Probiotic compositions for use in the treatment of bowel diseases

10155015 ยท 2018-12-18

Assignee

Inventors

Cpc classification

International classification

Abstract

The present disclosure is directed to methods of administering and compositions comprising Lactobacillus plantarum CECT 7478, Lactobacillus plantarum CECT 7485, and Pediococcus acidilactici CECT 7483 or a mutant or variant thereof. The compositions and methods are useful in the probiotic treatment of bowel diseases or conditions such as Inflammatory Bowel Disease, Irritable Bowel Syndrome, and abdominal distension and bloating.

Claims

1. A method of treating abdominal distension and bloating, comprising administering to a patient in need thereof a therapeutically effective amount of an ingestible probiotic composition comprising at least one strain selected from the group consisting of: (a) from about 10.sup.5 cfu to about 10.sup.12 cfu of the isolated strain of Lactobacillus plantarum deposited in the Spanish Type Culture Collection (CECT) under the accession number CECT 7484, per gram weight of the composition; (b) from about 10.sup.5 cfu to about 10.sup.12 cfu of the isolated strain of Lactobacillus plantarum deposited in the Spanish Type Culture Collection (CECT) under the accession number CECT 7485, per gram weight of the composition; and (c) from about 10.sup.5 cfu to about 10.sup.12 cfu of the isolated strain of Pediococcus acidilactici deposited in the Spanish Type Culture Collection (CECT) under the accession number CECT 7483, per gram weight of the composition.

2. The method of claim 1, wherein the isolated strain has been cultivated in a suitable culture medium and post-treated after cultivation to obtain a biologically pure culture, and wherein the resulting biologically pure culture is in the form of a liquid or solid.

3. The method of claim 2, wherein the post-treatment is freeze drying.

4. The method of claim 1, wherein the composition further comprises at least one pharmaceutically acceptable excipient.

5. The method of claim 1, wherein the composition further comprises at least one veterinary acceptable excipient.

6. The method of claim 1, wherein the composition further comprises at least one edible ingredient.

7. The method of claim 6, wherein the composition is a dietary supplement.

8. A method of treating inflammatory bowel conditions or disorders comprising administering to a patient in need thereof a therapeutically effective amount of an ingestible probiotic composition comprising at least one strain selected from the group consisting of: (a) from about 10.sup.5 cfu to about 10.sup.12 cfu of the isolated strain of Lactobacillus plantarum deposited in the Spanish Type Culture Collection (CECT) under the accession number CECT 7484, per gram weight of the composition; (b) from about 10.sup.5 cfu to about 10.sup.12 cfu of the isolated strain of Lactobacillus plantarum deposited in the Spanish Type Culture Collection (CECT) under the accession number CECT 7485, per gram weight of the composition; and (c) from about 10.sup.5 cfu to about 10.sup.12 cfu of the isolated strain of Pediococcus acidilactici deposited in the Spanish Type Culture Collection (CECT) under the accession number CECT 7483, per gram weight of the composition.

9. The method of claim 8, wherein the bowel condition or disorder is bowel inflammation.

10. The method of claim 8, wherein the bowel condition or disorder is Inflammatory Bowel Disease.

11. The method of claim 8, wherein the isolated strain has been cultivated in a suitable culture medium and post-treated after cultivation to obtain a biologically pure culture, and wherein the resulting biologically pure culture is in the form of a liquid or solid.

12. The method of claim 11, wherein the post-treatment is freeze drying.

13. The method of claim 8, wherein the composition further comprises at least one pharmaceutically acceptable excipient.

14. The method of claim 8, wherein the composition further comprises at least one veterinary acceptable excipient.

15. The method of claim 8, wherein the composition further comprises at least one edible ingredient.

16. The method of claim 15, wherein the composition is a dietary supplement.

17. A method of treating Irritable Bowel Syndrome or disorders with similar symptoms comprising administering to a patient in need thereof a therapeutically effective amount of an ingestible probiotic composition comprising at least one strain selected from the group consisting of: (a) from about 10.sup.5 cfu to about 10.sup.12 cfu of the isolated strain of Lactobacillus plantarum deposited in the Spanish Type Culture Collection (CECT) under the accession number CECT 7484, per gram weight of the composition; (b) from about 10.sup.5 cfu to about 10.sup.12 cfu of the isolated strain of Lactobacillus plantarum deposited in the Spanish Type Culture Collection (CECT) under the accession number CECT 7485, per gram weight of the composition; and (c) from about 10.sup.5 cfu to about 10.sup.12 cfu of the isolated strain of Pediococcus acidilactici deposited in the Spanish Type Culture Collection (CECT) under the accession number CECT 7483, per gram weight of the composition.

