 0.07. Also in ELISAs with control SDA SVA12Lwith exception of the GT1 b-TeNT inhibition ELISAabsorbance values were at most 0.155 (directly coated TeNT and biotinylated SDAs or mAbs) or 0.072 (other ELISAs). Thus, absorbance values above 0.2 are indicative of antigen binding. The ELISAs with biotinylated SDAs or mAbs on directly coated TeNT or captured TeNT were generally consistent with similar ELISAs using unlabelled SDAs or mAbs. None of the biotinylated SDAs or mAbs were negative in an ELISA where its unlabelled counterpart was positive. This shows that biotinylation never abrogated antigen binding. Often biotinylated SDAs gave slightly higher absorbance values on captured TeNT (e.g. the three CDR3 group B SDAs SVT06L, SVT08L and SVT31L). Notable exceptions are mAbs B417M and 11n185 that generally give lower absorbance values and >50-fold higher EC when biotinylated, indicating that biotinylation was either less effective or affected antigen binding by these mAbs. In case of mAb B417M the presence of 0.5% HSA as a stabilising agent could have decreased its biotinylation efficiency.
(67) In general the ELISA binding of the yeast-produced SVT SDAs is consistent with the ELISA binding of their E. coli produced counterparts (example 3; Table 2). As noted earlier in example 3, with exception of SVT02L and SVT03L, all SDAs bind to rTTC. As noted earlier, the failure to detect binding of SVT02 and SVT03 to rTTC could be due to direct coating of rTTC since these SDAs also fail to bind directly coated TeNT while they do bind to captured TeNT. Furthermore, as earlier observed, the three CDR3 group B SDAs SVT06L, SVT08L and SVT31L as well as SVT05L only partially inhibit TeNT-GT1b interaction with minimal absorbance values of about 0.5 and relatively high EC values. Furthermore, as observed earlier, SDA SVT03L does not inhibit TeNT-GT1b interaction. However, yeast produced clone SVT02L also shows partial TeNT-GT1b inhibition with an EC value of >1000 ng/ml while its E. coli produced counterpart did not show any inhibition. This difference could simply be due to the use of a too low SDA concentration in case of the E. coli produced SDA that was used at tenfold E. coli supernatant dilution with unknown SDA concentration. The observed binding of biotinylated yeast produced SVT03L to directly coated TeNT only at the highest SDA concentration analysed was also not observed earlier and can similarly be explained by the higher SDA concentration used (see example 11).
(68) The three mutant SDAs of SVT15L, SVT20L and SVT34L have similar maximal absorbance values and EC values as their wildtype counterparts in the ELISAs using biotinylated SDAs and in the GT1b-TeNT inhibition ELISA. This suggests that the framework 4 mutations introduced to increase antigen binding do not affect TeNT binding. Here, the EC values are determined at the absorbance value corresponding to 50% inhibition of TeNT-GT1 b inhibition (IC.sub.50). The IC.sub.50 values vary from 34 to 986 ng/ml. Clones from CDR3 group B show higher IC.sub.50 values (317-986 ng/ml) than clones from CDR3 groups A, C and D (34-133 ng/ml). Clones from the same CDR3 group differ in IC.sub.50 value with at most a factor 4.
(69) Six mAbs were included in the analysis. mAb 11n185 was selected because it binds TeNT light chain. The further five mAbs were selected because they neutralize TeNT in a mouse bioassay. The mAbs bind in the different ELISAs as follows: 1. mAbs 14F5 and 6F55 bind less efficiently to directly coated TeNT as compared to captured TeNT, similar to SVT02L and SVT03L. 2. Only mAbs 6E7 and 6F57 inhibit TeNT-GT1b interaction in ELISA. They have an IC50 that is considerably higher than the IC.sub.50 of most SDAs. 3. Whereas most SDAs bind to rTTC, only two out of six mAbs bind rTTC. This suggests that the neutralization of TeNT by three mAbs is not based on inhibition of TeNT-GT1 b interaction.
(70) 11. SDAs Characterized for Binding to Fragment C of TeNT (rTTC Binding).
(71) Two SDAs (SVT02L and SVT03L) do not bind to directly coated TeNT and therefore their binding to the directly coated fragment C (rTTC) of TeNT (named also Hc or TTC) is inconclusive with respect to particle specificity since passive adsorption could have abrogated antigen binding (example 10). the binding of these SDAs to rTTC captured with mAb 6E7 was therefore analysed in a similar manner as described in example 10. Six wells of a 96-well plate were coated with TeNT (0.75 ?g/ml) and 18 wells with mAb 6E7 (1 ?g/ml). Six mAb 6E7 coated wells were subsequently incubated with 2 ?g/ml rTTC, six further wells with 0.75 ?g/ml TeNT whereas the remaining six wells with mAb 6E7 coating were incubated with ELISA buffer (negative control). Subsequently six SDAs were incubated in the four wells with different antigens coated at 2 ?g/ml SDA concentration. Bound SDA was detected by incubation with anti-myc mAb PO-conjugate.
(72) The results (Table 11) show that: Negative controls SVA12L and mAb 6E7 coating without captured antigen are negative (absorbance <0.07). Capture of TeNT or rTTC with mAb 6E7 or direct coating of TeNT is successful as it is detected by SVT16L (high absorbance) and SVT15-3FW4M (lower absorbance). SVT02L and SVT03L are functional as they bind to captured TeNT. SVT03L does bind to directly coated TeNT, although with lower A450 than captured TeNT, whereas SVT02L does not bind to directly coated TeNT at all. SVT02L and SVT03L do not bind to rTTC captured with mAb 6E7. Since they recognize another antigenic site than mAb 6E7 (example 13) this is not due to use of mAb 6E7 for capture.
(73) Therefore, SVT02L and SVT03L bind another TeNT part than present in rTTC. This observation is consistent with the inability of these SDAs to inhibit TeNT-GT1b interaction (example 10).
(74) 12. Western Blot Analysis of TeNT Binding of SVT SDAs
(75) Binding of SVT clones to TeNT light or heavy chain was analysed by Western blotting (
(76) 13. Tetanus Toxin Antigen Mapping by SDAs (SVT)
(77) The antigenic sites of SVT SDAs and six anti-TeNT mAbs were mapped by blocking/competition ELISA using biotinylated SDAs and mAbs. If possible, two representatives of each CDR3 group were used for this purpose. SDAs were primarily selected based on their IC.sub.50 value in TeNT-GT1b interaction. However, SVT29L was yeast-produced at only 0.07 mg/L and therefore replaced by SVT15L-3FW4M. Competition/blocking ELISAs were done using similar ELISA procedures as described in the previous example, but using 0.5 ?g/ml TeNT for direct coating. A biotinilyated SDA or mAb concentration was used that resulted in almost maximal absorbance value and competed/blocked this SDA or mAb with 5 ?g/ml of various unlabelled SDAs or mAbs. TeNT coated plates were first incubated with the unlabelled SDA or mAb in 90 ?l/well for 30 min (blocking step). Then 10 ?l 50 ?g/ml biotinylated SDA or mAb was added and incubated for another 30 min (competition step). In case of biotinylated SVT02 and SVT04 TeNT was captured with cAb-TT2 since these SDAs only bind to captured TeNT but not to directly coated TeNT. In all other cases directly coated antigens were used. A control without antigen coating and a control without biotinylated SDA were included. The % inhibition of antigen binding due to a competing/blocking SDA was then calculated as 100-100*([A450 with competing SDA or mAb][A450 without Ag coating])/([A450 without competing SDA or mAb][A450 without Ag coating]). All SDAs and mAbs blocked the binding of their biotinylated counterpart by at least 75%, indicating that the assay was valid.
(78) At least five independent antigenic sites indicated by letters A-E were identified (Tables 12 and 13). As expected, SDAs from the same CDR3 group are always part of the same antigenic site. SVT02L, mAb 14F5 and mAb 6F55 form antigenic site A. These three SDAs or mAbs also show other similar characteristics in other ELISAs. Most notable is their more efficient binding to captured TeNT as compared to directly coated TeNT. This suggests that their binding is highly dependent on the correct TeNT tertiary conformation. SVT03L is a single SDA forming antigenic site B. SVT15L and its mutant derivative SVT15L-3FW4M form antigenic site C. SVT06L, SVT08L, mAb 6E7 and mAb 6F57 form antigenic site D. These SDAs are expected to be less dependent on the correct conformation of the antigenic site since they also bind to TeNT in Western blot (example 12).
(79) Consistent with this notion partial competition by clones from other antigenic sites does not occur for these four SDAs or mAbs. The SDAs SVT13, SVT16, SVT22 and SVT34, representing two CDR3 groups, form antigenic site E.
(80) The results of the SVT clones are summarized in Table 12. In general the results are consistent with the general view on Ag specificity of SDAs and antigenic structure of TeNT: SDAs of the same CDR3 group fall into the same antigenic site. SDAs or mAbs of the same antigenic site show similar antigen binding specificity: SDAs or mAbs of antigenic site A bind an epitope that is conformationally sensitive since they show reduced binding upon direct coating of TeNT. SDAs of antigenic site D bind TeNT Hc in Western blot. SDAs and mAbs of antigenic sites C, D and E all inhibit TeNT-GT1 b interaction, whereas SDAs or mAbs of antigenic sites A and B do not. SDAs or mAbs that inhibit TeNT-GT1b interaction all bind to rTTC.
(81) Of note is that clone SVT02 is now shown to bind the same antigenic site as two mAbs reported to neutralize TeNT in a mouse bioassay. This strongly suggests that SVT02 could also neutralize TeNT although it did not inhibit TeNT-GT1b interaction. TeNT neutralizing mAbs that do not inhibit GT1b interaction have been described earlier [68]. Similarly, clones SVT06 and SVT08 probably neutralize TeNT (example 17) since they compete with two neutralizing mAbs. Clone SVT06 is most suitable for further work since it produced at a higher level. The SDAs from antigenic sites C and E do not compete with any of the neutralizing mAbs. However, these SDAs do inhibit TeNT-GT1b interaction. Therefore, they are likely to neutralize TeNT, only to be proven in in vivo assays (example 17). SDAs SVT02L, SVT06L, SVT15L-3FW4M and SVT16L are therefore recommended building blocks for generation of multimeric SDAs (Table13).
(82) 14. Yeast Production of Multimeric SDAs
(83) Multimeric SDAs were produced by making stable MIRY integrants [75] using plasmid pRL44 [69] in yeast strain SU50 [70] in order to increase SDA production levels. Such MIRY integrants on average have a fivefold increased production level of SDAs as compared to 2 micron based plasmids. Twelve plasmids were generated that encode multimeric SDAs (Table 14) composed of fusions of TeNT binding SVT-SDAs with either Alb binding SVA12 SDA (5 plasmids), IgG binding SVG06 SDA (2 plasmids) or IgG binding SVG13 SDA (5 plasmids). The elements from which these multimeric SDAs were made are as follows: GS3: (G4S).sub.3 linker described earlier [27] GS2: (G4S).sub.2 linker derived from pRL144 plasmid [19] H6: his6 tag, double stop codon and HindlIl site as in pRL188 [2] SVG06M4: SVG06 with four mutations: Q1E, Q5V, E120Q, L123Q SVG13M4: SVG13 with four mutations: Q1E, Q5V, K120Q, L123Q SVA12M2: SVA12 with two mutations: Q1E, Q5V SVT15-3FW4M: SVT15 without internal Sac site and 3 mutations: K120Q, 1122T, L123Q SVT16-L123Q: SVT16 with silently restored BstEII site and L123Q mutation Synthetic Sacl-Hindlll fragments were produced and subsequently subcloned into plasmid pRL44 [69] using Sacl and Hindlll sites, resulting in plasmids pRL482 to pRL501 (Table 14).
(84) Baker's yeast strain SU50 (MATa; cir?; leu2-3,-112; his4-519; can1; [70]) was transformed with Hpal-linearized plasmids pRL482 to pRL501 by electroporation [71] and leu+ auxotrophs were selected. A single colony-purified transformant was induced for SDA expression at 0.5 L scale in shaker flasks and SDA was purified from spent culture supernatant by IMAC [58]. SDA was subsequent further purified by cation exchange chromatography on an SP sepharose column as earlier described [44] with slight modifications. SP sepharose Fast Flow (GE Healthcare, Piscataway, NJ) and 25 mM sodium acetate pH 4.7 buffer was used for SDA binding to the column. Bound SDA was eluted with a step gradient of 0.1, 0.2, 0.4, 0.6, 0.8 and 1 M NaCl in binding buffer. Bound SDA generally eluted between 0.4 and 0.8 M NaCl (Table 14). It was concentrated and buffer exchanged to PBS using 3-kDa molecular weight cutoff centrifugal concentration devices. The SDA concentration was determined using the bicinchonic acid assay (BCA, Pierce cat.no, 23212) and a bovine serum albumin standard (Thermo Scientific, Rockford, IL). Based on purified SDA yield the production level of the multimeric SDAs in yeast was calculated (Table 14). Mono and multimeric SDAs were analysed by reducing SDS PAGE using NuPage Novex 4%-12% Bis-Tris gels with MOPS running buffer (Invitrogen) and staining with Gelcode Blue reagent (Thermo Scientific). In contrast to the multimeric SDAs the monomeric SDAs contain a myc tag in addition to the his6 tag. The monomeric SDAs which contained a myc tag yielded an additional molecule with an about a 2-kDa higher molecular mass that is not observed with most multimeric SDAs which lack the myc tag (
(85) SDS PAGE analysis of two SVG06M4 containing multimeric SDAs (
(86) All SVG13M4-as well as all SVA12M2-containing multimeric SDAs migrated at positions expected based on their predicted molecular mass (
(87) 15. Bispecific or Bivalent Antigen Binding of Multimeric SDAs
(88) The several target antigen binding capacities of the various multimeric yeast-produced SDAs was amongst others evaluated in ELISA. Controls of monovalent SDAs that formed the building blocks of these multimeric SDAs were included. ELISAs were basically done as described in earlier examples. Seven different types of ELISA were done (Tables 15 and 16). The GT1b-TeNT inhibition ELISA was earlier described in examples 3 and 10. Three further ELISAs served to measure monovalent SDA binding to passively adsorbed TeNT (0.75 ?g/ml), Alb (5 ?g/ml) or IgG (5 ?g/ml), where both an anti-his tag mAb and a polyclonal anti-SDA serum was used for SDA detection. For measuring bispecific binding to TeNT and IgG or Alb or bivalent TeNT binding TeNT and horse Alb were also biotinylated using Sulfo-NHS-LC-biotin (Pierce, Rockford, IL) with a weight ratio of protein to biotin of 5 as described earlier [72]. They were used in three ELISAs to measure: bispecific binding to coated dog IgG or Alb (5 ?g/ml) and biotinylated TeNT (0.25 ?g/ml) bispecific binding to TeNT (0.75 ?g/ml) that was captured with passively adsorbed cAb-TT2 (1 ?g/ml) and biotinylated horse Alb (1 ?g/ml) bivalent binding to coated TeNT (0.75 ?g/ml) and biotinylated TeNT (0.25 ?g/ml)
(89) Polystyrene 96-well plates were coated with the required antigens dissolved in either PBS (TeNT) or 50 mM NaHCO.sub.3 pH 9.2 (all further antigens) overnight at 4? C. at 100 ?l/well. All subsequent incubations were done, after washing plates using 100 ?l/well in ELISA buffer (1% skimmed milk; 0.05% Tween-20; 0.5 M NaCl; 2.7 mM KCl; 2.8 mM KH2PO4; 8.1 mM Na2HPO4; pH 7.4), for 1 h at RT. cAb-TT2 coated plates were subsequently incubated with TeNT in ELISA buffer. Then plates were incubated with twofold SDA dilution series starting at 1 ?g/ml SDA concentration over twelve wells. In some ELISAs bound SDAs were detected directly using 1000-fold diluted anti-his6 clone BMG-his-1 mAb PO conjugate (hisPO; Roche Applied Science) or 10,000-fold diluted goat anti-llama Ig PO conjugate (GALPO; Bethyl Laboratories). In other ELISAs plates with bound SDAs were incubated with biotinylated TeNT or biotinylated horse Alb. Biotinylated antigens were then detected with 0.5 ?g/ml of a streptavidin PO conjugate (StrepPO; Jackson Immunoresearch Laboratories). Bound PO was then detected by staining with 3,3,5,5 tetramethylbenzidine. After stopping the reaction by addition of 0.5 M sulfuric acid (50 ?l per well) the absorbance at 450 nm was measured using a spectrophotometer. Absorbance data were evaluated using an Excel? spreadsheet template (Microsoft Corporation, Redmond, USA). This was used to calculate the maximal A450 value. A four-parameter logistic curve was fitted to absorbance and SDA concentrations using appropriate computer software. This curve was used to interpolate the Effective Concentration (EC) resulting in a particular absorbance value for each SDA in each ELISA. The exact absorbance value used for interpolation of SDA concentration (see Table 14) varied between different ELISAs, dependent on background absorbance values in the absence of SDA and maximal absorbance values observed with different SDAs.
