Recombinant nucleic acid molecule based on point mutation of translation initiation element and use thereof in preparation of circular RNA
12054722 ยท 2024-08-06
Assignee
Inventors
- Qiangbo HOU (Suzhou, CN)
- Zonghao QIU (Suzhou, CN)
- Yang ZHAO (Suzhou, CN)
- Chijian ZUO (Suzhou, CN)
- Zhenhua SUN (Suzhou, CN)
Cpc classification
C12N2770/32022
CHEMISTRY; METALLURGY
C12N15/64
CHEMISTRY; METALLURGY
C12N15/67
CHEMISTRY; METALLURGY
C12N2830/42
CHEMISTRY; METALLURGY
C12N15/1034
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure relates to a recombinant nucleic acid molecule based on point mutation of translation initiation element and use thereof in the preparation of circular RNA, and in particular to a recombinant nucleic acid molecule for preparing circular RNA, a recombinant expression vector, circular RNA, a composition, a method for preparing circular RNA, a method for expressing a target polypeptide in a cell, a method for preventing or treating a disease, a method for editing a translation initiation element sequence, and a system for editing a translation initiation element sequence. The recombinant nucleic acid molecule provided by the present disclosure provides a novel Clean PIE system for the in vitro preparation of circular RNA, which can avoid introducing additional exon sequences into circular RNA, improve sequence accuracy of circular RNA molecules, reduce changes in a secondary structure of circular RNA, and then reduce immunogenicity of circular RNA, and has a good application prospect in the fields of nucleic acid vaccines, expression of therapeutic proteins, gene therapy, etc.
Claims
1. A recombinant nucleic acid molecule for preparing a circular RNA, wherein in the 5 to 3 direction, the recombinant nucleic acid molecule comprises elements arranged in the following order: an intron fragment II, a truncated fragment II of the translational initiation element, a coding element encoding at least one target polypeptide, a truncated fragment I of the translation initiation element, and an intron fragment I, wherein the truncated fragment II of the translational initiation element comprises the nucleotide sequence of SEQ ID NO: 14, and the truncated fragment I of the translation initiation element comprises the nucleotide sequence of SEQ ID NO: 13; wherein the 3 end of the truncated fragment I of the translation initiation element includes ribozyme recognition site I consisting of a first predetermined number of nucleotides located at the 3 end of the truncated fragment I of the translation initiation element; the 5 end of the truncated fragment II of the translational initiation element includes a ribozyme recognition site II consisting of a second predetermined number of nucleotides located at the 5 end of the truncated fragment II of the translational initiation element; the nucleotide sequence of the truncated fragment I of the translation initiation element and the nucleotide sequence of the truncated fragment II of the translational initiation element are used to form a translation initiation element sequence in the 5 to 3 direction; the nucleotide sequence of the truncated fragment I of the translation initiation element corresponds to a partial sequence of the translation initiation element sequence near the 5 direction, and the nucleotide sequence of the truncated fragment II of the translational initiation element corresponds to a remaining partial sequence of translation initiation element sequence near the 3 direction; the nucleotide sequence of the intron fragment I and the nucleotide sequence of the intron fragment II are used to form an intron sequence in the 5 to 3 direction; the nucleotide sequence of intron fragment I includes a partial sequence of the intron sequence near the 5 direction, and the nucleotide sequence of intron fragment II includes the remaining partial sequence of the intron sequence near the 3 direction.
2. The recombinant nucleic acid molecule of claim 1, wherein the intron fragment I and the intron fragment II are derived from Group I intron, the ribozyme recognition site I is derived from a natural exon sequence ligated to the 5 end of the intron fragment I, and the ribozyme recognition site II is derived from a natural exon sequence ligated to the 3 end of the intron fragment II; optionally, the Group I intron is derived from any one of the following Group I introns: T4 phage td gene, Anabaena tRNA.sup.Leu, TpaCOX2, and Ptu.
3. The recombinant nucleic acid molecule of claim 1, wherein the first predetermined number of nucleotides is selected from 3 to 100 nucleotides; or, wherein the second predetermined number of nucleotides is selected from 1 to 100 nucleotides; or, wherein the sum of the first predetermined number and the second predetermined number is not equal to 3y, y?1 and y is an integer.
4. The recombinant nucleic acid molecule of claim 1, wherein the translation initiation element sequence is a sequence having an activity of initiating translation of the coding element; and optionally, the translation initiation element sequence includes one or a combination of two or more of the following sequences: an IRES sequence, a 5UTR sequence, a Kozak sequence, a sequence with m.sup.6A modification, and a complementary sequence of ribosomal 18S rRNA.
5. The recombinant nucleic acid molecule of claim 1, wherein the coding element comprises at least one coding region; and optionally, the coding element comprises at least two coding regions, and each coding region independently encodes any type of target polypeptide; or, the coding element including at least two coding regions, wherein a linker is linked between any two adjacent coding regions; optionally, the linker is a polynucleotide encoding a 2A peptide; or, the coding element comprising at least two coding regions, wherein a translation initiation element is ligated between any two adjacent coding regions; optionally, the translation initiation element located between any two adjacent coding regions includes one or a combination of two or more of the following sequences: an IRES sequence, a 5UTR sequence, a Kozak sequence, a sequence with m.sup.6A modification, and a complementary sequence of ribosomal 18S rRNA.
6. The recombinant nucleic acid molecule of claim 1, wherein the target polypeptide is a human-derived protein or a non-human-derived protein.
7. The recombinant nucleic acid molecule of claim 1, wherein the target polypeptide is selected from one or a combination of two or more of the following: an antigen, an antibody, an antigen-binding fragment, a fluorescent protein, a protein with therapeutic activity against a disease, and a protein with gene editing activity.
8. The recombinant nucleic acid molecule of claim 1, wherein the recombinant nucleic acid molecule further comprises an insertion element between the coding element and the truncated fragment I of the translation initiation element, wherein the insertion element is at least one selected from the group consisting of (i) to (iii): (i) a transcriptional level regulatory element, (ii) a translational level regulatory element, and (iii) a purification element.
9. The recombinant nucleic acid molecule of claim 8, wherein the insertion element includes a sequence of one or a combination of two or more of the following: an untranslated region sequence, a polyA sequence, an aptamer sequence, a riboswitch sequence, and a sequence that binds to a transcriptional regulator.
10. The recombinant nucleic acid molecule of claim 1, wherein the recombinant nucleic acid molecule further comprises a 5 homologous arm and a 3 homologous arm, and the nucleotide sequence of the 5 homologous arm hybridizes to the nucleotide sequence of the 3 homologous arm, wherein the 5 homologous arm is ligated to the 5 end of the intron fragment II, and the 3 homologous arm is ligated to the 3 end of the intron fragment I.
11. The recombinant nucleic acid molecule of claim 1, wherein a nucleotide sequence derived from an exon is not comprised in any one of the intron fragment I, the translation initiation element, or the intron fragment II.
12. The recombinant nucleic acid molecule of claim 1, wherein an exon-derived nucleotide sequence is not included between any two of the intron fragment I, the truncated fragment II of the translational initiation element, the coding element, the truncated fragment I of the translation initiation element and the intron fragment II.