18. The method of claim 17, wherein the isolated strain has been cultivated in a suitable culture medium and post-treated after cultivation to obtain a biologically pure culture, and wherein the resulting biologically pure culture is in the form of a liquid or solid.

19. The method of claim 18, wherein the post-treatment is freeze drying.

20. The method of claim 17, wherein the composition further comprises at least one pharmaceutically acceptable excipient.

21. The method of claim 17, wherein the composition further comprises at least one veterinary acceptable excipient.

22. The method of claim 17, wherein the composition further comprises at least one edible ingredient.

23. The method of claim 22, wherein the composition is a dietary supplement.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 represents the pulsed field gel electrophoresis patterns of Not-I or Sfi-I (left) and Sma-I (right) restricted genomic DNA of: 1, Pediococcus acidilacticiCECT 7483; 2, Lactobacillus plantarum CECT 7484; 3, Lactobacillus plantarum CECT 7485. As controls: 4, commercial strain P. acidilactici Rosse111001 (Institut Rossell, Canada); 5, L. plantarum 299v (Probi AB, Sweden); and 6, L. plantarum strain isolated from commercial product VSL#3 (VSL Pharmaceuticals, USA). This Figure refers to the strain genotyping section.

(2) FIG. 2 represents the Disease Activity Index (Y-axis) in a group of mice suffering from a DSS-induced intestinal inflammation. X-axis represents the administration of: a, probiotic formulation of the invention in a group of mice suffering from a DSS-induced intestinal inflammation; b, a commercial probiotic formulation (VSL#3) in a group of mice suffering from a DSS-induced intestinal inflammation; c, vehicle in a group of mice suffering from a DSS-induced intestinal inflammation; and d, vehicle in a healthy control group. This figure refers to the In Vivo Effect on Chemically-induced Gut Inflammation section.

(3) FIG. 3 represents the levels of IL-6 (Y-axis) in a group of mice suffering from a DSS-induced intestinal inflammation. X-axis represents: a, probiotic formulation of the invention administered to a group of mice suffering from a DSS-induced intestinal inflammation; b, a commercial probiotic formulation (VSL#3) administered to a group of mice suffering from a DSS-induced intestinal inflammation; c, vehicle administered to a group of mice suffering from a DSS-induced intestinal inflammation; and d, vehicle in a healthy control group. This figure refers to the In Vivo Effect on Chemically-induced Gut Inflammation section.

(4) FIG. 4 represents the number of Symptom-free weeks (i.e. number of weeks before the onset of the first symptom, thus being the Disease Activity Index equal to zero) (Y-axis) in a IL-10 knock-out mouse model. X-axis represents the administration of: a, the probiotic composition of the invention to a IL-10 knock-out mice group; b, the commercial probiotic formulation VSL#3 to a IL-10 knock-out mice group; c, PBS to a IL-10 knock-out mice group; and d, vehicle in a healthy control group. This figure refers to the In Vivo Effect on Spontaneous Gut Inflammation section.

(5) FIG. 5 represents the levels of IFN- (Y-axis) in a IL-10 knock-out mouse model. X-axis represents: a, probiotic formulation of the invention to a IL-10 knock-out mice group; b, a commercial probiotic formulation (VSL#3) to a IL-10 knock-out mice group; c, vehicle to a IL-10 knock-out mice group; and d, vehicle to a healthy control group. This figure refers to the In Vivo Effect on Chemically-induced Gut Inflammation section.

