Sexual maturation in rainbow trout
12054769 ยท 2024-08-06
Assignee
Inventors
Cpc classification
G16B20/20
PHYSICS
Y02A40/81
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Q1/6883
CHEMISTRY; METALLURGY
C12Q2600/124
CHEMISTRY; METALLURGY
International classification
Abstract
Described herein are polymorphisms, and in particular single nucleotide polymorphisms (SNP) associated with late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss). In particular, provided are methods for predicting late onset of sexual maturation in rainbow trout, methods for selecting a rainbow trout having late onset of sexual maturation and kit suitable for carrying out said methods. Further provided are rainbow trout cells, sperm and unfertilized eggs carrying at least one allele conferring late onset of sexual maturation in their genome.
Claims
1. A method for obtaining rainbow trout having late onset of sexual maturation, said method comprising: providing an initial population of rainbow trout; obtaining a nucleic acid sample from at least one individual rainbow trout within said initial population; detecting in each of said nucleic acid samples the presence of at least one allele conferring late onset of sexual maturation (late maturation allele) within the genome of said rainbow trout; wherein the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the SNPs listed in the following table; TABLE-US-00009 Nor- Late mal Position ma- ma- Seq Affy- Chro- in tur- tur- SNP ID metrix mo- GenBank Genbank ation ation # NO: ID some contig contig allele allele 134 134 Affx- chr28 CM007962.1 11382381 A C 88927547 135 135 Affx- chr28 CM007962.1 11414120 G A 88946147 137 137 Affx- chr28 CM007962.1 11414399 A G 88953900 138 138 Affx- chr28 CM007962.1 11487704 C T 88947402 140 140 Affx- chr28 CM007962.1 11537736 T C 88940276 selecting a rainbow trout from said initial population based on the presence of the at least one late maturation allele in the nucleic acid samples; and mating said selected rainbow trout with a second rainbow trout to produce progeny rainbow trout having late onset of sexual maturation.
2. The method according to claim 1, wherein at least one rainbow trout within said mating pair is homozygous for the late maturation allele.
3. The method according to claim 1, wherein each rainbow trout within said mating pair is homozygous for the late maturation allele.
4. The method according to claim 1, the method further comprising obtaining a nucleic acid sample from at least two individual rainbow trout within said initial population; detecting the presence of at least one allele conferring late onset of sexual maturation (late maturation allele) within the genome of said at least two rainbow trout; selecting a mating pair of rainbow trout from said initial population based on the presence of the at least one allele conferring late onset of sexual maturation (late maturation allele) in the nucleic acid samples of both rainbow trout within said mating pair; and mating said selected mating pair of rainbow trout to produce progeny rainbow trout having late onset of sexual maturation.
5. The method according to claim 4, wherein at least one rainbow trout within said mating pair is homozygous for the late maturation allele.
6. The method according to claim 4, wherein each rainbow trout within said mating pair is homozygous for the late maturation allele.
7. A method for obtaining gametes from rainbow trout having late onset of sexual maturation, said method comprising providing an initial population of rainbow trout; obtaining a nucleic acid sample from at least one individual rainbow trout within said initial population; detecting in each of said nucleic acid samples the presence of at least one allele conferring late onset of sexual maturation (late maturation allele) within the genome of said rainbow trout; wherein the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the SNPs listed in the following table; TABLE-US-00010 Position Seq in Late Normal SNP ID Affymetrix GenBank Genbank maturation maturation # NO: ID Chromosome contig contig allele allele 134 134 Affx- chr28 CM007962.1 11382381 A C 88927547 135 135 Affx- chr28 CM007962.1 11414120 G A 88946147 137 137 Affx- chr28 CM007962.1 11414399 A G 88953900 138 138 Affx- chr28 CM007962.1 11487704 C T 88947402 140 140 Affx- chr28 CM007962.1 11537736 T C 88940276 selecting a rainbow trout from said initial population based on the presence of the at least one late maturation allele in the nucleic acid samples; and isolating gametes from said selected trout.
8. The method according to claim 7, wherein said gametes are eggs.
9. The method according to claim 7, wherein said gametes are spermatozoa.
10. A method for obtaining rainbow trout having late onset of sexual maturation, said method comprising: providing an initial population of rainbow trout; obtaining a nucleic acid sample from at least one individual rainbow trout within said initial population; detecting in each of said nucleic acid samples the presence of at least one allele conferring late onset of sexual maturation (late maturation allele) within the genome of said rainbow trout; wherein the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of the SNPs listed in the following table; TABLE-US-00011 Position Seq in Late Normal SNP ID Affymetrix GenBank Genbank maturation maturation # NO: ID Chromosome contig contig allele allele 134 134 Affx- chr28 CM007962.1 11382381 A C 88927547 135 135 Affx- chr28 CM007962.1 11414120 G A 88946147 137 137 Affx- chr28 CM007962.1 11414399 A G 88953900 138 138 Affx- chr28 CM007962.1 11487704 C T 88947402 140 140 Affx- chr28 CM007962.1 11537736 T C 88940276 selecting a rainbow trout from said initial population based on the presence of the at least one late maturation allele in the nucleic acid samples; isolating gametes from said selected trout; and utilizing said isolated gametes to produce progeny rainbow trout comprising late onset of sexual maturation.
11. The method according to claim 10, wherein said gametes are eggs.
12. The method according to claim 10, wherein said gametes are spermatozoa.
13. The method of claim 7, further comprising producing progeny rainbow trout comprising late onset of sexual maturation from the isolated gametes.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The present invention is described in detail by reference to the following drawings:
(2)
(3)
(4) A distinctive and highly significant QTL for maturity is detected on chromosome 28. The most preferred SNPs are marked in light grey color (SNP #120, 127-131, 134-135, 137-138, 140, 142, 143-144, 146-147; 16 SNPs in total). All of these SNPs (16 in total) have a p-value lower than 3.12e-7 and are located within a genomic region of 1.9 megabases.
(5)
(6) TABLE-US-00001 Genotype Allelic variants qq homozygous for normal maturation allele qQ heterozygous for late maturation allele QQ homozygous for late maturation allele
(7) The figure shows how the genotype correlate with maturation without correcting for polygenic effect (effect of all other genes, i.e. family effect) and other potential co-factors. The effect size of the allele is adjusted for the polygenic effect and sex; hence it is a more accurate measure. The effect is significant in both male and female Trout; but seems to be somewhat larger in female Trout.
(8)
(9) TABLE-US-00002 Genotype Allelic variants qq homozygous for normal maturation allele qQ heterozygous for late maturation allele QQ homozygous for late maturation allele
(10)
DETAILED DESCRIPTION
(11) Unless specifically defined herein, all technical and scientific terms used have the same meaning as commonly understood by a skilled artisan in the fields of genetics, biochemistry, and molecular biology.
(12) All methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, with suitable methods and materials being described herein. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will prevail.
(13) Where a numerical limit or range is stated herein, the endpoints are included. Also, all values and sub ranges within a numerical limit or range are specifically included as if explicitly written out.
Definitions
(14) As used herein, late onset of sexual maturation means that an individual having late onset of sexual maturation has a higher probability of maturing later than a random individual (under the same conditions, i.e. under same intrinsic and extrinsic factors) with whom it is comparable. Two individuals are comparable if they are, with regards to all discriminating factors except the genotype at the SNP which is used for predicting late onset of sexual maturation, random representatives of one and the same population of rainbow trout.
(15) As used herein, a late maturation allele is an allele conferring late onset of sexual maturation. This means that a rainbow trout having such allele at the position of a polymorphism detailed herein shows late onset of sexual maturation. The late maturation allele may identify a single nucleotide polymorphism that can be used to detect or determine the degree of late sexual maturation.
(16) As used herein, a polymorphism is a variation in a genomic sequence. In particular, a polymorphism is a position on the genome where different allelic variants are generally found between individuals of a population, or between individuals from different populations. The polymorphism may be a single nucleotide difference present at a locus or may be an insertion or deletion of one or a few nucleotides at a position of a gene.
(17) As used herein, a single nucleotide polymorphism or SNP refers to a single base (nucleotide) polymorphism in a DNA sequence among individuals in a population. As such, a single nucleotide polymorphism is characterized by the presence in a population of one or two, three or four different nucleotides (i.e. adenine, cytosine, guanine or thymine), typically less than all four nucleotides, at a particular locus in a genome, such as the genome of rainbow trout.
(18) As used herein, polymorphic sequence refers to a nucleotide sequence including a polymorphic site at which a SNP or another type of polymorphism occurs.
(19) As used herein, a polymorphic site is the locus or position within a given sequence at which divergence occurs. Preferred polymorphic sites have at least two alleles, each occurring at frequency greater than 1%, and more preferably greater than 10%. Those skilled in the art will recognize that nucleic acid molecules may be double-stranded molecules and that reference to a particular site on one strand refers, as well, to the corresponding site on a complementary strand. In defining a polymorphic site or allele reference to an adenine, a thymine, a cytosine, or a guanine at a particular site on one strand of a nucleic acid molecule also defines the thymine, adenine, guanine, or cytosine (respectively) at the corresponding site on a complementary strand of the nucleic acid.
(20) Herein, when a polymorphism is specified as having a particular allele, then it is understood that that particular allele goes together with the sequence given for the polymorphism. For example, when it is said that thymine is the late maturation allele of Affx-88940276, then it is understood that the late maturation allele of Affx-88940276 harbors a thymine nucleotide in the polymorphic site defined in Table 2 when the DNA is read in the direction defined in Table 2. In other words, as stated in Table 2, the late maturation form of the DNA sequence of Affx-88940276 (with flanking sequences) is CCGCCAGTGTCGATGCCAAACCCTTGAAAATAGGT[C/T]GGGAAAGGAAATCC TTTCCCTCTAAATATCTGTCG (SEQ ID NO: 329; polymorphic site in brackets) when read in the direction defined in Table 2. When read in the opposite direction, the sequence of Affx-88940276 (with flanking sequence) is GCTGTCTATAAATCTCCCTTTCCTAAAGGAAAGGG[T/C]TGGATAAAAGTTCCC AAACCGTAGCTGTGACCGCC (SEQ ID NO: 330; polymorphic site in brackets). Although only one direction is used when late maturation alleles and normal maturation alleles are defined herein, the two read directions are equivalent.
(21) As used herein, a sample, such as a biological sample that includes nucleic acid molecules, is a sample obtained from a rainbow trout, including, but not limited to, cells, tissue, and bodily fluids.
(22) As used herein, an oligonucleotide is a plurality of joined nucleotides joined by native phosphodiester bonds, typically from 8 to 300 nucleotides in length.
(23) As used herein, probes and primer are isolated oligonucleotides of at least 8 nucleotides, such as at least 10 nucleotides, capable of hybridizing to a target nucleic acid.
(24) As used herein, isolated means that an organism or a biological component, such as a cell, population of cells or a nucleic acid molecule, has been separated from its natural environment.
(25) As used herein, genetic linkage refers to the tendency of polymorphisms that are located close to each other on a chromosome to be inherited together during meiosis. Thus, polymorphisms located close to each other on the same chromosome are said to be genetically linked. Alleles at two such genetically linked loci are co-inherited (from parents to offspring) more often than they are not. Assume, for example, two polymorphisms; polymorphism A having alleles A1 and A2, and polymorphism B having alleles B1 and B2. Assume further that a given rainbow trout carries all of the alleles A1, A2, B1, and B2 (in other words, this rainbow trout is heterozygous at both marker and marker B). If alleles A1 and B1 are, in this particular rainbow trout, located on the same chromosome copy, then alleles A1 and B1 are co-inherited, to the offspring of the rainbow trout, more often than not.
(26) As used herein, genetic linkage analysis refers to a statistical procedure where genotype data, coming from sets of animals comprising parents and their offspring, are investigated in order to test for the presence of genetic linkage between polymorphisms. Genetic linkage analysis can be used in order to assign polymorphisms to chromosomes, provided that the analysis incorporates polymorphisms that have already been assigned to chromosome using, for example, Fluorescence In Situ Hybridization.
(27) As used herein Fluorescence In Situ Hybridization or FISH refers to a technique that detect the presence or absence of specific DNA sequences on chromosomes. FISH can be used in order to assign known DNA polymorphisms to chromosomes.
(28) Centi-Morgen is a unit of measurement, used to describe genetic distances, where genetic distance is a measure of the extent to which two polymorphisms are genetically linked.
(29) Linkage disequilibrium (LD) or, more precisely, gametic phase linkage disequilibrium, is used in order to describe the co-inheritance of alleles at genetically linked polymorphisms, at the population level. Assume, for example, two polymorphisms located on the same chromosome; polymorphism A having alleles A1 and A2, and polymorphism B having alleles B1 and B2. All copies of the chromosome in question will harbor a combination of alleles at the two loci (i.e. a haplotype), and there are four possible haplotypes: A1-B1, A1-B2, A2-B1, and A2-B2. The two loci are in said to be LD with each other if the number of A1-B1 and A2-B2 haplotypes within the population are significantly larger or significantly smaller than the number of A1-B2 and A2-B1 haplotypes.
(30) Polymorphisms and Late Maturation Allele(s) of the Invention
(31) The present inventors have identified several quantitative trait locus (QTL) responsible for a significant fraction of the genetic variation related to sexual maturation in rainbow trout. More specifically, the present inventors have identified polymorphisms, and in particular single nucleotide polymorphisms (SNP), within the genome, more particularly on chromosome 1 to 29, of rainbow trout which are associated with late onset of sexual maturation. Specific details of single nucleotide polymorphisms of the invention are provided in Table 1 below. The respective nucleotide sequences including the SNP (at position 31) are shown in Table 2.
(32) The polymorphisms of the invention can be present in either of two forms, i.e., the polymorphisms have two alleles.
(33) One allele can be characterized as being an allele conferring late onset of sexual maturation. This means that a rainbow trout having such allele at the position of a polymorphism detailed herein shows late onset of sexual maturation. This allele is herein denoted late maturation allele. The respective late maturation allele for each of the single nucleotide polymorphism of the invention is specified in Table 1 below. A late maturation allele according to the present invention may therefore be used to predict late onset of sexual maturation in a rainbow trout. A late maturation allele according to the present invention may also be used to select a rainbow trout having late onset of sexual maturation.
(34) The other allele can be characterized as being an allele that does not confer late onset of sexual maturation. Such allele is herein denoted normal maturation allele.
(35) Rainbow trout are diploid, in some case triploid organisms, and thus possess at least two copies of the polymorphisms of the invention (one copy to be found on each copy of the chromosome).
(36) As demonstrated herein, if at least one allele of a polymorphism, and more particularly of a SNP, is the respective late maturation allele, then the rainbow trout has late onset of sexual maturation as compared to a rainbow trout wherein both alleles are normal maturation alleles (i.e. such rainbow trout being homozygous for the normal maturation allele). In a great number of cases the onset of sexual maturation is even further delayed if both alleles of a polymorphism, and more particularly of a SNP, are the respective late maturation alleles (such rainbow trout being homozygous for the late maturation allele). Such further increase is, for example, seen for SNP #140 (
(37) A polymorphism of the invention may be any of several polymorphisms associated with late onset of sexual maturation of a rainbow trout. Particularly, a polymorphism of the invention is a polymorphism located on any one of chromosome 1 to 29 of rainbow trout (following the nomenclature of Palti et al. (2011)), i.e. a polymorphism found to be located on any one of chromosome 1 to 29 on the basis of genetic linkage analysis, Fluorescence In Situ Hybridization (FISH) or any other method that assigns DNA polymorphisms to their respective chromosomes.
(38) A polymorphism of the invention may be any polymorphism, including single nucleotide polymorphism, located within any of the rainbow trout genomic sequences listed in the column titled GenBank contig in Table 1.
(39) A polymorphism of the invention may be any polymorphism, including single nucleotide polymorphism, which is in strong linkage disequilibrium (LD) with any one of the SNPs listed in table 1. Here, two polymorphisms are defined to be in strong LD if the square of the correlation coefficient between the two loci (r2, the most commonly used measure of LD) is equal to or larger than 0.5, more preferably equal to or larger than 0.7, even more preferably equal to or larger than 0.8 and most preferably equal to or larger than 0.9. A person who is skilled in the art will know how to estimate r2, as well as what data is required for this estimation.
(40) A polymorphism of the invention may be at least one of the single nucleotide polymorphisms listed in Table 1. Therefore, according to certain embodiments, the at least one SNP of the invention is selected from the SNPs listed in Table 1. Each of the SNPs listed in Table 1 is contemplated as being disclosed individually as part of the present invention.