13. A recombinant expression vector comprising the recombinant nucleic acid molecule of claim 1.
14. A method for preparing circular RNA in vitro, comprising the following steps: transcription step: transcribing the recombinant nucleic acid molecule of claim 1 to form a precursor nucleic acid molecule; circularization step: subjecting the precursor nucleic acid molecule to a circularization reaction to obtain circular RNA; and optionally, the method further comprising a step of purifying the circular RNA.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
DETAILED DESCRIPTION
Definitions
(19) When used in conjunction with the terms including, comprising or containing in the claims and/or the specification, the words a or an may refer to one, but may also refer to one or more, at least one, and one or more than one.
(20) As used in the claims and specification, the words comprising, having, including, or containing are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
(21) Throughout this application, the term about means that: a value includes the standard deviation of error for the device or method being employed to determine the value.
(22) Although the disclosure supports the definition of the term or as a mere alternative and and/or, the term or in the claims means and/or unless explicitly indicated to be a mere alternative or mutually exclusive.
(23) The terms polypeptide, peptide and protein are used interchangeably herein and are amino acid polymers of any length. The polymers may be linear or branched, may contain modified amino acids, and may be interrupted by non-amino acids. The term also includes amino acid polymers that have been modified (e.g., disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component).
(24) As used in the present disclosure, the PIE system, also known as permuted introns and exons, is a process of ligating to form circRNA using a self-splicing system of Group I introns.
(25) As used in the present disclosure, Group I intron has a self-splicing system for circularization in the presence of GTP and Mg.sup.2+.
(26) The group I intron is a class of super large ribozymes that can undergo self-splicing reactions, which is commonly found in many species, and is mainly involved in the catalytic cleavage of precursors of mRNA, tRNA and rRNA. Its core secondary structure typically includes nine pairing regions (P1-P9) and corresponding loop regions (L1-L9) (
(27) As used in the present disclosure, an internal guide sequence generally refers to a nucleotide sequence in Group I intron that is paired with a corresponding exon sequence by either a Watson-Crick pairing or a wobble pairing, typically in P1 stem in Group I intron.
(28) As used in the present disclosure, ribozyme is used to describe RNA that has catalytic activity. In some embodiments, a ribozyme recognition site in the present disclosure refers to a polynucleotide sequence capable of being recognized by a ribozyme and having an internal phosphodiester bond breaking, when RNA forms a ribozyme molecule with catalytic function.
(29) As used in the present disclosure, the term circular nucleic acid molecule refers to a nucleic acid molecule in a closed loop form. In some specific embodiments, the circular nucleic acid molecule is a circular RNA molecule. More specifically, the circular nucleic acid molecule is a circular mRNA molecule.
(30) As used in the present disclosure, the term linear RNA refers to a circRNA precursor capable of forming a circRNA through a circularization reaction, which is typically formed by transcription from a linear DNA molecule (e.g., a vector containing a recombinant nucleic acid molecule, etc.).
(31) As used in the present disclosure, the term IRES is also referred to as an internal ribosome entry site. An internal ribosome entry site (IRES) belongs to a translation control sequence, usually located at the 5 end of a gene of interest, and allows translation of RNA in a cap-independent manner. The transcribed IRES can bind directly to a ribosomal subunit such that a mRNA initiation codon is properly oriented in the ribosome for translation. The IRES sequence is usually located in the 5UTR of mRNA (directly upstream of the initiation codon). IRES functionally replaces the need for a variety of protein factors that interact with eukaryotic translation mechanisms.
(32) As used in the present disclosure, the term translation initiation element refers to any sequence element capable of recruiting ribosomes, initiating a translation process of an RNA molecule. Illustratively, the translation initiation element is an IRES element, a sequence with m.sup.6A modification, or an initiation sequence for rolling circle translation, and the like.
(33) The term coding region refers to a gene sequence capable of transcribing messenger RNA and finally translating it into a target polypeptide, or protein.
(34) The term expression includes any step involving the production of a polypeptide, including, but not limited to: transcription, post-transcriptional modification, translation, post-translational modification, and secretion.
(35) The term antibody is used herein in the broadest sense, refers to a protein including an antigen-binding site and encompasses natural and artificial antibodies of various structures including, but not limited to, polyclonal, monoclonal, monospecific, multispecific, nonspecific, humanized, single-chain, chimeric, synthetic, recombinant, hybrid, mutant, and grafted antibodies. The term antibody also includes antibody fragments such as Fab, F (ab).sub.2, FV, scFv, Fd, dAb and other antibody fragments that retain the antigen binding function. Typically, such fragments will include antigen-binding fragments.
(36) As used in the present disclosure, the term hybridization refers to a process by which a base on one nucleic acid strand binds to a complementary base on the other nucleic acid strand through base pairing. Hybridization reactions can be selective, such that a particular sequence of interest can be selected from a sample when it is present at low concentrations. Stringency of hybridization conditions (e.g., high stringency, medium stringency, stringency) can be adjusted by, for example, concentrations of salt or formamide in a prehybridization solution and a hybridization solution, or hybridization temperature. For example, the stringency can be increased by decreasing the salt concentration, increasing the formamide concentration, or increasing the hybridization temperature. Generally, stringent conditions include hybridization at a temperature of about 25? C. to about 42? C. in at least about 0% to at least about 15% v/v formamide and at least about 1 M to at least about 2 M salt, and washing in at least about 1 M to at least about 2 M salt; moderately stringent conditions include hybridization at a temperature of about 25? C. to about 65? C. in at least about 16% to at least about 30% v/v formamide and at least about 0.5 M to at least about 0.9 M salt, and washing in at least about 0.5 M to at least about 0.9 M salt; and highly stringent conditions include hybridization at a temperature of about at least 65? C. in at least about 31% to at least about 50% v/v formamide and at least about 0.01 M to at least about 0.15 M salt, and washing in at least about 0.01 M to at least about 0.15 M salt; formamide is optional in these hybridization conditions. Other suitable hybridization buffers and conditions are well known to those skilled in the art and are described, for example, in Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Press, plainview, N.Y. (1989); and Ausubel et al. Short Protocols in Molecular Biology, 4 th ed. John Wiley & Sons (1999).
(37) The term pharmaceutically acceptable carrier used in the context of the present disclosure refers to auxiliary materials that are widely used in the field of pharmaceutical manufacture. The primary purpose of using the carrier is to provide a pharmaceutical composition that is safe for use and stable in properties, and/or has specific functionality, and also to provide a method for dissolution of an active ingredient at a desired rate after administration of a drug to a subject, or to facilitate effective absorption of the active ingredient in the subject receiving administration. The pharmaceutically acceptable carrier can be an inert filler or a functional ingredient that provides some function to the pharmaceutical composition, such as stabilizing the overall pH of the composition or preventing degradation of the active ingredient in the composition. Non-limiting examples of the pharmaceutically acceptable carrier include, but are not limited to, binders, suspending agents, emulsifiers, diluents (or fillers), granulating agents, adhesives, disintegrants, lubricants, anti-adherents, glidants, wetting agents, gelling agents, absorption delaying agents, dissolution inhibitors, enhancers, adsorbents, buffers, chelating agents, preservatives, colorants, flavors, sweeteners, and the like.
(38) As used in the present disclosure, the terms complementary or hybridized are used to refer to polynucleotides and oligonucleotides (which are interchangeable terms and refer to nucleotide sequences) in relation to base-pairing rules. For example, the sequence CAGT is complementary to the sequence GTCA. Complementation or hybridization may be partial or complete. Partial complementation or hybridization means that one or more nucleic acid bases are mismatched according to the base pairing rules, and total or complete complementation or hybridization between nucleic acids means that each nucleic acid base matches with the other base under the base pairing rules. Degree of complementation or hybridization between nucleic acid strands has a significant effect on efficiency and strength of hybridization between nucleic acid strands. This is particularly important in amplification reactions and detection methods that depend on binding between nucleic acids.