(6) FIG. 6 represents the levels of IL-6 (Y-axis) in a IL-10 knock-out mouse model. X-axis represents: a, probiotic formulation of the invention to a IL-10 knock-out mice group; b, a commercial probiotic formulation (VSL#3), to a IL-10 knock-out mice group; c, vehicle administered to a IL-10 knock-out mice group; and d, vehicle to a healthy control group. This figure refers to the In Vivo Effect on Chemically-induced Gut Inflammation section.

(7) FIG. 7 represents the variation of the IBSQoL score compared to baseline (Y-axis) of volunteers treated with capsules including the composition (black bars) or placebo (white bars). X-axis represents the variation of the score 21 days and after 42 days of treatment. This figure refers to the Improvement of Health-Related Quality of Life in the In Vivo Efficacy on IBS Subiects section.

(8) FIG. 8 represents the variation of the VSI score compared to baseline (Y-axis) of volunteers treated with capsules including the composition (black bars) or placebo (white bars). X-axis represents the variation of the score after three weeks and after six weeks of treatment. This figure refers to the Improvement of the Visceral Sensitivity in the In Vivo Efficacy on IBS Subjects section.

EXAMPLES

(9) The following sections describe the characterization of the strains of the invention, their specific probiotic features and their physiological effects on the gastrointestinal and immune systems. As used hereinafter, strain F1033 corresponds to Pediococcus acidilactici CETC 7483, strain F2064 to Lactobacillus plantarum CECT 7484, and strain F2076 to Lactobacillus plantarum CECT 7485.

(10) 1. Isolation of Microorganisms

(11) A) Methods

(12) For isolation of microorganisms, fresh stools and saliva (Daniel C. et al., 2006) were collected from 0-5 year-old children and dissolved in PBS buffer (pH 7.4), aliquoted and plated on MRS supplemented with various antibiotic combinations. Strains were cultured under microaerophilic conditions (5% CO.sub.2) at 37 C. Incubation time depended on the growth rate, but run normally from 24 h to 3 days. Gram staining was carried out in order to get a first identification. Once grown, isolated strains were stored by lyophilisation in PBS 0.1 with 15% skim milk powder.

(13) B) Results

(14) Novel strains F2064, F2076 and F1033 were grown on MRS agar supplemented with 10 g/ml vancomycin. Microscopic examination revealed that strains F2064 and F2076 are Gram-positive bacilli, while strain F1033 is a Gram-positive with coccal morphology.

(15) 2. Identification

(16) A) Methods

(17) Genomic DNA was extracted using Wizard genomic DNA purification kit (Promega). For each isolated strain, the 16S gene was amplified by PCR, using the universal primers 27f, 357f, 907r and 1492r (Weisburg W. G. et al., 1991), which generate a nearly full-length 16S rRNA fragment (1465 bp). DNA was washed using Quiaquick kit (Quiagene, GmbH, Hilden, Germany) and four sequencing reactions were performed per sample, using BigDye v.3.1 kit, on a Genetic Analyzer 3130 (Applied Biosystems). Selected sequencing primers DNA Sequence Analysis v.5.2 (Applied Biosystems) software was used to collect data and to build chromatograms, which were analyzed through Chromas (Technelysium Pty Ltd.) and BioEdit (Ibis Biosciencies) software. Genus and species identification was performed by comparison of the obtained sequence with 16S sequences of known organisms from both RefSeq data base (http://www.ncbi.nlm.nih.gov/RefSeq/) by means of a BLASTN search (Altschul S. F. et al., 1990), and from the Ribosomal Database Project (Wang Q. et al., 2007).

(18) TABLE-US-00001 TABLE1 Primersusedforamplifyingandsequencing the16Sgene. Orienta- Step Primer tion 5 .fwdarw. 3 Sequence Amplifi- 27f forward AGAGTTTGATCCTGGCTCAG cation (SEQIDNO:1) 1492r reverse GGTTACCTTGTTACGACTT (SEQIDNO:2) Se- 27f forward AGAGTTTGATCCTGGCTCAG quencing (SEQIDNO:1) 357f forward CGCCCGCCGCGCCCCGCGCCCGGCCCGC CGCCCCCGCCCCCCTACGGGAGGCAGCA G(SEQIDNO:3) 907r reverse CCGTCAATTCCTTTGAGTTT (SEQIDNO:4) 1492r reverse GGTTACCTTGTTACGACTT (SEQIDNO:2)

(19) B) Results

(20) Strains F2064 and F2076 were identified as members of the Lactobacillus plantarum group. Strain F1033 was identified as Pediococcus acidilactici.