(41) TABLE-US-00003 TABLE 1 SNPs associated with sexual maturation in Rainbow trout. Position in Late Normal Genbank maturation maturation SNP# Affymetrix ID Chromosome GenBank contig contig allele allele 1 Affx-88904935 chr1 CM007935.1 63783597 T C 2 Affx-88955402 chr1 CM007935.1 64700514 A C 3 Affx-88936832 chr1 CM007935.1 65578255 G A 4 Affx-88950378 chr1 CM007935.1 65615419 A G 5 Affx-88925365 chr2 CM007936.1 54285214 A G 6 Affx-88946858 chr2 CM007936.1 56918053 C T 7 Affx-88954034 chr2 CM007936.1 57044148 C T 8 Affx-88936668 chr2 CM007936.1 59081958 A C 9 Affx-88953569 chr2 CM007936.1 62341749 A G 10 Affx-88961158 chr2 CM007936.1 62572758 C T 11 Affx-88934762 chr2 CM007936.1 63306724 G A 12 Affx-88923797 chr2 CM007936.1 63685704 T C 13 Affx-88905095 chr3 CM007937.1 19524784 A G 14 Affx-88915123 chr3 CM007937.1 19535483 A G 15 Affx-88954577 chr3 CM007937.1 19603901 G T 16 Affx-88938133 chr3 CM007937.1 30879389 A C 17 Affx-88915067 chr4 CM007938.1 8909969 C T 18 Affx-88941840 chr4 CM007938.1 11240214 G A 19 Affx-88904592 chr4 CM007938.1 12590767 T G 20 Affx-88958567 chr4 CM007938.1 71235287 C T 21 Affx-88920423 chr5 CM007939.1 51055810 A G 22 Affx-88951600 chr5 CM007939.1 71720042 A G 23 Affx-88958428 chr5 CM007939.1 81401808 A G 24 Affx-88921734 chr5 CM007939.1 82479766 G T 25 Affx-88952785 chr6 CM007940.1 6340153 G A 26 Affx-88954186 chr6 CM007940.1 18411308 G A 27 Affx-88940319 chr6 CM007940.1 29053396 A C 28 Affx-88936711 chr6 CM007940.1 32381726 A G 29 Affx-88909681 chr7 CM007941.1 18849968 C A 30 Affx-88920716 chr7 CM007941.1 33271630 T C 31 Affx-88936725 chr7 CM007941.1 34065749 C A 32 Affx-88930546 chr7 CM007941.1 35811286 G T 33 Affx-88932380 chr8 CM007942.1 69313777 T C 34 Affx-88919018 chr8 CM007942.1 70769104 A G 35 Affx-88948691 chr8 CM007942.1 70793135 T C 36 Affx-88916802 chr8 CM007942.1 77412834 G A 37 Affx-88916833 chr9 CM007943.1 22487940 A G 38 Affx-88929636 chr9 CM007943.1 22627473 A G 39 Affx-88926137 chr9 CM007943.1 22675057 A G 40 Affx-88926394 chr9 CM007943.1 31913561 A G 41 Affx-88934825 chr10 CM007944.1 31683283 G A 42 Affx-88904537 chr10 CM007944.1 33539443 T C 43 Affx-88959739 chr10 CM007944.1 39056184 T G 44 Affx-88956881 chr11 CM007945.1 3987284 G T 45 Affx-88951001 chr11 CM007945.1 49414158 G T 46 Affx-88954986 chr11 CM007945.1 57541195 T C 47 Affx-88916907 chr11 CM007945.1 67172627 C T 48 Affx-88947853 chr12 CM007946.1 27799868 C A 49 Affx-88939958 chr12 CM007946.1 57549580 G A 50 Affx-88911641 chr12 CM007946.1 86816745 T C 51 Affx-88957555 chr13 CM007947.1 12693726 G T 52 Affx-88942222 chr13 CM007947.1 32421268 G A 53 Affx-88904308 chr13 CM007947.1 45827883 C T 54 Affx-88931117 chr14 CM007948.1 19467149 C T 55 Affx-88959989 chr14 CM007948.1 21894963 C T 56 Affx-88918911 chr14 CM007948.1 24115228 T G 57 Affx-88922027 chr14 CM007948.1 24920208 G A 58 Affx-88921698 chr15 CM007949.1 24569160 T C 59 Affx-88925753 chr15 CM007949.1 27726385 T C 60 Affx-88956336 chr15 CM007949.1 27801757 C A 61 Affx-88961133 chr15 CM007949.1 54519499 G T 62 Affx-88921645 chr16 CM007950.1 36765420 T G 63 Affx-88949977 chr16 CM007950.1 48753210 A G 64 Affx-88957804 chr16 CM007950.1 49749575 A G 65 Affx-88913266 chr17 CM007951.1 38785093 A G 66 Affx-88939862 chr17 CM007951.1 38831122 G T 67 Affx-88915748 chr18 CM007952.1 21596568 T C 68 Affx-88922933 chr18 CM007952.1 22420190 G A 69 Affx-88915837 chr18 CM007952.1 27494999 C T 70 Affx-88929378 chr19 CM007953.1 30636790 C A 71 Affx-88961378 chr19 CM007953.1 34580702 A C 72 Affx-88953889 chr19 CM007953.1 36847192 C T 73 Affx-88922131 chr19 CM007953.1 36901034 G A 74 Affx-88958970 chr20 CM007954.1 2000433 G T 75 Affx-88910072 chr20 CM007954.1 10825499 T G 76 Affx-88933134 chr20 CM007954.1 15246572 A C 77 Affx-88939049 chr21 CM007955.1 12015696 T G 78 Affx-88950195 chr21 CM007955.1 14532693 T C 79 Affx-88933377 chr21 CM007955.1 14717955 G A 80 Affx-88909724 chr21 CM007955.1 34227983 A G 81 Affx-88917486 chr22 CM007956.1 4433427 A G 82 Affx-88941752 chr22 CM007956.1 23757569 G T 83 Affx-88942920 chr22 CM007956.1 24124923 A T 84 Affx-88945639 chr23 CM007957.1 46442301 A G 85 Affx-88905397 chr23 CM007957.1 46444905 T G 86 Affx-88949049 chr23 CM007957.1 47383604 A G 87 Affx-88923532 chr23 CM007957.1 48284540 C T 88 Affx-88924387 chr23 CM007957.1 48657925 G T 89 Affx-88905064 chr23 CM007957.1 48711098 A G 90 Affx-88957818 chr24 CM007958.1 20952836 A G 91 Affx-88945529 chr24 CM007958.1 25019945 T C 92 Affx-88940262 chr24 CM007958.1 25020252 T C 93 Affx-88928194 chr25 CM007959.1 10849854 C A 94 Affx-88944575 chr25 CM007959.1 14555851 T C 95 Affx-88911550 chr25 CM007959.1 14574366 A G 96 Affx-88940618 chr25 CM007959.1 15498993 C T 97 Affx-88918400 chr25 CM007959.1 47014119 T G 98 Affx-88926265 chr25 CM007959.1 47014758 G A 99 Affx-88945363 chr25 CM007959.1 47015074 A G 100 Affx-88914956 chr25 CM007959.1 48229209 G A 101 Affx-88959143 chr25 CM007959.1 48397292 C T 102 Affx-88907320 chr26 CM007960.1 10225818 T G 103 Affx-88950639 chr26 CM007960.1 10495031 A C 104 Affx-88951915 chr26 CM007960.1 12901743 G A 105 Affx-88939677 chr26 CM007960.1 26154364 C T 106 Affx-88921625 chr27 CM007961.1 7278740 G A 107 Affx-88918503 chr27 CM007961.1 7764626 C T 108 Affx-88958017 chr27 CM007961.1 7820269 C A 109 Affx-88911327 chr27 CM007961.1 10784017 C T 110 Affx-88950248 chr28 CM007962.1 9037911 C A 111 Affx-88932371 chr28 CM007962.1 9072612 C T 112 Affx-88923416 chr28 CM007962.1 9082601 C T 113 Affx-88955399 chr28 CM007962.1 9102905 T C 114 Affx-88908191 chr28 CM007962.1 9446099 T C 115 Affx-88923808 chr28 CM007962.1 9632653 A G 116 Affx-88908821 chr28 CM007962.1 9909392 G A 117 Affx-88955530 chr28 CM007962.1 10202248 A G 118 Affx-88941807 chr28 CM007962.1 10237515 A G 119 Affx-88904869 chr28 CM007962.1 10252908 T G 120 Affx-88912748 chr28 CM007962.1 10378833 C A 121 Affx-88924717 chr28 CM007962.1 10406672 A C 122 Affx-88946195 chr28 CM007962.1 10407234 C A 123 Affx-88931804 chr28 CM007962.1 10500800 G A 124 Affx-88929559 chr28 CM007962.1 10502719 T G 125 Affx-88905073 chr28 CM007962.1 10564775 G T 126 Affx-88947012 chr28 CM007962.1 10593406 G A 127 Affx-88939287 chr28 CM007962.1 10605800 A G 128 Affx-88947787 chr28 CM007962.1 11093692 C T 129 Affx-88932913 chr28 CM007962.1 11096202 C T 130 Affx-88952141 chr28 CM007962.1 11139401 G T 131 Affx-88913454 chr28 CM007962.1 11148320 T C 132 Affx-88959734 chr28 CM007962.1 11200364 T G 133 Affx-88915384 chr28 CM007962.1 11251982 T G 134 Affx-88927547 chr28 CM007962.1 11382381 A C 135 Affx-88946147 chr28 CM007962.1 11414120 G A 136 Affx-88938817 chr28 CM007962.1 11414342 C T 137 Affx-88953900 chr28 CM007962.1 11414399 A G 138 Affx-88947402 chr28 CM007962.1 11487704 C T 139 Affx-88918233 chr28 CM007962.1 11523747 C T 140 Affx-88940276 chr28 CM007962.1 11537736 T C 141 Affx-88913684 chr28 CM007962.1 11575843 G T 142 Affx-88921970 chr28 CM007962.1 11667915 A G 143 Affx-88945246 chr28 CM007962.1 11704242 A G 144 Affx-88958541 chr28 CM007962.1 11745469 T C 145 Affx-88949728 chr28 CM007962.1 11771654 A G 146 Affx-88961021 chr28 CM007962.1 12063041 T C 147 Affx-88907679 chr28 CM007962.1 12252318 A G 148 Affx-88951316 chr28 CM007962.1 12259307 G T 149 Affx-88930743 chr28 CM007962.1 12593967 G T 150 Affx-88941593 chr28 CM007962.1 12700154 T C 151 Affx-88948678 chr28 CM007962.1 12735308 C T 152 Affx-88912846 chr28 CM007962.1 12847942 A C 153 Affx-88915764 chr28 CM007962.1 12982469 C T 154 Affx-88905807 chr28 CM007962.1 13010185 C A 155 Affx-88948195 chr28 CM007962.1 13365774 A C 156 Affx-88937868 chr28 CM007962.1 13877922 A G 157 Affx-88929314 chr28 CM007962.1 13927035 A G 158 Affx-88919686 chr28 CM007962.1 14120232 G T 159 Affx-88948530 chr28 CM007962.1 14551487 C T 160 Affx-88911474 chr28 CM007962.1 14570553 C T 161 Affx-88944645 chr28 CM007962.1 18046487 C T 162 Affx-88952966 chr29 CM007963.1 12570007 C T 163 Affx-88904400 chr29 CM007963.1 17738627 T G 164 Affx-88914995 chr29 CM007963.1 38728561 T C A = Adenine, G = Guanine; C = Cytosine, T = Thymine. Affymetrix ID is a unique identifier given to each SNP by Affymetrix, the provider of a commercial genotyping assay which incorporates many of the SNPs listed in the table; the Affymetrix ID serves as a link to further details pertaining to the SNPs, provided in a file which can be downloaded from http://www.affymetrix.com/estore/. Chromosome indicates on which chromosome the SNPs are situated. GenBank contig is the name of a GenBank DNA contig (a genome sequence from rainbow trout) wherein the SNP resides, and the position is the position of the SNP within this contig. SNPs in bold are of particular interest. All of these SNPs are located within a genomic region of 1.9 megabases on chromosome 28 (FIG. 1b), have a p-value lower than 3.12e?7 (FIG. 1b) and show varying degree of elevated squared correlations to each other (FIG. 3).
(42) TABLE-US-00004 TABLE2 NucleotidesequenceforeachSNPincludingthepolymorphicsite.Thepolymorphicsiteandthe correspondingallelicvariantsareindicatedinbrackets.ThecolumnlabeledNucleotidesequence includingSNPsiteprovidesareferencenucleotidesequenceforidentificationoftheSNPwithin thegenomeofarainbowtrout.ThesequencesSEQIDNO:1to164areeachpolymorphicsequences includingapolymorphicsite.SNPsinboldareofparticularinterest.AlloftheseSNPsare locatedwithinagenomicregionof1.9megabasesonchromosome28(FIG.1b),haveap-valuelower than3.12e-7(FIG.1b)andshowvaryingdegreeofelevatedsquaredcorrelationstoeachother (FIG.3). SEQ Late Normal ID maturation maturation SNP# NO NucleotidesequenceincludingSNPsite allele allele 1 1 AGTATATGATGATTCAATGAGATACAGTAC[C/T]TTACACTTTATTGCCCATTTCCATGAAAAT T C 2 2 TCAGTCCATAAGTAATGCAAAGATCAAAGT[A/C]ATTCTACAGAAACCGATTGGGCAGACTAAC A C 3 3 AGTACAAACAGAGATGTGTTATGTTAGACA[A/G]CTGAAGTGAACCGCTACACCTGCTTGGTGC G A 4 4 GAGTGCAGTGGATAGAGACAGCTCCTCAGT[A/G]CATAAAGGCCCACCTGTCCTGGGGGAAGAT A G 5 5 TACTATAATCGGGGACAGTGACATGCATCG[A/G]CCCACAAAGTTTTTAAGACTGCAGTTATGT A G 6 6 GGAACCAGTCACTGTCTCACTACATTTTCA[C/T]GTGGCAGTTTTGTCTTCCACCGTGCAAGCC C T 7 7 TTGGTTCTTGCAACTCTATAGCTCTGGGTC[C/T]TTCCCTTACCTCGGCACGGCAGCCAGTCAG C T 8 8 CTGTATAAAGTTGTTACTGCAGGTACAGGC[A/C]GTGATGCTGAGACTCTTCTGCCAAGACACC A C 9 9 ATCGTACTGAGCTTGTTGTCATTGCAGGCA[A/G]TCTCAACTCTGTGCATTACACTGAAGACTT A G 10 10 AGACAGATCATCAAAAGCTTTTATTCTGAT[C/T]AAGTTCAGTAGTTTGTTTAGGACACTGAAA C T 11 11 TGACCTGCAGCTATGCACCATAATCTAGCA[A/G]GTTCATTTGAACACCCTTTGAAAAGGTAAT G A 12 12 TCTATACTACGGTCTATTGCCTATTTTTAA[C/T]GTATCTTTAATTTCGTATCCCAGTTATTAG T C 13 13 TTACCATACTAACTTGTAGGGCTGAGCAAT[A/G]TATTTTGAATACAGGCACAGAGCCACATAC A G 14 14 CTACACTAAAATGCAATTTGATCTGGACAG[A/G]TTGTCTGTTATGCTATTGCAGTGTTATGAC A G 15 15 CACTACCTGATGCAGTCCCAGTTTGTGATT[G/T]TTATCTGCAGAAACTCAAATATAAATTCCA G T 16 16 GACGCTGCTGTTCCTGCTGCTGCCACCACA[A/C]CCATTTCCTCTCGTCATGAGCAAAAGCTAT A C 17 17 AGGTACCCTGCACTACATTCCTAGCGCGAC[C/T]AGAGGATGGTATAGAAAATGTAATGGTATA C T 18 18 TCTCTGAGTGAGATCAAGAACGGTTCGGTT[A/G]TCTACGACTGTTGGGGCCACTTCATAGAAC G A 19 19 TGCAGATATGAACAGCTTGAGTAAAAAGAT[G/T]ATGTTACCCACTGAACATCAATGAACAAAT T G 20 20 CAAAGGGACTTATCTTCTCCCAAAAGACAA[C/T]GGGCCGATCATTTAACGAATCTTCTCTTGA C T 21 21 CTGCGACATGTTTTGAGTTAGCGTAATTTC[A/G]TACTAAAGATTGGAGAAGTGTGCCTAATTA A G 22 22 TTCGCCTTCACCCTGAGTTAGGACGGCTCC[A/G]AGCCCCATATTTGAGGCGTCTACCTGCACA A G 23 23 AATTGACTAACAATATTGTCTAACAAGTGC[A/G]GTATAAATAAATCCATCCTTCTCATCCTCC A G 24 24 GTATGGTTTTGAAGAGTACAACTGTGTGAG[G/T]GTGGATTGAACAAAATAGTATCTTAAACAC G T 25 25 TAAACAGCAGTTGAACGAGCTGGGCAGCGA[A/G]TCGGCCAAGATCAAGGCCATGGGCATCACC G A 26 26 GATGCGTCCCTCCAACACAGTGCATCTGCT[A/G]GTTTTGTGTGAGGACCACAGAGCCGGCATG G A 27 27 GTGCGGCAGGCGGCAGTGGTGGACAACTTC[A/C]TGTCCCAGCAAGAGAAGAAGCAGAAACACC A C 28 28 