(90) The results of the various ELISAs are presented as both maximal absorbance reached (minimal absorbance for TeNT-GT1b inhibition ELISA; Table 15) and Effective Concentration of SDA (Table 16). From these ELISAs it can be concluded that: The GT1b-TeNT inhibition ELISA shows that all SVT02 containing SDAs as well as monomeric SVA and SVG SDAs do not inhibit whereas all further monomeric and multimeric SDAs do inhibit. This is consistent with earlier observations on monomeric SDAs SVT06L, SVT15L and SVT16L (Example 10). The ELISA with TeNT and biotin-TeNT has high maximal absorbance values of 1.63 and 1.72 with multimeric SDAs, as expected, but lower absorbance values of at most 1.12 with some bispecific multimeric SDAs and slightly increased absorbance values of at most 0.35 with some monomeric SDAs, which is not expected. Background absorbance is about 0.14. Possible there is bridging due to IgG or Alb present in milk that is used as a blocking agent. Nevertheless these results indicate bivalent TeNT binding by the two bivalent and bispecific SDAs. As observed earlier, multimeric SDAs containing an SVT02 SDA domain never bind to directly coated TeNT. In ELISA with cAb-TT2 captured TeNT and biotinylated horse Alb the monomeric SVA12L SDA does not bind and all multimeric SDAs containing SVA12 SDA do bind, including SVT02-GS2-SVA12M2-H6 that did not bind to directly coated TeNT. The SVT15-3FW4M SDA and SVT15-3FW4M-GS2-SVG06M4-H6 SDA seem to be inefficiently recognized by anti-his6 mAb PO-conjugate, but is well detected with GALPO or in GT1b-TeNT inhibition ELISA. This is consistent with C-terminal proteolytic degradation of the his6 tag that was also observed in SDS-PAGE (example 14). SVT02-GS2-SVG06M4-H6 (example 14) showed degradation in SDS-PAGE that could indicate loss of the his6 tag from most SDA molecules, which can explain the low absorbance value in an ELISA on dog IgG using anti-his6 mAb for SDA detection. For this particular bispecific SDA this cannot be confirmed by demonstrating binding to TeNT using GALPO or in the GT1b-TeNT inhibition ELISA since SVT02 does not bind to directly coated TeNT nor inhibit in the GT1b-TeNT ELISA. All multimeric SDAs, including SVT02-GS2-SVG06M4-H6 and SVT15-3FW4M-GS2-SVG06M4-H6 bind to both TeNT and either Alb or IgG as demonstrated by the ELISA using dog IgG or dog Alb coating and biotinylated TeNT. Monomeric SDAs do not show binding in these ELISAs. STV02-GS2-SVG13M4-H6 gives a maximal absorbance value on dog IgG of 0.18 that is much lower than the other multimeric SDAs containing SVG13M4 but comparable to the value of 0.16 for monomeric SVG13L and clearly above the background values of 0.05-0.06 observed for a specific monomeric SVT-SDAs. This indicates that STVO2-GS2-SVG13M4-H6 binds dog IgG. This is confirmed by the higher absorbance values using biotinylated TeNT for STVO2-GS2-SVG13M4-H6 detection bound to plates coated with dog IgG.
(91) Taken together, all multimeric SDAs show bispecific binding to TeNT and either IgG or Alb but some SDAs do not show strong binding in specific ELISAs since they do not bind to directly coated TeNT (SVT02 containing SDAs), or they do not inhibit GT1b-TeNT interaction (SVT02 containing SDAs) or they have lost the C-terminal his-tag (SVT02-GS2-SVG06M4-H6 and SVT15-3FW4M-GS2-SVG06M4-H6).
(92) To confirm the bispecific/bivalent nature of the multimeric SDAs a second and completely different assay system was used. Biolayer interferometry (BLI) was used as an analytical technique to measure the interactions between TeNT (holotoxin), Albumin (horse) and several SDAs. BLI is an optical technique that analyses the interference pattern of waves of light reflected from two surfaces. Changes in the number of molecules bound to the biosensor causes a spectral shift in the interference wavelength pattern that is measured (real time) and reported in nanometer (nm) shift. The Octet? platform provides herewith the means to obtain accurate information about the rate of biomolecular complex formation between SDAs and target antigens. The Octet Red96 instrument (ForteBio) was equipped with Streptavidin (SAX) biosensors. For measurements 10 ?g/ml of biotinylated TeNT (bio-T, Table 17a) or biotinylated horse Albumin (bio-Ah, Table 17b), called the ligand, was coupled to SAX sensors for 10 minutes. The sensors (loaded with the respective target antigen) where than transferred into a solution that contained a specific SDA (mono or multimeric) at 100 nM, and it was measured if interaction occurred for 4 minutes. In a next step the sensors, now with bound with mono or multimeric SDA, were transferred in a solution and allowed to react with a second analyte either the non-labeled toxin (TeNT, at 100 nM) or horse Albumin (Ah, at 100 nM) for 5 minutes. The interaction (nm shift) between sensor and analyte was again monitored. The results were analyzed and Tables 17a and 17b below shows the results for different SDAs (mono and multimeric).
(93) From the results it can be concluded that: SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 demonstrates bivalent binding to two TeNT-TeNT molecules. SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT06-GS2-SVA12M2-H6 demonstrate bispecific binding to TeNT and horse albumin in two different test setups. SVT16-L123Q-GS2-SVG13M4-H6 and SVT16L were able to bind to TeNT. SVT16-L123Q-GS2-SVG13M4-H6 and SVG13L was as expected not able to interact with horse albumin.
(94) 16. Analysis of Multimeric SDA Serum Half-Life in Swine
(95) Several in vitro assays (examples 4, 5, 7, 8, 9, 15 and 18) with mono and multimeric SDAs have demonstrated that these SDAs can bind to blood components of several species (e.g. Equine, Canine, Feline and Swine). To evaluate the in vivo characteristics of some of the SDAs with regard to prolongation of serum half-life an animal experiment was performed. The animal experiment was performed in swine, being a true cross species since the SDAs were generated by use of Equine and Canine proteins only. For this purpose 24 about 6 weeks old piglets consisting of 12 males and 12 females were used. They were weighed 10 days before multimeric SDA inoculation and allocated into four groups of 6 piglets each with equal distribution of gender, preferably equal average body weights and preferably equal distribution of piglets according to sow origin. Groups (Table 18) are indicated by the name of the plasmid encoding the bispecific SDAs (pRL489, pRL490, pRL495 and pRL499) to be injected intramuscularly. Three piglets of group pRL489, two males and one female, also received a second bispecific SDA encoded by plasmid pRL276 called M8ggsVI4q6e [44]. This bispecific SDA contains the same IgG binding SDA domain as SDA2 K609ggsVI-4q6e that was earlier used for measuring half-life [19], but a different fused SDA domain that is specific for foot-and-mouth disease virus (FMDV) antigen.
(96) Piglets were weighed one day before SDA inoculation (day-1). Based on these body weights the dosing of the multimeric SDAs was calculated (Table 18). Dosages increased from 0.2, 0.3 to 0.5 mg/kg for each group. Filter sterilized SDAs diluted in PBS were injected intramuscularly at a single site into the hind thigh in a volume of about 5 ml. Blood samples for serum preparation were collected from the vena jugularis immediately prior to SDA inoculation and 1, 2, 4, 8, 11, 14, 21 and 28 days after SDA inoculation. The body weight of the piglets was also determined at the end of the experiment at day 28 in order to compensate serum half-life for growth of animals.
(97) SDA levels in sera were determined by ELISA using either TeNT holotoxin or FMDV and an anti-tag mAb PO-conjugate. For this purpose 96-well polystyrene plates coated with either TeNT holotoxin at 2 ?g/ml in PBS or SDA M23F specific for FMDV 01 manisa [2] dissolved in coating buffer (50 mM NaHCO.sub.3 pH 9.2 buffer) overnight at 4? C. at 100 ?l/well. All subsequent incubations were done, after washing plates with buffer, for 1 hr at RT. M23F coated plates were subsequently incubated with 5 ?g/ml 146S of FMDV 01 Manisa in ELISA buffer. Then plates were incubated with twofold SDA dilution series over eight wells starting at both 1 ?g/ml and 0.1 ?g/ml SDA standard in two series and fivefold diluted piglet sera. Sera of piglets inoculated with SVT06 or SVT16 containing multimeric SDAs were incubated on TeNT-coated plates whereas sera from piglets inoculated with M8ggsVI4q6e were incubated on FMDV-coated plates. TeNT-coated plates were subsequently incubated with anti-his6 mAb-PO conjugate and FMDV coated plates with anti-myc mAb-PO conjugate. Bound PO was then detected by staining with 3,3,5,5 tetramethylbenzidine. After stopping the reaction by addition of 0.5 M sulfuric acid the absorbance at 450 nm was measured using a spectrophotometer. A four-parameter logistic curve was fitted to absorbance and SDA concentrations of standards. This curve was used to interpolate the SDA concentration resulting in a particular absorbance value for each serum sample in each ELISA. Calculated serum SDA concentrations were exported to an Excel? spreadsheet template (Microsoft Corporation, Redmond, USA).
(98) Piglet weight increased from about 10 kg to about 25 kg during the 4 weeks period of serum collection. We compensated for body weight increase in serum half-life measurement as follows. For each piglet we assumed that the body weight increase per hour depends on the initial body weight and fits to the formula BW(t)=BW(0)*T{circumflex over ()}t, that can be rewritten as T=10{circumflex over ()}(log 10(BW(t)/BW(0))/t), where t is time in hours, where BW(t) is body weight at time t, BW(0) is body weight at time 0, T is fraction weight gain per hour.
(99) This allows the calculation of factor T from the piglets weights at day ?1 and day 28. At intermediate time points between day ?1 and day 28 we then compensated for body weight increase by multiplying the VHH concentration measured with T{circumflex over ()}t.
(100) Terminal serum half-life was calculated according to the formula: SDA(t)=SDA(0)*(0.5{circumflex over ()}(t/T??)), where t is time in hrs, where SDA(0) is the SDA concentration at first time point used, for half-life calculation that is compensated for body weight increase, SDA(t) is than the SDA concentration at time t, T?? is the terminal half-life.
(101) Since the day 28 samples contained a lower SDA level as revealed by absorbance values that were often less than 3 times the background absorbance value these data were omitted from analysis. The serum half-life was calculated from the day 4 to day 21 samples. The Solver function of Microsoft Excel was used to fit SDA concentrations against time according to the above formula for each individual piglet. Average and standard deviation of T?? were then calculated.
(102) The biodistribution volume of intravenous injected IgG in humans is 60 ml/kg body weight according to references in [73]. Therefore, the initial (day 1-2) concentration of SDA in blood is expected to be a bit less than 1/0.06=16.67 times the injected dose since most SDA is initially in the blood. This fits nicely for the three Alb binding SDAs and control SDA M8ggsVI-4q6e that have initial SDA concentrations above 2 mg/L (
(103) The T?? of SDAs starting from day 4 (96 h.) was calculated, including bodyweight compensation, these are summarized in Table 18. The T?? of M8ggsVI-4q6e is lower than T?? of K609ggsVI-4q6e measured earlier [19]. This could be due to the different SDA fused or a difference between the two animal experiments.
(104) All three Alb binding multimeric SDAs showed a T?? ranging from 111 to 135 hr, with low standard deviations. This is higher than the T?? of 82 hr of the positive control SDA M8ggsVI-4q6e. All these three multimeric SDAs contained the Alb binding SDA domain SVA12M2, fused to either SVT06, SVT16-L123Q or fused to both these SVT SDA domains into a multimeric SDA. Apparently the half-life driven by SVA12M2 is not affected by the specific SVT SDA fused to it, nor by the number of SDAs fused to it.
(105) The T?? of SVT16-L123Q-GS2-SVG13M4-H6 containing the SVG13 SDA directed against IgG is only 20 hr. The T?? is clearly increased as compared to a control monomer SDA K609ggsK812 that does not bind serum proteins and has a 1.8 hours T?? [19], indicating that half-life extension did occur. Nevertheless this is much lower than the T?? of the Alb binding multimeric SDAs. The binding of SVG13L to porcine IgG in ELISA resulted in lower maximal absorbance values and lower EC values for swine IgG when compared to Feline, Equine, Canine and human IgG (Table 8). This suggests that the binding of SVG13L to other IgG than porcine IgG is of higher affinity and leads consequently to a more prolonged serum half-life in these species.
(106) The affinity of SVA12L to Equine, Canine and Feline Albumin varies between 10.sup.?270 nM, and was approximately 159 nM for swine Albumin (example 18). Therefore a similar or even better serum half-life of SVA12 when included in multimeric SDAs can be expected in vivo in Equine, Canine and Felines.
(107) The positive control M8ggsVI-4q6e contains the SDA domain VI-4 as also contained in VI-4L (example 9). The SDAs VI-4L, V18L, V111L and V114L have an affinity (K.sub.D) of 1-33 nM to porcine IgG [19,44]. The SDA SVG13 gave comparable EC values to Equine, Canine and Feline IgG as the SDAs VI4L, VI8L, VilL and V114L demonstrated against swine IgG (Table 8). Therefore a similar serum half-life of SVG13 can be expected in vivo in Equine, Canine and Feline species.
(108) 17. Analysis of SDA for Tetanus Toxin Neutralizing Capacity in a Mouse Model
(109) In vitro assays (examples 3, 10, 11, 12, 13, 15 and 18) with mono and multimeric SVT based SDAs demonstrated that these SDAs can efficiently bind to tetanus holotoxin in several experimental test settings. To evaluate the in vivo characteristics of some of these SDAs an animal experiment was performed to assess their tetanus toxin neutralising capacity. Six candidate SDA samples (see Table 19) were tested for anti-tetanus toxin potency using the mouse toxin neutralisation test. One monomeric SDA (SVT03L), four bispecific SDAs (SVT02-GS2-SVG13M4-H6, SVT06-GS2-SVG13M4-H6, SVT153FW4M-GS2-SVG13M4-H6, SVT16L123Q-GS2-SVG13M4-H6), and one bispecific (for albumin and tetanus) and bivalent (for tetanus toxin) SDA (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) were evaluated in the mouse toxin neutralisation test (TNT). It was performed following a method similar to as described in the European Pharmacopoeia monograph 0091 for tetanus antitoxin. The assay was performed using a level of sensitivity higher than the method described in the Ph Eur monograph 0091, allowing for detection of lower amounts of toxin neutralising antibodies in order to accurately determine the neutralizing endpoints of the SDAs. The tetanus toxin (NIBSC: AWX 4664, diluted 1/100) dose level of the assay performed was at Lp/200. A reference tetanus antitoxin TE3 (prediluted 1/400 to 0.025 lU/ml in the first dilution) was included (one group of 4 mice) in each study which allowed determination of the potency for each test sample. Each time a fixed volume of 0.35 ml toxin was mixed with 2.15 ml of prediluted SDA test sample and left to stand for 30 minutes prior to injection into mice (0.5 ml s.c., left thigh). Each prediluted sample was serially diluted with buffer to create a two-fold or four-fold dilution series. Each SDA dilution had n=4 mice. Animals were observed for 96 hr for signs of tetanus paresis. In each assay the reference TE3 was diluted (two fold or fourfold) with buffer.ln each study (1, 2 and 3) female NIH mice, 16-20 g, age 5-6 weeks were used. In total 3 consecutive studies were performed.