(39) The term recombinant nucleic acid molecule refers to a polynucleotide having sequences that are not linked together in nature. The recombinant polynucleotide may be included in a suitable vector, and the vector may be used for transformation into a suitable host cell. The polynucleotide is then expressed in a recombinant host cell to produce, for example, a recombinant polypeptide, a recombinant protein, and a fusion protein.
(40) The term recombinant expression vector refers to a DNA structure used to express, for example, a polynucleotide encoding a desired polypeptide. A recombinant expression vector may include, for example, i) a collection of genetic elements having a regulatory effect on gene expression, such as promoters and enhancers; ii) a structure or coding sequence that is transcribed into mRNA and translated into a protein; and iii) appropriate transcriptional subunits of transcription and translation initiation and termination sequences. Recombinant expression vectors can be constructed in any suitable manner. The nature of the vector is not critical and any vector may be used, including plasmids, viruses, phages and transposons. Possible vectors for use in the present disclosure include, but are not limited to, chromosomal, non-chromosomal and synthetic DNA sequences, such as viral plasmids, bacterial plasmids, phage DNA, yeast plasmids and vectors derived from combinations of plasmids and phage DNA, and DNA from viruses such as lentiviruses, retroviruses, vaccinia, adenoviruses, fowlpox, baculoviruses, SV40, and pseudorabies.
(41) The term host cell refers to a cell into which an exogenous polynucleotide has been introduced, and includes the progeny of such a cell. Host cells include transformants and transformed cells, which include primary transformed cells and progeny derived therefrom. Host cells are any type of cellular system that can be used to produce antibody molecules of the present invention, including eukaryotic cells, e.g., mammalian cells, insect cells, yeast cells; and prokaryotic cells, e.g., Escherichia coli cells. Host cells include cultured cells as well as cells within transgenic animals, transgenic plants or cultured plant tissues or animal tissues. The term recombinant host cell encompasses a host cell different from the parent cell upon introduction of a recombinant nucleic acid molecule, recombinant expression vector, or circRNA, and is specifically achieved by transformation. A host cell of the present disclosure can be a prokaryotic cell or a eukaryotic cell, as long as the cell is capable of introducing the recombinant nucleic acid molecule, recombinant expression vector, or circRNA, etc. of the present disclosure.
(42) As used in the present disclosure, the term individual, patient, or subject includes mammals. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).
(43) As used in the present disclosure, the term transformation, transfection, and transduction has the meanings commonly understood by those skilled in the art, i.e., a process of introducing exogenous DNA into a host. The methods of transformation, transfection, and transduction include any method of introducing a nucleic acid into a cell, including, but not limited to, electroporation, calcium phosphate (CaPO.sub.4) precipitation, calcium chloride (CaCl.sub.2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, and lithium acetate-DMSO method.
(44) As used in the present disclosure, treatment or treating refers to: contacting (e.g., administering) a subject with circRNA, circularized precursor RNA, composition, etc. of the present invention after suffering from a disease, thereby reducing symptoms of the disease as compared with not contacting, and does not necessarily mean that the symptoms of the disease must be completely suppressed. Suffering from a disease means that: a body has symptoms of the disease.
(45) As used in the present disclosure, prevention, preventing refer to: contacting (e.g., administering) a subject with a circular RNA, composition, etc. of the present invention prior to suffering from a disease, thereby reducing symptoms after suffering from the disease as compared with not contacting, and does not mean that it is necessary to completely suppress the disease.
(46) As used in the present disclosure, the term effective amount refers to an amount or dose of the recombinant nucleic acid molecule, recombinant expression vector, circularized precursor RNA, circular RNA, vaccine or composition of the invention that, upon single or multiple dose administration to a patient, produces the desired effect in the patient in need of treatment or prevention. An effective amount can be readily determined by the attending physician, as one skilled in the art, by considering a variety of factors: species such as mammals; its size, age and general health; specific disease involved; extent or severity of disease; individual patient's response; specific antibody administered; mode of administration; bioavailability characteristics of the administered formulation; selected dosing regimen; and use of any concomitant therapy.
(47) As used in the present disclosure, the term individual, patient, or subject includes mammals. Mammals include, but are not limited to, domestic animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats).
(48) Unless defined otherwise or clearly indicated by the context, all technical and scientific terms in the present disclosure have the same meaning as commonly understood by a person with ordinary skill in the art to which the present disclosure belongs.
(49) Clean PIE System
(50) A process of ligating a conventional PIE system to form circRNA is shown in
(51) However, the use of a conventional PIE system will result in the presence of additional E1 and E2 exon sequences in circRNA and reduced sequence accuracy of circRNA, thereby resulting in increased natural immunogenicity of circRNA and susceptibility to degradation in cells.
(52) In order to solve the above problems, the present disclosure provides a Clean PIE system with a novel structure. The Clean PIE system can be used to prepare circRNA by using the self-splicing of the PIE system without changing the protein expression sequence, and has a high circularization efficiency. Furthermore, no additional E1 and E2 sequences need to be introduced into circRNA after circularization, which not only simplifies a structure of circRNA, but also reduces potential safety hazards. The Clean PIE system can also improve sequence accuracy of circRNA, reduce natural immunogenicity of circRNA and improve its intracellular stability. It is suitable for gene therapy vectors, expression of therapeutic proteins, nucleic acid vaccines and other clinical applications, and has broad application prospects.
(53) In the present disclosure, the Clean PIE system includes, but is not limited to, a DNA construct for preparing circRNA, a recombinant expression vector including the DNA construct, a circularized precursor RNA molecule obtained by in vitro transcription using the recombinant expression vector, and the like.
(54) In some embodiments, the present disclosure provides a recombinant nucleic acid molecule for preparing circRNA. Illustratively, the recombinant nucleic acid molecule can be the DNA construct for preparing circRNA, a circularized precursor RNA molecule, etc. as described above.
(55) In some embodiments, the recombinant nucleic acid molecule has a structure shown in
(56) Among them, the 3 end of the truncated fragment I of the translation initiation element includes a ribozyme recognition site I consisting of a first predetermined number of nucleotides located at the 3 end of the truncated fragment I of the translation initiation element; and the 5 end of the truncated fragment II of the translational initiation element includes a ribozyme recognition site II consisting of a second predetermined number of nucleotides located at the 5 end of the truncated fragment II of the translational initiation element.
(57) The nucleotide sequence of the truncated fragment I of the translation initiation element and the nucleotide sequence of the truncated fragment II of the translational initiation element are used to form a translation initiation element sequence in the 5 to 3 direction; the nucleotide sequence of the truncated fragment I of the translation initiation element corresponds to a partial sequence of the translation initiation element sequence near the 5 direction, and the nucleotide sequence of the truncated fragment II of the translational initiation element corresponds to the remaining partial sequence of the translation initiation element sequence near the 3 direction;
(58) The nucleotide sequence of the intron fragment I and the nucleotide sequence of the intron fragment II form an intron sequence in the 5 to 3 direction; the nucleotide sequence of the intron fragment I includes a partial sequence of the intron sequence near the 5 direction, and the nucleotide sequence of the intron fragment II includes the remaining partial sequence of the intron sequence near the 3 direction.