GCCTGCAGATGTTCCTCACGTGATGTGATG[A/G]CCTTTTAACTGGGCGTCCTTTGAATATAAG A G 29 29 ACGTGCCTTTTGATGGTTATTACTAGACCG[A/C]TTATTGTACCTGCCCTATTGATCAACCGGA C A 30 30 GACATAGGGACGTTTCCACATGAAGTGAAT[C/T]GGAAAAGCATACACTTACATGACTTTCAAT T C 31 31 ATCAGATTCTCCAAAAAGGTCCAGGGGAAA[A/C]AGTTTGCTGCTTTTGTTGGATATTTTTACA C A 32 32 ATGAGTGATATTACAGTTTGTCCTTCAGAT[G/T]AAACAATTGAGGAGCCAACTATGTGTAATC G T 33 33 GCATAAAGTTGATACAATTCACACAAAGTC[C/T]TTGTCGGGGGACTCCAATCCTCTGTGTTTC T C 34 34 ACACACTGCAGAGTAAACAGCAAACACTGA[A/G]AAAGCTGCACCCAGACTGGCATTCACACAC A G 35 35 TGCTCTGAGAAGGGGGTTCTGATTTCTGTC[C/T]ACAGGGGGCTCCCTCCTGCCTATCCAACGA T C 36 36 CTGTAGTATCTGGAAGCCTAGGCCCAGTAG[A/G]ATAGTGTTCTTATTCCCTATGGAGCGCATC G A 37 37 ATGAGATATGAATTAGACCTAAAGGCCTCA[A/G]CATGCTTCAGTTTTGCTGGTGCCTAGCTTG A G 38 38 CTTGAGTATGTGTGTTCCATTAGAGTGTAT[A/G]CAGAGTGTGTCGCTCGCACAGACAGATTGG A G 39 39 TGTGATTCGATTTTGTAGCTACAACAAGCG[A/G]TGGCTCAAAACCAACCTACACATTTTCAGT A G 40 40 ACAAATACAACGGGATGGAGTGCTCGTCTC[A/G]TCACATAATGTTCCCTGGCAGTGCTTCGTT A G 41 41 GTTGACCTTCTTGTTGGTGGTGAAATCGCA[A/G]TCTGTGCACTGGTACTTCTTCTTGAAGATG G A 42 42 GTCTTAACTGCAAATGTGAGCTTAAATCGG[C/T]TTTCAGCTCCCATGTATTACGGTATTCAAA T C 43 43 GGGAATGGATTGTAGCAGTGAAGGAGGAGA[G/T]TTATTGGTTTAGAGCTACACCAAGGAGCAC T G 44 44 AACAGTAAATAGAGCCTGAGATGACTCAAA[G/T]GTCTGATACATGGAGGCAGACTCCTTTCCA G T 45 45 AAGAACTGTCTGACCGGAACCACTCACACA[G/T]AAAACAGAGAGGCCCGAAGAGATACTGTTG G T 46 46 TCGTAGCATGTCTGTGTTCCTGGTGAAGAA[C/T]CTTCCAGCGGGAGTGACGGTGGAGAACCTG T C 47 47 TCACAAAATATGTATACAAGTGTAACCATG[C/T]TGGTTTTGTGGTAATATGTCATGTGTATCT C T 48 48 CGGTAAAGCCAATGGGAGCGTCCTTAACCT[A/C]AATCAGCCGGGCTACAATCACCACAACCTC C A 49 49 ATATTAGTAATCTCAAGCCATATTCATACA[A/G]TTTTGTTGAATAGGAAATACGTCATATAAT G A 50 50 GAATGGACAATGAAGTGGTATTCATTTCTA[C/T]GGGGATATTCACGGTTCTAAAAATAATGAC T C 51 51 TCTGTCAACGGTCTTCCAAAACAGTATGAC[G/T]GAATCAACAGCAGGGCTGAAACTGACTAAC G T 52 52 AAAGAAACACGTCACATTTCTAATGATCCA[A/G]CAATCACACTTGGAGGTGTCCATATCCCAC G A 53 53 TTTCATGGCAATAAATAGAAGTTGGAGAAC[C/T]CTGAGAATGTTGGAGAACCCTGAGAATGCT C T 54 54 AAAGCCATAGATAGGATATAGGCCTACCTC[C/T]GACACAGAACTGACTGAGTGTCAGTCAACT C T 55 55 CTTTAAAGTCCCTTGTCCTACATATAGTCT[C/T]TAGCTTGTAAAAAGCCCACAATACAGAGTT C T 56 56 ATTGCAGTCTCCATTCTGGCTCTGTATCCT[G/T]TTCTCACGGAAGCCACGGTGATTTTTATAG T G 57 57 GCATGGCTTTCTGTGGCTATATTTGGGGTT[A/G]TCTCAGTCTCCAAAAATCTCTCTGAAATAA G A 58 58 CATAGTTTATTGTTGCGGACAATAACTTGC[C/T]CTCACATTAAAACTATAGTCTCTCTTACGT T C 59 59 CATTTTGGATGCATCTGAAGTCATCAGTCG[C/T]CGTATCAACAAAGGGCTTTTTATTGACTGT T C 60 60 AACTCGGTATTAGGGAAGCAAGCAGGACAA[A/C]ATGGGTTTGGATGCGGGTGAACTAACGTGA C A 61 61 ACAATGATTACCTTCAAAAAATAATGAATA[G/T]ATTATGTTTTTGCATTTGTAACTGAGCTCA G T 62 62 TCTCATTGACACCCACTGTGCTCTGTAAAT[G/T]ACTTGATTGTTTGAAGTAAGGCATACTAGG T G 63 63 GAGAGTGGTAATATCAGCAGCAGAAGCAAC[A/G]CGGTTTCCTGCTGTCCTTACTGTCGAGAGA A G 64 64 CACCACAAACCCTAGACGTATTATGAATAG[A/G]ATAAAATTTAGAGTAGGTCTCAAATTTAGG A G 65 65 ACAGGTGGTGGTAACAGAATATTCATTAAG[A/G]TTGCTACTGGCTTTTCAACTAATTCTTAGT A G 66 66 GGAGCATAGAGCAGATGATGAGAAAGGAGA[G/T]GATGTTCTGATTGAACCAACCCCTTTTGAC G T 67 67 TTTGCTGCCAATGTCATGATTGATTCAATG[C/T]ATTCGGTGCCAGTTTAGAGCTTCGTTACTC T C 68 68 ATCTCAGGGTTATAAAGGTAGAAAGGCACT[A/G]TGGGTTCAATTTTGGAAAACAAAAGGAGAG G A 69 69 TTGTTCCACATGCCTGGATGCCACACAGCA[C/T]TAGATTTTCACTGCTGCAGATACCGGTATG C T 70 70 GACTGAATTGAAATGGTATTGACCCCAAAC[A/C]TGAGAGGGAAGCATCAATACAAAAGGCACA C A 71 71 CGACACAGCTGCCGTTTGGACTGCAGCCTT[A/C]AACAGTTTGACAGTTTTTGGTGTTTCTCGT A C 72 72 TGCGGTGGGTGTCTTTGTGGTGTTTCTGGC[C/T]GTCCTCTTCCTCTTCATCAATAAGAAGCTG C T 73 73 TTGTGATTAAGTAGAGGGTCACTCTGAGTA[A/G]AACAGTGCTTCATTAGACTCAAGCCTAAAA G A 74 74 TGGATCAACCATTTGTTCCAAATTCCACTT[G/T]AATGATGTAAAAGGTGTCCGCCTGCCTGCG G T 75 75 ATGTAGCATTATGTCAGACTTTCGTCAAAA[G/T]CAGTTCAAAAGGAATGGGTGCAGTGACCCT T G 76 76 GTTCCAATGGTACATTTGAGTAAATAACTT[A/C]GTTTTTACAATATTGTTTATCATTTAGTCT A C 77 77 AGAAAACACTGCCAGTTGGTTACCAACCCG[G/T]CCCATGTCCAGCTCAAAAATATGTTTTGTC T G 78 78 TGTTGTCATCCTCGTCAGAGCTGTGGACTT[C/T]CTCCTCAGAGTGAGCATCATCCAATCCATG T C 79 79 CATATACTGTTTTTATAAACTCACTGTGAT[A/G]TCCAGCTTCTGCAGAGCAAAAAGCTGGTGA G A 80 80 AAACCGTCTTTTAAGTGTTGATGACATCAG[A/G]GAGAGAATTCATTAATGATCAGAGGTACTT A G 81 81 AAGTCATTTTGGCTGTCCTGACAAGCTTTG[A/G]GTTTTAATTTTGAGGATGCCTTGGAGGACT A G 82 82 GGAATGATATTAAAGGAATTGTTGTGAGTT[G/T]TAAATGTGTTTCTTAATATGTGTATGTGTC G T 83 83 CACCTACGGATGGTACACACAATTATGACA[A/T]ACTTCTCAACTATCATTACCTCAGCCGCTA A T 84 84 CTTTCTAGCATAGCGTCGCCCACCTGCAGC[A/G]AAGCCGTCAAATATCCTGTTCTTCCTCAGG A G 85 85 AAAAGATTAATTGAGAAATAGCCATGGTAT[G/T]CTGATTTATTACTGACGTAACGGTCTCCTC T G 86 86 TAAGGCGTAGTGGTGCACTAATGGGGGAAC[A/G]CGCACTACATCTTGGACCAGAGATAGAGGG A G 87 87 AGGTGTGACTGACTGACTGAAGTGTAGGTG[C/T]GAGTGAGTAACTGAATAAGAAGGTACTGTA C T 88 88 CTGTTGTGAAGGTAACTCACACGTATGTAT[G/T]TATGTAGACAAAATACTGTCATGAGTTACA G T 89 89 ACTAAAAAATACAACAGAACATCTTCCTTT[A/G]GATTCTTAAAACCAACAAACTGGGCTTTAG A G 90 90 CACATGCTACAATGAGTTACTCTATGAACC[A/G]AACACATTACTGTCAAGTAAATTGTCTCCC A G 91 91 ACTGGACTATTTGACATGAACCTATTACCT[C/T]ACTCTCTCTCTCCCCTGACCTCCCTACCTC T C 92 92 GTGTGTGCTATACGACGTCCTCAGCGTAGT[C/T]AAGGAGAAGAAGTACATGGCCCTGGACCCA T C 93 93 ACAAATCCACGTTGATTTGACTCGCACGGC[A/C]AGGAGTATGACGCTGATAGTAAGATTATTT C A 94 94 AAGACGGTAAATCACATCAAGTTTAGATGT[C/T]GAGTGTCTGAATACTGAGGAAGTATGTCTT T C 95 95 GCATCGCTGCAGGTAAAATGAGAACCTTCA[A/G]GTTGTTTTTCATTGGGCTCATCTTCATCAT A G 96 96 CCTTCCTCACTTTCTACTTCGACTATCGCT[C/T]TCTGTCACACGCTCGTGCACACAGAATGCA C T 97 97 CATTCAAATAGGCCAAAAGTTTACATACAC[G/T]TTTTTCTCTTTTTGCAAAGCTAATCGCTAA T G 98 98 GCCTAGAATAAGCATAGATGAGATATCTTC[A/G]TCGTCTCATCAAAACATTTTGGTATTGTGC G A 99 99 CAGGTTGTCTTTGTTGAGCTTGATGAGGGC[A/G]GAGTAGAGCTCTGAGGCTCGGCCCATGCCC A G 100 100 TTGATGTAGTCTATTCCTGAAATACAAGGG[A/G]GATGACAATATAAATCATGCAGTTATGTTT G A 101 101 CAGTACAGACAAGATTTATCGATAGCATTT[C/T]ATGTATGTAACAGGAGACTGTTTATATTTC C T 102 102 CTGTGCTCGAAGCTAGCAATCACTGATAAA[G/T]CAAATAACAAGCTTTTTCTGAAAACCTTTA T G 103 103 CATTAAACCACTGATGACAACAAATATGCT[A/C]ATTTCCCCATGTCTCTGTAATGTCATCCTC A C 104 104 AACATGCAAGGCTATAACTCCCCAGCAGGA[A/G]AGAGAGGGGCTTTTACCACTCCATCAAGTC G A 105 105 AAGTATGATTCCAAATTGAACTGCAGGTGA[C/T]GCAATGCAACTCATTTCAAGCCTGCACTCA C T 106 106 GACAGTTGAATTTAACAGGTGAACATTACA[A/G]TTGATATTTTACATTGCATCATGTATGCAA G A 107 107 ATATCTATACTCCTATTAGTGAAATTGGAA[C/T]ATTATCTAGGCCTACCTACAATCATGGATT C T 108 108 AGGCCCAATACATTCTGAGATACAGGGTCC[A/C]AAGGTCTAAAACTAATAGTTCAAAACTTTC C A 109 109 CTCATTATTTCACTTGAAAGGTTTTTCCCC[C/T]GTATCACCTTTCAGTGCACAATTTAAAGGA C T 110 110 TGTATGTGTGTCTTGAAAGGTCAGGAGCTT[A/C]ACAGAGGGACTGACATTCACTGAGACCAAC C A 111 111 TTCATTTCAACACCAAGCAGCAGATCAGCT[C/T]AGAACATAAACATAAAACACCACAGTGACC C T 112 112 CATTTGCAAATGCACACTAGAAAATTTGAG[C/T]CTGGTCTGACCTAGCCCGAGCCCTACCCGA C T 113 113 ATAGCTACCATTTTGGCCCCATTACGGAAA[C/T]GTTAAGGTTTATGATATCTCCTCTAGTAAT T C 114 114 GGAGAAAGAACTTAAAAAGATCAAGAACAG[C/T]ACCAATAATGCTGGGACTCCCACCAAAACA T C 115 115 CTGAGACTGTTAAGGAAGAGGAGGTGAAAA[A/G]GGAAGAAAAGCCCCTACAGTTGATTAGGGG A G 116 116 TACTCGGTATTCTCTTTAAACTACTTCCCT[A/G]TATCCCCTTCTGGTGAGCTTGGGACAGAAA G A 117 117 AAATCATCTAAAAAGCAAGATATGAAATTG[A/G]AAATGCATTCACATTTCACAGATCGTCGTC A G 118 118 GTTCATCAAAGCTCGAATTTTCCTAGTAGC[A/G]AGCCGGGACTTGGAGGTAAAACTGCAGTCT A G 119 119 CAATTAACAGAAACTGAGTCAATTCAAAAC[G/T]TTAGTTAGAGAAATTGCACATAAAAACACA T G 120 120 CCTCAACTCTCTCCCAACACAATCTTTTCC[A/C]CACTTTTTCAAATTGGATTTATTCCCAAGT C A 121 121 CACCAATACTTGGTCACCTGGCTGTAGTGG[A/C]CAAGAAAAAGCCTGTTTATCATTGTGTCTT A C 122 122 GTTGTCCAGCCCAAATTACAGTTTTGTATT[A/C]TCTGTGTGACGAAAAGTATACAATTTCGAT C A 123 123 TTCTCAGGGTCCATCATGGCGATCTCTGCA[A/G]TGGGTACTCAGTGGGTCCAGCTGCATGGTG G A 124 124 CATCAATTCCCCTGCAAGACCACAGAAAGT[G/T]ATTTGCCTTGTATTTTGCAAAGACCAAACT T G 125 125 CTGTTTGTACTGGAGAGCCATGTAATCCTA[G/T]ATCCTGTACTATCTATCCTCTTATTGTTTA G T 126 126 GGAGGTGTTCTTTACAGGGGACGAGGAGGA[A/G]GAGCTGTCTGAGAGAAAGTCCCAGAGAAAT G A 127 127 GCCCGAACGTCCTGTCCTCTATCCGCGTCA[A/G]GGTGTTGAAGGACAAATCCAGGTAAGCAAG A G 128 128 AGGCGAATGGCAGCGTCAGTAAAGTTATGT[C/T]TCTCCCTCTCAAAGTTCCTCCTCTGCTCGT C T 129 129 GTCTAATGAACACTGCCGTGGATTGTCATC[C/T]GAGTTGTCTGTTGAGTCCACAGTAACACAA C T 130 130 ATACTCTGCTAAAATTAGAACTGACCAGTT[G/T]ATTTTTTTTACATGATACATGATAATAATG G T 131 131 GTTGAATTTGGTCATATAAGGAAATGTGCC[C/T]TACTGCCTTTCGAATTTTGTGAAACTTAAA T C 132 132 GATACAGTCTGCATTTCAACAGGCTGCATT[G/T]TATTGCACCACACCCTGCTGTTATCAGATA T G 133 133 GGAAAATGTAACAACCAAACAGGACAGCAC[G/T]CGGTCTGTTGATGTTACAGGCAGCTCAGCT T G 134 134 CCATATTTCTTTGTTGTTGTTTGGAATAGT[A/C]TCCTACTCGAAAAAATATGCATTTGTATTT A C 135 135 GCCAGCGGGTCGGCACAGCCTAGTCATGCG[A/G]TCACAAGCCATTCAGTCTGGTCGCAGTCTA G A 136 136 AACAAACTAATCATCTCTAGTGGAGCGCAC[C/T]CGCACCACAAGGGGGGCCTTATCGTCGACC C T 137 137 AACACTGCCCTGCCCACCACAGAGGACATC[A/G]CGCTGTTCACGGATTTAGACCAGGGCAACA A G 138 138 AACTTTGTGTGCGTTCTATCCTTGTTTCCC[C/T]CCTACAGCCAGCGGTAACATCCCGGCCATG C T 139 139 TCAACTGAACAGACAGCAACTTTCCCTCCT[C/T]GTTCATTTCATCTTCACCTGCTTCTTCTTT C T 140 140 AGTGTCGATGCCAAACCCTTGAAAATAGGT[C/T]GGGAAAGGAAATCCTTTCCCTCTAAATATC T C 141 141 ACTAGTGGAGATGAAGGGGACTGGTAATGA[G/T]AATACAGTGACAGTAGGCAGTGTTGTAAAT G T 142 142 TGTACTTGTTTTATTAAAACACAATGCAAG[A/G]CTTAAAACGAACTGTACTGTAGATATAACC A G 143 143 CCGGGTTCTGAACGAATAGGCCTACATAAC[A/G]GGACATGGATTACGATGGGACCGTTACGAA A G 144 144 CATCTCTTTCCTCCACAATGCATACTTGGG[C/T]TTATGCCTTGGGTTGGTGTATCTGAAGACA T C 145 145 AATGGCCTTTGCAACGTGTTCCCAGCACAC[A/G]CTCAGCTCGGGGAGCTTTCTGTGGTCCTCC A G 146 146 TCATTAATGTGTAGTAGCAGTTATTTAGTT[C/T]ATAATAGTGATACAACAATAATACTTCATT T C 147 147 CATTTCCTCGTATCACTAGGAGTTCCTAAC[A/G]TAACAGATGTAAGCTAGTGAGCTGTATGCT A G 148 148 AAATAGGACACCATACCTGGTTGATTTCGT[G/T]TCGGTTGTGTGAAGTCAATGTTGTAAATGT G T 149 149 GAGATTCTAATTATATATTTTTTTAGAGAT[G/T]AATTATTTTGGAGGTTTATATACTCACATA G T 150 150 CATGAATAGTGGCAAAATGTCCTTCAATTT[C/T]GGTAGCTAGATCATAAAATACATTTGTACT T C 151 151 TGGTCACCAGCTGCATTAAGTACTGCAGTG[C/T]ATCTCCTCAGACTGCACCAGATATGTTCTT C T 152 152 AGTTTATTGGCGTAAACATAATCTAGAAGT[A/C]ATTTTCATAATATGCAACAATTGGCATGTA A C 153 153 ACTCTTGAGATTCGGATCAGCCTAGATGGA[C/T]GATTGAAGCTCCAGTCGATGATGAATCAAT C T 154 154 ATTTTCCCTATAATTTTGAAGAAATTGTTT[A/C]TTTAGCTCCTAATTATACACCCAGGTGTAG C A 155 155 GCCGATGGAAACAAGGTTATGGTTAGTGAC[A/C]ATACACAGCGTACCCAGTCTAATCCAAAGA A C 156 156 GAACGGCCTGAACACCATGGACCTCAACAC[A/G]GAGTTCACTGTGGCTCGCCTGGAAGCAATA A G 157 157 CTAAGGAGGAAATGGAGCTTGTCTTGCTAA[A/G]GTCAATGGTGATGTCAATGTCTCCCTCTCA A G 158 158 GATCTTGTACGCTGTCTGTGGGCTCCCTGA[G/T]AAATAATTGTAAGAAGCCTACTGATGCCAT G T 159 159 TCTGCGTCATTCCATCCCTGCCATCACACT[C/T]CTGCTACACTGCATTCTGCGTGTGGTGTAT C T 160 160 AAAAACTGCGTGTTTATCAAATTAGAAATT[C/T]ACAACCATAAAGTTTTGCGTTGACAAAAAA C T 161 161 CTTTGAGCTGGATCCAGTCAAGAAGAAGGC[C/T]AAAGAGAGGATGGTGAAGTCCACCAGCAGC C T 162 162 AAAGCTGCTTCCAGCTGATGGTGTAGTCTA[C/T]GGACAGGTTCGTTACCCATCCACATCTCTC C T 163 163 AGAATAAATGCAATCTTAATGTGAATTTAT[G/T]TATGTTTAGAAACTGCTTACTAATAGGTAA T G 164 164 CTGAATCAAATGCTCTCACTTGCCAGACTT[C/T]GAGGTTGACAGTGCAGCAATGACAAATACA T C
(43) SEQ ID NOs: 1 to 164 has an n at the polymorphic site (position 31; indicated in brackets in table 2), wherein n is either the late maturation allele or the normal maturation allele. SEQ ID NOs: 165 to 328 are identical to SEQ ID NOs: 1 to 164 except that the n at the polymorphic site is the late maturation allele.
(44) According to particular embodiments, the at least one SNP of the invention is selected from the group consisting of SNP #1 to SNP #164 listed in table 1.
(45) According to particular embodiments, the at least one SNP of the invention is located on chromosome 1 and is selected from the group consisting of SNP #1 to SNP #4 listed in table 1.
(46) According to particular embodiments, the at least one SNP of the invention is located on chromosome 2 and is selected from the group consisting of SNP #5 to SNP #12 listed in table 1.
(47) According to particular embodiments, the at least one SNP of the invention is located on chromosome 3 and is selected from the group consisting of SNP #13 to SNP #16 listed in table 1.