(110) In study 1 the SDA samples were diluted such that the starting concentration of each SDA in the assay mixture was 1000 nM for all candidates, except for SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 where the amount in the mixture was 100 nM. Each candidate was then serially diluted to create a two-fold dilution series of 5 or 6 dilutions in total (see table 19). Each dilution was mixed with a fixed amount of tetanus toxin and left to stand for 30 minutes prior to injection into mice (0.5 ml s.c., left thigh). Each dilution group had n=4 mice. Animals were observed for 96h for signs of tetanus paresis. The proportion of mice protected at each dilution is shown in table 19. No in vivo tetanus toxin neutralising effect, at 1000 nM level, was noted for the SDAs SVT02-GS2-SVG13M4-H6, SVT03L and SVT16-L123Q-GS2-SVG13M4-H6.
(111) The SDAs SVT06-GS2-SVG13M4-H6 and SVT15-3FW4M-GS2-SVG13M4-H6 both provided protection, at the 1000 nM and 500 nM concentration. Both SDAs were able to neutralize the tetanus toxin effectively when tested in this in vivo model.
(112) The SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 SDA provided full protection at all 6 dilutions. Although given at a 10-fold lower concentration this bivalent (i.e. to TeNT) SDA was more potent than all other bispecific SDAs. In addition, the SVA12L SDA fused to the two fused SVT SDAs (SVT06-GS3-SVT16-L123Q) does (in vitro) not bind to mouse albumin. Therefore this multimeric SDA neutralises the tetanus toxin very efficient in the 30 minutes incubation time that is given. Based on the concentration of the reference antitoxin TE3 (prediluted 1/400 to 0.025 IU/ml in the first dilution) at end-point (mid-way between dilution steps 2 and 3), the potency for each test sample can be expressed in IU/ml. Note that where no end-point was obtained, the potency is expressed as <(if 0% protection at all dilutions) or >(if 100% protection at all dilutions). The data are shown in table 20.
(113) The end-point for the reference antitoxin was midway between dilutions 2 and 3=1.3 ml in the assay mixture (0.0325 IU in the assay mixture). For the unknown samples, at end-point there is 0.0325 IU in the assay mixture=0.0325 IU in 2.15 ml which=0.0151 IU/ml. This value can then be multiplied by the respective total dilution factor of the relevant SDA.
(114) The trivalent SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 has the highest potency (protection at lower than 3.1 nM) of all samples tested. It is a trivalent SDA, with one SDA (SVA12), out of three linked SDAs, that binds to the albumin of several species. The other two SDAs (SVT06 and SVT16) bind with high affinity (low K.sub.D value to the tetanus toxin and each bind to a different domain (example 13, 15, 18).
(115) Subsequently, another TNT had to be performed (study 2) to determine the endpoint of protection for SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6. In addition, in the literature [7,42] it is described that mixing mouse monoclonal antibodies directed against different epitopes can provide a synergistic effect towards the level of tetanus toxin neutralisation. A similar effect was observed for scFvs that can neutralise tetanus toxin [67]. Others [24] have published that a bivalent anti tetanus toxin nanobody did not lead to a strong improved efficacy when compared to the monomeric form. Therefore, in addition in this second test it was evaluated whether combinations of these different multimeric SDAs when mixed together in a solution would show a stronger toxin neutralisation effect (synergistic effect) than when tested single, see Table 21 for the scheme tested. The assay was performed as described above.
(116) The results of the 2nd mouse toxin neutralisation test are shown in Table 22a and 22b and 23. The end-point for the reference antitoxin was the same as in study 1, midway between dilutions 2 and 3=1.3 ml in the assay mixture (0.0325 IU in the assay mixture). The same potency calculation (based on the relevant concentrations at the first dilution) could therefore be followed for group 7 (single SDA) as shown in study 1. For the SDA combinations it is not possible to provide an estimate for the potency of each SDA in the mixture as the relative contribution of each SDA is unknown. The potency of the mixture can however be described as the lowest concentration (nM) at which the SDA mixture provided a 100% protection (Table 22b).
(117) The multimeric SDAs SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6 when mixed with SVT06-GS2-SVG13M4-H6 at 62.5 nM (group 1 and 3) provided protection at least at a >125 fold higher level, final concentration of both SDAs was 3.91 nM in total, than when SVT06-GS2-SVG13M4-H6 was tested as single molecule (500 nM). Thus clear evidence of a strong synergistic effect between these SDAs (see Table 21a+21b) was demonstrated.
(118) The mice in Group 5 were unprotected, this shows that in this mixture, and at these concentrations of the relevant SDAs, no synergistic effect was found for SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6.
(119) The SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 again provided full protection at all dilutions. The final dilution at which full protection was found had an amount of SDA equal to 0.2 nM (Table 23). The potency of this SDA consequently is >1478 IU/mg.
(120) From the data in study 2 it cannot be excluded whether the SDAs SVT02-GS2-SVG13M4-H6 and SVT03L can have a synergistic effect since the synergistic effect of the other SDAs in the mixtures alone is present at the final dilution. The final concentrations of in group 2 and 4 of the individual SDAs SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6 when mixed with SVT06-GS2-SVG13M4-H6 was however two-fold lower than that of the same SDAs in group 1 and 3. At the lowest concentration (0.97 nM in the final dilution step) full protection was found. Subsequently a third study was performed to determine the endpoint of potency of candidate SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (see Table 24 below). In this study it was decided to implement a 4-fold dilution per step. In addition, in order to investigate whether the single multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 alone was more potent than when the two SDAs SVT06-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6 molecules were mixed and diluted in the same manner this group was included as well.
(121) To investigate whether SVT15-3FW4M-GS2-SVG13M4-H6 could further increase the potency of the single SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 the mixture of both was tested as well in a separate group.
(122) In study 3 the endpoint for the reference antitoxin (TE-3) was slightly different to that obtained in study1 and study 2 with only 75% of animals protected in dilution 2 (Table 24). Using the Spearman-Karber method to calculate the 50% protective dose, the concentration of antitoxin at end point is calculated as 0.034 IU in the assay mixture (in phase 1 and 2, the end point for the reference was midway between dilutions 2 and 3=0.0325 IU in the assay mixture).
(123) For SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, which was tested individually, the end point is dilution 1 (50% of animals protected) and dilution 1 contains 0.034 IU in the assay mixture (=0.034 IU in 2.15 ml of test sample and 0.0158 IU/ml). A neutralising titre can be calculated by multiplying the total dilution factor for the sample by the concentration of antitoxin at end point as shown in Table 25.
(124) The very high tetanus toxin neutralising capacity for SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 was again confirmed. The potency of the master stock for this particular multimeric SDA was calculated from the results of this particular assay at 11,474 IU/ml which would equate to more than 1500 IU/per mg protein. In another assay with smaller dilutions steps from 0.2 nM onwards the neutralising capacity of this SDA can be determined even more precisely.
(125) Notably, SVA12L does not bind to mouse Alb and therefore is unlikely to give half-life elongation in mice and contribute to the measured potency (example 7) after administering it to the mice. Indication of a synergistic effect of combining SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT15-3FW4M-GS2-SVG13M4-H6 was demonstrated at 0.4 nM of total SDA providing full protection.
(126) No protection was seen in this assay for the combination of candidate SVT06-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6. Therefore based on the results shown above it can be concluded that the total concentration of this SDA pair required to give full protection would be in the range 0.4-4 nM, resulting in an amount of 0.2-2 nM or lower for the individual SDAs in the mixture.
(127) Therefore the three studies performed show that the single bivalent and bispecific multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 provides a very high level of protection against the extremely potent tetanus toxin. Furthermore, it outperformed the strong synergistic effect seen after mixing the two single bispecific SDAs SVT06-GS2-SVG13M4-H6 and SVT16-L123Q-GS2-SVG13M4-H6. The SVG13L SDA has shown to bind to mouse IgG (example 8) which may have contributed to the potency of these bispecific SDAs after administration of the mixture to mice. The bivalent bispecific SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 has as a single molecule more potency than suprasynergistic tetanus toxin neutralising properties shown of the mixture, this is a remarkable feature.
(128) 18. Affinity Determination of Different SDAs Against TeNT, Albumin and Immunoglobulin
(129) Several SDAs were tested for their target (TeNT, albumin and immunoglobulin of different species) binding characteristics. The tetanus toxin binding characteristics are of importance in the capacity of each SVT SDA to neutralise the tetanus toxin in vivo (example 17). The SVA and SVG SDAs once fused to the SVT SDAs serve to prolong the terminal serum half-life of the SVT SDAs. Thus for the SVA and SVG SDAs binding characteristics [19, 22, 23, 25] to the different blood components are of importance. For veterinary purposes it is in addition of importance to address the species differences between such blood components. For certain cross species disease targets (e.g. Tetanus) it would be preferred to use a single SDA for therapeutic use in several species instead of developing for each species a separate therapeutic SDA.
(130) Here, the biolayer interferometry (BLI) technique was used to measure the interactions between TeNT, albumin of different species and immunoglobulin of different species and several mono and multimeric SDAs. BLI is an optical analytical technique that analyses the interference patterns between waves of light. Changes in the number of molecules (analyte) bound to the biosensor (coated with ligand) causes a spectral shift (nm shift) in the interference wavelength pattern (=signal) that is measured in real time. K.sub.D is the affinity constant, or equilibrium dissociation constant, which is a measure for how tightly the ligand binds to its analyte. It represents the ratio of the on-rate to the off-rate and can be calculated using k.sub.a and k.sub.dis. K.sub.D is expressed in molar units (M). The K.sub.D corresponds to the concentration of analyte at which 50% of ligand binding sites are occupied at equilibrium, or the concentration at which the number of ligand molecules with analyte bound equals the number of ligand molecules without analyte bound. There is an inverse relationship between Ko and affinity a smaller affinity constant indicates a tighter interaction, or greater affinity of analyte to ligand.
(131) To measure the interactions between the targets and SDAs the Octet Red96 instrument (Pall Life Sciences) was equipped with either Streptavidin (SA/SAX), Anti-Penta-HI (HIS1 K) or for example Ni-NTA (NTA) Dip and Read? biosensors (Fort?Bio).
(132) To determine the binding affinity of SDAs to tetanus toxin 2 ?g/ml of biotinylated (see example 3) TeNT was coupled to SA sensors. The SDAs were diluted in PBS buffer (PBS 10?Fischer scientific, cat BP399-1 and WFI, Hyclone, cat #SH3022110) containing 0.02% Tween 20 (ACROS ORGANICS, CAT #233362500) (PBSTween) in a twofold dilution series from 100 nM to 1.56 nM (SVT02-GS2-SVG13M4-H6, SVT03L, SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16L123Q-GS2-SVG13M4-H6), or a twofold dilution series from 10 nM to 0.156 nM (SVT06-GS2-SVG13M4-H6, SVT06-GS2-SVA12M2-H6 and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6). The SDA dilution series were incubated with TeNT-coupled sensors for 5 minutes (100 nM start concentration) or 10 minutes (10 nM start concentration) followed by a dissociation step in PBS-Tween for another 10 minutes (SVT02-GS2-SVG13M4-H6, SVT03L, SVT15-3FW4M-GS2-SVG13M4-H6 and SVT16L123Q-GS2-SVG13M4-H6) or 60 minutes (SVT06-GS2-SVG13M4-H6, SVT06-GS2-SVA12M2-H6 and SVT06-GS3-SVT16-L123Q-SVA1212M2-H6).
(133) To determine the binding affinity of the SDAs SVT06L, SVT15L and SVT16L to tetanus toxin, 5 ?g/ml of the respective biotinylated SDA was coupled to SA sensors and the tetanus toxin, in a twofold dilution series from 75 nM to 4.69 nM were incubated with the SDA-coupled sensors for 5 minutes followed by a dissociation step in PBS-Tween for another 30 minutes.
(134) The results were then analyzed using ForteBio Data Analysis software to determine the affinity constant (K.sub.D, which is k.sub.diss/k.sub.a). Table 27 shows affinity data for several purified SDAs.
(135) The bispecific and monomeric SDAs (SVT02-GS2-SVG13M4-H6, SVT06-GS2-SVG13M4-H6, SVT06-GS2-SVA12M2-H6, SVT15-3FW4M-GS2-SVG13M4-H6, SVT06L, SVT15L, SVT16L, SVT16L123Q-GS2-SVA12M2-H6, SVT16L123Q-GS2-SVG13M4-H6) bound with sub-nanomolar to picomolar affinities to TeNT. For TeNT neutralisation capacity this is a pivotal characteristic. A quick association and a strongly delayed dissociation of the SVT based SDAs prevent the toxin from exerting its activity in a rapid and durable manner at low toxin concentrations that are normally found in intoxicated animals.
(136) Especially the stability of the complex of tetanus toxin and SDA is important as it will prevent for example the uptake of the toxin in the neuron. Very low dissociation (Kdis) values were found for the SDAs SVT03L, SVT15-3FW4M-GS2-SVG13M4-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVG06M4-H6 and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6.
(137) For three out of four of these fragment C binding SDAs SVT06-GS2-SVG13M4-H6, SVT15-3FW4M-GS2-SVG13M4-H6 and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 excellent toxin neutralising properties were demonstrated when tested as single SDA (at <4 ?g/ml and <30 ng/ml levels) and mixed together (at <30 ng/ml levels, see example 17) in an in vivo TNT.
(138) The avidity (K.sub.D) for TeNT of the three SDAs containing two SVT domains, SVT06-GS3-SVT02-GS2-SVG06M4-H6, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 is in the picomolar range. For SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 the measured avidity is 13 picomolar and this SDA has shown excellent tetanus toxin neutralising properties in the in vivo toxin neutralisation model (example 17).
(139) This SDA has an about tenfold higher affinity (lower K.sub.D value) than the affinities of comparable monomeric SDAs or multimeric VHHs containing only one corresponding TeNT binding SDA domain (SVT06 or SVT16), suggesting that both SDA domains present in SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 are capable of simultaneous antigen binding.
(140) For determining the binding affinity of SDAs to serum albumin several assays were performed. Firstly 1.0 (SVA06L) or 1.5 (SVA12L, SVA16L) microgram/ml of SDA was coupled to Ni-NTA sensors (loading time 15 min). The Equine, Canine or Feline albumin was added as analyte, in a twofold dilution series from 76.9 nM to 4.81 nM (Horse or Dog or Cat albumin) for SVA06L. For SVA12L a twofold dilution series from 307.7 nM to 19.2 nM (Horse or Dog albumin), or 615.4 nM to 38.5 nM (Cat albumin) was used. For SVA16L a twofold dilution series from 100 nM to 3.1 nM (Horse, Dog and Cat albumin) was used. Albumins were reacted on the SDA (SVA06L and SVA12L) coated sensors for 1 minute followed by a dissociation step in PBSTween for another 2 minutes, for SVA16L the intervals were 3 and 5 minutes respectively.