(59) That is, the nucleotide sequence of the truncated fragment I of the translation initiation element is ligated to the nucleotide sequence of the truncated fragment II of the translational initiation element to obtain a translation initiation element sequence, and the nucleotide sequence of the intron fragment I is ligated to the nucleotide sequence of the intron fragment II to obtain an intron sequence. When a recombinant nucleic acid molecule having the above structure is used for preparing circRNA, the linking position of the ribozyme recognition site I and the intron fragment I first breaks to release the intron fragment I; and the linking position of the ribozyme recognition site II and the intron fragment II then breaks to release the intron fragment II. The 3 end of the truncated fragment I of the translation initiation element is ligated to the 5 end of the truncated fragment II of the translational initiation element to form a circular molecule. In the present disclosure, without changing the target polypeptide sequence encoded by the coding region, and without additionally introducing E1 and E2 sequences, circRNA encoding the target protein can be obtained by self-splicing, which has high sequence accuracy, stability, and low immunogenicity.
(60) Meanwhile, since the ribozyme recognition site I and the ribozyme recognition site II are arranged inside the translation initiation element truncated fragments, no additional E1 and E2 sequences need to be introduced into circRNA after circularization in vitro, providing advantages of accurate sequence, simple structure, low immunogenicity, and the like, enabling large-scale in vitro production with the application advantages in the fields of nucleic acid vaccines, expression of therapeutic proteins, clinical immunotherapy, and the like.
(61) Translation Initiation Element
(62) In the present disclosure, the translation initiation element may be any type of element capable of initiating translation of a target polypeptide. In some embodiments, the translation initiation element is an element including any one or two or more of the following sequences: an IRES sequence, a 5UTR sequence, a Kozak sequence, a sequence with m.sup.6A modification (N(6)methyladenosine modification), and a complementary sequence of ribosomal 18S rRNA. In other embodiments, the translation initiation element may also be any other type of cap-independent translation initiation element.
(63) In some embodiments, the translation initiation element is an IRES element, and the IRES element is derived from, but not limited to, viruses, mammals, drosophila, and the like. In some alternative embodiments, the IRES element is derived from a virus. Illustratively, the IRES element includes an IRES sequence from a small RNA virus. Further, IRES elements include, but are not limited to, an IRES sequence derived from Echovirus, Human poliovirus, Human Enterovirus, Coxsackievirus, Human rhinovirus, Canine picornavirus, Turdivirus 3, Hepatovirus, Passerivirus, Picornaviridae, Tremovirus A, Feline kobuvirus, Murine kobuvirus, Kobuvirus sewage Kathmandu, Ferret kobuvirus, Marmot kobuvirus, Human parechovirus, Chicken picornavirus, Falcon picornavirus, Feline picornavirus, French Guiana picornavirus, and the like.
(64) In some alternative embodiments, the recombinant nucleic acid molecules provided by the present disclosure, in the 5 to 3 direction, consist of the following elements: intron fragment II, truncated fragment II of the translational initiation element, a coding element encoding at least one target polypeptide, truncated fragment I of the translation initiation element, and intron fragment I. In some other alternative embodiments, the recombinant nucleic acid molecule may also include any other one or more than two elements, for example, a transcriptional regulatory element for regulating transcription level, a translational regulatory element for regulating translation level, a purification element for purifying the prepared circRNA, and the like.
(65) Intron Fragment
(66) The intron fragments in the present disclosure are derived from Group I intron which has ribozyme activity for self-splicing reactions and is widely present in various species. Illustratively, the Group I intron includes, but is not limited to, T4 phage td gene, Anabaena tRNALeu, TpaCOX2, Ptu, and the like.
(67) In some embodiments, the intron fragment I and the intron fragment II are derived from Group I intron and include a partial sequence near the 5 direction and a partial sequence near the 3 direction, respectively, constituting the Group I intron. The ribozyme recognition site I is derived from the exon sequence (Exon 1, E1) ligated to the 5 end of the Group I intron, and the ribozyme recognition site II is derived from the exon sequence (Exon 2, E2) ligated to the 3 end of the Group I intron. The intron fragment I is ligated to the ribozyme recognition site I, and the intron fragment II is ligated to the ribozyme recognition site II, constituting a PIE system capable of self-splicing.
(68) In some alternative embodiments, the ribozyme recognition site I consists of 3 to 100 nucleotides, preferably 3 to 50 nucleotides, and more preferably 3 to 10 nucleotides. That is, the first predetermined number of nucleotides at the 3 end of the truncated fragment I of the translation initiation element is 3 to 100 nucleotides, preferably 3 to 50 nucleotides, and more preferably 3-10 nucleotides. Illustratively, the first predetermined number is 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 150, 200, 250, 300, and any integer value therebetween.
(69) In some alternative embodiments, the ribozyme recognition site II consists of 1 to 100 nucleotides, preferably 1 to 50 nucleotides, and more preferably 1 to 10 nucleotides. That is, the second predetermined number of nucleotides at the 5 end of the truncated fragment II of the translational initiation element is 1 to 100 nucleotides, preferably 1 to 50 nucleotides, and more preferably 1 to 10 nucleotides. Illustratively, the first predetermined number is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, and any integer value therebetween.
(70) In some preferred embodiments, the sum of the first predetermined number and the second predetermined number is not equal to 3y, y?1 and y is an integer. That is, the sum of the first predetermined number and the second predetermined number is not equal to an integer multiple of 3. When the sum of the two is not an integer multiple of 3, degree of freedom for arranging ribozyme recognition sites in the coding region can be increased to achieve efficient looping of circRNA.
(71) In some alternative embodiments, the Group I intron is T4 td intron derived from the td gene of T4 phage, the secondary structure of which is shown in
(72) It should be noted that, ribozyme recognition sites with a small number of base mutations can also be used for circRNA in vitro, under conditions that the bases at the circularization position are unchanged. Illustratively, the present disclosure finds that ribozyme recognition sites and their linked intron fragments retain circularization activity when one or more than two of the following mutations are present in 5-TTGGGTCT-3: base T at position 2 is mutated to C, base G at position 3 is mutated to A, and base T at position 8 is mutated to A.
(73) In some alternative embodiments, the intron fragment I derived from T4 td intron has a nucleotide sequence as set forth in SEQ ID NO: 20, or a sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 20.
(74) In some alternative embodiments, the intron fragment II derived from T4 td intron has a nucleotide sequence as set forth in SEQ ID NO: 19 or a sequence having 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% and 99% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 19.
(75) In some alternative embodiments, the Group I intron is TpaCOX2 intron. The TpaCOX2 intron is an intron sequence of cytochrome oxidase subunit cox2 gene of T. papilionaceus mitochondria, the secondary structure of which is shown in
(76) In some alternative embodiments, the Group I intron is Ptu intron, the secondary structure of which is shown in
(77) It should be noted that, in the present disclosure, sequences of ribozyme recognition site and intron fragments are not restrictively defined, as long as they are derived from Group I intron and can be efficiently circularized to produce circRNA in vitro.
(78) Recombinant Nucleic Acid Molecule Containing Insertion Element
(79) In some embodiments, the recombinant nucleic acid molecule includes an insertion element that can be used to regulate transcription of the recombinant nucleic acid molecule, to regulate translation of circRNA, to achieve specific expression of circRNA between different types of tissue, or to purify circRNA, etc. Illustratively, as shown in
(80) In some embodiments, the insertion element is at least one selected from the group consisting of (i)-(iii): (i) a transcriptional level regulatory element, (ii) a translational level regulatory element, and (iii) a purification element. Illustratively, the insertion element includes one or a combination of any two or more of the following sequences: an untranslated region (UTR) sequence, a polyN sequence, an aptamer sequence, a riboswitch sequence, and a transcription regulatory factor-binding sequence; and in the polyN sequence, N is selected from at least one of A, T, G and C.