(48) According to particular embodiments, the at least one SNP of the invention is located on chromosome 4 and is selected from the group consisting of SNP #17 to SNP #20 listed in table 1.
(49) According to particular embodiments, the at least one SNP of the invention is located on chromosome 5 and is selected from the group consisting of SNP #21 to SNP #24 listed in table 1.
(50) According to particular embodiments, the at least one SNP of the invention is located on chromosome 6 and is selected from the group consisting of SNP #25 to SNP #28 listed in table 1.
(51) According to particular embodiments, the at least one SNP of the invention is located on chromosome 7 and is selected from the group consisting of SNP #29 to SNP #32 listed in table 1.
(52) According to particular embodiments, the at least one SNP of the invention is located on chromosome 8 and is selected from the group consisting of SNP #33 to SNP #36 listed in table 1.
(53) According to particular embodiments, the at least one SNP of the invention is located on chromosome 9 and is selected from the group consisting of SNP #37 to SNP #40 listed in table 1.
(54) According to particular embodiments, the at least one SNP of the invention is located on chromosome 10 and is selected from the group consisting of SNP #41 to SNP #43 listed in table 1.
(55) According to particular embodiments, the at least one SNP of the invention is located on chromosome 11 and is selected from the group consisting of SNP #44 to SNP #47 listed in table 1.
(56) According to particular embodiments, the at least one SNP of the invention is located on chromosome 12 and is selected from the group consisting of SNP #48 to SNP #50 listed in table 1.
(57) According to particular embodiments, the at least one SNP of the invention is located on chromosome 13 and is selected from the group consisting of SNP #51 to SNP #53 listed in table 1.
(58) According to particular embodiments, the at least one SNP of the invention is located on chromosome 14 and is selected from the group consisting of SNP #54 to SNP #57 listed in table 1.
(59) According to particular embodiments, the at least one SNP of the invention is located on chromosome 16 and is selected from the group consisting of SNP #62 to SNP #64 listed in table 1.
(60) According to particular embodiments, the at least one SNP of the invention is located on chromosome 17 and is selected from the group consisting of SNP #65 to SNP #66 listed in table 1.
(61) According to particular embodiments, the at least one SNP of the invention is located on chromosome 18 and is selected from the group consisting of SNP #67 to SNP #69 listed in table 1.
(62) According to particular embodiments, the at least one SNP of the invention is located on chromosome 19 and is selected from the group consisting of SNP #70 to SNP #73 listed in table 1.
(63) According to particular embodiments, the at least one SNP of the invention is located on chromosome 20 and is selected from the group consisting of SNP #74 to SNP #76 listed in table 1.
(64) According to particular embodiments, the at least one SNP of the invention is located on chromosome 21 and is selected from the group consisting of SNP #77 to SNP #80 listed in table 1.
(65) According to particular embodiments, the at least one SNP of the invention is located on chromosome 22 and is selected from the group consisting of SNP #81 to SNP #83 listed in table 1.
(66) According to particular embodiments, the at least one SNP of the invention is located on chromosome 23 and is selected from the group consisting of SNP #84 to SNP #89 listed in table 1.
(67) According to particular embodiments, the at least one SNP of the invention is located on chromosome 24 and is selected from the group consisting of SNP #90 to SNP #92 listed in table 1.
(68) According to particular embodiments, the at least one SNP of the invention is located on chromosome 25 and is selected from the group consisting of SNP #93 to SNP #101 listed in table 1.
(69) According to particular embodiments, the at least one SNP of the invention is located on chromosome 26 and is selected from the group consisting of SNP #102 to SNP #105 listed in table 1.
(70) According to particular embodiments, the at least one SNP of the invention is located on chromosome 27 and is selected from the group consisting of SNP #106 to SNP #109 listed in table 1.
(71) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #110 to SNP #161 listed in table 1.
(72) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #120, SNP #127 to SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 to SNP #144, SNP #146 and SNP #147 listed in table 1.
(73) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(74) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137 and SNP #128 listed in table 1.
(75) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128 and SNP #144 listed in table 1.
(76) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144 and SNP #142 listed in table 1.
(77) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, and SNP #127 listed in table 1.
(78) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127 and SNP #146 listed in table 1.
(79) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146 and SNP #147 listed in table 1.
(80) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147 and SNP #131 listed in table 1.
(81) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131 and SNP #129 listed in table 1.
(82) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129 and SNP #120 listed in table 1.
(83) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120 and SNP #130 listed in table 1.
(84) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120, SNP #130 and SNP #138 listed in table 1.
(85) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(86) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 and SNP #143 listed in table 1.
(87) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143 and SNP #144 listed in table 1.
(88) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144 and SNP #146 listed in table 1.
(89) According to particular preferred embodiments, the at least one SNP of the invention is located on chromosome 28 and is selected from the group consisting of SNP #130, SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(90) According to particular embodiments, the at least one SNP of the invention is located on chromosome 29 and is selected from the group consisting of SNP #162 to SNP #164 listed in table 1.
(91) According to particular embodiments, the at least one SNP of the invention is selected from the group consisting of SNP #127, SNP #128, SNP #135, SNP #137, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147.
(92) According to particular embodiments, the at least one SNP of the invention is selected from the group consisting of SNP #93, SNP #114, SNP #120, SNP #129, SNP #130, SNP #131, SNP #132, SNP #134, SNP #138 and SNP #148.
(93) According to particular embodiments, the at least one SNP of the invention is selected from the group consisting of SNP #5, SNP #24, SNP #86, SNP #121, SNP #125, SNP #126, SNP #133, SNP #141, SNP #150 and SNP #154.
(94) According to particular embodiments, the at least one SNP of the invention is selected from the group consisting of SNP #7, SNP #9, SNP #19, SNP #85, SNP #111, SNP #116, SNP #117, SNP #119, SNP #153 and SNP #155.
(95) According to particular embodiments, the at least one SNP of the invention is selected from the group consisting of SNP #10, SNP #11, SNP #23, SNP #88, SNP #89, SNP #91, SNP #101, SNP #124, SNP #145 and SNP #151.
(96) It is understood that the foregoing disclosure regarding the polymorphisms of the invention, and in particular regarding SNPs and late maturation allele(s), is applicable to the following aspects.
(97) Methods for Predicting
(98) The present invention provides in a first aspect, a method for predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising determining the presence of at least one allele conferring late onset of sexual maturation (late maturation allele) within the genome of said rainbow trout; wherein the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the SNPs listed in Table 1.
(99) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 1 and being selected from SNP #1 to SNP #4 listed in table 1.
(100) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 2 and being selected from SNP #5 to SNP #12 listed in table 1.
(101) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 3 and being selected from SNP #13 to SNP #16 listed in table 1.
(102) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 4 and being selected from SNP #17 to SNP #20 listed in table 1.
(103) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 5 and being selected from SNP #21 to SNP #24 listed in table 1.
(104) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 6 and being selected from SNP #25 to SNP #28 listed in table 1.
(105) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 7 and being selected from SNP #29 to SNP #32 listed in table 1.
(106) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 8 and being selected from SNP #33 to SNP #36 listed in table 1.
(107) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 9 and being selected from SNP #37 to SNP #40 listed in table 1.
(108) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 10 and being selected from SNP #41 to SNP #43 listed in table 1.
(109) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 11 and being selected from SNP #44 to SNP #47 listed in table 1.
(110) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 12 and being selected from SNP #48 to SNP #50 listed in table 1.
(111) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 13 and being selected from SNP #51 to SNP #53 listed in table 1.
(112) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 14 and being selected from SNP #54 to SNP #57 listed in table 1.
(113) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 15 and being selected from SNP #58 to SNP #61 listed in table 1.
(114) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 16 and being selected from SNP #62 to SNP #64 listed in table 1.
(115) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 17 and being selected from SNP #65 to SNP #66 listed in table 1.
(116) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 18 and being selected from SNP #67 to SNP #69 listed in table 1.
(117) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 19 and being selected from SNP #70 to SNP #73 listed in table 1.
(118) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 20 and being selected from SNP #74 to SNP #76 listed in table 1.
(119) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 21 and being selected from SNP #77 to SNP #80 listed in table 1.
(120) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 22 and being selected from SNP #81 to SNP #83 listed in table 1.
(121) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 23 and being selected from SNP #84 to SNP #89 listed in table 1.
(122) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 24 and being selected from SNP #90 to SNP #92 listed in table 1.
(123) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 25 and being selected from SNP #93 to SNP #101 listed in table 1.
(124) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 26 and being selected from SNP #102 to SNP #105 listed in table 1.
(125) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 27 and being selected from SNP #106 to SNP #109 listed in table 1.
(126) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from SNP #110 to SNP #161 listed in table 1.
(127) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #120, SNP #127 to SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 to SNP #144, SNP #146 and SNP #147 listed in table 1.
(128) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(129) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137 and SNP #128 listed in table 1.
(130) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128 and SNP #144 listed in table 1.
(131) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144 and SNP #142 listed in table 1.
(132) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, and SNP #127 listed in table 1.
(133) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127 and SNP #146 listed in table 1.
(134) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146 and SNP #147 listed in table 1.
(135) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147 and SNP #131 listed in table 1.
(136) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131 and SNP #129 listed in table 1.
(137) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129 and SNP #120 listed in table 1.
(138) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120 and SNP #130 listed in table 1.
(139) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120, SNP #130 and SNP #138 listed in table 1.
(140) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(141) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 and SNP #143 listed in table 1.
(142) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143 and SNP #144 listed in table 1.
(143) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144 and SNP #146 listed in table 1.
(144) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #130, SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(145) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 29 and being selected from SNP #162 to SNP #164 listed in table 1.
(146) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #127, SNP #128, SNP #135, SNP #137, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(147) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #127, SNP #128, SNP #135, SNP #137, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #148 listed in table 1.
(148) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #5, SNP #24, SNP #86, SNP #121, SNP #125, SNP #126, SNP #133, SNP #141, SNP #150 and SNP #154 listed in table 1.
(149) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #7, SNP #9, SNP #19, SNP #85, SNP #111, SNP #116, SNP #117, SNP #119, SNP #153 and SNP #155 listed in table 1.
(150) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #10, SNP #11, SNP #23, SNP #88, SNP #89, SNP #91, SNP #101, SNP #124, SNP #145 and SNP #151 listed in table 1.
(151) A preferred embodiment according to the first aspect of the present invention relates to a method for predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the presence of at least one allele conferring late onset of sexual maturation (late maturation allele) within the genome of said rainbow trout; wherein the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being SNP #140 listed in table 1 wherein the presence of a thymine at the position corresponding to position 31 of SEQ ID NO. 140 indicates that the rainbow trout has late onset of sexual maturation.
(152) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 164, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 164 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(153) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 4, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 4 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(154) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 5 to 12, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 5 to 12 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(155) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 13 to 16, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 13 to 16 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(156) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 17 to 20, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 17 to 20 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(157) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 21 to 24, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 21 to 24 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(158) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 28, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 25 to 28 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(159) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 29 to 32, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 29 to 32 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(160) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 33 to 36, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 33 to 36 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(161) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 37 to 40, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 37 to 40 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(162) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 41 to 43, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 41 to 43 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(163) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 44 to 47, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 44 to 47 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(164) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 48 to 50, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 48 to 50 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(165) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 51 to 53, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 51 to 53 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(166) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 54 to 57, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 54 to 57 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(167) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 58 to 61, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 58 to 61 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(168) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 62 to 64, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 62 to 64 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(169) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 65 to 66, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 65 to 66 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(170) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 67 to 69, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 67 to 69 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(171) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 70 to 73, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 70 to 73 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(172) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 74 to 76, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 74 to 76 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(173) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 77 to 80, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 77 to 80 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(174) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 81 to 83, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 81 to 83 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(175) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 84 to 89, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 84 to 89 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(176) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 90 to 92, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 90 to 92 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(177) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 93 to 101, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 93 to 101 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(178) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 102 to 105, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 102 to 105 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(179) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 106 to 109, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 106 to 109 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(180) According to certain particularly preferred embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 110 to 161, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 110 to 161 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(181) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 162 to 164, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 162 to 164 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(182) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs:127, 128, 135, 137, 140, 142, 143, 144, 146 and 147, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 127, 128, 135, 137, 140, 142, 143, 144, 146 and 147 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(183) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 93, 114, 120, 129, 130, 131, 132, 134, 138 and 148, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 93, 114, 120, 129, 130, 131, 132, 134, 138 and 148 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(184) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 5, 24, 86, 121, 125, 126, 133, 141, 150 and 154, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 5, 24, 86, 121, 125, 126, 133, 141, 150 and 154 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(185) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 7, 9, 19, 85, 111, 116, 117, 119, 153 and 155 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 7, 9, 19, 85, 111, 116, 117, 119, 153 and 155 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(186) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 10, 11, 23, 88, 89, 91, 101, 124, 145 and 151, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 10, 11, 23, 88, 89, 91, 101, 124, 145 and 151 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(187) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 120, 127 to 131, 134, 135, 137, 138, 140, 142 to 144, 146 and 147, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 120, 127 to 131, 134, 135, 137, 138, 140, 142 to 144, 146 and 147 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(188) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143 and 137, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143 and 137 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(189) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137 and 128 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143 and 128 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(190) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128 and 144 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 128 and 144 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(191) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144 and 142 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144 and 142 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(192) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142 and 127 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142 and 127 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(193) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127 and 146 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127 and 146 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(194) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146 and 147 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146 and 147 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(195) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147 and 131 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147 and 131 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(196) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131 and 129 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131 and 129 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(197) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129 and 120 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129 and 120 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(198) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120 and 130 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120 and 130 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(199) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120, 130 and 138 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120, 130 and 138 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(200) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143 and 137 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143 and 137 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(201) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 135, 137, 138, 140, 142 and 143 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 135, 137, 138, 140, 142 and 143 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(202) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 134, 135, 137, 138, 140, 142, 143 and 144 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 134, 135, 137, 138, 140, 142, 143 and 144 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(203) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 131, 134, 135, 137, 138, 140, 142, 143, 144 and 146 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 131, 134, 135, 137, 138, 140, 142, 143, 144 and 146 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(204) According to certain embodiments, the present invention provides a method of predicting late onset of sexual maturation in rainbow trout (Oncorhynchus mykiss), the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 130, 131, 134, 135, 137, 138, 140, 142, 143, 144, 146 and 147 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 131, 134, 135, 137, 138, 140, 142, 143, 144 and 146 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences.
(205) The rainbow trout has late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the respective SNP. The late maturation allele of each SNP is specified in Table 1.
(206) Methods for Selecting
(207) The present invention provides in a second aspect, a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising determining the presence of at least one allele conferring late onset of sexual maturation (late maturation allele) within the genome of said rainbow trout; and selecting said rainbow trout as having late onset of sexual maturation when the at least one late maturation allele is present; wherein the at least one late maturation allele is an allele of at least one SNP, the at least one SNP being selected from the SNPs listed in Table 1.
(208) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 1 and being selected from SNP #1 to SNP #4 listed in table 1.
(209) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 2 and being selected from SNP #5 to SNP #12 listed in table 1.
(210) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 3 and being selected from SNP #13 to SNP #16 listed in table 1.
(211) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 4 and being selected from SNP #17 to SNP #20 listed in table 1.
(212) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 5 and being selected from SNP #21 to SNP #24 listed in table 1.
(213) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 6 and being selected from SNP #25 to SNP #28 listed in table 1.
(214) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 7 and being selected from SNP #29 to SNP #32 listed in table 1.
(215) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 8 and being selected from SNP #33 to SNP #36 listed in table 1.
(216) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 9 and being selected from SNP #37 to SNP #40 listed in table 1.
(217) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 10 and being selected from SNP #41 to SNP #43 listed in table 1.
(218) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 11 and being selected from SNP #44 to SNP #47 listed in table 1.
(219) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 12 and being selected from SNP #48 to SNP #50 listed in table 1.
(220) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 13 and being selected from SNP #51 to SNP #53 listed in table 1.
(221) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 14 and being selected from SNP #54 to SNP #57 listed in table 1.
(222) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 15 and being selected from SNP #58 to SNP #61 listed in table 1.
(223) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 16 and being selected from SNP #62 to SNP #64 listed in table 1.
(224) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 17 and being selected from SNP #65 to SNP #66 listed in table 1.
(225) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 18 and being selected from SNP #67 to SNP #69 listed in table 1.
(226) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 19 and being selected from SNP #70 to SNP #73 listed in table 1.
(227) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 20 and being selected from SNP #74 to SNP #76 listed in table 1.
(228) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 21 and being selected from SNP #77 to SNP #80 listed in table 1.
(229) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 22 and being selected from SNP #81 to SNP #83 listed in table 1.
(230) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 23 and being selected from SNP #84 to SNP #89 listed in table 1.
(231) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 24 and being selected from SNP #90 to SNP #92 listed in table 1.
(232) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 25 and being selected from SNP #93 to SNP #101 listed in table 1.
(233) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 26 and being selected from SNP #102 to SNP #105 listed in table 1.
(234) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 27 and being selected from SNP #106 to SNP #109 listed in table 1.
(235) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from SNP #110 to SNP #161 listed in table 1.
(236) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #120, SNP #127 to SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 to SNP #144, SNP #146 and SNP #147 listed in table 1.
(237) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(238) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137 and SNP #128 listed in table 1.
(239) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128 and SNP #144 listed in table 1.
(240) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144 and SNP #142 listed in table 1.
(241) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, and SNP #127 listed in table 1.
(242) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127 and SNP #146 listed in table 1.
(243) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146 and SNP #147 listed in table 1.
(244) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147 and SNP #131 listed in table 1.
(245) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131 and SNP #129 listed in table 1.
(246) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129 and SNP #120 listed in table 1.
(247) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120 and SNP #130 listed in table 1.
(248) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120, SNP #130 and SNP #138 listed in table 1.
(249) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(250) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 and SNP #143 listed in table 1.
(251) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143 and SNP #144 listed in table 1.
(252) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144 and SNP #146 listed in table 1.
(253) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #130, SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(254) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 29 and being selected from SNP #162 to SNP #164 listed in table 1.
(255) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #127, SNP #128, SNP #135, SNP #137, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(256) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #127, SNP #128, SNP #135, SNP #137, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #148 listed in table 1.
(257) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #5, SNP #24, SNP #86, SNP #121, SNP #125, SNP #126, SNP #133, SNP #141, SNP #150 and SNP #154 listed in table 1.
(258) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #7, SNP #9, SNP #19, SNP #85, SNP #111, SNP #116, SNP #117, SNP #119, SNP #153 and SNP #155 listed in table 1.
(259) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #10, SNP #11, SNP #23, SNP #88, SNP #89, SNP #91, SNP #101, SNP #124, SNP #145 and SNP #151 listed in table 1.