(141) To determine the affinity of SVA12L to Swine albumin a twofold dilution series of 250 to 15.6 nM was used, here a one minute association and dissociation step was used.
(142) The results were then analyzed using ForteBio Data Analysis software. Table 28 shows the data for the tested SDAs.
(143) Several SDAs that bind to the Fc part of Equine or Canine immunoglobulin were also tested for their binding characteristics. Firstly, to determine the affinity of SDAs SVG03L, SVG23L and SVG24L when binding to Equine IgG (Fc) (Fitzgerald, cat #31C-CH0804), a setup was used were 0.5 ?g/ml of the SDA was coupled to NTA sensors. The scout assay showed that SVG23L did not bind to the Equine Fc protein used. The Equine IgG (Fc) was diluted in PBSTween in a twofold dilution series from 50 nM to 3.13 nM for SDA SVG03L. The Equine IgG (Fc) was diluted in PBSTween in a twofold dilution series from 100 nM to 6.25 nM for SDA SVG24L. The Fc dilution series were incubated with SDA-coupled sensors for 3 minutes (association phase) followed by a dissociation step in PBSTween for 10 minutes.
(144) To determine the affinity of SDAs SVG03L, SVG23L and SVG24L when binding to Canine IgG (Fc) (Rockland, cat #004-0103), a setup was used were 1 ?g/ml of the SDA was coupled to NTA sensors. The scout assay showed that SVG03L did not bind to the Canine Fc protein used. The Canine IgG (Fc) was diluted in PBSTween in a twofold dilution series from 40 nM to 2.5 nM for SDA SVG23L. The Canine IgG (Fc) was diluted in PBSTween in a twofold dilution series from 400 nM to 18.80 nM for SDA SVG24L. The Fc dilution series were incubated with SDA-coupled sensors for 70-100 seconds (association phase) followed by a dissociation step in PBSTween for 5 minutes.
(145) The results were then analysed using ForteBio Data Analysis software. Table 35 shows the data for the tested SDAs against the Fc part of Equine or Canine immunoglobulin.
(146) Since albumin and immunoglobulin are abundant serum proteins the affinity of SDAs for albumin or immunoglobulin does not need to be very high in order to have most SDAs molecules bind these targets. Consistent with this notion, it has been observed that serum half-life extension of protein therapeutics using genetically engineered bacterial albumin binding domains was mostly not dependent on the affinity for albumin. If K.sub.D values were lower than 100 nM (increased binding affinity) then serum half-life was not affected by affinity. Only when K.sub.D values became close to 1 ?M was serum half-life slightly decreased [36,37].
(147) For the SDAs SVA06L, SVA12L and SVA16L the affinity to albumin of Porcine, Equine, Canine or Feline origin varied between 1-275 nM and all were below 1000 nM. For the multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 a serum half-life of approximately 110.sup.?145 hours was estimated in young swine. At 21 days after administration the SDAs SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 (0.3 mg/kg), SVT06-GS2-SVA12M2-H6 (0.2 mg/kg) and SVT16-L123Q-GS2-SVA12M2-H6 (0.5 mg/kg) were still detectable in the serum of swine. Thus for SDA SVA12L the dosage given, the amount of SDAs fused to it and the type of SDA did not influence significantly the half-life in swine. Since all the SVA SDAs were generated with Equine and Canine albumin a similar half-life profile can be expected for these SDAs in Equines, Canines and Felines.
(148) For the SDAs SVG03L, SVG23L and SVG24L the affinity constant Ko to the Fc part of the immunoglobulin of Equine or Canine origin varied between 0.1-4 nM and all were below 10 nM. The use of these binders may be of benefit in interfering with different immunological processes (a.o. activation of the complement pathway, type I hypersensitivity reactions, allergy, atopy).
(149) 19. Construction and Production of Further Multimeric SDAs Against TeNT
(150) Two more multimeric SDAs (SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) were produced by making stable MIRY integrants [75] using plasmid pRL44 [69] in yeast strain SU50 [70]. The elements from which these multimeric SDAs were made are as follows: GS3: (G4S).sub.3 linker described earlier [27] GS2: (G4S).sub.2 linker derived from pRL144 plasmid [19] H6: his6 tag, double stop codon and Hindlll site as in pRL188 [2] SVG13M5: SVG13 with five mutations: Q1E, Q5V, W118R, K120Q, L123Q SVA12M2: SVA12 with two mutations: Q1E, Q5V SVT15-3FW4M: SVT15 without internal Sac site and 3 mutations: K120Q, 1122T, L123Q SVT16-L123Q: SVT16 with silently restored BstEII site and L123Q mutation Synthetic Sacl-Hindill fragments were produced and subsequently subcloned into plasmid pRL44 [69] using Sac and Hindlll sites, resulting in plasmids pRL505 and pRL506 (Table 34).
(151) Baker's yeast strain SU50 (MATa; cir?; leu2-3,-112; his4-519; can1; [70]) was transformed with Hpal-linearized plasmids pRL505 and pRL506 by electroporation [71] and leu+ auxotrophs were selected. A single colony-purified transformant was induced for SDA expression at 0.5 L scale and SDA was purified from spent culture supernatant by IMAC [58]. SDA was subsequent further purified by cation exchange chromatography on an SP sepharose column as earlier described [44] with slight modifications. SP sepharose Fast Flow (GE Healthcare, Piscataway, NJ) and 25 mM sodium acetate pH 4.7 buffer was used for SDA binding to the column. Bound SDA was eluted with a step gradient of 0.1, 0.2, 0.4, 0.6, 0.8 and 1 M NaCl in binding buffer. Bound SDA generally eluted between 0.4 and 0.6 M NaCl (Table 34). It was concentrated and buffer exchanged to PBS using 3-kDa molecular weight cutoff centrifugal concentration devices. The SDA concentration was determined using the bicinchonic acid assay (BCA, Pierce cat.no, 23212) and a bovine serum albumin standard (Thermo Scientific, Rockford, IL). Based on purified SDA yield the production level of the multimeric SDAs in yeast was calculated (Table 34).
(152) Multimeric SDAs were analysed by reducing SDS PAGE using NuPage Novex 4%-12% Bis-Tris gels with MOPS running buffer (Invitrogen) and staining with Gelcode Blue reagent (Thermo Scientific). Both multimeric SDAs migrated at positions expected based on their predicted molecular mass. From the stocks a sample was biotinylated (Sulfo-NHS-LC-biotin, Pierce, Cat. No. 21335, lot No. OE185235A) with an appropriate weight ratio of protein to biotin.
(153) 20. Further Bindings Characteristics of Several SDAs Against TeNT,
(154) Further assays were performed to study the binding of a selection of SDAs when compared to cAb-TT1 and cAb-TT2 [46] when using the Octet Red96 instrument (Pall Life Sciences) when equipped with Streptavidin (SA) biosensors. For this purpose the binding affinity of the SDAs SVT06L, SVT15L and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, cAb-TT1 and cAb-TT2 to tetanus toxin was evaluated.
(155) To determine the binding affinity to tetanus toxin, the biotinylated SDAs were coupled to SA sensors (see example 18). A twofold dilution series of the tetanus toxin was prepared, for assay details see table 29. After further assay optimisation the SDAs were incubated with the different dilutions of the tetanus toxin, the association step (2-8 minutes), followed by a dissociation step in PBS-Tween (2-10 minutes). The results were then analysed using ForteBio Data Analysis software to determine the affinity constant (K.sub.D), table 29 shows the affinity data for each SDA.
(156) The earlier test results (see Table 27) of SVT06L, SVT15L and SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 were repeated in this assay setup and confirm the high affinity to tetanus toxin. For cAb-TT1 and cAb-TT2 the lower affinity as published was confirmed. Especially the fast dissociation of both cAb-TT1 and cAb-TT2 is remarkable. However, this is in line with the results from a mouse toxin neutralisation test, as described in WO96/34103, where after application of 4 ?g of cAb-TT2 75% of the mice had died after 4 days. In contrast, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 has protected mice when used at low nanogram levels (20-30 ng/ml) in several sequentially performed TNTs against a 5? higher lethal dose of the tetanus toxin.
(157) To determine the affinity of 2 additional multimeric SDAs (SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) when binding to tetanus toxin, a setup was used were 4 ?g/ml of biotinylated TeNT was coupled to SA sensors. The SDAs (incl. SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6) were diluted in PBS buffer containing 0.02% Tween 20 (PBSTween) in a twofold dilution series from 10 nM to 0.62 nM. The SDA dilution series were incubated with TeNT-coupled sensors for 3 minutes (association phase) followed by a dissociation step in PBS-Tween for another 15 minutes. The results were then analysed using Fort?Bio Data Analysis software to determine the affinity constant (K.sub.D) for each SDA.
(158) From this study the bispecific (binding to tetanus toxin, and albumin or IgG) and bivalent (for tetanus toxin) SDAs bound with sub-nanomolar to picomolar affinities to TeNT, see Table 30. It is expected that these SDAs (SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) will provide effective neutralisation of tetanus toxin in vivo at low nanogram levels based on the results provided in example 17.
(159) 21. Further Bindings Characteristics of Several Multimeric SDAs Against Equine, Human or Canine Albumin,
(160) In order to determine the binding affinity of a selection of bivalent and bispecific (multimeric) SDAs to Equine, Canine and Human serum albumin additional assays were performed.
(161) To determine the affinity of 3 multimeric SDAs (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) when binding to Equine albumin, after optimisation a setup was used were 2.5 microgram/ml of biotinylated (Sulfo-NHS-LC-biotin, Pierce, Cat. No. 21335, lot No. OE185235A, at an appropriate weight ratio of protein to biotin) Equine or 5.0 microgram of Human albumin was coupled to SA sensors. After further optimisation two of these SDAs (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6) were diluted in PBS buffer containing 0.02% Tween 20 (PBSTween) in a twofold dilution series from 10 nM to 0.62 nM. The SDA dilution series were incubated with Equine albumin-coupled sensors for 6-10 minutes (association phase) followed by a dissociation step in PBS-Tween for another 10 minutes. For SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6 a concentration of 100 nM was chosen.
(162) The monomer SDA SVA12L and all 3 multimeric SDAs were evaluated for affinity binding characteristics to human albumin at a concentration of 100 nM.
(163) To determine the affinity of the 3 multimeric SDAs (SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6) when binding to Canine albumin, after optimisation a setup was used were 1.25 microgram/ml of biotinylated multimeric SDA (see example 19) was coupled to SA sensors. The Canine albumin was diluted in PBS buffer containing 0.02% Tween 20 (PBSTween) in a twofold dilution series from 500 nM to 16 nM. The albumin dilution series were incubated with the respective SDA coupled sensors for 4-5 minutes (association phase) followed by a dissociation step in PBS-Tween for another 5-10 minutes.
(164) The results were then analyzed using ForteBio Data Analysis software. Table 31a and Table 31b show the data for the tested SDAs. None of the mono or multimeric SDAs was found to bind to human albumin, as expected. The multimeric SDA_SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6 was found not to bind to Equine, Human or Canine albumin, as expected.
(165) For the multimeric SDAs SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 the affinity constant Kn to albumin of Equine or Canine origin varied between 0.5-1.5 nM and 250-400 nM, respectively. For the multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 a serum half-life of approximately 110.sup.?145 hours (4.5-6 days) was found in Porcine (see example 16) and a serum half-life of approximately 510 hours (21.25 days) was found in Equines (see example 23). Based on the affinity data one can expect a similar half-life for SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 in Porcine and Equine.
(166) 22. The Affinity of Several SDAs to TeNT as Determined by a Another Methodology (Creoptix WAVE System).
(167) For several SDAs the affinity constant to the target TeNT was in the ?M range as determined by the Octet Red96 instrument. In order to confirm these findings an additionally technology, the Creoptix? sensors proprietary Grating-Coupled Interferometry (GCI) methodology [76], was used. GCI is a method based on waveguide interferometry to monitor and characterize molecular interactions and to determine kinetic rates, affinity constants and concentrations of the interacting analytes. Waveguide Interferometry like other optical label-free methods, such as Surface Plasmon Resonance (SPR), detect refractive index changes within an evanescent field near a sensor surface due to changes in mass by complex formation of the interacting molecules. The combination of two very sensitive methods, namely interferometry and planar optical waveguide sensing leads to very low limits of detection.
(168) Affinity (KD) experiments of several mono and multimeric SDAs with TeNT as target were performed with the Creoptix WAVE instrument (Creoptix A G, Waedenswil, Switzerland), at 30? C. The protocols in the WAVE control software for conditioning of the chip (4PCP-S), immobilization of proteins and performing kinetics experiments were followed. Standard chemicals were used. Biotinylated tetanus toxin (10 microgram/ml) was immobilized on the PCH-streptavidin chip with 10 microliter/min injection and 120 s injection duration over the relevant channels. All experiments were run with PBS buffer containing 0.02% Tween 20 (PBSTween) as running buffer. The binding characteristics were evaluated for several SDAs (mono and multimeric) at five concentrations (100-1.2 nM, 3-fold dilution steps). The association phase for the evaluated SDAs was 4 minutes. For SVT 03L, SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6 the dissociation period was 6000 seconds. For SVT06-SVT16-L123Q-GS2-SVG13M4-H6 and SVT15-3FW4M-GS2-SVG13M4-H6 the dissociation duration was set at 1000 and 12000 seconds, respectively. The results were then analysed using the Creoptix Data Analysis software to determine the affinity constant (K.sub.D), results are shown in Table 32.
(169) The results confirm the earlier findings with regard to the slow dissociation and fast association of each of the SDAs tested. The K.sub.D of the SDAs tested varied between 1.0-25 ?M.
(170) 23. Analysis of the Serum Half-Life of a Multimeric SDA in Equines.
(171) For SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 the determination of the serum half-life was also performed in Equines. A relevant target species since the SDAs were generated by use of Equine and Canine albumin proteins only. For this purpose three 4.5-6.5 yr old ponies (females) were used. They were weighed before intramuscularly inoculation. Based on the body weights the needed amount of the multimeric SDA was calculated (dosage at 0.17 mg/kg) per animal. Filter sterilized SDA, dissolved in PBS, was injected intramuscularly at a single site into the hind thigh in a volume of about 2.5 ml. Blood samples for serum preparation were collected from the vena jugularis immediately prior to and at 1, 2, 4, 7, 10, 13, 17 and 21 days after SDA inoculation. SDA levels in sera were determined by ELISA using TeNT holotoxin and an anti-tag mAb PO-conjugate. For this purpose 96-well polystyrene plates coated with TeNT holotoxin at 2 ?g/ml in PBS dissolved in coating buffer (50 mM NaHCO.sub.3 pH 9.2 buffer) overnight at 40C at 100 ?l/well. All subsequent incubations were done, after washing plates with ELISA buffer (1% skimmed milk; 0.05% Tween-20; 0.5 M NaCl; 2.7 mM KCl; 2.8 mM KH.sub.2PO.sub.4; 8.1 mM Na.sub.2HPO.sub.4; pH 7.4, 100 ?l/well), for 1 hr at RT. TeNT coated plates were incubated with twofold dilution series over eight wells, per column, starting at both 1 microgram/ml and 0.1 microgram/ml with an SDA standard, a null serum spiked with 1 microgram/ml SDA in column 3 and the nine collected sera of an animal in columns 4-12. Sera were initially diluted fivefold and further twofold diluted over eight wells. After washing, TeNT-coated plates were subsequently incubated with an anti-his6 mAb-PO conjugate (1/1000, Roche, Cat. No. 11965085001). Bound PO was then detected by staining with 3,3,5,5 tetramethylbenzidine (Surmodics; Cat. No. TMBW-1000-01). After stopping the reaction by addition of 0.5 M sulfuric acid the absorbance at 450 nm was measured using a spectrophotometer. Absorbance data were evaluated using a suitable commercial software program. A four-parameter logistic curve was fitted to absorbance and SDA concentrations of standards. This curve was used to interpolate the SDA concentration resulting in a particular absorbance value for each serum sample in each ELISA. Calculated serum SDA concentrations were exported to an Excel? spreadsheet template (Microsoft Corporation, Redmond, USA).