(81) In some alternative embodiments, the translational regulatory element includes an untranslated region sequence that can be used to regulate stability, immunogenicity, and efficiency of circRNA in expressing a target polypeptide, and the like. In the present disclosure, the untranslated region sequence is not particularly defined, and may be selected from any type of sequence known in the art having the properties of regulating circRNA transcription, translation, intracellular stability, immunogenicity, and the like. Further, the untranslated region sequence is not limited to a 5UTR sequence or a 3 UTR sequence.
(82) In some alternative embodiments, the untranslated region sequence includes one or more miRNA recognition sequences, e.g., 1, 2, 3, 4, 5, 6 and 7 miRNA recognition sequences. By adding one or more miRNA recognition sequences, specific expression of circRNA in different types of tissue and different cells can be realized, and targeted delivery of the circRNA molecule can be achieved.
(83) In some alternative embodiments, the translational regulatory element includes a polyN sequence, wherein N may be at least one of A, T, G, and C. A translational regulatory element including a polyN sequence can be added to improve efficiency of circRNA in expressing a target polypeptide, improve immunogenicity and stability, etc., or purify circRNA. In the present disclosure, the length of the polyN sequence, the type of N selected in the polyN sequence, and the manner of composition are not specifically defined, as long as they are advantageous to improved performance of circRNA. Illustratively, the polyN sequence is a polyA sequence, a polyAC sequence, and the like.
(84) In some alternative embodiments, the translational regulatory element includes a riboswitch sequence. The riboswitch sequence is a class of untranslated sequences that regulate transcription and translation of RNA. In the present disclosure, the riboswitch sequence can affect expression of circRNA, including, but not limited to, transcription termination, inhibition of translation initiation, mRNA self-cleavage, and alterations in the splicing pathway in eukaryotes. In addition, the riboswitch sequence may also control expression of circRNA by triggering binding or removal of molecules. Illustratively, the riboswitch sequence is cobalamin riboswitch (also known as B12-element), FMN riboswitch (also known as RFN element), glmS riboswitch, SAM riboswitch, SAH riboswitch, tetrahydrofolate riboswitch, Moco riboswitch, and the like, and in the present disclosure, the riboswitch type and sequence are not defined, as long as the riboswitch can regulate the transcription and translation levels of circRNA in expressing a target polypeptide.
(85) In some alternative embodiments, the translational regulatory element includes an aptamer sequence. In the present disclosure, the aptamer sequence can be used to regulate transcription and translation of circRNA, or used for in vitro purification and preparation of circRNA.
(86) Recombinant Nucleic Acid Molecule Containing Homologous Arm
(87) In some embodiments, the recombinant nucleic acid molecule includes a homologous arm. Specifically, the homologous arm includes a 5 homologous arm at the 5 end of the recombinant nucleic acid molecule and a 3 homologous arm at the 3 end of the recombinant nucleic acid molecule, and the nucleic acid sequence of the 5 homologous arm hybridizes to the nucleotide sequence of the 3 homologous arm.
(88) In some embodiments, as shown in
(89) Target Polypeptides
(90) In the present disclosure, the type of target polypeptide is not restrictively defined, which may be human-derived or non-human-derived. Exemplary target polypeptides include, but are not limited to, antigens, antibodies, antigen-binding fragments, fluorescent proteins, proteins with therapeutic activity against diseases, proteins with gene editing activity, and the like.
(91) In the present disclosure, the term antibody is used in the broadest sense, refers to a protein including an antigen binding site and encompasses natural and artificial antibodies of various structures, including, but not limited to, monoclonal antibodies, polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies), single chain antibodies, intact antibodies, and antibody fragments.
(92) In the present disclosure, the term antigen-binding fragment is a portion or fragment of an intact or complete antibody that has fewer amino acid residues than the intact or complete antibody, and is capable of binding to an antigen or competing with an intact antibody (i.e., with the intact antibody from which the antigen-binding fragment is derived) for binding to an antigen. Antigen-binding fragments can be prepared by recombinant DNA technology, or by enzymatic or chemical cleavage of intact antibodies. Antigen binding fragments include, but are not limited to, Fv, Fab, Fab, Fab-SH, F(ab)2; diabodies; linear antibodies; single chain antibodies (e.g., scFvs); single domain antibodies; bivalent or bispecific antibodies or fragments thereof; camelid antibodies (heavy chain antibodies); and bispecific or multispecific antibodies formed from antibody fragments.
(93) In the present disclosure, proteins with therapeutic activity against diseases may include, but are not limited to, enzyme replacement proteins, proteins for supplementation, protein vaccines, antigens (e.g., tumor antigens, viruses, bacteria), hormones, cytokines, antibodies, immunotherapies (e.g., for cancer), cell reprogramming/transdifferentiation factors, transcription factors, chimeric antigen receptors, transposases or nucleases, immune effectors (e.g., affecting susceptibility to immune responses/signals), regulated death effector proteins (e.g., inducers of apoptosis or necrosis), non-soluble inhibitors of tumors (e.g., oncoprotein inhibitors), epigenetic modifiers, epigenetic enzymes, transcription factors, DNA or protein-modifying enzymes, DNA intercalators, efflux pump inhibitors, nuclear receptor activators or inhibitors, proteasome inhibitors, enzyme competitive inhibitors, protein synthesis effectors or inhibitors, nucleases, protein fragments or domains, ligands or receptors, and CRISPR systems or components thereof, and the like.
(94) Coding Element Containing Tandem Coding Region
(95) In some embodiments, the recombinant nucleic acid molecule includes a coding element, and the coding element includes at least one coding region. Illustratively, the coding element includes 1, 2, 3, 4, 5, 10, 15, 20 or 25 coding regions, etc. In some alternative embodiments, optionally, the coding element includes at least two coding regions, and each coding region independently encodes any type of target polypeptide.
(96) In some alternative embodiments, the coding element includes two or more coding regions. As shown in
(97) In some preferred embodiments, the coding element further includes a linker between any two adjacent coding regions. The adjacent coding regions are separated by the linker to enable expression of two or more target polypeptides by circRNA prepared from the recombinant nucleic acid molecule.
(98) In the present disclosure, the linker may be a polynucleotide encoding a 2A peptide, or other types of polynucleotides encoding a linker peptide for spacing target polypeptides. Among them, the 2A peptides are short peptides (about 18 to 25 amino acids in length) derived from viruses and are commonly referred to as self-cleaving peptides, enabling the production of multiple proteins from a transcript. Illustratively, the 2A peptide is P2A, T2A, E2A, F2A, and the like.
(99) In the present disclosure, each coding region encompassed by the coding element independently encodes any type of target polypeptide. Among them, target polypeptides encoded by any two coding regions may be the same or different.
(100) Coding Element Containing at Least 1 Translation Initiation Element
(101) In some embodiments, the coding element includes at least two coding regions, wherein a translation initiation element is linked between any two adjacent coding regions. Illustratively, the coding element includes 1, 2, 3, 4, 5, 10, 15, 20 or 25 coding regions, etc. Also, within the coding element, a translation initiation element is arranged between any two adjacent coding regions. In this manner, expression of two or more target polypeptides can be achieved by ligating a translation initiation element upstream of each coding region in circRNA prepared in vitro from the recombinant nucleic acid molecule.