(21) 3. Survival to GI Tract

(22) A) Methods

(23) To assess tolerance to acidic environment, 20-l aliquots of each bacterial strain culture were placed in 96-well plates, together with 200-l aliquots of MRS medium adjusted with HCl to pH 2 and 3 (Panreac). Plates were kept at 37 C. for 1 h and optical density at 620 nm was measured. Finally, viable cells were determined by plate counting and compared to the number of viable cells in the inoculum.

(24) To assess tolerance to bile salts, 20-l aliquots of each bacterial strain culture were placed in a 96-well plate together with 200 l of MRS medium supplemented with 0.5% Oxgall (Sigma). Plates were incubated at 37 C. and 5% CO.sub.2 for 3 hours, and then optical density was measured. Finally, viable cells were determined by plate counting and compared to the number of viable cells in the inoculum.

(25) B) Results

(26) All three strains displayed a good ability to survive acidic environments, with less than one log reduction in the number of viable cells after 1 h incubation in MRS at pH=2 or pH=3. Strains also posses a marked resistance to bile salts, with less than a 50% reduction in the number of viable cells after 3 h incubation in MRS supplemented with 0.5% of bile salts.

(27) 4. Adherence

(28) A) Methods

(29) Porcine intestine was washed with PBS pH 7.4, containing 0.01% gelatin and a cocktail of protease inhibitors (Complete, Sigma). The mucosa was scrapped and dissolved in HEPES-Hank's buffer (10 mM HEPES, pH 7.4) (Collado M. et al., 2007) containing the aforementioned inhibitors. Then, mucus was centrifuged at 13000 rpm for 10 min using the same buffer. Supernatants were recovered and protein content was determined by Bradford protocol. 24 h before the assay, 1 ml of mucus solution 0.5 mg/ml was incubated in wells of a 24-well ELISA plate.

(30) Each strain to be tested was grown overnight in MRS medium supplemented with tritium-labeled thymidine (5 l in 3 ml of MRS). Cultures were centrifuged and adjusted to 10.sup.8 cfu/ml in PBS by counting on a Neubauer chamber and samples of each culture were taken to determine the amount of tritium-labeled thymidine incorporated by means of a scintillation reader. Then, 0.5 ml were added to the mucus-containing wells of the 24-well plate and incubated at 37 C. for 60 min. Supernatant of each well was removed, and wells were washed twice with MEM Alpha medium (Gibco) to remove loosely adherent bacteria. Finally, wells were scrapped to retrieve the mucus together with the adhering bacteria, and radioactivity was measured. Specific activity (cpm/CFU) of each culture was calculated from the total radioactivity incorporated in the PBS suspension adjusted to 10.sup.8 cfu/ml. Lactobacillus rhamnosus GG (Valio Ltd, Finland) was used as a positive control, because of its remarkable high adherence to the intestinal epithelium (Jacobsen C. N. et al., 1999).

(31) Caco-2 cells were obtained from ATCC (ECACC No: 86010202). Cells were seeded in 24-well plates and allowed to grow in DMEM until confluence (37 C., 5% CO.sub.2). The experimental procedure to obtain the number of bacteria that adhere per unit of caco-2 cells area is essentially the same as the one explained above for adhesion to mucus.

(32) B) Results

(33) Adhesion capacity of strains F1033, F2064 and F2076 was measured from scintillation of tritium-labeled thymidine and compared to those of the commercial strain L. rhamnosus GG. Adhesion to epithelial cells using the Caco-2 model is a common assay for probiotic strains. Compared to L. rhamnosus GG, strains F2064 and F2076 show an affinity for epithelial cells 60% lower. However, considering the high affinity of L. rhamnosus GG for epithelial cells, these values are comparable to other well known probiotics such as L. plantarum 299v, and superior to many other probiotic strains (Jacobsen C. N. et al., 1999). On the other hand, adhesion of strain F1033 to epithelial cells is 2.5 times higher than L. rhamnosus GG. Besides, strains F2064 and F2076 displayed a much higher affinity for intestinal mucus than for epithelial cells, while strain F1033 showed the opposite behavior. Results are shown in the following table.