(172) Terminal serum half-life was calculated according to the formula:
(173) SDA(t)=SDA(0)*(0.5{circumflex over ()}(t/T1/2?)), where t is time in hrs, where SDA(0) is the SDA concentration at first time point used, for half-life calculation that is compensated for body weight increase, SDA(t) is than the SDA concentration at time t, T1/2? is the terminal half-life.
(174) The serum half-life was calculated from the data retrieved from the day 2 to day 21 samples. The Solver function of Microsoft Excel was used to fit SDA concentrations against time according to the above formula for each individual animal. Average and standard deviation of T % R were then calculated (see Table 33).
(175) The animals inoculated with the (Equine) albumin binding bivalent and bispecific multimeric SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 showed an average T1/2? of 510 hr. This multimeric SDA contained the albumin binding SDA domain SVA12M2, linked to the SVT06 and SVT16-L123Q SDA domains into a multimeric SDA. At 21 days after administration of the SDA a serum level of 0.4-0.6 microgram/ml was measured for three animals, thus based on the data shown in example 17 all animals would have been protected against tetanus are levels far above the minimum level required (0.1 IU/ml). As expected, the calculated serum half-life for the SDA SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 in Equines exceeds that measured and calculated for Porcines. This supports calculations predicting that a similar long serum half-life can be expected for Canines.
(176) TABLE-US-00002 TABLE 2 Phage display selection and binding in ELISA of E. coli-produced TeNT binding SDAs. Phage display selection conditions Antigen in first round Antigen in second round Absorbance at 450 nm in ELISA Concen- Concen- GT1b- cAb-TT2 directly tration tration CDR3 TeNT directly captured coated SDA (?g/ml) Antigen (?g/ml) Antigen IEP.sup.e Group inhibition coated TeNT TeNT rTTC None .sup.NA.sup.a NA NA NA NA NA 1.302 0.053 0.058 0.054 None NA NA NA NA NA NA 1.257 0.056 0.059 0.054 SVT20 0.1 TeNT 1 TeNT 9.5 A 0.132 1.076 0.685 0.165 SVT34 0.1 TeNT 1 rTTC 9.4 A 0.117 1.433 0.483 0.160 SVT16 1 rTTC 1 TeNT 8.9 A 0.120 1.039 0.736 0.151 SVT25 0.1 TeNT 1 rTTC 9.2 A 0.139 1.135 0.427 0.211 SVT06 1 TeNT 0.1 TeNT 4.7 B 0.720 1.037 0.683 0.105 SVT31 1 rTTC 1 rTTC 5.0 B 0.105 1.379 1.095 0.218 SVT08 0.1 TeNT 0.1 TeNT 5.0 B 0.746 1.067 0.510 0.130 SVT15 1 TeNT 1 rTTC 7.0 C 0.190 1.026 0.680 0.099 SVT29 1 TeNT 1 TeNT 7.1 C 0.152 1.282 0.868 0.111 SVT13 0.1/1.sup.c cAb-TT2-TeNT 1/1 cAb-TT2-TeNT 7.8 D 0.196 0.762 0.165 0.128 SVT22 1 rTTC 1 TeNT 7.8 D 0.137 1.082 0.299 0.138 SVT02 1/1.sup.b cAb-TT2-TeNT.sup.d 1/1 cAb-TT2-TeNT 9.5 E 1.338 0.078 0.511 0.060 SVT03 1/1.sup. mAb TT10-TeNT.sup.d 1/1 mAb TT10-TeNT 8.7 F 1.286 0.091 0.534 0.061 SVT05 1 rTTC 0.1 TeNT 5.0 G 0.985 1.037 0.548 0.108 .sup.aNA, not applicable .sup.b1/1 indicates that both capture antibody and TeNT were used at 1 ?g/ml .sup.c0.1/1 indicates that capture antibody was used at 0.1 ?g/ml and TeNT at 1 ?g/ml .sup.dTeNT was captured with directly coated cAb-TT2 or mAb TT10. .sup.ePredicted from mature SDA sequence ending at IMGT residue 128 using web.expasy.orq/compute_pi/, resolution is average.
(177) TABLE-US-00003 TABLE 3 Phage display selection history and binding in ELISA of E. coli-produced IgG binding SDAs. Phage display selection conditions Antigen in round 1 Antigen in round 2 Absorbance at 450 nm in ELISA Concen- Concen- Guinea tration IgG tration IgG Dog Horse Human Swine Pig Bovine Horse Horse Dog SDA (?g/ml) Origin (?g/ml) Origin IgG IgG IgG IgG IgG IgG Fc Fab Fab None None .sup.NA.sup.a NA NA NA 0.062 0.255 0.074 0.073 0.062 0.060 0.065 0.055 0.054 0.060 None NA NA NA NA 0.068 0.261 0.074 0.072 0.082 0.073 0.067 0.053 0.057 0.053 SVG13 1 Horse 1 Horse 0.693 0.436 0.524 0.195 0.579 0.272 0.097 0.222 0.590 0.051 SVG18 1 Dog 1 Horse 1.003 0.478 0.096 0.097 0.174 0.124 0.072 0.320 1.365 0.050 SVG19 1 Horse 1 Dog 1.018 0.681 0.309 0.146 0.435 0.453 0.079 0.472 1.223 0.069 SVG06 1 Horse 1 Dog 0.277 0.325 0.365 0.131 0.204 0.172 0.073 0.089 0.178 0.059 SVG23 1 Dog 1 Dog 1.735 0.260 0.073 0.092 0.068 0.062 0.072 0.056 0.061 0.090 SVG24 1 Horse 1 Dog 1.741 0.765 0.084 0.341 0.068 0.075 1.669 0.060 0.074 0.063 SVG03 1 Horse 1 Horse 0.070 1.102 0.076 0.075 0.063 0.061 0.476 0.057 0.054 0.051 SVG07 1 Horse 1 Dog 0.479 0.401 0.170 0.103 0.249 0.121 0.099 0.152 0.454 0.060 .sup.aNA, not applicable
(178) TABLE-US-00004 TABLE 4 Phage display selection history and binding in ELISA of E. coli-produced Alb binding SDAs. Phage display selection conditions Antigen round 1 Antigen round 2 Concen- Concen- tration Alb tration Alb Absorbance at 450 nm in ELISA SDA (?g/ml) Origin (?g/ml) Origin Horse Dog Human None None .sup.NA.sup.a NA NA NA 0.087 0.115 0.083 0.135 None NA NA NA NA 0.064 0.081 0.057 0.080 SVA16 1 Horse 1 Dog 2.110 2.020 0.083 0.064 SVA04 1 Dog 1 Horse 2.013 1.533 0.085 0.151 SVA06 1 Horse 1 Dog 1.655 1.987 0.067 0.108 SVA12 1 Dog 1 Horse 1.999 1.775 0.057 0.058 SVA02 1 Dog 1 Dog 1.904 1.873 0.065 0.066 SVA07 1 Horse 1 Horse 1.455 0.059 0.062 0.060 .sup.aNA, not applicable
(179) TABLE-US-00005 TABLE 5 Yeast production of SDAs. SDA Sub-fam. Ratio SU51/ Ratio Mutant/ (designation W303-1a Wildtype Yeast according to Total SDA Production Production Production SDA Strain [52]) ml.sup.c Yield (mg) Level (mg/L) Level Level SVT02L W303-1a 1 500 0.868 1.74 ND ND SVT03L W303-1a 1 500 0.222 0.44 ND ND SVT05L W303-1a X 500 0.076 0.15 ND ND SVT06L W303-1a X 500 2.208 4.42 ND ND SVT08L W303-1a X 500 1.024 2.05 ND ND SVT13L W303-1a 3 500 1.276 2.55 ND ND SVT15L W303-1a 1 500 0.202 0.40 ND ND SVT15L W303-1a 1 50 0.016 0.32 ND ND SVT15L-3FW4M W303-1a 1 50 0.093 1.87 ND 5.2 SVT16L W303-1a 1 500 1.043 2.09 ND ND SVT20L W303-1a 1 50 0.022 0.43 ND ND SVT20L W303-1a 1 500 0.126 0.25 ND ND SVT20L-L123Q W303-1a 1 50 0.061 1.22 ND 3.6 SVT22L W303-1a 3 500 0.310 0.62 ND ND SVT25L W303-1a 1 500 0.023 0.05 ND ND SVT29L W303-1a 1 500 0.037 0.07 ND ND SVT31L W303-1a X 500 0.177 0.35 ND ND SVT34L W303-1a 1 500 0.218 0.44 ND ND SVT34L W303-1a 1 50 0.037 0.73 ND ND SVT34L-L123Q W303-1a 1 50 0.076 1.52 ND 2.6 SVG03L W303-1a 1 50 0.015 0.29 ND ND SVG06L W303-1a C 50 0.090 1.81 ND ND SVG07L W303-1a C 50 0.007 0.15 ND ND SVG13L W303-1a C 50 0.079 1.59 ND ND SVG18L W303-1a C 50 0.015 0.30 ND ND SVG19L W303-1a C 50 0.082 1.65 ND ND SVG23L W303-1a 1 50 0.021 0.41 ND ND SVG24L W303-1a 1 50 0.049 0.99 ND ND SVA02L W303-1a 1 50 0.011 0.22 ND ND SVA04L W303-1a 1 50 0.009 0.18 ND ND SVA06L W303-1a 1 50 0.011 0.21 ND ND SVA07L W303-1a 1 50 0.141 2.82 ND ND SVA12L W303-1a 1 50 0.192 3.85 ND ND SVA16L W303-1a 1 50 0.037 0.73 ND ND SVT13L SU51 3 50 0.320 6.39 2.5 ND SVT15L SU51 1 50 0.047 0.94 2.6 ND SVT20L SU51 1 50 0.190 3.79 11.1 ND SVT34L SU51 1 50 0.397 7.93 13.6 ND
(180) TABLE-US-00006 TABLE 6 ELISA binding of SVA clones to different antigens. Albumin from different species SDA Horse Dog Mouse Swine Cat Human Sheep Bovine Chicken None Maximal absorbance value at 450 nm SVA16L 1.822 1.761 0.066 0.079 0.083 0.056 0.060 0.051 0.053 0.052 SVA04L 0.190 0.069 0.107 0.080 0.087 0.052 0.052 0.050 0.052 0.050 SVA06L 0.483 0.921 0.360 0.288 0.158 0.050 0.052 0.052 0.054 0.051 SVA12L 1.950 1.674 0.057 1.371 0.202 0.056 0.054 0.055 0.055 0.051 SVA02L 0.809 0.579 0.191 0.085 0.089 0.078 0.061 0.054 0.059 0.057 SVA07L 0.550 0.056 0.079 0.084 0.086 0.060 0.055 0.056 0.057 0.054 SVT06L 0.056 0.053 0.073 0.080 0.099 0.065 0.060 0.051 0.057 0.051 No SDA 0.074 0.086 0.097 0.085 0.060 0.124 0.104 0.069 0.068 0.065 SDA Effective Concentration (ng/ml) resulting in A.sub.450 nm = 0.2.sup.a SVA16L 3.6 6.4 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 SVA04L >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 SVA06L 235 51 180 344 >1000 >1000 >1000 >1000 >1000 >1000 SVA12L 3.7 9.1 >1000 21 673 >1000 >1000 >1000 >1000 >1000 SVA02L 149 171 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 SVA07L 238 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 SVT06L >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 No SDA >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 .sup.a>1000 indicates that absorbance is below 0.2 at highest SDA concentration analysed
(181) TABLE-US-00007 TABLE 7 ELISA binding of SVG clones to different antigens Purified IgG or antibody fragments derived thereof Horse Horse Horse Horse Dog Dog Dog A450 nm for EC IgG.sup.b Fab.sub.2 Fab Fc IgG Fc Fab SDA 0.4 0.2 0.2 0.2 0.2 0.2 0.2 Maximal absorbance value at 450 nm (background subtracted).sup.b SVG03L 1.393 0.132 0.096 1.438 0.080 0.146 0.083 SVG06L 0.284 0.330 0.333 0.096 1.297 0.109 1.308 SVG07L 0.074 0.100 0.085 0.066 0.242 0.073 0.210 SVG13L 0.533 0.826 0.853 0.094 1.611 0.089 1.603 SVG18L 0.127 0.149 0.144 0.064 0.743 0.071 1.168 SVG19L 0.253 0.299 0.303 0.068 0.876 0.073 1.216 SVG23L 0.056 0.078 0.074 0.063 0.618 1.400 0.065 SVG24L 0.088 0.089 0.194 1.184 0.847 1.446 0.089 SDA Effective Concentration (ng/ml) resulting in indicated absorbance values.sup.a SVG03L 16 >1000 >1000 35 >1000 >1000 >1000 SVG06L 237 184 184 >1000 12 >1000 20 SVG07L >1000 >1000 >1000 >1000 441 >1000 818 SVG13L 45 37 44 >1000 9.7 >1000 13 SVG18L >1000 >1000 >1000 >1000 37 >1000 29 SVG19L 212 215 305 >1000 29 >1000 26 SVG23L >1000 >1000 >1000 >1000 252 78 >1000 SVG24L >1000 >1000 >1000 109 50 28 >1000 Purified IgG from different animal species Mouse Swine Cat Human Sheep Bovine Chicken Guinea Pig A450 nm for EC GG IgG GG GG GG.sup.b IgG GG.sup.b IgG SDA 0.2 0.2 0.2 0.2 0.3 0.2 0.4 0.2 Maximal absorbance value at 450 nm (background subtracted).sup.b SVG03L 0.093 0.105 0.088 0.193 0.180 0.083 0.079 0.114 SVG06L 0.708 0.402 1.609 1.301 0.328 0.721 0.070 1.075 SVG07L 0.073 0.103 0.116 0.164 0.114 0.108 0.074 0.137 SVG13L 1.002 0.436 1.633 1.255 0.277 0.704 0.164 1.309 SVG18L 0.075 0.100 0.233 0.142 0.131 0.101 0.470 0.146 SVG19L 0.136 0.114 0.583 0.249 0.162 0.322 0.397 0.318 SVG23L 0.068 0.089 0.071 0.121 0.101 0.077 0.064 0.076 SVG24L 0.091 0.132 0.108 0.139 0.144 0.087 0.069 0.094 SDA Effective Concentration (ng/ml) resulting in indicated absorbance values.sup.a SVG03L >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 SVG06L 58 71 7.5 8.6 258 19 >1000 19 SVG07L >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 SVG13L 19 54 7.8 12 391 19 >1000 9.3 SVG18L >1000 >1000 683 >1000 >1000 >1000 45 >1000 SVG19L >1000 >1000 58 223 >1000 127 65 126 SVG23L >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 SVG24L >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 .sup.a>1000 indicates that at highest SDA concentration analysed absorbance is below required value. .sup.bTo compensate for high background the abs value of the individual SDAs was subtracted with a value of 0.2 (Horse IgG and chicken GG) or 0.1 (sheep GG). The absorbance value where effective concentrations are calculated are increased with these subtracted values for these three ELISAs.