(102) In some alternative embodiments, the coding element includes two or more coding regions. As shown in
(103) In the present disclosure, the translation initiation element may be any type of element capable of initiating translation of a target polypeptide. In some embodiments, the translation initiation element is an element including any one or more than two of the following sequences: an IRES sequence, a 5UTR sequence, a Kozak sequence, a sequence with m.sup.6A modification (N(6)methyladenosine modification), and a complementary sequence of ribosomal 18S rRNA. In other embodiments, the translation initiation element may also be any other type of cap-independent translation initiation element.
(104) In the present disclosure, each coding region encompassed by the coding element independently encodes any type of target polypeptide. The target polypeptides encoded by any two coding regions may be the same or different.
(105) In the circRNA prepared by using the above recombinant nucleic acid molecule, one translation initiation element is correspondingly ligated to the 5 end of each coding region, and multiple coding regions are in tandem via multiple translation initiation elements to realize expression of at least two target polypeptides.
(106) Recombinant Expression Vector Containing Recombinant Nucleic Acid Molecule
(107) In some embodiments, the recombinant nucleic acid molecule is present as part of a recombinant expression vector used to prepare circRNA. During in vitro transcription and circularization, circRNA expressing a target polypeptide can be prepared.
(108) In other embodiments, the recombinant nucleic acid molecule can also be present as a circularized precursor RNA molecule, or a part thereof, obtained after linearization and transcription reaction of the recombinant expression vector. That is, the recombinant nucleic acid molecule needs only undergo a circularization reaction to obtain circRNA expressing a target polypeptide.
(109) In some embodiments, steps of preparing circRNA in vitro includes: transcription step: transcribing the recombinant nucleic acid molecule as described in the present disclosure or the recombinant expression vector according to the present disclosure to form a circularized precursor nucleic acid molecule; and circularization step: subjecting the circularized precursor nucleic acid to a circularization reaction to give circRNA.
(110) In some alternative embodiments, the method further includes a step of purifying the circRNA.
(111) CircRNA
(112) In some embodiments, the circRNA of the present disclosure is prepared using the Clean PIE system provided by the present disclosure, including the elements, in the 5 to 3 direction, arranged in the following order: a translation initiation element, and a coding element for encoding at least one target polypeptide.
(113) Compared with circRNA prepared by a traditional PIE system as shown in
(114) In some embodiments, the coding element of the circRNA includes at least one coding region, and each coding region independently encodes any type of target polypeptide, the circRNA being capable of encoding one or more target polypeptides in tandem. Illustratively, the circRNA expresses 1, 2, 3, 4, 5, 10, 15, 20 or 25 target polypeptides, etc.
(115) As a preferred embodiment, any two adjacent coding regions are linked by a linker, and the target polypeptides encoded by the adjacent coding regions are separated by a linking peptide encoded by the linker, so that the same circRNA can express two or more target polypeptides in tandem.
(116) In some alternative embodiments, the coding element of the circRNA includes two or more coding regions. Illustratively, as shown in
(117) In some embodiments, the coding element of the circRNA includes at least two coding regions, wherein a translation initiation element is linked between any two adjacent coding regions. Illustratively, 1, 2, 3, 4, 5, 10, 15, 20 or 25 coding regions and so on are contained in the coding element. Transcription of different coding regions may be initiated by a translation initiation element linked at the 5 end of each coding region, enabling the same circRNA to be used to encode two or more target polypeptides.
(118) In some alternative embodiments, as shown in
(119) In the present disclosure, each coding region independently encodes any type of target polypeptide. The target polypeptides encoded by any two coding regions may be the same or different.
(120) In some alternative embodiments, the circRNA includes an insertion element. The insertion element is ligated to the 5 end of any translation initiation element.
(121) Method and System for Editing Translation Initiation Element Sequence
(122) In some embodiments, the present disclosure provides a method for encoding a translation initiation element, including the following steps:
(123) S1, determining a secondary structure of the translation initiation element according to a translation initiation element sequence.
(124) Specifically, an RNA structure prediction software receives the input translation initiation element sequence and then outputs the secondary structure corresponding to the translation initiation element sequence. In the present disclosure, the software for obtaining the secondary structure of the translation initiation element is not specifically defined, which may be any type of RNA structure prediction software capable of obtaining an RNA secondary structure from an input sequence. Illustratively, the RNA structure prediction software can be at least one of the following: RNAfold, Mfold, RNAfoldweerver, and Vienna RNA.
(125) S2, determining a to-be-edited region in the translation initiation element sequence according to the secondary structure.
(126) In the present disclosure, the to-be-edited region is a position with less hairpin structure, low free energy and easiness for circularization in the secondary structure. In some embodiments, no hairpin structure of more than 20 bp is presented within the range of 100 bp upstream to 100 bp downstream of the to-be-edited region.
(127) By mutating the base of the to-be-edited region at the above position, a nucleic acid recognition site can be inserted into the translation initiation element without affecting sequence activity of the translation initiation element. Also, after mutation of the base site of the to-be-edited region at the above position, effective circularization of circRNA can be achieved.
(128) S3, substituting the base at any one or more than two positions in the to-be-edited region to obtain an editing region including a ribozyme recognition site.
(129) In the present disclosure, the ribozyme recognition site sequence is formed by ligating a nucleotide sequence of the ribozyme recognition site I with a nucleotide sequence of the ribozyme recognition site II.
(130) By substituting the base at any one or more than two positions in the to-be-edited region, a corresponding ribozyme recognition site sequence is formed in the to-be-edited region. Illustratively, the ribozyme recognition site sequence includes, but is not limited to, 5-TTGGGTCT-3, 5-ACGTCTTAACCAA-3, 5-AGGGATCA-3, and the like.
(131) Further, the edited translation initiation element sequence is truncated at the position of the ribozyme recognition site to obtain truncated fragment I of the translation initiation element and truncated fragment II of the translational initiation element for constructing a Clean PIE system. Specifically, the position at which the edited translation initiation element sequence is truncated is between two bases of the ribozyme recognition site linked by ribozyme recognition site I to ribozyme recognition site II. For example, when the ribozyme recognition site sequence is 5-TTGGGTCT-3, the truncation position is between bases TC.
(132) System for Editing Translation Initiation Element
(133) In some embodiments, the present disclosure provides a system for editing a translation initiation element sequence, wherein the system includes: a secondary structure constructing module for determining a secondary structure of the translation initiation element according to the translation initiation element sequence; a to-be-edited region screening module for determining a to-be-edited region in the translation initiation element sequence according to the secondary structure; and a base substitution module for substituting base(s) at any one or two or more positions in the to-be-edited region to obtain an editing region including a ribozyme recognition site.
(134) In the present disclosure, the ribozyme recognition site sequence is formed by ligating the nucleotide sequence of ribozyme recognition site I and the nucleotide sequence of ribozyme recognition site II.
(135) In the present disclosure, the to-be-edited region is a position with less hairpin structure, low free energy and easy for circularization in the secondary structure. In some embodiments, the to-be-edited region does not have a hairpin structure of more than 20 bp within the range of 100 bp upstream to 100 bp downstream.
(136) In addition, the present disclosure also discloses a processing device for screening a target coding region sequence including a ribozyme recognition site, including: a memory for storing a computer program; and a processor for executing a computer program to implement the method for editing a translation initiation element sequence as described above.