(260) A preferred embodiment according to the first aspect of the present invention relates to a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the presence of at least one allele conferring late onset of sexual maturation (late maturation allele) within the genome of said rainbow trout; and selecting said rainbow trout as having late onset of sexual maturation when the at least one late maturation allele is present; wherein the at least one late maturation allele is an allele of at least one SNP, the at least one SNP being SNP #140 listed in table 1 wherein the presence of a thymine at the position corresponding to position 31 of SEQ ID NO. 140 indicates that the rainbow trout has late onset of sexual maturation.
(261) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 164, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 164 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(262) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 4, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 1 to 4 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(263) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 5 to 12, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 5 to 12 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(264) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 13 to 16, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 13 to 16 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(265) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 17 to 20, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 17 to 20 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(266) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 21 to 24, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 21 to 24 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(267) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 28, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 25 to 28 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(268) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 29 to 32, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 29 to 32 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(269) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 33 to 36, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 33 to 36 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(270) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 37 to 40, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 37 to 40 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(271) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 41 to 43, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 41 to 43 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(272) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 44 to 47, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 44 to 47 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(273) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 48 to 50, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 48 to 50 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(274) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 51 to 53, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 51 to 53 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(275) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 54 to 57, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 54 to 57 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(276) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 58 to 61, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 58 to 61 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(277) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 62 to 64, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 62 to 64 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(278) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 65 to 66, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 65 to 66 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(279) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 67 to 69, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 67 to 69 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(280) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 70 to 73, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 70 to 73 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(281) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 74 to 76, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 74 to 76 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(282) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 77 to 80, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 77 to 80 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(283) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 81 to 83, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 81 to 83 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(284) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 84 to 89, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 84 to 89 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(285) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 90 to 92, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 90 to 92 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(286) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 93 to 101, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 93 to 101 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(287) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 102 to 105, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 102 to 105 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(288) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 106 to 109, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 106 to 109 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(289) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 110 to 161, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 110 to 161 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(290) According to certain embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 162 to 164, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 162 to 164 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(291) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 127, 128, 135, 137, 140, 142, 143, 144, 146 and 147, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 127, 128, 135, 137, 140, 142, 143, 144, 146 and 147 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(292) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 93, 114, 120, 129, 130, 131, 132, 134, 138 and 148, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 93, 114, 120, 129, 130, 131, 132, 134, 138 and 148 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(293) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 5, 24, 86, 121, 125, 126, 133, 141, 150 and 154, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 5, 24, 86, 121, 125, 126, 133, 141, 150 and 154 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(294) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 7, 9, 19, 85, 111, 116, 117, 119, 153 and 155, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 7, 9, 19, 85, 111, 116, 117, 119, 153 and 155 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(295) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 10, 11, 23, 88, 89, 91, 101, 124, 145 and 151, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 10, 11, 23, 88, 89, 91, 101, 124, 145 and 151 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(296) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 120, 127 to 131, 134, 135, 137, 138, 140, 142 to 144, 146 and 147, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 120, 127 to 131, 134, 135, 137, 138, 140, 142 to 144, 146 and 147 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(297) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143 and 137, or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143 and 137 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(298) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137 and 128 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143 and 128 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(299) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128 and 144 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 128 and 144 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(300) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144 and 142 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144 and 142 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(301) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142 and 127 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142 and 127 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(302) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127 and 146 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127 and 146 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(303) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146 and 147 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146 and 147 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(304) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147 and 131 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147 and 131 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(305) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131 and 129 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131 and 129 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(306) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129 and 120 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129 and 120 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(307) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120 and 130 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120 and 130 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(308) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120, 130 and 138 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120, 130 and 138 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(309) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143 and 137 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 140, 135, 143 and 137 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(310) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 135, 137, 138, 140, 142 and 143 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 135, 137, 138, 140, 142 and 143 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(311) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 134, 135, 137, 138, 140, 142, 143 and 144 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 134, 135, 137, 138, 140, 142, 143 and 144 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(312) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 131, 134, 135, 137, 138, 140, 142, 143, 144 and 146 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 131, 134, 135, 137, 138, 140, 142, 143, 144 and 146 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(313) According to certain particularly preferred embodiments, the present invention provides a method for selecting a rainbow trout having late onset of sexual maturation, the method comprising: determining the identity of a nucleotide of at least one allele of at least one SNP associated with late onset of sexual maturation within the genome of said rainbow trout; the at least one SNP being located within said genome at a position corresponding to position 31 of the nucleotide sequence set forth in any one of SEQ ID NOs: 130, 131, 134, 135, 137, 138, 140, 142, 143, 144, 146 and 147 or at a position corresponding to position 31 of a nucleotide sequence which is derived from any one of SEQ ID NOs: 131, 134, 135, 137, 138, 140, 142, 143, 144 and 146 by 1 to 5, such as 1 to 2, nucleotide substitutions; with the proviso that said nucleotide substitution(s) are not at position 31 of said derived sequences; and selecting said rainbow trout as having late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the SNP.
(314) The rainbow trout has late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the respective SNP. The late maturation allele of each SNP is specified in Table 1.
(315) Numerous techniques are known in the art for determining the identity of a nucleotide of an allele present at a polymorphic site. For example, the determination may involve sequence analysis of the rainbow trout to be tested using, e.g., traditional sequence methodologies (e.g., the dideoxy-mediated chain termination method, also known as the Sanger Method (Sanger, F., et al., J. Molec. Biol. 94: 441 (1975); Prober et al. Science 238: 336-340 (1987)) and the chemical degradation method also known as the Maxam-Gilbert method (Maxam, A. M., et al., Proc. Natl. Acad. Sci. (U.S.A.) 74: 560 (1977). Alternatively, the determination may involve single base extension of DNA oligonucleotides terminating at the polymorphic site (e.g. iPLEX assays from Sequenom (San Diego, USA) and Infinium assays from Illumina (San Diego, USA), allele-specific ligation assays (e.g. Axiom technology from Affymetrix (San Diego, USA), allele-specific PCR (e.g. SNPtype assays from Fluidigm (San Francisco) or KASP assays from LGC Genomics (Teddington, UK)), or competitive hybridization of probes complementary to the different alleles (e.g. the TaqMan assay from Applied Biosystems (Foster City, USA)).
(316) Methods for the detection of allelic variation are also reviewed by Nollau et al., Clin. Chem. 43, 1114-1120, 1997; and in standard textbooks, for example Laboratory Protocols for Mutation Detection, Ed. by U. Landegren, Oxford University Press, 1996 and PCR, 2nd Edition by Newton & Graham, BIOS Scientific Publishers Limited, 1997.
(317) For analyzing SNPs, it may for example be appropriate to use oligonucleotides specific for alternative SNP alleles. Such oligonucleotides which detect single nucleotide variations in target sequences may be referred to by such terms as allele-specific oligonucleotides, allele-specific probes, or allele-specific primers. The design and use of allele-specific probes for analyzing polymorphisms is described in, e.g., Mutation Detection A Practical Approach, ed. Cotton et al. Oxford University Press, 1998; Saiki et al., Nature 324, 163-166 (1986); Dattagupta, EP235726; and Saiki, WO 89/11548.
(318) Rainbow Trout
(319) The present invention provides in a further aspect, a rainbow trout, such as an isolated rainbow trout, or a progeny thereof having late onset of sexual maturation comprising within its genome at least one allele, such as at least two alleles, conferring late onset of sexual maturation (late maturation allele); wherein the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the SNPs listed in Table 1.
(320) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 1 and being selected from SNP #1 to SNP #4 listed in table 1.
(321) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 2 and being selected from SNP #5 to SNP #12 listed in table 1.
(322) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 3 and being selected from SNP #13 to SNP #16 listed in table 1.
(323) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 4 and being selected from SNP #17 to SNP #20 listed in table 1.
(324) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 5 and being selected from SNP #21 to SNP #24 listed in table 1.
(325) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 6 and being selected from SNP #25 to SNP #28 listed in table 1.
(326) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 7 and being selected from SNP #29 to SNP #32 listed in table 1.
(327) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 8 and being selected from SNP #33 to SNP #36 listed in table 1.
(328) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 9 and being selected from SNP #37 to SNP #40 listed in table 1.
(329) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 10 and being selected from SNP #41 to SNP #43 listed in table 1.
(330) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 11 and being selected from SNP #44 to SNP #47 listed in table 1.
(331) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 12 and being selected from SNP #48 to SNP #50 listed in table 1.
(332) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 13 and being selected from SNP #51 to SNP #53 listed in table 1.
(333) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 14 and being selected from SNP #54 to SNP #57 listed in table 1.
(334) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 15 and being selected from SNP #58 to SNP #61 listed in table 1.
(335) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 16 and being selected from SNP #62 to SNP #64 listed in table 1.
(336) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 17 and being selected from SNP #65 to SNP #66 listed in table 1.
(337) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 18 and being selected from SNP #67 to SNP #69 listed in table 1.
(338) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 19 and being selected from SNP #70 to SNP #73 listed in table 1.
(339) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 20 and being selected from SNP #74 to SNP #76 listed in table 1.
(340) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 21 and being selected from SNP #77 to SNP #80 listed in table 1.
(341) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 22 and being selected from SNP #81 to SNP #83 listed in table 1.
(342) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 23 and being selected from SNP #84 to SNP #89 listed in table 1.
(343) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 24 and being selected from SNP #90 to SNP #92 listed in table 1.
(344) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 25 and being selected from SNP #93 to SNP #101 listed in table 1.
(345) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 26 and being selected from SNP #102 to SNP #105 listed in table 1.
(346) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 27 and being selected from SNP #106 to SNP #109 listed in table 1.
(347) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from SNP #110 to SNP #161 listed in table 1.
(348) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #120, SNP #127 to SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 to SNP #144, SNP #146 and SNP #147 listed in table 1.
(349) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(350) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137 and SNP #128 listed in table 1.
(351) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128 and SNP #144 listed in table 1.
(352) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144 and SNP #142 listed in table 1.
(353) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, and SNP #127 listed in table 1.
(354) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127 and SNP #146 listed in table 1.
(355) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146 and SNP #147 listed in table 1.
(356) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147 and SNP #131 listed in table 1.
(357) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131 and SNP #129 listed in table 1.
(358) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129 and SNP #120 listed in table 1.
(359) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120 and SNP #130 listed in table 1.
(360) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120, SNP #130 and SNP #138 listed in table 1.
(361) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(362) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 and SNP #143 listed in table 1.
(363) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143 and SNP #144 listed in table 1.
(364) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144 and SNP #146 listed in table 1.
(365) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #130, SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(366) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 29 and being selected from SNP #162 to SNP #164 listed in table 1.
(367) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #127, SNP #128, SNP #135, SNP #137, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(368) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #93, SNP #114, SNP #120, SNP #129, SNP #130, SNP #131, SNP #132, SNP #134, SNP #138 and SNP #148 listed in table 1.
(369) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #5, SNP #24, SNP #86, SNP #121, SNP #125, SNP #126, SNP #133, SNP #141, SNP #150 and SNP #154 listed in table 1.
(370) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #7, SNP #9, SNP #19, SNP #85, SNP #111, SNP #116, SNP #117, SNP #119, SNP #153 and SNP #155 listed in table 1.
(371) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #10, SNP #11, SNP #23, SNP #88, SNP #89, SNP #91, SNP #101, SNP #124, SNP #145 and SNP #151 listed in table 1.
(372) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 165 to 328, and b) nucleotide sequences derived from any one of SEQ ID NOs: 165 to 328 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(373) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 165 to 168, and b) nucleotide sequences derived from any one of SEQ ID NOs: 165 to 168 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(374) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 169 to 176, and b) nucleotide sequences derived from any one of SEQ ID NOs: 169 to 176 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(375) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 177 to 180, and b) nucleotide sequences derived from any one of SEQ ID NOs: 177 to 180 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(376) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 181 to 184, and b) nucleotide sequences derived from any one of SEQ ID NOs: 181 to 184 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(377) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 185 to 188, and b) nucleotide sequences derived from any one of SEQ ID NOs: 185 to 188 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(378) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 189 to 192, and b) nucleotide sequences derived from any one of SEQ ID NOs: 189 to 192 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(379) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 193 to 196, and b) nucleotide sequences derived from any one of SEQ ID NOs: 193 to 196 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(380) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 197 to 200, and b) nucleotide sequences derived from any one of SEQ ID NOs: 197 to 200 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(381) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 201 to 204, and b) nucleotide sequences derived from any one of SEQ ID NOs: 201 to 204 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(382) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 205 to 207, and b) nucleotide sequences derived from any one of SEQ ID NOs: 205 to 207 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(383) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 208 to 211, and b) nucleotide sequences derived from any one of SEQ ID NOs: 208 to 211 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(384) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 212 to 214, and b) nucleotide sequences derived from any one of SEQ ID NOs: 212 to 214 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(385) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 215 to 217, and b) nucleotide sequences derived from any one of SEQ ID NOs: 215 to 217 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(386) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 218 to 221, and b) nucleotide sequences derived from any one of SEQ ID NOs: 218 to 221 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(387) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 222 to 225, and b) nucleotide sequences derived from any one of SEQ ID NOs: 222 to 225 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(388) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 226 to 228, and b) nucleotide sequences derived from any one of SEQ ID NOs: 226 to 228 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(389) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 229 to 230, and b) nucleotide sequences derived from any one of SEQ ID NOs: 229 to 230 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(390) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 231 to 233, and b) nucleotide sequences derived from any one of SEQ ID NOs: 231 to 233 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(391) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 234 to 237, and b) nucleotide sequences derived from any one of SEQ ID NOs: 234 to 237 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(392) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 238 to 240, and b) nucleotide sequences derived from any one of SEQ ID NOs: 238 to 240 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(393) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 241 to 244, and b) nucleotide sequences derived from any one of SEQ ID NOs: 241 to 244 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(394) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 245 to 247, and b) nucleotide sequences derived from any one of SEQ ID NOs: 245 to 247 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(395) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 248 to 253, and b) nucleotide sequences derived from any one of SEQ ID NOs: 248 to 253 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(396) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 254 to 256, and b) nucleotide sequences derived from any one of SEQ ID NOs: 254 to 256 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(397) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 257 to 265, and b) nucleotide sequences derived from any one of SEQ ID NOs: 257 to 265 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(398) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 266 to 269, and b) nucleotide sequences derived from any one of SEQ ID NOs: 266 to 269 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(399) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 270 to 273, and b) nucleotide sequences derived from any one of SEQ ID NOs: 270 to 273 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(400) According to certain particularly preferred embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 274 to 325, and b) nucleotide sequences derived from any one of SEQ ID NOs: 274 to 325 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(401) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 326 to 328, and b) nucleotide sequences derived from any one of SEQ ID NOs: 326 to 328 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(402) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 291, 292, 299, 301, 304, 306, 307, 308, 310 and 311, and b) nucleotide sequences derived from any one of SEQ ID NOs: 291, 292, 299, 301, 304, 306, 307, 308, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(403) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 257, 278, 284, 293, 294, 295, 296, 298, 302 and 312, and b) nucleotide sequences derived from any one of SEQ ID NOs: 257, 278, 284, 293, 294, 295, 296, 298, 302 and 312 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(404) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 169, 188, 250, 285, 289, 290, 297, 305, 314 and 318, and b) nucleotide sequences derived from any one of SEQ ID NOs: 169, 188, 250, 285, 289, 290, 297, 305, 314 and 318 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(405) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 171, 173, 183, 249, 275, 280, 281, 283, 317 and 319, and b) nucleotide sequences derived from any one of SEQ ID NOs: 171, 173, 183, 249, 275, 280, 281, 283, 317 and 319 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(406) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 174, 175, 187, 252, 253, 255, 265, 288, 309 and 315, and b) nucleotide sequences derived from any one of SEQ ID NOs: 174, 175, 187, 252, 253, 255, 265, 288, 309 and 315 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(407) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 284, 291 to 295, 298, 299, 301, 302, 304, 306 to 308, 310 and 311, and b) nucleotide sequences derived from any one of SEQ ID NOs: 284, 291 to 295, 298, 299, 301, 302, 304, 306 to 308, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(408) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307 and 301, and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307 and 301 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(409) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301 and 292 and b) nucleotide sequences derived from any one of SEQ ID NOs: SEQ ID NOs: 304, 299, 307, 301 and 292 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(410) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292 and 308 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292 and 308 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(411) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308 and 306 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308 and 306 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(412) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306 and 291 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306 and 291 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(413) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291 and 310 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291 and 310 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(414) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310 and 311 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(415) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311 and 295 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311 and 295 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(416) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295 and 293 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295 and 293 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(417) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293 and 284 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293 and 284 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(418) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284 and 294 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284 and 294 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(419) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284, 294 and 302 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284, 294 and 302 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(420) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307 and 301 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307 and 301 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(421) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 299, 301, 302, 304, 306 and 307 and b) nucleotide sequences derived from any one of SEQ ID NOs: 299, 301, 302, 304, 306 and 307 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(422) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 298, 299, 301, 302, 304, 306, 307 and 308 and b) nucleotide sequences derived from any one of SEQ ID NOs: 298, 299, 301, 302, 304, 306, 307 and 308 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(423) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 295, 298, 299, 301, 302, 304, 306, 307, 308 and 310 and b) nucleotide sequences derived from any one of SEQ ID NOs: 295, 298, 299, 301, 302, 304, 306, 307, 308 and 310 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(424) According to certain embodiments, the present invention provides a rainbow trout, such as an isolated rainbow trout, or a progeny thereof which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 294, 295, 298, 299, 301, 302, 304, 306, 307, 308, 310 and 311 and b) nucleotide sequences derived from any one of SEQ ID NOs: 294, 295, 298, 299, 301, 302, 304, 306, 307, 308, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(425) The rainbow trout has late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the respective SNP. The late maturation allele of each SNP is specified in Table 1.
(426) The present invention provides in a further aspect a population of rainbow trout, such as an isolated population of rainbow trout, each individual rainbow trout within the population being a rainbow trout according to the further aspect as discussed above.
(427) According to certain embodiments, the rainbow trout is a female.
(428) According to certain other embodiments, the rainbow trout is a male.
(429) According to certain embodiments, the rainbow trout or progeny thereof is obtained by a method according to the present invention.
(430) In one further aspect of the present invention, a rainbow trout or progeny thereof comprises in its genome at least one allele conferring late sexual maturation obtainable by a process comprising the steps of: a) genotyping the trout, b) selecting individuals having at least one allele preferably two alleles conferring late onset of sexual maturation (late maturation allele); and c) mating individuals in such a way that at least one individual within each mated pair has two alleles conferring late onset of sexual maturation.
(431) According to certain embodiments the mating in c) may also be conducted in such a way that the mated pair each has two alleles conferring late onset of sexual maturation, or that each mated pair has one allele conferring late onset of sexual maturation.
(432) The rainbow trout has late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the respective SNP. The late maturation allele of each SNP is specified in Table 1.