(182) TABLE-US-00008 TABLE 8 Binding of monovalent yeast-produced SDAs to IgG of eight species. SDA bovine cat dog horse human mouse sheep swine Maximal A450 on IgG from different species SVG13L 0.71 1.32 1.34 1.05 1.16 1.13 0.66 0.74 VI-4L 0.14 0.10 0.11 0.30 0.17 0.11 0.25 1.62 VI-8L 0.11 0.11 0.10 0.29 0.14 0.11 0.23 1.75 VI-11L 0.14 0.11 0.09 0.57 0.13 0.10 0.31 1.86 VI-14L 0.15 0.12 0.11 0.31 0.18 0.13 0.21 1.83 None 0.14 0.10 0.08 0.27 0.14 0.10 0.18 0.12 EC.sub.A450=0.3 (ng/ml) on IgG from different species.sup.a SVG13L 49 8 7 5 14 17 145 51 VI-4L >1000 >1000 >1000 >1000 >1000 >1000 >1000 10 VI-8L >1000 >1000 >1000 >1000 >1000 >1000 >1000 5 VI-11L >1000 >1000 >1000 226 >1000 >1000 980 3 VI-14L >1000 >1000 >1000 875 >1000 >1000 >1000 4 None >1000 >1000 >1000 >1000 >1000 >1000 >1000 >1000 .sup.a>1000 indicates absorbance of 0.3 is not reached at highest SDA concentration analysed.
(183) TABLE-US-00009 TABLE 9 mAbs against TeNT. TeNT Neutralization in mouse Western mAb Supplier Cat. No. Bioassay Blotting 6E7.sup.a ThermoFisher HYB 278-17-02 Yes unknown 14F5.sup.a ThermoFisher HYB 278-14-02 Yes unknown 6F55.sup.b US Biological T2962-33 Yes unknown 6F57.sup.b US Biological T2962-35 Yes unknown 11n185.sup.c US Biological T2962-01E unknown Yes (Lc) B417M Antibodies Online ABIN349738 Yes Yes TT10.sup.d NIBSC 10/134 Yes Yes (Hc) .sup.amAbs 6E7 and 14F5 bind independent antigenic sites according to manufacturer .sup.bmAbs 6F55 and 6F57 bind independent antigenic sites according to manufacturer .sup.cmAb 11n185 binds to TeNT light chain according to manufacturer .sup.dReferences: [48, 62].
(184) TABLE-US-00010 TABLE 10 Antigen binding of different SVT clones and mAbs. Antigen: TeNT TeNT TeNT.sup.a rTTC None TeNT TeNT TeNT TeNT TeNT.sup.a TeNT TeNT cAbTT2 GT1b cAb-TT2 cAbTT GT1b cAb-TT2 SDA/mAb biotinilation: No No No No No Yes Yes No No No Yes Yes CDR3 Max. absorbance value EC (ng/ml) resulting in indicated A450 SDA or mAb Group (Min.forGT1b-TeNT inhibition).sup.b 0.2 0.15 0.59 0.4 0.2 SVT16L A 1.575 0.363 0.129 1.011 0.05 1.423 0.971 1.1 3.2 47 0.52 1.6 SVT20L A 1.536 0.327 0.117 0.967 0.05 1.204 0.535 1.2 3.1 39 2.1 4.5 SVT20L-L123Q A 0.857 0.098 0.096 0.265 0.06 1.328 0.698 4 >1000 38 1.4 2.8 SVT25L A 1.559 0.362 0.106 0.936 0.05 0.985 0.302 3.6 6.4 133 43 84 SVT34L A 1.537 0.335 0.103 0.886 0.06 1.293 0.669 1 3.2 46 1.7 3.5 SVT34L-L123Q A 1.011 0.178 0.137 0.559 0.05 1.209 0.518 2 5.9 34 2 3.2 SVT06L B 1.392 0.409 0.481 0.543 0.06 1.507 1.204 1.7 2.6 317 0.39 0.37 SVT08L B 1.367 0.360 0.486 0.502 0.05 1.574 1.200 2.2 3.6 411 0.4 0.52 SVT31L B 1.318 0.270 0.568 0.483 0.05 1.430 1.033 2.4 4.3 986 0.98 1.5 SVT15L C 1.337 0.477 0.140 0.528 0.05 1.401 0.825 2.8 5.7 72 2.8 5.7 SVT15L3FW4M C 0.817 0.195 0.127 0.206 0.05 1.372 0.697 3.8 9.8 39 2 3.5 SVT29L C 1.516 0.429 0.135 0.580 0.05 1.128 0.596 2.6 6.3 114 6.9 14 SVT13L D 1.544 0.487 0.126 1.105 0.05 1.484 1.056 1.9 4.1 82 0.57 1.3 SVT22L D 1.593 0.318 0.107 0.981 0.06 1.337 0.799 2 5.4 105 1.3 2.6 SVT02L E 0.077 0.196 0.576 0.057 0.05 0.191 0.530 >1000 36 >1000 >1000 11 SVT03L F 0.104 0.304 0.903 0.053 0.05 0.233 0.493 >1000 1.9 >1000 >1000 2.8 SVT05L G 1.292 0.375 0.655 0.604 0.05 1.260 0.622 0.51 0.86 >1000 0.98 1.7 SVA12L 0.071 0.056 0.711 0.057 0.05 0.155 0.072 >1000 >1000 >1000 >1000 >1000 mAb B417M 1.646 1.393 0.833 0.052 0.05 0.630 0.299 3.3 <0.49 >1000 124 27 mAb 6E7 1.832 1.375 0.420 1.794 0.06 1.656 1.566 1.2 1 1410 1.4 1.2 mAb 14F5 0.318 1.240 0.979 0.051 0.05 0.461 1.259 81 3.2 >1000 406 8.1 mAb 6F57 1.765 1.354 0.568 1.764 0.04 1.259 0.965 3.4 4.1 1590 24 18 mAb 6F55 0.217 0.956 0.974 0.048 0.05 0.226 0.630 504 18 >1000 >100 134 mAb 11n185 1.841 0.061 0.945 0.048 0.04 0.294 0.100 2.3 >1000 >1000 >100 >1000 .sup.aIn the GT1b-TeNT inhibition ELISA the maximal absorbance value in the absence of SDA is 0.999. .sup.bFor the GT1b-TeNT inhibition ELISA absorbance values below 0.7 are considered positive. For all further ELISAs absorbance values above 0.2 are considered indicative of antigen binding.
(185) TABLE-US-00011 TABLE 11 Binding to rTTC of two SVT clones that do not bind directly coated TeNT and three control SDAs. Absorbance at 450 nm Coating: TeNT 6E7 6E7 6E7 Capture step: SDA none rTTC none TeNT SVA12L 0.048 0.059 0.059 0.059 SVT02L 0.062 0.062 0.067 1.189 SVT03L 0.331 0.061 0.070 1.325 SVT15L-3FW4M 0.477 0.528 0.063 0.236 SVT16L 1.269 1.377 0.063 1.131
(186) TABLE-US-00012 TABLE 12 Epitope binning (competition/blocking) ELISAs of SVT SDAs and anti-TeNT mAbs. % inhibition of binding of biotinylated SDA or mAb.sup.a mAb mAb SVT15L- mAb SDA or mAb.sup.b SVT02L 14F5 6F55 SVT03L SVT15L 3FW4M SVT06L SVT08L 6E7 SVT02L 96 97 94 9 6 12 2 16 8 mAb 14F5 81 78 54 28 6 16 12 22 ?16 mAb 6F55 72 85 78 10 4 41 16 30 29 SVT03L 10 ?8 35 97 12 10 10 10 ?12 SVT15L 6 7 ?2 ?5 96 96 1 15 6 SVT15L-3FW4M 10 2 ?4 ?8 96 95 7 6 6 SVT06L 11 11 4 ?3 14 12 96 97 67 SVT08L 7 3 1 0 6 12 95 96 66 mAb 6E7 12 8 1 4 4 7 18 35 75 mAb 6F57 4 3 ?1 ?3 ?1 10 45 49 88 SVT13L 7 5 1 1 ?19 8 1 13 2 SVT22L 4 0 ?2 5 2 11 6 1 8 SVT16L 13 6 ?3 ?1 12 17 ?8 2 6 SVT34L 2 4 ?3 0 3 14 ?2 ?4 10 mAb B417M ?220 ?23 ?44 7 66 33 11 ?56 66 mAb 11n185 ?43 ?24 ?17 19 18 3 5 ?4 19 % inhibition of binding of biotinylated SDA or mAb.sup.a mAb mAb mAb Anti-genic SDA or mAb.sup.b 6F57 SVT13L SVT16L SVT22L SVT34L B417M 11n185 site SVT02L 19 21 26 3 ?16 ?11 19 A mAb 14F5 9 42 0 ?28 20 35 14 A mAb 6F55 ?24 39 17 10 12 33 27 A SVT03L 17 23 18 10 ?4 0 ?26 B SVT15L 4 2 5 2 10 5 0 C SVT15L-3FW4M 6 ?5 3 4 3 ?9 ?1 C SVT06L 53 7 ?3 3 11 4 5 D SVT08L 50 5 8 6 8 0 4 D mAb 6E7 64 ?3 ?2 1 7 0 6 D mAb 6F57 85 ?4 0 7 11 1 ?3 D SVT13L 0 95 91 92 91 4 2 E SVT22L 10 95 92 94 93 ?2 3 E SVT16L 2 96 95 96 95 ?1 ?2 E SVT34L 13 93 93 94 95 ?2 2 E mAb B417M 65 6 ?56 66 ?43 79 ?146 mAb 11n185 16 1 ?14 38 ?11 15 84 .sup.aValues above or equal to 50 are indicated in grey background colour. .sup.bBiotinylated SDA or mAb is in rows and unlabelled SDA or mAb in columns.
(187) TABLE-US-00013 TABLE 13 Overview of SVT clones most suitable for multimeric SPA construction and reference mAbs. Binding Yeast strain TeNT-GT1b Neutralizing Binding in Anti- directly W303-1a SDA Biotinylated SDA or CDR3 Inhibition rTTC TeNT in Mouse Western genic coated production level mAb Group (IC.sub.50 in ng/ml).sup.a Binding.sup.b bioassay.sup.c blot.sup.d site TeNT.sup.e (mg/L).sup.f SVT02L E >1,000 No unknown A No 1.74 mAb 14F5 >10,000 No Yes ND A Reduced mAb 6F55 >10,000 No Yes ND A Reduced SVT03L F >1,000 No unknown B Reduced 0.44 SVT15L C 72 Yes unknown C Good 0.40 SVT15L-3FW4M C 39 Yes unknown C Good 1.87 SVT06L.sup.g B 317 Yes unknown Hc D Good 4.42 SVT08L.sup.g B 411 Yes unknown Hc D Good 2.05 mAb 6E7 1,410 Yes Yes ND D Good mAb 6F57 1,590 Yes Yes ND D Good SVT13L D 82 Yes unknown E Good 2.55 SVT22L D 105 Yes unknown E Good 0.62 SVT16L A 47 Yes unknown E Good 2.09 SVT34L A 46 Yes unknown E Good 0.44 mAb B417M >10,000 No Yes ND Good mAb 11n185 >10,000 No unknown Lc.sup.c Good .sup.aFrom Table 10. .sup.bFrom Table 10. Absorbance value above 0.2 is considered positive binding (Yes). .sup.cAccording to manufacturer. .sup.dHc, heavy-chain; Lc, light-chain; dashes indicate no binding is detectable in Western blot; ND, not determined. .sup.eReduced indicates maximal A450 value is higher on cAb-TT2-captured TeNT than on directly coated TeNT (Table 10). .sup.fFrom Table 5, 500-ml cultures of wild-type SDAs. .sup.gUnusual VEDG sequence insertion after IMGT position 50.
(188) TABLE-US-00014 TABLE 14 Multimeric SPA production in yeast using MIRY type transformants. Elutes in SDA SP-seph. production Fractions Level.sup.b Plasmid Multimeric SDA IEP.sup.a (M NaCl) (mg/L) pRL482 SVT02-GS2-SVG06M4-H6 9.1 0.4-0.6 11 pRL484 SVT15-3FW4M-GS2-SVG6M4-H6 6.9 0.4-0.6 2.6 pRL489 SVT06-GS2-SVA12M2-H6 5.8 0.4-0.6 11 pRL490 SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 6.4 0.4-0.6 10 pRL493 SVT02-GS2-SVA12M2-H6 9.1 0.4-0.6 0.97 pRL494 SVT15-3FW4M-GS2-SVA12M2-H6 6.8 0.4-0.6 34 pRL495 SVT16-L123Q-GS2-SVA12M2-H6 8.6 0.4-0.6 99 pRL496 SVT02-GS2-SVG13M4-H6 8.8 0.4-0.6 17 pRL497 SVT06-GS2-SVG13M4-H6 5.5 0.6-0.8 0.93 pRL498 SVT15-3FW4M-GS2-SVG13M4-H6 6.3 0.6-0.8 41 pRL499 SVT16-L123Q-GS2-SVG13M4-H6 7.8 0.4-0.6 97 pRL501 SVT06-SVT16-L123Q-GS2-SVG13M4-H6 6.0 0.4-0.6 0.2 .sup.aPredicted from mature multimeric SDA sequence using web.expasy.org/cgi-bin/compute_pi/pi_tool. .sup.bThe production level in yeast strain SU50 was calculated from the yield of purified SDA from 0.5 L cultures.