(137) In addition, the present disclosure also discloses a computer-readable storage medium on which a computer program is stored. When executed by a processor, the computer program implements the method for editing a translation initiation element sequence as described above.
(138) Those skilled in the art will further appreciate that units and algorithm steps described in connection with the embodiments disclosed herein may be implemented with electronic hardware, computer software, or combinations of the two, and that elements and steps of the embodiments have been described above generally in terms of their functions in order to clearly illustrate the interchangeability of hardware and software. Whether such functions are implemented in hardware or software depends upon the particular application and design constraints of the technical solution. Those skilled in the art may implement the described functions in varying ways for each particular application, but such implementation should not be considered to go beyond the scope of the present invention.
EXAMPLES
(139) Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and specific examples, while indicating specific embodiments of the present disclosure, are given for the purpose of illustration only, since various changes and modifications within the spirit and scope of the present disclosure will become apparent to those skilled in the art from this detailed description.
(140) The experimental techniques and methods used in the examples, unless otherwise specified, are conventional techniques and methods. For example, the experimental methods in the following examples, where specific conditions are not specified, are generally in accordance with conventional conditions described in such as Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989) by Sambrook et al. or the conditions recommended by the manufacturer. The materials, reagents and the like used in the examples can be obtained from regular commercial sources unless otherwise specified.
Example 1
(141) (1) Translation initiation element sequences seq1 (Enterovirus A90 IRES), seq2 (Caprine kobuvirus IRES) and seq3 (Echovirus E29 IRES) with high protein expression verified by previous experiments were selected.
(142) (2) Secondary structure predictions were performed on seq1, seq2, and seq3 respectively using software RNAfold, corresponding to
(143) (3) Positions with less hairpin structure (low free energy and easyness for circularization) were selected as to-be-edited regions according to the secondary structure. In particular, no hairpin structure of more than 20 bp is presented within the range of 100 bp upstream and 100 bp downstream of the to-be-edited region. Point mutation was performed on the to-be-edited regions. The seq1 (Enterovirus A90 IRES) sequence has an A-to-T mutation at position 15, a T-to-C mutation at position 20, and a G-to-T mutation at position 21 to obtain a mutated sequence seq4. The seq1 (Enterovirus A90 IRES) sequence has a T-to-G mutation at position 677, and a T-to-C mutation at position 679 to obtain a mutated sequence seq5. The seq2 (Caprine kobuvirus IRES) sequence has a G-to-T mutation at position 80, an A-to-C mutation at position 81, and a G-to-T mutation at position 82 to obtain a mutated sequence seq6. The seq3 (Echovirus E29 IRES) has a G-to-T mutation at position 13, a T-to-C mutation at position 19, and a G-to-T mutation at position 20 to obtain a mutated sequence seq7.
(144) (4) A circularization intermediate consisting of intron fragment II, truncated fragment II of the translational initiation element, a coding region, truncated fragment I of the translation initiation element and intron fragment I in sequence was assembled. The intron fragment II is seq9, the intron fragment I is seq8, and the coding region sequence is a human interleukin-12 sequence (seq10). The truncated fragment II of the translational initiation element resulting from seq4 truncation is seq12, and the truncated fragment I of the translation initiation element resulting from seq4 truncation is seq11. The truncated fragment II of the translational initiation element resulting from seq5 truncation is seq14, and the truncated fragment I of the translation initiation element resulting from seq5 truncation is seq13. The truncated fragment II of the translational initiation element resulting from seq6 truncation is seq16, and the truncated fragment I of the translation initiation element resulting from seq6 is seq15. The truncated fragment II of the translational initiation element resulting from seq7 truncation is seq18, and the truncated fragment I of the translation initiation element resulting from seq7 is seq17. The circularization intermediate consisting of seq9, seq12, seq10, seq11 and seq8 in sequence was named as p3049, the circularization intermediate consisting of seq9, seq14, seq10, seq13 and seq8 in sequence was named as p3051, the circularization intermediate consisting of seq9, seq16, seq10, seq15 and seq8 in sequence was named as p3052, and the circularization intermediate consisting of seq9, seq18, seq10, seq17 and seq8 in sequence was named as p3046.
(145) The sequences involved in this example are shown in the following table:
(146) TABLE-US-00001 TABLE 1 SEQ ID NO: Seq1 SEQ ID NO: 1 Seq2 SEQ ID NO: 2 Seq3 SEQ ID NO: 3 Seq4 SEQ ID NO: 4 Seq5 SEQ ID NO: 5 Seq6 SEQ ID NO: 6 Seq7 SEQ ID NO: 7 Seq8 SEQ ID NO: 8 Seq9 SEQ ID NO: 9 Seq10 SEQ ID NO: 10 Seq11 SEQ ID NO: 11 Seq12 SEQ ID NO: 12 Seq13 SEQ ID NO: 13 Seq14 SEQ ID NO: 14 Seq15 SEQ ID NO: 15 Seq16 SEQ ID NO: 16 Seq17 SEQ ID NO: 17 Seq18 SEQ ID NO: 18
Example 2
(147) 1. Gene Synthesis
(148) The p3049, p3051, p3052, and p3046 described above were synthesized and cloned by GENEWIZ, Inc. The resulting gene fragment was ligated into pUC57 vector.
(149) 2. Preparation of Linear Plasmid Template
(150) 1) Plasmid Extraction
(151) (1) Externally synthesized stab cultured bacteria were activated at 37? C./220 rpm/3 to 4 hours (2) The activated bacteria solution was enlarged culturing at 37? C./220 rpm/overnight (3) Plasmid extraction was performed (with TIANGEN? EndoFree Mini Plasmid Kit II), and the OD value was measured
2) Plasmid Digestion
(152) The plasmid prepared in step 1) above was subjected to XbaI single enzyme digestion. The digestion system is shown in the table below:
(153) TABLE-US-00002 TABLE 2 Reagents Volume Plasmid 10 ?g Enzyme (1000 units) 5 ?l 10? cutsmart buffer 50 ?l Nuclease free, H.sub.2O Total 500 ?l
(154) Enzyme digestion was performed overnight at 37? C. The enzyme-digested products were recovered with universal DNA Gel Purification Kit (TIANGEN Biotech Co. Ltd.), the OD value was measured, and the digestion products were identified by 1% agarose gel electrophoresis. Purified linear plasmid templates were used for in vitro transcription.
(155) 3. Preparation of Linear mRNA by In Vitro Transcription
(156) 1) In Vitro Transcription
(157) mRNA was synthesized with T7 in vitro transcription kit (APE?BIO T7 High Yield RNA Synthesis Kit). The transcription system is shown in the table below:
(158) TABLE-US-00003 TABLE 3 Reagents Volume 10? Reaction Buffer 2 ?l ATP (20 mM) 2 ?l CTP (20 mM) 2 ?l UTP (20 mM) 2 ?l GTP (20 mM) 2 ?l Linear DNA template 1 ?g T7 RNA Polymerase Mix 2 ?l RNA Nuclease free, H.sub.2O Total 20 ?l
(159) After incubation at 37? C. for 2.5 hours, the linear DNA template was digested with DNase I. Digestion conditions: 37? C., 15 minutes.
(160) 2) Linear mRNA Purification
(161) The transcription products obtained in 1) above were purified by silica membrane spin column (Thermo, GeneJET RNA Purification Kit) method, the OD value was measured, and the size of RNA was determined by 1% denatured agarose gel electrophoresis.