(433) Rainbow Trout Cell
(434) The present invention provides in a third aspect, a rainbow trout cell, such as an isolated rainbow trout cell, comprising within its genome at least one allele conferring late onset of sexual maturation (late maturation allele); wherein the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the SNPs listed in Table 1.
(435) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 1 and being selected from SNP #1 to SNP #4 listed in table 1.
(436) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 2 and being selected from SNP #5 to SNP #12 listed in table 1.
(437) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 3 and being selected from SNP #13 to SNP #16 listed in table 1.
(438) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 4 and being selected from SNP #17 to SNP #20 listed in table 1.
(439) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 5 and being selected from SNP #21 to SNP #24 listed in table 1.
(440) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 6 and being selected from SNP #25 to SNP #28 listed in table 1.
(441) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 7 and being selected from SNP #29 to SNP #32 listed in table 1.
(442) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 8 and being selected from SNP #33 to SNP #36 listed in table 1.
(443) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 9 and being selected from SNP #37 to SNP #40 listed in table 1.
(444) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 10 and being selected from SNP #41 to SNP #43 listed in table 1.
(445) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 11 and being selected from SNP #44 to SNP #47 listed in table 1.
(446) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 12 and being selected from SNP #48 to SNP #50 listed in table 1.
(447) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 13 and being selected from SNP #51 to SNP #53 listed in table 1.
(448) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 14 and being selected from SNP #54 to SNP #57 listed in table 1.
(449) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 15 and being selected from SNP #58 to SNP #61 listed in table 1.
(450) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 16 and being selected from SNP #62 to SNP #64 listed in table 1.
(451) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 17 and being selected from SNP #65 to SNP #66 listed in table 1.
(452) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 18 and being selected from SNP #67 to SNP #69 listed in table 1.
(453) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 19 and being selected from SNP #70 to SNP #73 listed in table 1.
(454) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 20 and being selected from SNP #74 to SNP #76 listed in table 1.
(455) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 21 and being selected from SNP #77 to SNP #80 listed in table 1.
(456) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 22 and being selected from SNP #81 to SNP #83 listed in table 1.
(457) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 23 and being selected from SNP #84 to SNP #89 listed in table 1.
(458) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 24 and being selected from SNP #90 to SNP #92 listed in table 1.
(459) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 25 and being selected from SNP #93 to SNP #101 listed in table 1.
(460) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 26 and being selected from SNP #102 to SNP #105 listed in table 1.
(461) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 27 and being selected from SNP #106 to SNP #109 listed in table 1.
(462) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from SNP #110 to SNP #161 listed in table 1.
(463) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #120, SNP #127 to SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 to SNP #144, SNP #146 and SNP #147 listed in table 1.
(464) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(465) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137 and SNP #128 listed in table 1.
(466) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128 and SNP #144 listed in table 1.
(467) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144 and SNP #142 listed in table 1.
(468) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, and SNP #127 listed in table 1.
(469) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127 and SNP #146 listed in table 1.
(470) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146 and SNP #147 listed in table 1.
(471) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147 and SNP #131 listed in table 1.
(472) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131 and SNP #129 listed in table 1.
(473) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129 and SNP #120 listed in table 1.
(474) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120 and SNP #130 listed in table 1.
(475) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120, SNP #130 and SNP #138 listed in table 1.
(476) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(477) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 and SNP #143 listed in table 1.
(478) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143 and SNP #144 listed in table 1.
(479) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144 and SNP #146 listed in table 1.
(480) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #130, SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(481) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 29 and being selected from SNP #162 to SNP #164 listed in table 1.
(482) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #127, SNP #128, SNP #135, SNP #137, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(483) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #93, SNP #114, SNP #120, SNP #129, SNP #130, SNP #131, SNP #132, SNP #134, SNP #138 and SNP #148 listed in table 1.
(484) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #5, SNP #24, SNP #86, SNP #121, SNP #125, SNP #126, SNP #133, SNP #141, SNP #150 and SNP #154 listed in table 1.
(485) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #7, SNP #9, SNP #19, SNP #85, SNP #111, SNP #116, SNP #117, SNP #119, SNP #153 and SNP #155 listed in table 1.
(486) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #10, SNP #11, SNP #23, SNP #88, SNP #89, SNP #91, SNP #101, SNP #124, SNP #145 and SNP #151 listed in table 1.
(487) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 165 to 328, and b) nucleotide sequences derived from any one of SEQ ID NOs: 165 to 328 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(488) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 165 to 168, and b) nucleotide sequences derived from any one of SEQ ID NOs: 165 to 168 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(489) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 169 to 176, and b) nucleotide sequences derived from any one of SEQ ID NOs: 169 to 176 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(490) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 177 to 180, and b) nucleotide sequences derived from any one of SEQ ID NOs: 177 to 180 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(491) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 181 to 184, and b) nucleotide sequences derived from any one of SEQ ID NOs: 181 to 184 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(492) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 185 to 188, and b) nucleotide sequences derived from any one of SEQ ID NOs: 185 to 188 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(493) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 189 to 192, and b) nucleotide sequences derived from any one of SEQ ID NOs: 189 to 192 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(494) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 193 to 196, and b) nucleotide sequences derived from any one of SEQ ID NOs: 193 to 196 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(495) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 197 to 200, and b) nucleotide sequences derived from any one of SEQ ID NOs: 197 to 200 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(496) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 201 to 204, and b) nucleotide sequences derived from any one of SEQ ID NOs: 201 to 204 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(497) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 205 to 207, and b) nucleotide sequences derived from any one of SEQ ID NOs: 205 to 207 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(498) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 208 to 211, and b) nucleotide sequences derived from any one of SEQ ID NOs: 208 to 211 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(499) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 212 to 214, and b) nucleotide sequences derived from any one of SEQ ID NOs: 212 to 214 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(500) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 215 to 217, and b) nucleotide sequences derived from any one of SEQ ID NOs: 215 to 217 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(501) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 218 to 221, and b) nucleotide sequences derived from any one of SEQ ID NOs: 218 to 221 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(502) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 222 to 225, and b) nucleotide sequences derived from any one of SEQ ID NOs: 222 to 225 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(503) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 226 to 228, and b) nucleotide sequences derived from any one of SEQ ID NOs: 226 to 228 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(504) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 229 to 230, and b) nucleotide sequences derived from any one of SEQ ID NOs: 229 to 230 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(505) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 231 to 233, and b) nucleotide sequences derived from any one of SEQ ID NOs: 231 to 233 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(506) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 234 to 237, and b) nucleotide sequences derived from any one of SEQ ID NOs: 234 to 237 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(507) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 238 to 240, and b) nucleotide sequences derived from any one of SEQ ID NOs: 238 to 240 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(508) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 241 to 244, and b) nucleotide sequences derived from any one of SEQ ID NOs: 241 to 244 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(509) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 245 to 247, and b) nucleotide sequences derived from any one of SEQ ID NOs: 245 to 247 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(510) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 248 to 253, and b) nucleotide sequences derived from any one of SEQ ID NOs: 248 to 253 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(511) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 254 to 256, and b) nucleotide sequences derived from any one of SEQ ID NOs: 254 to 256 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(512) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 257 to 265, and b) nucleotide sequences derived from any one of SEQ ID NOs: 257 to 265 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(513) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 266 to 269, and b) nucleotide sequences derived from any one of SEQ ID NOs: 266 to 269 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(514) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 270 to 273, and b) nucleotide sequences derived from any one of SEQ ID NOs: 270 to 273 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(515) According to certain particularly preferred embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 274 to 325, and b) nucleotide sequences derived from any one of SEQ ID NOs: 274 to 325 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(516) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 326 to 328, and b) nucleotide sequences derived from any one of SEQ ID NOs: 326 to 328 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(517) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 291, 292, 299, 301, 304, 306, 307, 308, 310 and 311, and b) nucleotide sequences derived from any one of SEQ ID NOs: 291, 292, 299, 301, 304, 306, 307, 308, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(518) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 257, 278, 284, 293, 294, 295, 296, 298, 302 and 312, and b) nucleotide sequences derived from any one of SEQ ID NOs: 257, 278, 284, 293, 294, 295, 296, 298, 302 and 312 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(519) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 169, 188, 250, 285, 289, 290, 297, 305, 314 and 318, and b) nucleotide sequences derived from any one of SEQ ID NOs: 169, 188, 250, 285, 289, 290, 297, 305, 314 and 318 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(520) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 171, 173, 183, 249, 275, 280, 281, 283, 317 and 319, and b) nucleotide sequences derived from any one of SEQ ID NOs: 171, 173, 183, 249, 275, 280, 281, 283, 317 and 319 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(521) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 174, 175, 187, 252, 253, 255, 265, 288, 309 and 315, and b) nucleotide sequences derived from any one of SEQ ID NOs: 174, 175, 187, 252, 253, 255, 265, 288, 309 and 315 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(522) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 284, 291 to 295, 298, 299, 301, 302, 304, 306 to 308, 310 and 311, and b) nucleotide sequences derived from any one of SEQ ID NOs: 284, 291 to 295, 298, 299, 301, 302, 304, 306 to 308, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(523) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307 and 301, and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307 and 301 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(524) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301 and 292 and b) nucleotide sequences derived from any one of SEQ ID NOs: SEQ ID NOs: 304, 299, 307, 301 and 292 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(525) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292 and 308 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292 and 308 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(526) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308 and 306 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308 and 306 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(527) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306 and 291 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306 and 291 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(528) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291 and 310 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291 and 310 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(529) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310 and 311 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(530) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311 and 295 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311 and 295 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(531) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295 and 293 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295 and 293 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(532) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293 and 284 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293 and 284 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(533) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284 and 294 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284 and 294 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(534) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284, 294 and 302 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284, 294 and 302 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(535) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307 and 301 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307 and 301 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(536) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 299, 301, 302, 304, 306 and 307 and b) nucleotide sequences derived from any one of SEQ ID NOs: 299, 301, 302, 304, 306 and 307 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(537) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 298, 299, 301, 302, 304, 306, 307 and 308 and b) nucleotide sequences derived from any one of SEQ ID NOs: 298, 299, 301, 302, 304, 306, 307 and 308 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(538) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 295, 298, 299, 301, 302, 304, 306, 307, 308 and 310 and b) nucleotide sequences derived from any one of SEQ ID NOs: 295, 298, 299, 301, 302, 304, 306, 307, 308 and 310 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(539) According to certain embodiments, the present invention provides a rainbow trout cell, such as an isolated rainbow trout cell, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 294, 295, 298, 299, 301, 302, 304, 306, 307, 308, 310 and 311 and b) nucleotide sequences derived from any one of SEQ ID NOs: 294, 295, 298, 299, 301, 302, 304, 306, 307, 308, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(540) The rainbow trout has late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the respective SNP. The late maturation allele of each SNP is specified in Table 1.
(541) The present invention provides in a further aspect a population of rainbow trout cells, such as an isolated population of rainbow trout cells, each individual cell within the population being a cell according to the third aspect of the present invention.
(542) According to certain embodiments, the rainbow trout cell is a gamete.
(543) According to certain embodiments, the rainbow trout cell is not a gamete.
(544) According to particular embodiments, the rainbow trout cell is an egg, such as an eyed egg. According to more particular embodiments, the egg is unfertilized. According to other more particular embodiments, the egg is fertilized.
(545) According to particular embodiments, the rainbow trout cell is a sperm cell.
(546) According to certain other embodiments, the rainbow trout cell is a somatic cell.
(547) According to certain embodiments, the rainbow trout cell has been isolated from a rainbow trout of the invention.
(548) According to particular embodiments, the rainbow trout cell has been isolated from a female rainbow trout of the invention.
(549) According to particular embodiments, the rainbow trout cell has been isolated from a male rainbow trout of the invention.
(550) Rainbow Trout Egg or Spermatozoa
(551) The present invention provides in a fourth aspect, a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, comprising within its genome at least one allele conferring late onset of sexual maturation (late maturation allele); wherein the isolated rainbow trout egg is unfertilized; and the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the SNPs listed in Table 1.
(552) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 1 and being selected from SNP #1 to SNP #4 listed in table 1.
(553) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 2 and being selected from SNP #5 to SNP #12 listed in table 1.
(554) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 3 and being selected from SNP #13 to SNP #16 listed in table 1.
(555) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 4 and being selected from SNP #17 to SNP #20 listed in table 1.
(556) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 5 and being selected from SNP #21 to SNP #24 listed in table 1.
(557) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 6 and being selected from SNP #25 to SNP #28 listed in table 1.
(558) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 7 and being selected from SNP #29 to SNP #32 listed in table 1.
(559) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 8 and being selected from SNP #33 to SNP #36 listed in table 1.
(560) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 9 and being selected from SNP #37 to SNP #40 listed in table 1.
(561) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 10 and being selected from SNP #41 to SNP #43 listed in table 1.
(562) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 11 and being selected from SNP #44 to SNP #47 listed in table 1.
(563) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 12 and being selected from SNP #48 to SNP #50 listed in table 1.
(564) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 13 and being selected from SNP #51 to SNP #53 listed in table 1.
(565) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 14 and being selected from SNP #54 to SNP #57 listed in table 1.
(566) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 15 and being selected from SNP #58 to SNP #61 listed in table 1.
(567) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 16 and being selected from SNP #62 to SNP #64 listed in table 1.
(568) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 17 and being selected from SNP #65 to SNP #66 listed in table 1.
(569) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 18 and being selected from SNP #67 to SNP #69 listed in table 1.
(570) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 19 and being selected from SNP #70 to SNP #73 listed in table 1.
(571) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 20 and being selected from SNP #74 to SNP #76 listed in table 1.
(572) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 21 and being selected from SNP #77 to SNP #80 listed in table 1.
(573) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 22 and being selected from SNP #81 to SNP #83 listed in table 1.
(574) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 23 and being selected from SNP #84 to SNP #89 listed in table 1.
(575) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 24 and being selected from SNP #90 to SNP #92 listed in table 1.
(576) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 25 and being selected from SNP #93 to SNP #101 listed in table 1.
(577) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 26 and being selected from SNP #102 to SNP #105 listed in table 1.
(578) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 27 and being selected from SNP #106 to SNP #109 listed in table 1.
(579) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from SNP #110 to SNP #161 listed in table 1.
(580) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #120, SNP #127 to SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 to SNP #144, SNP #146 and SNP #147 listed in table 1.
(581) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(582) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137 and SNP #128 listed in table 1.
(583) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128 and SNP #144 listed in table 1.
(584) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144 and SNP #142 listed in table 1.
(585) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, and SNP #127 listed in table 1.
(586) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127 and SNP #146 listed in table 1.
(587) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146 and SNP #147 listed in table 1.
(588) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147 and SNP #131 listed in table 1.
(589) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131 and SNP #129 listed in table 1.
(590) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129 and SNP #120 listed in table 1.
(591) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120 and SNP #130 listed in table 1.
(592) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143, SNP #137, SNP #128, SNP #144, SNP #142, SNP #127, SNP #146, SNP #147, SNP #131, SNP #129, SNP #120, SNP #130 and SNP #138 listed in table 1.
(593) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #140, SNP #135, SNP #143 and SNP #137 listed in table 1.
(594) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #135, SNP #137, SNP #138, SNP #140, SNP #142 and SNP #143 listed in table 1.
(595) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143 and SNP #144 listed in table 1.
(596) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144 and SNP #146 listed in table 1.
(597) According to certain particularly preferred embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 28 and being selected from the group consisting of SNP #130, SNP #131, SNP #134, SNP #135, SNP #137, SNP #138, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(598) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being located on chromosome 29 and being selected from SNP #162 to SNP #164 listed in table 1.
(599) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #127, SNP #128, SNP #135, SNP #137, SNP #140, SNP #142, SNP #143, SNP #144, SNP #146 and SNP #147 listed in table 1.
(600) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #93, SNP #114, SNP #120, SNP #129, SNP #130, SNP #131, SNP #132, SNP #134, SNP #138 and SNP #148 listed in table 1.
(601) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #5, SNP #24, SNP #86, SNP #121, SNP #125, SNP #126, SNP #133, SNP #141, SNP #150 and SNP #154 listed in table 1.
(602) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #7, SNP #9, SNP #19, SNP #85, SNP #111, SNP #116, SNP #117, SNP #119, SNP #153 and SNP #155 listed in table 1.
(603) According to certain embodiments, the at least one late maturation allele is an allele of at least one single nucleotide polymorphism (SNP), the at least one SNP being selected from the group consisting of SNP #10, SNP #11, SNP #23, SNP #88, SNP #89, SNP #91, SNP #101, SNP #124, SNP #145 and SNP #151 listed in table 1.