(189) TABLE-US-00015 TABLE 15 Functional analysis of multimeric yeast-produced SDAs by ELISA: absorbance values. Antigen IgG/Alb.sup.a TeNT TeNT IgG/Alb.sup.a TeNT TeNT TeNT Captured with cAb-TT2 GT1b Detection Ab or biotinylated antigen TeNT TeNT Alb L9237.sup.c PO-Conjugate StrepPO StrepPO StrepPO hisPO hisPO GALPO GALPO Plasmid SDA Maximal absorbance value (Minimal for GT1b-TeNT inhibition) PSVA12L SVA12L 0.26 0.24 0.22 1.47 0.13 0.14 0.89 pRL489 SVT06-GS2-SVA12M2-H6 1.56 0.66 1.47 1.67 1.59 1.21 0.18 pRL490 SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 1.55 1.62 1.45 1.51 1.72 1.41 0.13 pRL493 SVT02-GS2-SVA12M2-H6 1.29 0.18 1.10 1.91 0.10 0.09 0.66 pRL494 SVT15-3FW4M-GS2-SVA12M2-H6 1.34 0.64 1.34 1.55 1.35 1.36 0.15 pRL495 SVT16-L123Q-GS2-SVA12M2-H6 1.28 0.78 1.37 1.78 1.67 1.39 0.15 pRL482 SVT02-GS2-SVG06M4-H6 1.00 0.14 .sup.ND.sup.b 0.06 0.06 0.10 0.82 pRL484 SVT15-3FW4M-GS2-SVG06M4-H6 1.30 0.29 ND 0.07 0.37 1.23 0.12 pRL496 SVT02-GS2-SVG13M4-H6 1.32 0.19 ND 0.18 0.06 0.09 0.77 pRL497 SVT06-GS2-SVG13M4-H6 1.61 0.98 ND 1.18 1.44 1.20 0.22 pRL498 SVT15-3FW4M-GS2-SVG13M4-H6 1.47 0.78 ND 1.00 1.51 1.16 0.13 pRL499 SVT16-L123Q-GS2-SVG13M4-H6 1.50 1.12 ND 0.69 1.45 1.22 0.13 pRL501 SVT06-SVT16-L123Q-GS2-SVG13M4-H6 1.69 1.73 ND 0.78 1.62 1.37 0.13 pSVG06L SVG06L 0.11 0.14 ND 0.56 0.05 0.07 0.80 pSVG13L SVG13L 0.11 0.17 ND 0.16 0.08 0.09 0.72 pSVT02L SVT02L 0.10 0.16 ND 0.06 0.06 0.08 0.77 pSVT06L SVT06L 0.12 0.35 ND 0.05 1.44 0.32 0.27 pSVT15L-3FW4M SVT15L-3FW4M 0.14 0.20 ND 0.05 0.19 0.35 0.19 pSVT16L SVT16L 0.19 0.18 ND 0.06 1.56 0.44 0.18 No SDA 0.09 0.15 ND 0.06 0.06 0.08 0.88 .sup.aSVA12 containing SDAs wells were coated with dog Alb, for all other SDAs wells were coated with dog IgG, biotinylated Equine Alb was used .sup.bND, not determined .sup.cLlama serum of animal L9237 (49 dpi), diluted 1:1000 (see example 1)
(190) TABLE-US-00016 TABLE 16 Functional analysis of multimeric yeast-produced SDAs by ELISA: Effective Concentration of SDA. Antigen IgG/Alb.sup.a TeNT TeNT IgG/Alb.sup.a TeNT TeNT TeNT Captured with cAb-TT2 GT1b Detection antibody or biotinylated antigen TeNT TeNT Alb.sup.b L9237.sup.d PO-Conjugate StrepPO StrepPO StrepPO hisPO hisPO GALPO GALPO A450 for EC value 0.3 0.3 0.7 0.2 0.15 0.15 0.56 Plasmid SDA Effective SDA Concentration (ng/ml) PSVA12L SVA12L >1000.sup.c >1000 >1000 50 >1000 >1000 >1000 pRL489 SVT06-GS2-SVA12M2-H6 0.8 19 1.5 39 3.5 1.1 55 pRL490 SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 1.5 5.4 1.8 71 3.8 1.1 49 pRL493 SVT02-GS2-SVA12M2-H6 14 >1000 11 13 >1000 >1000 >1000 pRL494 SVT15-3FW4M-GS2-SVA12M2-H6 11 33 3.9 76 8 2 78 pRL495 SVT16-L123Q-GS2-SVA12M2-H6 4.3 15 2.5 34 2.9 1 45 pRL482 SVT02-GS2-SVG06M4-H6 26.5 >1000 ND.sup.e >1000 >1000 >1000 >1000 pRL484 SVT15-3FW4M-GS2-SVG06M4-H6 8.3 >1000 ND >1000 37 4.3 131 pRL496 SVT02-GS2-SVG13M4-H6 9.1 >1000 ND >1000 >1000 >1000 >1000 pRL497 SVT06-GS2-SVG13M4-H6 <0.49 9.6 ND 46 3.4 2 93 pRL498 SVT15-3FW4M-GS2-SVG13M4-H6 2.2 23 ND 63 4.9 2 77 pRL499 SVT16-L123Q-GS2-SVG13M4-H6 2.6 13 ND 127 8 3 73 pRL501 SVT06-SVT16-L123Q-GS2-SVG13M4-H6 1.2 5.3 ND 134 11 4 35 pSVG06L SVG06L >1000 >1000 ND 164 >1000 >1000 >1000 pSVG13L SVG13L >1000 >1000 ND >1000 >1000 >1000 >1000 pSVT02L SVT02L >1000 >1000 ND >1000 >1000 >1000 >1000 pSVT06L SVT06L >1000 64 ND >1000 4.9 14 33 pSVT15L-3FW4M SVT15L-3FW4M >1000 >1000 ND >1000 26 6 31 pSVT16L SVT16L >1000 >1000 ND >1000 1.4 5 21 No SDA >1000 >1000 ND >1000 >1000 >1000 >1000 .sup.aSVA12 containing SDAs wells were coated with dog Alb, whereas for all further SDAs wells were coated with dog IgG .sup.bbiotinylated horse Alb was used .sup.c>1000, at the highest SDA concentration used the absorbance for calculating the EC value is not reached .sup.dLlama serum of animal L9237 (49 dpi) diluted 1:1000 (see example 1) .sup.eND, not determined
(191) TABLE-US-00017 TABLE 17a Functional analysis of multimeric SDAs by biolayer interferometry to TeNT and horse Albumin (TeNT loaded) Bivalent 1.sup.st test 2.sup.nd TeN-TeNT or Ligand Signal.sup.d sample 2.sup.nd test bispecificTeNT- Loaded 1.sup.st sample analyte (SDA) (nm) analyte Signal(nm) Ah binding bio-T.sup.b SVA12L 0.01 TeNT 0.02 no bio-T SVG13L 0.02 TeNT 0.03 no bio-T SVT16L 0.11 TeNT 0.01 no bio-T SVT16-GS2-SVA12M2-H6 0.19 TeNT 0.02 no bio-T SVT16-L123Q-GS2-SVG13M4-H6 0.18 TeNT 0.03 no bio-T SVT06-GS3-SVT16-L123Q-GS2- 0.32 TeNT 0.15 yes SVA12M2-H6 bio-T M8ggsVI4q6e 0.02 TeNT 0.03 no bio-T PBST.sup.a 0.01 TeNT 0.03 no bio-T SVA12L 0.02 Ah 0.01 no bio-T SVG13L 0.02 Ah 0.01 no bio-T SVT16L 0.11 Ah 0.01 no bio-T SVT16-GS2-SVA12M2-H6 0.19 Ah 0.17 yes bio-T SVT16-L123Q-GS2-SVG13M4-H6 0.18 Ah 0.00 no bio-T SVT06-GS3-SVT16-L123Q-GS2- 0.33 Ah 0.26 yes SVA12M2-H6 bio-T M8ggsVI4q6e.sup.c 0.02 Ah 0.01 no bio-T PBST 0.01 Ah 0.01 no .sup.aBuffer, negative control. .sup.bAverage signal after loading TeNT was 2.05 nm .sup.cSDA negative control, bispecific SDA [44] .sup.dA shift (nm) in the interference wavelength pattern caused by binding of the analyte
(192) TABLE-US-00018 TABLE 17b Functional analysis of multimeric SDAs by Biolayer interferometry to TeNT (Equine Albumin loaded) 1.sup.st test 2.sup.nd Bispecific Ligand Signal.sup.d sample 2.sup.nd test binding Loaded 1.sup.st sample analyte (SDA) (nm) analyte Signal (nm) Ah-TeNT bio-Ah.sup.b SVA12L 0.08 TeNT 0.01 no bio-Ah SVG13L 0.01 TeNT 0.02 no bio-Ah SVT16L 0.02 TeNT 0.01 no bio-Ah SVT16-GS2-SVA12M2-H6 0.17 TeNT 0.47 yes bio-Ah SVT16-L123Q-GS2-SVG13M4-H6 0.02 TeNT 0.02 no bio-Ah SVT06-GS3-SVT16-L123Q-GS2- 0.21 TeNT 0.53 yes SVA12M2-H6 bio-Ah M8ggsVI4q6e.sup.c 0.01 TeNT 0.02 no bio-Ah PBST 0.00 TeNT 0.02 no .sup.a Buffer, background control. .sup.bAverage signal after loading horse albumin was 0.78 nm .sup.cSDA negative control, bispecific SDA [44] .sup.dA shift (nm) in the interference wavelength pattern caused by binding of the analyte
(193) TABLE-US-00019 TABLE 18 Terminal serum half-life of multimeric SDAs in swine Curve SDA Fitting Dosing Region T??.sup.c Plasmid SDA (mg/kg) (hours) (hours) pRL489 SVT06-GS2-SVA12M2-H6 0.2 96-504 135 ? 19 pRL490 SVT06-GS3-SVT16- 0.3 96-504 122 ? 13 L123Q-GS2-SVA12M2-H6 pRL495 SVT16-L123Q-GS2- 0.5 96-504 111 ? 13 SVA12M2-H6 pRL499 SVT16-L123Q-GS2- 0.5 24-96 .sup.21.sup.b ? 3.8 SVG13M4-H6 pRL276 M8ggsVI-4q6e.sup.a 0.5 96-504 .sup.82 ? 4.5 .sup.asee reference [19] .sup.bEstimate based on assuming that levels have decreased to detection level in 96 h sample. .sup.cMean and standard deviation (including bodyweight increase).
(194) TABLE-US-00020 TABLE 19 SDAs inoculated, concentration of stock solution, and proportion of mice protected (as a %) at end of test (study 1). Proportion (%) of mice (n = 4) protected at end of test SDA/Reference 1.sup.a 2 4 8 16 32 64 SVT02-GS2-SVG13M4-H6 0 0 0 0 0 0 0 SVT03L 0 0 0 0 0 0 .sup.ND.sup.c SVT06-GS2-SVG13M4-H6 100 75 0 0 0 0 0 SVT15-3FW4M-GS2-SVG13M4-H6 100 100 0 0 25 0 0 SVT16-L123Q-GS2-SVG13M4-H6 0 0 0 0 0 0 0 SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 100 100 100 100 100 100 ND Reference antitoxin (TE3.sup.b) 100 100 0 0 0 0 ND .sup.aDilution factor, starting concentration at dilution 1 of all SDAs is 1000 nM, except for the SDA3 it is 100 nM. .sup.bHuman Tetanus Immunoglobulin; it has a fixed amount tetanus toxin neutralising capacity (International Units), here a 10 IU/ml stock solution was used that was prediluted 1/400 to 0.025 IU/ml. .sup.cND = not determined
(195) TABLE-US-00021 TABLE 20 Summary of end points for SDAs and potency in IU/mg Endpoint SDA concentration dilution providing full Potency.sup.c SDA factor protection (nM) IU/mg SVT02-GS2-SVG13M4-H6 <1 .sup.>1000.sup.d SVT03L <1 >1000 SVT06-GS2-SVG13M4-H6 2.4.sup.a .sup.1000.sup.e 1.04 SVT15-3FW4M-GS2- 2.8.sup.b 500 1.21 SVG13M4-H6 SVT16-L123Q-GS2- <1 >1000 SVG13M4-H6 SVT06-GS3-SVT16- >32 3.1 >93.1 L123Q-GS2-SVA12M2-H6 .sup.aSpearman-Kaerber method used for calculation (100% at dilution 1.75% at dilution 2 and 0% at dilution 3) .sup.bgeomean of 2 (dilution number 2) and 4 (dilution number 3) .sup.cTetanus antitoxin potency (International Units/mg) of master stock solution .sup.dNo protection at 1000 nM level .sup.eFull protection at the concentration tested
(196) TABLE-US-00022 TABLE 21 Scheme of the SDAs evaluated in different mixtures (or single) in the TNT (study 2) Group SDA 1 2 3 4 5 6 7.sup.b SVT02-GS2-SVG13M4-H6 31.25 31.25 SVT03L 31.25 31.25 SVT06-GS2-SVG13M4-H6 62.5.sup.a 31.25 62.5 31.25 SVT15-3FW4M-GS2- 62.5 31.25 62.5 62.5 SVG13M4-H6 SVT16-L123Q-GS2-SVG13M4- 62.5 31.25 62.5 H6 SVT06-GS3-SVT16-L123Q- 6.25 6.25 GS2-SVA12M2-H6 Total nM per group 125 125 125 125 125 68.75 6.25 .sup.aAmount (nM) of each SDA in the mixture at starting point .sup.bOnly group containing a single SPA
(197) TABLE-US-00023 TABLE 22a Proportion of mice protected (as a %) at end of test of mixture evaluation (study 2). Total Group nM.sup.a 1.sup.b 2 4 8 16 32 1 125 .sup.100.sup.c 100 100 100 100 100 2 125 100 100 100 100 100 100 3 125 100 100 100 100 100 100 4 125 100 100 100 100 100 100 5 125 0 0 0 0 0 0 6 68.75 100 100 100 100 100 100 7 6.25 100 100 100 100 100 100 Reference TE3.sup.d 100 100 0 0 0 0 .sup.aAt dilution 1 .sup.bDilution tested, two-fold dilution steps follow .sup.cTotal amount of mice per dilution is 4 .sup.dPrediluted to 0.025 IU/ml
(198) TABLE-US-00024 TABLE 22b Summary of end points for mixed SDAs SDA(s) Total amount of concentration Protection SDA in 1.sup.st providing full at this Group dilution (nM) protection (nM) concentration 1 125 ?3.91 Yes 2 125 ?3.91 Yes 3 125 ?3.91 Yes 4 125 ?3.91 Yes 5 125 >125 No 6 68.75 ?2.15 Yes
(199) TABLE-US-00025 TABLE 23 Summary of end points and potency in IU/ml for single samples End point Total Dilution Dilution End point dilution Potency.sup.a Group SDA factor No. Dil. Factor factor IU/mg 7 SVT06-GS3-SVT16-L123Q-GS2- 23,240 >6 >32 743,680 >1478 SVA12M2-H6 .sup.aTetanus antitoxin potency (International Units/mg)
(200) TABLE-US-00026 TABLE 24 Proportion of mice (n = 4) protected (as a %) at end of test (study 3). Total Group nM.sup.a 1.sup.b 4 16 64 256 1024 SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 1 0.2 .sup.50.sup.c 0 0 0 0 0 SVT06-GS2-SVG13M4-H6 + 2 0.4 0 0 0 0 0 0 SVT16-L123Q-GS2-SVG13M4-H6 SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 + 3 0.4 100 0 0 0 0 0 SVT15-3FW4M-GS2-SVG13M4-H6 Reference TE-3 prediluted to 0.025 IU/ml 100 75 0 0 0 0 .sup.aAt dilution 1 .sup.bFirst dilution with starting concentration as shown, four-fold dilution steps follow .sup.cTotal amount of mice per dilution is 4
(201) TABLE-US-00027 TABLE 25 Summary of end points and potency in IU/ml for single samples End point Total Dilution Dilution End point dilution Potency.sup.a Group SDA factor No. Dil. Factor factor IU/mg 1 SVT06-GS3-SVT16-L123Q-GS2- 726,222 1 1 726,222 1509.7 SVA12M2-H6 .sup.aTetanus antitoxin potency (International Units/mg) calculated on 4-fold dilution step study 3 results of TE-3 reference.