(162) The 1% denatured agarose gel was prepared as follows: (1) 1 g agarose was weighed into 72 ml nuclease-free H.sub.2O, and heated in a microwave oven for dissolution; (2) when the agarose was cooled to 55?60? C., 0.1% gel red, 10 ml 10?MOPS, 18 ml formaldehyde were added in a fume cupboard, and gel was filled; (3) the denatured agarose gel electrophoresis procedure was as follows: equal volume sample of RNA and 2? Loading buffer were taken, and denatured at 65?70? C. for 5 to 10 minutes. Samples were loaded, electrophoresed at 100V for 30 minutes, and photographed with a gel imaging system.
4. mRNA Circularization
1) Circularization Reagent:
(163) GTP Buffer: 50 mM Tris-HCl, 10 mM MgCl2, 1 mM DTT, pH at about 7.5.
(164) 2) Circularization System and Conditions:
(165) TABLE-US-00004 TABLE 4 Solutions Volume mRNA 25 ?g mRNA GTP solution(20 mM) 50 ?l GTP buffer Make up to 500 ?l
(166) The solution was heated at 55? C. for 15 minutes, and then placed on ice. The circularized RNA product was purified by a silica membrane spin column (Thermo, GeneJET RNA Purification Kit) method, the OD value was measured, and the size of RNA was determined by 1% denatured agarose gel electrophoresis.
(167) 3) Identification of circRNA by 1% Denatured Agarose Gel
(168) Reagent preparation: 1 g agarose powder was added to 72 ml nuclease-free water, and heated to melt the agarose, adding 10 ml 10?MOPS buffer. 18 ml fresh 37% formaldehyde was then added to the resulting mixture in a fume cupboard, and mixed well. The gel was poured into a tank.
(169) mRNA detection: about 500 ng mRNA solution was added into 2?RNA loading buffer with equal volume, mixed well, and heated at 65? C. for 5 minutes, and subjected to agarose gel detection.
(170) The circularization process and method for preparing circRNA using the E1E2 Clean PIE system in the present disclosure did not require any additional modification, and the efficiency of circularization was similar to that of a classic PIE system as detected by agarose gel electrophoresis, and the circularization effect was obvious, without significant difference (
Example 3: Detection of Immunogenicity after Circularization
(171) Circular mRNA prepared by a classic PIE system and circular mRNAs p3049, p3051, p3052 and p3046 prepared by the E1E2 Clean PIE system of the present disclosure were used to induce the expression of immune response factors in A549 cells. The details are as follows:
(172) Circular mRNA obtained after circularization by a classic PIE system and circular mRNAs p3049, p3051, p3052 and p3046 obtained after circularization by the E1E2 Clean PIE of the present disclosure were subjected to RNaseR digestion followed by HPLC purification, and the resulting purified circular mRNAs were transfected into A549 cells by Lipofectamine Messenger Max (Invitrogen). The specific process is as follows:
(173) A549 cells were inoculated in a DMEM high glucose containing 10% fetal bovine serum and 1% penicillin-streptomycin solution and cultured in 5% CO.sub.2 incubator at 37? C. The cells were subcultured every 2 to 3 days.
(174) (1) Cell transfection:
(175) Before transfection, A549 cells were inoculated in a 24-well plate, 1?10.sup.5/well, and cultured in a 5% CO.sub.2 incubator at 37? C. After the cells reached 70% to 90% confluency, the mRNA was transfected into 293T cells with 500 ng/well using Lipofectamine MessengerMax (Invitrogen) transfection reagent. The specific operations are as follows:
(176) 1) The Messenger MAX? Reagent was diluted. The dilution system is shown in the table below:
(177) TABLE-US-00005 TABLE 5 Reagents Volume/well MEM serum-free medium 25 ?g Messenger MAX? Reagent 0.75 ?l
(178) The reagents were diluted and mixed, and incubated at room temperature for 5 minutes.
(179) 2) The mRNA was diluted. The dilution system is shown in the table below:
(180) TABLE-US-00006 TABLE 6 Reagents Volume/well mRNA 1 ?g MEM serum-free medium Make up to 25 ?l
(181) 3) Mix diluted Messenger MAX? Reagent and mRNA in a ratio of 1:1
(182) TABLE-US-00007 TABLE 7 Reagents Volume/well Diluted Messenger MAX? Reagent 25 ?l Diluted mRNA 25 ?l
(183) The reagents were diluted and mixed, and incubated at room temperature for 5 minutes.
(184) (2) 50 ?l of the above mixture was pipetted and slowly added into a 24-well plate with adhering to the wall, and incubated in 5% CO.sub.2 incubator at 37? C.
(185) (3) Cells expressed for 8 hours were lysed, and the expression level of immune response protein was verified by fluorescent quantitative PCR.
(186) The primer sequences used in fluorescent quantitation PCR are shown below:
(187) TABLE-US-00008 IFNb-F: (SEQIDNO:21) TGGGAGGATTCTGCATTACC IFNb-R: (SEQIDNO:22) CAGCATCGCTGGTTGAGA RIG-1-F: (SEQIDNO:23) CTCCCGGCACAGAAGTGTAT RIG-1-R: (SEQIDNO:24) CTTCCTCTGCCTCTGGTTTG IFNa-F: (SEQIDNO:25) CCATCTCTGTCCTCCATGAG IFNa-R: (SEQIDNO:26) ATTTCTGCTCTGACAACCTC PKR-F: (SEQIDNO:27) TGCAAAATGGGACAGAAAGA PKR-R: (SEQIDNO:28) TGATTCAGAAGCGAGTGTGC MDA5-F: (SEQIDNO:29) ACCAAATACAGGAGCCATGC MDA5-R: (SEQIDNO:30) GCGATTTCCTTCTTTTGCAG TNFa-F: (SEQIDNO:31) CGTCTCCTACCAGACCAAGG TNFa-R: (SEQIDNO:32) CCAAAGTAGACCTGCCCAGA IL-6-F: (SEQIDNO:33) TACCCCCAGGAGAAGATTCC IL-6-R: (SEQIDNO:34) GCCATCTTTGGAAGGTTCAG
(188)
(189) The Results Show that:
(190) Although INFb can still cause an immune response after RNase R digestion and HPLC purification in classic PIE, the circular mRNA prepared by the Clean PIE circularization system of the present disclosure is significantly reduced compared with that prepared by the classic PIE, thereby demonstrating that circular mRNA with more accurate sequences can reduce the induction of immunogenicity.
Example 4: Verification of In Vitro Expression of Circular mRNA Synthesized In Vitro by the Method of the Present Disclosure
(191) In this example, the circular mRNA prepared in Example 2 was transfected into 293T cells, the supernatant was pipetted, and the protein expression level was detected using abeam ab-213791-human IL-12(p70) Elisa kit. Compared with the circular mRNA prepared by a classic PIE circularization method, the circular mRNA prepared by the Clean PIE of the present disclosure had an increased protein expression level in 293T transfected cells (
(192) The above embodiments of the present disclosure are only examples to clearly illustrate the present disclosure, and are not intended for restriction. Those skilled in the art can also make other modifications and variations of different forms in the present invention without departing from the scope or spirit of the present invention. All embodiments need not be, and cannot be, exhaustive. Any modification, equivalent replacement and improvement made in accordance with the spirit and principles of the disclosure shall fall within the protection scope of the claims of the present disclosure.