(34) TABLE-US-00002 TABLE 2 Mucus adhesion of probiotic bacterial strains. [* From a total bacteria concentration of 10.sup.8 cfu]. Strain Caco-2 (cfus/cm.sup.2) Mucus (cfus/cm.sup.2) F1033 1.21 0.17 .Math. 10.sup.5 cfu 6.06 0.73 .Math. 10.sup.4 cfu F2064 1.89 0.12 .Math. 10.sup.4 cfu 2.25 0.12 .Math. 10.sup.6 cfu F2076 1.71 0.16 .Math. 10.sup.4 cfu 5.91 0.03 .Math. 10.sup.5 cfu L. rhamnosus GG 4.41 0.22 .Math. 10.sup.4 cfu 3.29 0.57 .Math. 10.sup.6 cfu

(35) 5. Antagonism Capacity

(36) A) Methods

(37) The following indicator strains were used: P. mirabilis CECT 4557, K. oxytoca CIP 103434, C. perfringens ATCC 13124, C. ramosum ATCC 25582, E. faecalis CETC 795, Y. pseudotuberculosis ATCC29833, B. vulgatus ATCC 8482 and B. thetaiotaomicron ATCC2079 were collection strains. C. albicans, S. enterica thyphimurium, S. enterica cholerasuis, C. jejuni, E. coli and P. aeruginosa were lab isolates. Indicator strains were swabbed uniformly in plates containing the appropriate medium (Oxoid) and grown to confluence at the appropriate temperatures in microaerophilic conditions (5% CO.sub.2). Then, 6 mm (diameter) cylinder sections of confluent F1033, F2064 or F2076 agar plates were placed upside-down on the indicator strain plate and incubated overnight at 37 C. The next day, inhibition zones were measured by placing the agar plate over a flat rule. Growth inhibitory activity (GI) was calculated as follows:

(38) GI = ( IZD - CD ) 2
where IZD is the Inhibition Zone Diameter and CD is the cylinder diameter, measured in millimeters.

(39) B) Results

(40) TABLE-US-00003 TABLE 3 Growth inhibitory activity (GI) of probiotic strains against 12 pathogenic or potentially pathogenic strains, and against 2 common commensal strains of the gastrointestinal flora. F2064 F2076 F1033 Pathogens C. albicans 2 0.5 1.25 S. enterica typhimurium 1 1 0.25 S. enterica cholerasuis 1 1 0.5 E. coli 1.75 3.7 1.1 C. jejuni 0 0 4.75 K. oxytoca 0.5 1 2 P. mirabilis 4 1.5 0.5 P. aeruginosa 3 3.75 4.5 E. faecalis 1.75 1 1.25 C. perfringens 2.25 3.75 1.75 C. ramosum 1.25 1.75 0.5 Y. pseudotuberculosis 5.5 3.4 4.5 Commensals B. thetaiotaomicron 0.4 0.4 0.5 B. vulgatus 0.3 0.5 0.7

(41) Strains F2064, F2076 and F1033 displayed significant inhibitory activity against Candida albicans and several potentially pathogenic bacteria. On the other hand, the strains displayed minimal activity against commensal strains commonly found in the indigenous gastrointestinal flora of the Bacteroides genus. Also, strains F2064, F2076 and F1033 did not display significant inhibitory activity among them. It is noteworthy that strain F1033 is the only strain displaying high inhibitory activity against Campylobacter jejuni, while strain F2076 outstands in inhibiting Escherichia coli and strain F2064 in inhibiting both Candida albicans and Proteus mirabilis.