(604) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 165 to 328, and b) nucleotide sequences derived from any one of SEQ ID NOs: 165 to 328 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(605) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 165 to 168, and b) nucleotide sequences derived from any one of SEQ ID NOs: 165 to 168 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(606) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 169 to 176, and b) nucleotide sequences derived from any one of SEQ ID NOs: 169 to 176 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(607) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 177 to 180, and b) nucleotide sequences derived from any one of SEQ ID NOs: 177 to 180 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(608) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 181 to 184, and b) nucleotide sequences derived from any one of SEQ ID NOs: 181 to 184 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(609) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 185 to 188, and b) nucleotide sequences derived from any one of SEQ ID NOs: 185 to 188 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(610) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 189 to 192, and b) nucleotide sequences derived from any one of SEQ ID NOs: 189 to 192 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(611) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 193 to 196, and b) nucleotide sequences derived from any one of SEQ ID NOs: 193 to 196 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(612) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 197 to 200, and b) nucleotide sequences derived from any one of SEQ ID NOs: 197 to 200 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(613) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 201 to 204, and b) nucleotide sequences derived from any one of SEQ ID NOs: 201 to 204 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(614) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 205 to 207, and b) nucleotide sequences derived from any one of SEQ ID NOs: 205 to 207 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(615) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 208 to 211, and b) nucleotide sequences derived from any one of SEQ ID NOs: 208 to 211 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(616) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 212 to 214, and b) nucleotide sequences derived from any one of SEQ ID NOs: 212 to 214 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(617) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 215 to 217, and b) nucleotide sequences derived from any one of SEQ ID NOs: 215 to 217 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(618) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 218 to 221, and b) nucleotide sequences derived from any one of SEQ ID NOs: 218 to 221 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(619) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 222 to 225, and b) nucleotide sequences derived from any one of SEQ ID NOs: 222 to 225 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(620) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 226 to 228, and b) nucleotide sequences derived from any one of SEQ ID NOs: 226 to 228 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(621) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 229 to 230, and b) nucleotide sequences derived from any one of SEQ ID NOs: 229 to 230 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(622) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 231 to 233, and b) nucleotide sequences derived from any one of SEQ ID NOs: 231 to 233 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(623) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 234 to 237, and b) nucleotide sequences derived from any one of SEQ ID NOs: 234 to 237 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(624) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 238 to 240, and b) nucleotide sequences derived from any one of SEQ ID NOs: 238 to 240 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(625) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 241 to 244, and b) nucleotide sequences derived from any one of SEQ ID NOs: 241 to 244 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(626) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 245 to 247, and b) nucleotide sequences derived from any one of SEQ ID NOs: 245 to 247 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(627) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 248 to 253, and b) nucleotide sequences derived from any one of SEQ ID NOs: 248 to 253 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(628) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 254 to 256, and b) nucleotide sequences derived from any one of SEQ ID NOs: 254 to 256 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(629) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 257 to 265, and b) nucleotide sequences derived from any one of SEQ ID NOs: 257 to 265 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(630) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 266 to 269, and b) nucleotide sequences derived from any one of SEQ ID NOs: 266 to 269 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(631) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 270 to 273, and b) nucleotide sequences derived from any one of SEQ ID NOs: 270 to 273 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(632) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 274 to 325, and b) nucleotide sequences derived from any one of SEQ ID NOs: 274 to 325 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(633) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 326 to 328, and b) nucleotide sequences derived from any one of SEQ ID NOs: 326 to 328 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(634) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 291, 292, 299, 301, 304, 306, 307, 308, 310 and 311, and b) nucleotide sequences derived from any one of SEQ ID NOs: 291, 292, 299, 301, 304, 306, 307, 308, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(635) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 257, 278, 284, 293, 294, 295, 296, 298, 302 and 312, and b) nucleotide sequences derived from any one of SEQ ID NOs: 257, 278, 284, 293, 294, 295, 296, 298, 302 and 312 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(636) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 169, 188, 250, 285, 289, 290, 297, 305, 314 and 318, and b) nucleotide sequences derived from any one of SEQ ID NOs: 169, 188, 250, 285, 289, 290, 297, 305, 314 and 318 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(637) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 171, 173, 183, 249, 275, 280, 281, 283, 317 and 319, and b) nucleotide sequences derived from any one of SEQ ID NOs: 171, 173, 183, 249, 275, 280, 281, 283, 317 and 319 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(638) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 174, 175, 187, 252, 253, 255, 265, 288, 309 and 315, and b) nucleotide sequences derived from any one of SEQ ID NOs: 174, 175, 187, 252, 253, 255, 265, 288, 309 and 315 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(639) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 284, 291 to 295, 298, 299, 301, 302, 304, 306 to 308, 310 and 311, and b) nucleotide sequences derived from any one of SEQ ID NOs: 284, 291 to 295, 298, 299, 301, 302, 304, 306 to 308, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(640) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307 and 301, and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307 and 301 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(641) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301 and 292 and b) nucleotide sequences derived from any one of SEQ ID NOs: SEQ ID NOs: 304, 299, 307, 301 and 292 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(642) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292 and 308 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292 and 308 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(643) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308 and 306 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308 and 306 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(644) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306 and 291 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306 and 291 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(645) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291 and 310 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291 and 310 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(646) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310 and 311 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(647) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311 and 295 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311 and 295 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(648) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295 and 293 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295 and 293 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(649) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293 and 284 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293 and 284 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(650) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284 and 294 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284 and 294 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(651) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284, 294 and 302 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307, 301, 292, 308, 306, 291, 310, 311, 295, 293, 284, 294 and 302 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(652) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 304, 299, 307 and 301 and b) nucleotide sequences derived from any one of SEQ ID NOs: 304, 299, 307 and 301 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(653) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 299, 301, 302, 304, 306 and 307 and b) nucleotide sequences derived from any one of SEQ ID NOs: 299, 301, 302, 304, 306 and 307 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(654) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 298, 299, 301, 302, 304, 306, 307 and 308 and b) nucleotide sequences derived from any one of SEQ ID NOs: 298, 299, 301, 302, 304, 306, 307 and 308 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(655) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 295, 298, 299, 301, 302, 304, 306, 307, 308 and 310 and b) nucleotide sequences derived from any one of SEQ ID NOs: 295, 298, 299, 301, 302, 304, 306, 307, 308 and 310 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(656) According to certain embodiments, the present invention provides a rainbow trout egg or spermatozoa, such as an isolated rainbow trout egg or spermatozoa, which comprises within its genome at least one nucleotide sequence selected from the group consisting of a) the nucleotide sequences set forth in SEQ ID NOs: 294, 295, 298, 299, 301, 302, 304, 306, 307, 308, 310 and 311 and b) nucleotide sequences derived from any one of SEQ ID NOs: 294, 295, 298, 299, 301, 302, 304, 306, 307, 308, 310 and 311 by 1 to 5, such as 1 to 2, nucleotide substitutions, provide that said nucleotide substitutions are not at position 31 of said derived sequence.
(657) The rainbow trout has late onset of sexual maturation when the nucleotide of the at least one allele is a nucleotide corresponding to the late maturation allele of the respective SNP. The late maturation allele of each SNP is specified in Table 1.
(658) The present invention provides in a further aspect a population of rainbow trout egg or spermatozoa, such as an isolated population of rainbow trout egg or spermatozoa, each individual egg or spermatozoa within the population being an egg or spermatozoa according to the fourth aspect of the present invention.
(659) According to certain embodiments, the rainbow trout egg is unfertilized.
(660) According to certain other embodiments, the rainbow trout egg is fertilized.
(661) According to particular embodiments, the rainbow trout egg is an eyed egg.
(662) According to certain embodiments, the rainbow trout egg has been isolated from a female rainbow trout of the invention.
(663) Oligonucleotide
(664) The present invention provides in a fifth aspect, an oligonucleotide, such as an isolated oligonucleotide, comprising at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 164, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 1 to 164 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(665) In one embodiment according to the fifth aspect of the present invention, the oligonucleotide has a total length of 8 to 61 nucleotides, such as a total length of 10 to 61 nucleotides, a total length of 12 to 61 nucleotides, a total length of 14 to 61 nucleotides, a total length of 16 to 61 nucleotides, a total length of 18 to 61 nucleotides or a total length of 20 to 61 nucleotides.
(666) In another embodiment according to the fifth aspect of the present invention, the oligonucleotide has a total length of 8 to 50 nucleotides, such as a total length of 10 to 50 nucleotides, a total length of 12 to 50 nucleotides, a total length of 14 to 50 nucleotides, a total length of 16 to 50 nucleotides, a total length of 18 to 50 nucleotides or a total length of 20 to 50 nucleotides.
(667) In another embodiment according to the fifth aspect of the present invention, the oligonucleotide has a total length of 8 to 40 nucleotides, such as a total length of 10 to 40 nucleotides, a total length of 12 to 40 nucleotides, a total length of 14 to 40 nucleotides, a total length of 16 to 40 nucleotides, a total length of 18 to 40 nucleotides or a total length of 20 to 40 nucleotides.
(668) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 1 to 4, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 1 to 4 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(669) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 5 to 12, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 5 to 12 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(670) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 13 to 16, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 13 to 16 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(671) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 17 to 20, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 17 to 20 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(672) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 21 to 24, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 21 to 24 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(673) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 25 to 28, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 25 to 28 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(674) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 29 to 32, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 29 to 32 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(675) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 33 to 36, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 33 to 36 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(676) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 37 to 40, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 37 to 40 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(677) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 41 to 43, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 41 to 43 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(678) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 44 to 47, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 44 to 47 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(679) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 48 to 50, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 48 to 50 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(680) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 51 to 53, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 51 to 53 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(681) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 54 to 57, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 54 to 57 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(682) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 58 to 61, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 58 to 61 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(683) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 62 to 64, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 62 to 64 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(684) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 65 to 66, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 65 to 66 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(685) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 67 to 69, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 67 to 69 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(686) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 70 to 73, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 70 to 73 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(687) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 74 to 76, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 74 to 76 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(688) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 77 to 80, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 77 to 80 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(689) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 81 to 83, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 81 to 83 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(690) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 84 to 89, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 84 to 89 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(691) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 90 to 92, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 90 to 92 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(692) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 93 to 101, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 93 to 101 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(693) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 102 to 105, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 102 to 105 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(694) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 106 to 109, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 106 to 109 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(695) In certain particularly preferred embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 110 to 161, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 110 to 161 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(696) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 162 to 164, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 162 to 164 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(697) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 127, 128, 135, 137, 140, 142, 143, 144, 146 and 147, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 127, 128, 135, 137, 140, 142, 143, 144, 146 and 147 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(698) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 93, 114, 120, 129, 130, 131, 132, 134, 138 and 148, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 93, 114, 120, 129, 130, 131, 132, 134, 138 and 148 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(699) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 5, 24, 86, 121, 125, 126, 133, 141, 150 and 154, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 5, 24, 86, 121, 125, 126, 133, 141, 150 and 154 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(700) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 7, 9, 19, 85, 111, 116, 117, 119, 153 and 155, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 7, 9, 19, 85, 111, 116, 117, 119, 153 and 155 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(701) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 10, 11, 23, 88, 89, 91, 101, 124, 145 and 151, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 10, 11, 23, 88, 89, 91, 101, 124, 145 and 151 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(702) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 120, 127 to 131, 134, 135, 137, 138, 140, 142 to 144, 146 and 147, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 120, 127 to 131, 134, 135, 137, 138, 140, 142 to 144, 146 and 147 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(703) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143 and 137, or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143 and 137 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(704) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137 and 128 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143 and 128 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(705) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128 and 144 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 128 and 144 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(706) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144 and 142 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144 and 142 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(707) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142 and 127 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142 and 127 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(708) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127 and 146 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127 and 146 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(709) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146 and 147 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146 and 147 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(710) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147 and 131 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147 and 131 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(711) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131 and 129 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131 and 129 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(712) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129 and 120 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129 and 120 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(713) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120 and 130 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120 and 130 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(714) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120, 130 and 138 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143, 137, 128, 144, 142, 127, 146, 147, 131, 129, 120, 130 and 138 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(715) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 140, 135, 143 and 137 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 140, 135, 143 and 137 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(716) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 135, 137, 138, 140, 142 and 143 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 135, 137, 138, 140, 142 and 143 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(717) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 134, 135, 137, 138, 140, 142, 143 and 144 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 134, 135, 137, 138, 140, 142, 143 and 144 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(718) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 131, 134, 135, 137, 138, 140, 142, 143, 144 and 146 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 131, 134, 135, 137, 138, 140, 142, 143, 144 and 146 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(719) In certain embodiments, the (isolated) oligonucleotide comprises at least 8 contiguous nucleotides, such as at least 10 contiguous nucleotides, at least 12 contiguous nucleotides, at least 14 contiguous nucleotides, at least 16 contiguous nucleotides, at least 18 contiguous nucleotides or at least 20 contiguous nucleotides, of a nucleotide sequence set forth in any one of SEQ ID NOs: 130, 131, 134, 135, 137, 138, 140, 142, 143, 144, 146 and 147 or a complementary sequence thereof; or of a nucleotide sequence derived from any one of SEQ ID NOs: 131, 134, 135, 137, 138, 140, 142, 143, 144 and 146 by 1 to 5, such as 1 to 2, nucleotide substitutions, or a complementary sequence thereof; with the proviso that that the oligonucleotide includes a late maturation allele or a normal maturation allele, the late maturation allele and the normal maturation allele being alleles of single nucleotide polymorphisms (SNP), the SNP being selected from the SNPs listed in Table 1.
(720) According to certain embodiments, the oligonucleotide or complement thereof has a length of at least 10 nucleotides, such as at least 16 nucleotides.
(721) According to certain embodiments, the oligonucleotide or complement thereof has a length of at least 16 nucleotides, such as at least 20 nucleotides.
(722) According to certain embodiments, the oligonucleotide or complement thereof has a length of at least 20 nucleotides, such as at least 25 nucleotides.
(723) According to certain embodiments, the oligonucleotide or complement thereof has a length of 10 to 200 nucleotides, such as 10 to 150 nucleotides.
(724) According to certain embodiments, the oligonucleotide or complement thereof has a length of 10 to 100 nucleotides, such as 10 to 70 nucleotides.
(725) According to certain embodiments, the oligonucleotide or complement thereof has a length of 16 to 100 nucleotides, such as 16 to 70 nucleotides.
(726) According to certain embodiments, the oligonucleotide or complement thereof has a length of 10 to 50 nucleotides, such as 10 to 40 nucleotides.
(727) According to certain embodiments, the oligonucleotide or complement thereof has a length of 16 to 50 nucleotides, such as 16 to 40 nucleotides.
(728) According to certain embodiments, the oligonucleotide or complement thereof has a length of 10 to 30 nucleotides, such as 8 to 25 nucleotides.
(729) According to certain embodiments, the oligonucleotide or complement thereof has a length of 16 to 30 nucleotides, such as 16 to 25 nucleotides.
(730) According to certain embodiments, the oligonucleotide or complement thereof is a primer, such as a PCR primer.
(731) According to certain embodiments, the oligonucleotide or complement thereof is a probe, such as a hybridization probe.
(732) According to certain embodiments, the present invention provides a complement to the oligonucleotide specified above. Such complement may be used as a probe, such as a hybridization probe.
(733) A probe or primer according to the present invention may have attached to it a detectable label or reporter molecule. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, for example, in Sambrook et al. (In Molecular Cloning, A Laboratory Manual, CSHL, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998). As a particular example, a probe or primer may include one fluorophor, such as an acceptor fluorophore or donor fluorophor. Such fluorophore may be attached at the 5- or 3 end of the probe/primer.
(734) Probes are generally at least 15 nucleotides in length, such as at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, or more contiguous nucleotides complementary to the target nucleic acid molecule, such as 20 to 70 nucleotides, 20 to 60 nucleotides, 20 to 50 nucleotides, 20 to 40 nucleotides, or 20 to 30 nucleotides.
(735) Primers are typically shorter in length. An oligonucleotide used as primer may be at least 10 nucleotides in length. The specificity of a primer increases with its length. Thus, for example, a primer that includes 30 consecutive nucleotides will anneal to a target sequence with a higher specificity that a corresponding primer of only 15 nucleotides. Thus, to obtain greater specificity, primers of the invention are at least 15 nucleotides in length, such as at least 16, at least 17, at least 18, at least 19, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, or more contiguous nucleotides complementary to the target nucleic acid molecule, such as 15 to 70 nucleotides, 15 to 60 nucleotides, 15 to 50 nucleotides, 15 to 40 nucleotides, or 15 to 30 nucleotides. Primer pairs can be used for amplification of nucleic acid sequences, for example, by PCT, real-time-PCR, or other nucleic-acid amplification methods known in the art.
(736) Kit
(737) The present invention provides in a sixth aspect, a kit for predicting late onset of sexual maturation in rainbow trout, the kit comprising at least one of the oligonucleotides according to the fifth aspect of the present invention.
(738) The present invention provides in a seventh aspect, a kit for selecting a rainbow trout having late onset of sexual maturation, the kit comprising at least one of the oligonucleotides according to the fifth aspect of the present invention.
(739) Having generally described this invention, a further understanding can be obtained by reference to certain specific examples, which are provided herein for purposes of illustration only, and are not intended to be limiting unless otherwise specified.
EXAMPLES
Example 1: Genome Wide Association Study (GWAS)
(740) Dataset: The dataset was acquired from rainbow trout (Oncorhynchus mykiss) from AquaGen's breeding nucleus population of the 2017 year-class.
(741) Egg incubation and first feeding: Eggs were fertilized in freshwater in February 2017. The eggs and yolk sac larvae were kept in covered trays with 8 h background light and 16 h darkness, and the mean water temperature was 8? C., until first feeding in April 2017. During egg incubation and first feeding each family group was kept separate, in 250 single tanks. Each first-feeding tank had 80 L, and 1000 fish per family. The fish were fed by a Storvik robot feeder, every 10 minutes 24 h per day. When the mean weight was 2.5 g the number of fish per tank was reduced to 250. All deformed and small fish were culled at this step.
(742) Smoltification & vaccination: In June 2017, when the mean fish weight was more than 5 g, 140 fish per family were PIT-tagged (Passive Integrated Transponder, Smartrac Unique 12?2 mm, supplied by RFID-solution). After tagging, fish from different families were mixed in three 6 m.sup.3 tanks, and kept at 24 h light and 13? C. In late July 2017, when the ambient water temperature was 12? C., all fish were transferred to two 50 m.sup.3 outdoor tanks, with ambient light and water temperature. Feeding in these tanks was done by Betten automatic feeders. All fish were manually vaccinated in September 2017, by injection of AlphaJect? 5-3. At this stage all fish were individually weighed, and PIT tag registered. Fish weighing less than 20 g and fish with deviations were culled.
(743) Freshwater to Seawater: 25 798 fish with a mean weight of 76 g were transferred to seawater in October 2017. From first feeding until transfer to outdoor tanks the fish were kept at 24 h light and 13? C. The fish were fed commercially available feed for rainbow trout, with nutritional composition and pellet size adjusted to the fish developmental stage and body size.
(744) The 25 798 smolts that were transferred to seawater were reared in a 90-meter polar circle cage under ambient light and sea water temperature, similar to national statistics for the Trondheim area. The fish were fed according to feeding tables adjusted for weight, with automatic feeding systems from Aqua.
(745) Selection & Identification of control fish: In October 2018, the remaining 25.548 fish were anaesthetised and inspected for deformities, skin colour and body shape. Weight and length were measured, and a photo stored for each fish. The purpose of the measurements was to calculate breeding values and select the best fish to be parents for a new generation trout.
(746) At this stage, the 30% biggest trout, with the silveriest skin colour, were kept as breeding candidates. 7 000 fish were pre-selected, at a mean weight of 3.93 kg. The culled ones, 18 547 fish, had a mean weight of 3.00 kg. These fish were transported to a processing plant for harvest during October 2018.
(747) At the processing plant, a group of 1 526 non-maturing fish (average weight of 3.1 kg), with maximum 7 fish per 250 family, were selected for registration of yield and analysis of pigment and DNA. The gender of these fish was determined when the fish were opened, and the gonads could be seen. This group of fish was considered the control group, i.e. non-maturing fish with known gender.
(748) Seawater to freshwater for spawning: 6900 fish of the pre-selected fish, with a mean weight of 5.11 kg, were sorted again in December 2018. All fish with a tendency for maturation were selected. Maturation is more difficult to determine in fish less than 2 years of age, as they have a silverier skin colour and less clear external sexual maturation characteristics. 1 748 fish were selected as broodstock candidates, and tissue samples were taken from all these fish for DNA analysis.
(749) The selected fish were transferred to freshwater in AquaGen's broodstock facilities in Kyrks?ter?ra, Norway, for spawning in February 2019. Included in this group were also fish of the type neo-males, which are sex-reversed so that genetic females develop masculine reproductive organs and produce sperm. This is done by administering testosterone to the fish at the time when the reproductive organs are first developed (at first feeding, around 0.15 g) (Biotechnology & Biotechnological Equipment, 2009, 23:4, 1509-1514, DOI: 10.2478/V10133-009-0002-X). The change in hormone levels stimulates females to develop male gonads, and they develop male external characteristics when they mature 2 years later. All neo-males were genotyped in advance to ensure that only genetic females were present.