(202) TABLE-US-00028 TABLE 26 Summary of end points for mixed SDAs Lowest concentration Protection Total SDA (nM) in (nM) at this Group 1.sup.st dilution providing full protection concentration 2 0.4 >0.4 No 3 0.4 0.4-0.1 Yes
(203) TABLE-US-00029 TABLE 27 TeNT binding affinity/avidity determination of several purified mono- and multimeric SDAs R- SDA K.sub.D (M) k.sub.a (1/Ms) k.sub.dis (1/s) square SVT02-GS2-SVG13M4-H6 9.87E?11 1.23E+06 1.21E?04 0.992 SVT03L <1.0E?12.sup.a 5.65E+06 <1.0E?07 0.914 SVT06-GS2-SVG13M4-H6 1.23E?10 6.7E+05 8.24E?05 0.998 SVT06-GS2-SVA12M2-H6 1.51E?10 5.91E+05 8.90E?05 0.992 SVT15-3FW4M-GS2-SVG13M4-H6 1.58E?11 4.29E+05 6.77E?06 0.998 SVT06L 5.35E?10 1.17E+05 6.27E?05 0.999 SVT15L 4.13E?10 9.36E+04 3.87E?05 0.998 SVT16L 3.39E?10 9.16E+05 3.11E?04 0.996 SVT16-L123Q-GS2-SVA12M2-H6 2.24E?10 8.86E+05 1.99E?04 0.998 SVT16-L123Q-GS2-SVG13M4-H6 2.27E?10 6.65E+05 1.84E?04 0.999 SVT06-GS3-SVT02-GS2-SVG06M4-H6.sup.b 1.30E?10 3.29E+05 4.27E?05 0.998 SVT06-GS3-SVT15-3FW4M-GS2- <1.0E?12.sup.a 6.91E+04 <1.0E?07 0.997 SVG06M4-H6.sup.b SVT06-GS3-SVT16-L123Q-GS2- 1.33E?11 9.89E+05 1.32E?05 0.998 SVA12M2-H6.sup.b .sup.aK.sub.D was not calculated because the SDA did not dissociate from the tetanus toxin within the time course studied. In case for the k.sub.dis value the value 1.0E?07 is chosen for both SDAs the K.sub.D value for SVT03L is estimated at 1.77E?14 and for SVT06-GS3-SVT15-3FW4M-GS2-SVG06M4-H6 would be 1.45E?12. .sup.bBivalent for TeNT therefore avidity measurement
(204) TABLE-US-00030 TABLE 28 Affinity data for purified SDAs against Alb (Equine, Porcine, Canine and Feline) Albumin SDA species K.sub.D (M) k.sub.a (1/Ms) k.sub.dis (1/s) R square SVA12L Swine 1.59E?07 1.50E+05 2.38E?02 0.990 SVA06L Swine SVA16L Swine SVA12L Horse 1.07E?08 1.01E+05 1.09E?03 0.999 SVA06L Horse 1.35E?08 7.26E+05 9.77E?03 0.971 SVA16L Horse 1.06E?08 2.29E+05 2.42E?03 0.999 SVA12L Dog 2.71E?07 4.59E+04 1.25E?02 0.990 SVA06L Dog 3.16E?09 7.11E+05 2.24E?03 0.998 SVA16L Dog 1.11E?08 4.35E+05 4.83E?03 0.997 SVA12L Cat 1.90E?08 3.88E+04 7.37E?04 0.999 SVA06L Cat 1.20E?09 7.29E+05 8.78E?04 0.996 SVA16L Cat 1.95E?09 1.47E+05 2.87E?04 0.976
(205) TABLE-US-00031 TABLE 29 TeNT binding affinity/avidity determination of several purified mono- and multimeric SDAs. Ligand Analyte loading (TeNT) concentration Concentration R- SDA (Ligand) (?g/ml) (nM) K.sub.D (M) k.sub.a (1/Ms) k.sub.dis (1/s) square SVT06L 0.6 0.94-15 2.24E?10 5.03E+05 1.13E?04 1 SVT15L 0.3 2.5-20 7.72E?10 1.11E+05 8.57E?05 0.998 SVT06-GS3-SVT16-L123Q-GS2- 0.3 2.5-20 1.10E?11 3.98E+05 4.39E?06 0.999 SVA12M2-H6.sup.a cAb-TT1 0.6 .sup.25-400 4.31E?08 4.91E+04 2.12E?03 0.951 cAb-TT2 0.3 0.75-12 6.01E?09 8.41E+05 5.05E?03 0.998 .sup.aBivalent for TeNT therefore avidity measurement
(206) TABLE-US-00032 TABLE 30 TeNT binding affinity/avidity determination of 3 multimeric SDAs Ligand (TeNT) Analyte loading (SDA) concentration Concentration R- SDA (Analyte) (?g/ml) (nM) K.sub.D (M) k.sub.a (1/Ms) k.sub.dis (1/s) square SVT06-GS3-SVT16-L123Q- 4 0.63-10 <1.0E?12 5.38E+05 <3.18E?07 0.999 GS2-SVA12M2-H6.sup.b SVT06-GS3-SVT15- 4 0.63-10 <1.0E?12.sup.a 9.40E+05 <3.2E?07 0.999 3FW4M-GS2-SVA12M2-H6.sup.b SVT15-3FW4M-GS3- 4 0.63-10 <1.0E?12.sup.a 4.84E+05 <1.99E?07 0.999 SVT06-GS2-SVG13M5-H6.sup.b .sup.aK.sub.D was not calculated because the SDA did not dissociate from the tetanus toxin within the time course studied.. If for SVT06-GS3-SVT16- L123Q-GS2-SVA12M2-H6, SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 and SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5 for the k.sub.dis value the value 3.18E?07, 3.2E?07 and 1.99E?07 is chosen, respectively, the K.sub.D values would be 5.91E?13, 3.4E?13 and 4.1E?13 respectively. .sup.bBivalent for TeNT therefore avidity measurement
(207) TABLE-US-00033 TABLE 31a The binding affinity of multimeric SDAs to Equine or Human serum albumin Ligand (Alb) loading Analyte SDA) Albumin concentration Concentration R- SDA (Analyte) Species (?g/ml) (nM) K.sub.D (M) k.sub.a (1/Ms) k.sub.dis (1/s) square SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 Equine 2.5 0.63-10 6.46E?10 2.16E+05 1.39E?04 1 SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 Equine 2.5 0.63-10 1.34E?09 1.1E+05 1.51E?04 1 SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6.sup.a Equine 2.5 100 No Signal SVA12L Human 5 100 No Signal SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 Human 5 100 No Signal SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 Human 5 100 No Signal SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6.sup.a Human 5 100 No Signal .sup.aSVG13M5 binds to for example Equine, or Human IgG Fab fragment
(208) TABLE-US-00034 TABLE 31b The binding affinity of multimeric SDAs to serum Canine serum albumin Ligand (SDA) Analyte loading (Alb) Albumin concentration Concentration R- SDA (Ligand) Species (?g/ml) (nM) K.sub.D (M) k.sub.a (1/Ms) k.sub.dis (1/s) square SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6 Canine 1.25 16-500 2.68E?07 2.3E+04 6.20E?03 0.998 SVT06-GS3-SVT15-3FW4M-GS2-SVA12M2-H6 Canine 1.25 16-500 3.75E?07 1.6E+04 6.16E?03 0.998 SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6.sup.a Canine 1.25 16-500 No Signal .sup.aSVG13M5 binds to for example Canine IgG Fab fragment
(209) TABLE-US-00035 TABLE 32 TeNT binding affinity/avidity of multimeric SDAs when evaluated with the Creoptix? WAVE system Ligand Analyte (TeNT) Analyte (SDA) captured flow Concentration R-max SDA (analyte) (pg/mm.sup.2) (?l/min) (nM) K.sub.D (M) k.sub.a (1/Ms) k.sub.dis (1/s) (pg/mm.sup.2) SVT03L 252.7 54 1.2-100 1.4E?12 4.62E+06 6.64E?06 14.5 SVT15-3FW4M-GS2-SVG13M4-H6 216.6 60 1.2-100 20.9E?12 3.90E05 8.15E?06 30.4 SVT06-SVT16-L123Q-GS2-SVG13M5-H6.sup.a, b 181.1 60 1.2-100 15.9E?12 4.17E+05 6.61E?06 37.5 SVT06-GS3-SVT16-L123Q-GS2-SVA12M2-H6.sup.a 239.6 54 1.2-100 8.86E?12 1.14E+06 1.01E?05 44.7 SVT15-3FW4M-GS3-SVT06-GS2-SVG13M5-H6.sup.a 176.5 60 1.2-100 22.9E?12 1.19E+06 2.73E?05 27.6 .sup.aBivalent for TeNT therefore avidity measurement .sup.bBivalent, with two SVT SDA's fused without linker in between
(210) TABLE-US-00036 TABLE 33 Terminal serum half-life of SVT06-GS3-SVT16-L123Q-GS2- SVA12M2-H6 (pRL490) in Equines (i.m. dose 0.17 mg/kg) Measured concentration (milligram/liter) Time (hrs) Curve 0 24 48 96 168 240 312 408 504 Fitting Animal Time (days) Region T??.sup.a # 0 1 2 4 7 10 13 17 21 (days) (hours) 2 <0.09 1.014 1.164 0.997 0.807 0.806 0.733 0.661 0.605 2-21 510 ? 107 5 <0.10 0.519 0.736 0.664 0.483 0.549 0.488 0.486 0.395 6 <0.09 1.08 1.32 1.21 1.04 1.01 0.795 0.708 0.593 .sup.aMean and standard deviation.
(211) TABLE-US-00037 TABLE 34 Multimeric SPA production in yeast using MIRY type transformants. Elutes in SDA SP-seph. production Fractions Level.sup.b Plasmid Multimeric SDA IEP.sup.a (M NaCl) (mg/L) pRL505 SVT06-GS3-SVT15-3FW4M- 5.94 0.4-0.6 3.2 GS2-SVA12M2-H6 pRL506 SVT15-3FW4M-GS3-SVT06- 5.80 0.4-0.6 4.8 GS2-SVG13M5-H6 .sup.aPredicted from mature multimeric SDA sequence using web.expasy.org/cgi-bin/compute_pi/pi_tool. .sup.bThe production level in yeast strain SU50 was calculated from the yield of purified SDA from 0.5 L cultures.
(212) TABLE-US-00038 TABLE 35 Affinity of several SDAs to Equine and Canine IgG IgG (Fc) SDA species K.sub.D (M) k.sub.a (1/Ms) k.sub.dis (1/s) Full R{circumflex over ()}2 SVG03L.sup.a Horse Fc 4.30E?10 1.14E+06 4.91E?04 0.987 SVG23L.sup.a Horse Fc no affinity SVG24L.sup.a Horse Fc 3.45E?09 1.02E+05 3.53E?04 0.996 SVG03L Dog Fc no affinity SVG23L Dog Fc 2.15E?10 2.43E+06 5.21E?04 0.991 SVG24L DogFc 2.22E?09 1.55E+05 3.44E?04 0.992 .sup.aFc fragment binding SDA
REFERENCES
(213) [1] Hamers-Casterman C et a. Nature. 1993; 363:446-8. [2] Harmsen M M et al. Vet Microbiol. 2007; 120:193-206. [3] Harmsen M M et al. J Immunoassay Immunochem. 2012; 33:234-51. [4] Rossetto 0 et al. Tetanus neurotoxin. Toxicon. 2013; 66:59-63. [5] Herreros J et al. Biochem J. 2000; 347 Pt 1:199-204. [6] Fitzsimmons S P et al. Vaccine. 2000; 19:114-21. [7] Yousefi M et al. Human vaccines & immunotherapeutics. 2014; 10:344-51. [8] Scott N et al. Mol Immunol. 2010; 47:1931-41. [9] Sagt C M et al. Appl Environ Microbiol. 2000; 66:4940-4. [10] Liu L. J Pharm Sci. 2015; 104:1866-84. [11] Gorlani A et al. Protein Eng Des Sel. 2012; 25:39-46. [12] Liu J L et al. Microbial cell factories. 2015; 14:158. [13] Goldman E R et al. Protein Expr Purif. 2014; 95:226-32. [14] Van de Laar T et al. Biotechnol Bioeng. 2007; 96:483-94. [15] Batra S K et al. Curr Opin Biotechnol. 2002; 13:603-8. [16] lznaga-Escobar N et al. Methods Find Exp Clin Pharmacol. 2004; 26:123-7. [17] Kontermann RE. Curr Opin Biotechnol. 2011; 22:868-76. [18] Klooster R et al. J Immunol Methods. 2007; 324:1-12. [19] Harmsen M M et al. Vaccine. 2005; 23:4926-34. [20] Coppieters K et al. Arthritis Rheum. 2006; 54:1856-66. [21] Holliger P et al. Nat Biotechnol. 1997; 15:632-6. [22] Holt L J et al. Protein Eng Des Sel. 2008; 21:283-8. [23] Hutt M et al. J Biol Chem. 2012; 287:4462-9. [24] Rossotti M A et al. mAbs. 2015; 7:820-8. [25] Walker A et al. Protein Eng Des Sel. 2010; 23:271-8. [26] Terryn S et al. PLoS ONE. 2014; 9:e109367. [27] Huston J S et al. Proc Natl Acad Sci. 1988; 85:5879-83. [28] Mukherjee J et al. PLoS ONE. 2012; 7:e29941. [29] Sepulveda J et al. Infect Immun. 2010; 78:756-63. [30] Vance D J et al. J Biol Chem. 2013; 288:36538-47. [31] Klein J S et al. Protein Eng Des Sel. 2014; 27:325-30. [32] Trinh R et al. Mol Immunol. 2004; 40:717-22. [33] Beirnaert E. Improved nanobodies.sup.TM against tumor necrosis factor-alpha. 2006. [34] WO2011064382 [35] Conrath K E et al. J Biol Chem. 2001; 276:7346-50. [36] Hopp J et al. Protein Eng Des Sel. 2010; 23:827-34. [37] Jacobs S A et al. Protein Eng Des Sel. 2015; 28:385-93. [38] Fridy P C et al. Nat Methods. 2014; 11:1253-60. [39] Chaudhury C et al. J Exp Med. 2003:197:315-22. [40] Nagel J et al. J Immunol. 1973; 110:1388-95. [41] Mizuguchi J et al. Naturwissenschaften. 1982; 69:597-8. [42] Volk W A et al. Infect Immun. 1984; 45:604-9. [43] Harmsen M M et al. Appl Microbiol Biotechnol. 2009; 84:1087-94. [44] Harmsen M M et al. Vet Microbiol. 2008; 132:56-64. [45] Frenken LGJ et al. J Biotechnol. 2000; 78:11-21. [46] Arbabi-Ghahroudi M et al. FEBS Lett. 1997; 414:521-6. [47] Xing D K et al. Biologicals. 1996; 24:57-65. [48] Coombes L et al. Biologicals. 2012; 40:466-72. [49] McCafferty J, Johnson KS. In: Phage display of peptides and proteins. 1996. p. 79-111. [50] Lou J et al. J Immunol Methods. 2001; 253:233-42. [51] Lefranc MP, Methods Mol Biol. 2004; 248:27-49. [52] Harmsen M M et al. Mol Immunol. 2000; 37:579-90. [53] Butler JE. Methods. 2000; 22:4-23. [54] Arbabi-Ghahroudi M et al. Protein engineering, design & selection: PEDS. 2009; 22:59-66. [55] de Wildt R M et al. J Mol Biol. 1999; 294:701-10. [56] Desmyter A et al. J Biol Chem. 2001; 276:26285-90. [57] Deschacht N et al. J Immunol. 2010; 184:5696-704. [58] Van der Vaart JM in Methods Mol Biol. Totowa, NJ: Humana Press; 2002. p. 359-66. [59] Harmsen M M et al. Appl Microbiol Biotechnol. 1996; 46:365-70. [60] Harmsen M M et al. Appl Microbiol Biotechnol. 2002; 60:449-54. [61] Harmsen M M et al. Appl Microbiol Biotechnol. 2007; 77:13-22. [62] Sheppard A J et al. Infect Immun. 1984; 43:710-4. [63] Emsley P et al. J Biol Chem. 2000; 275:8889-94. [64] Fotinou C et al. J Biol Chem. 2001; 276:32274-81. [65] Chen C, Baldwin M R, Barbieri J T. Biochemistry. 2008; 47:7179-86. [66] Chen C, Fu Z, Kim J J, Barbieri J T, Baldwin MR. J Biol Chem. 2009; 284:26569-77. [67] Wang H, Yu R, Fang T, Yu T, Chi X, Zhang X, et al. Toxins. 2016; 8. [68] Kenimer J G et al. Infect Immun. 1983; 42:942-8. [69] Harmsen M M et al. Vet Microbiol. 2005; 111:89-98. [70] Giuseppin M L et al. Appl Environ Microbiol. 1993; 59:52-9. [71] Becker DM, Guarente L. Methods Enzymol. 1991; 194:182-7. [72] Harmsen M M et al. Vaccine. 2011; 29:2682-90. [73] Van Oers J W, Tilders FJ. Endocrinology. 1991; 128:496-503. [74] Verheesen & Laeremans. Methods Mol Biol 2012; 911: 81-104. [75] Gorlani A et al. Methods Mol Biol. 2012; 911:277-86 [76] Kozma, F. et al. Biosensors and Bioelectronics 2014, 58:287-307.