(750) During the last period in freshwater (1 month) around 60% of the fish went through final maturation and became ready to spawn. Fish that did not go through final maturation, were culled. The gender of these fish was not checked. For the fish that went through final maturation, gender was determined by whether the spawning product was eggs (from females) or sperm (from males). The fish were kept at a 24 h light, and the mean water temperature was 10? C. during the month in freshwater.
(751) Genotyping: As already described above, tissue samples were taken from control fish and broodstock candidates. All tissue samples were taken from the tail fin of the fish for DNA-extraction and genotyping. DNA was extracted from the tissue samples, using a standard method (DNAdvance? kit from Beckman Coulter, Indianapolis, United States). The DNA was genotyped using the Axiom? Trout genotyping Array, a SNP-chip harbouring 57,501 single nucleotide polymorphisms (SNPs) in 96-well format. This SNP-chip was developed by AquaGen in collaboration with the United Stated Department of Agriculture 20 (USDA) and Affymetrix, and is commercially available from Affymetrix (San Diego, USA). Genotyping was performed using the Affymetrix' proprietary Axiom? platform, following the Axiom? 2.0 Assay Automated Workflow User Guide.
(752) Based on the raw data provided by the Axiom? machinery, genotypes were called using the Affymetrix PowerTools software. The analysis and interpretation of the raw data was done according to the Best Practices 30 Workflow provided by Affymetrix. SNPs and animals having quality parameters below the default thresholds, provided in the Best Practices Workflow, were not considered for further analyses.
(753) Only markers in the PolyHighResolution and NoMinorHom categories were analysed, as recommended by the genotyping platform producer. SNP markers with missingness above 10% and animals with missing data above 15% was removed, resulting in a dataset of 42,314 SNP markers and 1,647 fish with recorded maturation status and sex.
(754) GWAS: To search for DNA markers associated with late maturation in the sampled rainbow trout population, a single marker genome-wide association study was conducted using genotypes for 1 647 fish with recorded maturation status. Sex was included as a covariate in the analysis. The association study was conducted with the GCTA software (Yang et al., 2011, Am J Hum Genet. 2011 88(1): 76-82) which implements a mixed linear model single-marker association analysis using the -mlma-loco option of GCTA (Yang et al., 2014, Nat Genet. February; 46(2):100-6). Sex was included as a covariate in the analysis using the covar parameter. The model fitted to the performance information for each trait and each SNP was:
LATEMAT=a+bx+g?+e
where LATEMAT is the maturation status of the fish coded as 0 or 1 (0=immature; 1=mature), a is the mean term, b is the fixed additive effect of the candidate SNP to be tested for association, x is the SNP genotype indicator variable coded as 0, 1 or 2, g? is the random polygenic effect, i.e. the accumulated effect of all SNPs except those on the chromosome where the candidate SNP is located, and e is the residual. The var(g?) is re-estimated each time when a chromosome is excluded from calculating the genomic relationship matrix.
(755) The results of the genome-wide association study are presented in table 1 and table 3.
(756) TABLE-US-00005 TABLE 3 SNP # b p se 1 0.072621 0.000116 0.018841 2 0.066487 0.000363 0.018646 3 ?0.0733 0.000143 0.019278 4 0.069419 0.000374 0.01951 5 0.232912 1.39E?06 0.048258 6 ?0.20478 1.21E?05 0.046799 7 ?0.0878 3.16E?06 0.018842 8 0.155719 2.26E?05 0.036752 9 0.20537 3.29E?06 0.044148 10 ?0.19734 9.78E?06 0.044628 11 ?0.19984 7.04E?06 0.044482 12 0.19337 1.58E?05 0.044785 13 0.053904 0.006195 0.019693 14 0.066758 0.006195 0.024389 15 ?0.07529 0.001926 0.024278 16 0.062764 0.003561 0.021534 17 ?0.09764 3.73E?05 0.023679 18 ?0.09032 2.55E?05 0.021452 19 0.125808 4.33E?06 0.02738 20 ?0.07647 0.000213 0.020651 21 0.115704 1.72E?05 0.026915 22 0.111758 1.22E?05 0.025546 23 0.091821 6.78E?06 0.020402 24 ?0.0919 1.31E?06 0.018996 25 ?0.09971 0.005334 0.035786 26 ?0.05523 0.006552 0.020316 27 0.126665 0.00635 0.046413 28 0.05894 0.001665 0.018745 29 ?0.1057 0.000305 0.029273 30 0.147067 0.00117 0.045304 31 ?0.16004 0.000784 0.047657 32 ?0.10704 0.000775 0.031843 33 0.115041 0.000899 0.034647 34 0.12055 0.000502 0.034646 35 0.119566 0.000526 0.034488 36 ?0.08267 0.000725 0.024459 37 0.108508 0.002291 0.03558 38 0.110396 0.001872 0.035499 39 0.108853 0.002157 0.035483 40 0.110637 0.002715 0.0369 41 ?0.14723 0.000184 0.039366 42 0.070596 0.000442 0.020092 43 0.069851 0.00041 0.019768 44 ?0.06207 0.000744 0.018403 45 ?0.07639 0.000417 0.021643 46 0.073182 0.000715 0.021626 47 ?0.06458 0.000603 0.018827 48 ?0.13404 0.003149 0.045395 49 ?0.10799 0.003762 0.037271 50 0.056679 0.006409 0.020791 51 ?0.06892 0.000714 0.020366 52 ?0.14191 0.000392 0.040027 53 ?0.05961 0.001254 0.018476 54 ?0.06682 0.000265 0.018321 55 ?0.06498 0.000317 0.018043 56 0.127081 0.00027 0.034891 57 ?0.11243 0.000252 0.030712 58 0.159429 0.000285 0.043937 59 0.069496 0.000553 0.020121 60 ?0.09543 0.000307 0.026438 61 ?0.08153 0.000847 0.02443 62 0.05459 0.002727 0.018216 63 0.072264 0.003723 0.024912 64 0.09553 0.003666 0.032879 65 0.061393 0.001841 0.019711 66 ?0.06519 0.001032 0.019865 67 0.063174 0.000705 0.018649 68 ?0.06968 0.000576 0.020241 69 ?0.07971 0.00024 0.021706 70 ?0.08226 0.000214 0.02222 71 0.099409 1.23E?05 0.022736 72 ?0.08576 0.000127 0.022383 73 ?0.08458 0.000187 0.022635 74 ?0.08047 0.000126 0.020985 75 0.064418 0.000812 0.019236 76 0.063253 0.000951 0.019141 77 0.044405 0.021796 0.019358 78 0.066171 0.011509 0.026187 79 ?0.04933 0.015787 0.020436 80 0.042566 0.024577 0.018935 81 0.060481 0.014357 0.024704 82 ?0.09819 0.011979 0.039075 83 0.110566 0.009111 0.042397 84 0.111622 1.93E?05 0.026122 85 0.105807 3.43E?06 0.022787 86 0.104419 2.28E?06 0.022091 87 ?0.09058 1.21E?05 0.020704 88 ?0.11374 1.08E?05 0.025847 89 0.096867 9.5E?06 0.021875 90 0.104326 5.27E?05 0.025802 91 0.108363 1E?05 0.024537 92 0.105876 1.7E?05 0.024617 93 ?0.1047 1.33E?07 0.019847 94 0.079676 2.82E?05 0.019027 95 0.077646 4.61E?05 0.019056 96 ?0.0792 3.17E?05 0.019034 97 0.120882 4.93E?05 0.029782 98 ?0.12623 2.36E?05 0.029858 99 0.123603 3.31E?05 0.029775 100 ?0.12114 4.72E?05 0.02977 101 ?0.13242 9.56E?06 0.029912 102 0.075256 0.010179 0.029286 103 0.043721 0.014083 0.017808 104 ?0.065 0.004754 0.023025 105 ?0.04499 0.016455 0.018755 106 ?0.07967 0.000102 0.020501 107 ?0.07302 9.19E?05 0.018671 108 ?0.0709 0.000138 0.018599 109 ?0.07402 0.00024 0.020152 110 ?0.09654 4.21E?05 0.023571 111 ?0.08881 4.36E?06 0.019335 112 ?0.09654 4.21E?05 0.023571 113 0.09124 2.02E?05 0.021402 114 0.094936 3.3E?07 0.018595 115 0.081369 1.22E?05 0.018605 116 ?0.08526 2.5E?06 0.018109 117 0.081366 4.64E?06 0.017763 118 0.07669 1.78E?05 0.017876 119 0.104425 2.77E?06 0.02228 120 ?0.1101 1.97E?07 0.021165 121 0.090614 5.93E?07 0.018147 122 ?0.07324 4.21E?05 0.017881 123 ?0.07727 1.56E?05 0.017885 124 0.162104 6.3E?06 0.035896 125 ?0.08414 1.63E?06 0.017546 126 ?0.09229 8.96E?07 0.018783 127 0.112832 9.8E?08 0.021168 128 ?0.1145 6.4E?08 0.021176 129 ?0.11025 1.84E?07 0.02114 130 ?0.10958 2.43E?07 0.021225 131 0.111905 1.32E?07 0.021211 132 0.093353 3.85E?07 0.018391 133 0.088411 1.81E?06 0.018519 134 0.09229 3.12E?07 0.018039 135 ?0.1046 1.68E?08 0.018538 136 ?0.08991 1.52E?05 0.020784 137 0.10297 2.56E?08 0.018489 138 ?0.09344 3.12E?07 0.018263 139 ?0.08991 1.52E?05 0.020784 140 0.112587 6.95E?10 0.018256 141 ?0.09459 5.24E?07 0.018852 142 0.096872 8.73E?08 0.018103 143 0.101851 1.87E?08 0.018112 144 0.096511 8.44E?08 0.018014 145 0.080036 5.37E?06 0.017591 146 0.117443 1.18E?07 0.022174 147 0.084425 1.2E?07 0.015949 148 ?0.11203 4.33E?07 0.022169 149 ?0.09458 2.84E?05 0.022593 150 0.106663 1E?06 0.021805 151 ?0.08603 1.17E?05 0.019631 152 0.08138 2.35E?05 0.019247 153 ?0.09825 2.32E?06 0.0208 154 ?0.10695 6.85E?07 0.021539 155 0.10169 2.53E?06 0.021609 156 0.096217 2.48E?05 0.022817 157 0.097621 1.77E?05 0.022743 158 ?0.09713 1.93E?05 0.022735 159 ?0.09638 2.24E?05 0.022737 160 ?0.09391 3.63E?05 0.02274 161 ?0.09331 2.82E?05 0.022282 162 ?0.10438 0.008011 0.039364 163 0.132686 0.008268 0.050242 164 0.051735 0.01064 0.020254 b (also referred to as the beta value) is also called the allele substitution effect and refers to the estimated effect of receiving one copy of the tested allele (the normal maturation allele in table 1). Reference is e.g. made to SNP #140, wherein the mean effect on the phenotype of going from genotype TT to TC is 0.112587 while going from TT to CC is 0.112587 X2 = 0.225174. The phenotype in the present case is maturation status coded as 0 when immature and 1 when mature, the effect of 0.112587 translates to an 11 percentage point increase in percentage of mature fish in the data set. p measure of statistical evidence against a null hypothesis. A smaller p-value indicates stronger evidence substantiating the alternative hypothesis. In practice, the p-value indicates how likely a putative characteristic associated variant is due to random chance. High beta value and low se value will provide a low p-value, while low beta value and high se value will provide a high p-value. se represents the standard error which depends on the sample size and how well the observed data fits the linear model.
Linkage Disequilibrium (LD)
(757) LD or, more precisely, gametic phase linkage disequilibrium, is used in order to describe the co-inheritance of alleles at genetically linked polymorphisms, at the population level. Two polymorphisms are defined to be in strong LD if the square of the correlation coefficient between the two loci (r2, the most commonly used measure of LD) is equal to or larger than 0.5, more preferably equal to or larger than 0.7, even more preferably equal to or larger than 0.8 and most preferably equal to or larger than 0.9.
(758) A distinctive and highly significant QTL for maturity has been detected on chromosome 28 (see
(759) Table 4 provides a list of the 16 SNPs on chromosome 28 that are of particular interest and their position on the chromosome. Further, the list is sorted according to the square of the correlation coefficient between two loci.
(760) TABLE-US-00006 TABLE 4 A_SNP # A_BP # B_SNP # B_BP # R2 135 11414120 137 11414399 0.996177 128 11093692 129 11096202 0.995723 120 10378833 129 11096202 0.990043 120 10378833 128 11093692 0.988618 142 11667915 143 11704242 0.980364 143 11704242 144 11745469 0.979454 142 11667915 144 11745469 0.976509 129 11096202 131 11148320 0.97439 128 11093692 131 11148320 0.974313 120 10378833 131 11148320 0.967308 134 11382381 138 11487704 0.961402 128 11093692 130 11139401 0.934455 129 11096202 130 11139401 0.934442 120 10378833 130 11139401 0.927666 130 11139401 131 11148320 0.923362 138 11487704 140 11537736 0.870889 127 10605800 130 11139401 0.854619 134 11382381 140 11537736 0.841967 127 10605800 128 11093692 0.82477 127 10605800 129 11096202 0.824571 120 10378833 127 10605800 0.818416 127 10605800 131 11148320 0.813752 131 11148320 146 12063041 0.801846 134 11382381 137 11414399 0.776771 134 11382381 135 11414120 0.775718 137 11414399 138 11487704 0.755322 135 11414120 138 11487704 0.754192 137 11414399 140 11537736 0.640884 135 11414120 140 11537736 0.638918 134 11382381 147 12252318 0.63764 138 11487704 147 12252318 0.629467 137 11414399 142 11667915 0.571017 135 11414120 142 11667915 0.569716 137 11414399 143 11704242 0.568289 137 11414399 144 11745469 0.567879 135 11414120 143 11704242 0.566992 135 11414120 144 11745469 0.566587 137 11414399 147 12252318 0.555781 135 11414120 147 12252318 0.553991 140 11537736 147 12252318 0.547934 140 11537736 143 11704242 0.458642 140 11537736 144 11745469 0.456815 140 11537736 142 11667915 0.456404 134 11382381 143 11704242 0.439942 134 11382381 142 11667915 0.439518 134 11382381 144 11745469 0.43747 138 11487704 142 11667915 0.428019 138 11487704 144 11745469 0.425464 138 11487704 143 11704242 0.425421 129 11096202 143 11704242 0.399344 129 11096202 142 11667915 0.397379 128 11093692 142 11667915 0.395977 131 11148320 143 11704242 0.390864 131 11148320 142 11667915 0.388907 131 11148320 144 11745469 0.387393 130 11139401 143 11704242 0.362932 130 11139401 142 11667915 0.360975 130 11139401 144 11745469 0.359626 143 11704242 146 12063041 0.316434 144 11745469 147 12252318 0.3161 144 11745469 146 12063041 0.315437 142 11667915 146 12063041 0.313873 143 11704242 147 12252318 0.313531 142 11667915 147 12252318 0.312988 130 11139401 137 11414399 0.227957 130 11139401 135 11414120 0.227507 127 10605800 137 11414399 0.226163 127 10605800 135 11414120 0.225741 129 11096202 137 11414399 0.219178 128 11093692 137 11414399 0.219139 129 11096202 135 11414120 0.218713 128 11093692 135 11414120 0.218672 131 11148320 137 11414399 0.216527 131 11148320 135 11414120 0.216046 127 10605800 140 11537736 0.211376 127 10605800 134 11382381 0.192605 146 12063041 147 12252318 0.191637 130 11139401 140 11537736 0.188975 127 10605800 138 11487704 0.185399 128 11093692 140 11537736 0.182801 129 11096202 140 11537736 0.182682 131 11148320 140 11537736 0.179886 130 11139401 134 11382381 0.17262 130 11139401 138 11487704 0.166937 128 11093692 134 11382381 0.16544 129 11096202 134 11382381 0.16483 131 11148320 134 11382381 0.163749 137 11414399 146 12063041 0.160392 135 11414120 146 12063041 0.160383 128 11093692 138 11487704 0.159903 129 11096202 138 11487704 0.159742 131 11148320 138 11487704 0.158182 140 11537736 146 12063041 0.133768 138 11487704 146 12063041 0.115124 134 11382381 146 12063041 0.114512 A_SNP # a first SNP, wherein the number refers to the SNP # according to table 1. A_BP # position of the A_SNP # (first SNP) on chromosome 28. B_SNP # a second SNP, wherein the number refers to the SNP # according to table 1. B_BP # position of the B_SNP # (second SNP) on chromosome 28. R2 correlation coefficient between A_SNP # and B_SNP #.
TABLE 5A AND TABLE 5B PROVIDES A LIST OF THE 16 SNPS ON CHROMOSOME 28 THAT ARE OF PARTICULAR INTEREST, THEIR POSITION ALONG THE CHROMOSOME AND THEIR P-VALUE. TABLE 5A IS SORTED ACCORDING TO THE POSITION OF THE SNPS ALONG CHROMOSOME 28 WHILE TABLE 5B IS SORTED ACCORDING TO THE P-VALUE OF THE SNPS.
(761) TABLE-US-00007 TABLE 5a SNP # BP # p 120 10378833 1.97073E?07 127 10605800 9.79982E?08 128 11093692 6.40093E?08 129 11096202 1.83833E?07 130 11139401 2.43284E?07 131 11148320 1.32183E?07 134 11382381 3.11917E?07 135 11414120 1.67786E?08 137 11414399 2.55833E?08 138 11487704 3.11633E?07 140 11537736 6.95304E?10 142 11667915 8.7344E?08 143 11704242 1.87124E?08 144 11745469 8.4426E?08 146 12063041 1.18044E?07 147 12252318 1.20003E?07
(762) TABLE-US-00008 TABLE 5b SNP # BP # p 140 11537736 6.95304E?10 135 11414120 1.67786E?08 143 11704242 1.87124E?08 137 11414399 2.55833E?08 128 11093692 6.40093E?08 144 11745469 8.4426E?08 142 11667915 8.7344E?08 127 10605800 9.79982E?08 146 12063041 1.18044E?07 147 12252318 1.20003E?07 131 11148320 1.32183E?07 129 11096202 1.83833E?07 120 10378833 1.97073E?07 130 11139401 2.43284E?07 138 11487704 3.11633E?07 134 11382381 3.11917E?07 SNP # the number refers to the SNP # according to table 1. BP # position of the SNP along chromosome 28. p measure of statistical evidence against a null hypothesis. A smaller p-value indicates stronger evidence substantiating the alternative hypothesis. In practice, the p-value indicates how likely a putative characteristic associated variant is due to random chance. High beta value and low se value will provide a low p-value, while low beta value and high se value will provide a high p-value.