(42) 6. Antioxidant Capacity

(43) A) Methods

(44) 20 l aliquots of overnight cultures of each strain (10.sup.9 cfu/ml aprox) were placed in a 96-well plate. 200 l of MRS supplemented with 10 mM of paraquat (C.sub.12H.sub.14Cl.sub.2N.sub.2, a superoxide anion donor) or 10 mM of sodium nitroprusside (Na.sub.2[Fe(CN).sub.5NO], a nitric oxide donor) were added to wells and plates incubated at 37 C. and 5% CO.sub.2. Optical densities at 620 nm were read after 6 h. Results are expressed as percent of growth compared to growth in standard MRS medium. The same protocol was followed with the L. rhamnosus GG strain and the L. plantarum strain isolated from the commercial formulation VSL#3 (the isolation was performed using standard procedures).

(45) B) Results

(46) Oxidative stress is defined as an imbalance between generation of reactive oxygen species (ROS) and decreased antioxidant defence systems. Oxidative stress develops particularly in inflammatory reactions because the inflammatory cells, neutrophils, and macrophages produce large amounts of ROS (Rezaie A. et al., 2007; Roessner A. et al., 2008). Strains F1033, F2064 and F2076 showed a capacity to survive under strong oxidizing conditions comparable to the well-known probiotic strain L. rhamnosus GG, as well as to the L. plantarum strain isolated from the VSL#3 formula. It is worth noting that strain F2076 displayed the highest resistance both to paraquat (superoxide anion donor) and sodium nitroprusside (nitric oxide donor). Resistance to oxidative stress is a desirable trait for probiotic strains that are expected to survive in the environment of an inflamed mucosa.

(47) TABLE-US-00004 TABLE 4 Percent of growth in medium containing 10 mM of paraquat or sodium nitroprusside, compared to standard MRS medium. % growth in % growth in Strain paraquat nitroprusside L. rhamnosus GG 70 10 99 17 L. plantarum VSL#3 61 4 88 10 F1033 67 9 76 22 F2064 61 18 67 8 F2076 72 1 104 19

(48) 7. Strain Genotyping

(49) A) Methods

(50) Strains F1033, F2064 and F2076 were subjected to a previously described protocol (Rodas A. M. et al., 2005) with minor modifications. Strains were grown on MRS agar plates and incubated at 37 C. 5% CO.sub.2 for 18 h. Cells were harvested and washed 3 times in 8 ml PET (10 mM Tris pH 7.6, 1 M NaCl) then centrifuged at 6000 rpm 10 min. Pellets were resuspended in 700 ml lysis buffer (6 mM Tris, 1 M NaCl, 0.1 M EDTA, 0.5% SLS, 0.2% deoxycholic acid; 1 mg/ml lysozyme; 40 U/ml mutanolysin; 20 mg/ml RNase). An equal volume of 1.6% low melting point agarose (FMC BioProducts, Rockland, Me., USA) was added to the resuspended cells and solidification was allowed at 4 C. for 1 h. Inserts were transferred to 2 ml lysis buffer II (0.5 M EDTA pH 9.2, 1% N-lauryl sarcosine and 1 mg/ml pronase) and incubated at 50 C. for 48 h. Then inserts were washed at room temperature with TE buffer (10 mM Tris, 1 mM EDTA pH 8.0). Total DNA digestion was performed separately by Sfi-I and Sma-I restriction enzymes (Roche Diagnostics).

(51) Pulse-field electrophoresis was carried out using CHEF DRIII apparatus (BioRad Laboratories). Inserts were loaded in a 1% agarose gel (SeaKem ME agarose, FMC BioProducts, ME, USA). DNA MW markers were Lambda ladder PFG Marker and Low Range PFG Marker (New England Biolabs). After electrophoresis, gels were stained with ethidium bromide and UV using GelDoc System (BioRad).

(52) B) Results

(53) FIG. 1 shows the pulse-field electrophoresis profiles obtained. Strain F1033 shows a similar genomic restriction profile to P. acidilactici R1001 after digestion with Sma-I. However, the genomic profile obtained after digestion with enzyme Not-I is clearly different. On the other hand, the genomic restriction profiles of strains F2064 and F2076 are clearly different among them and also compared both to L. plantarum 299v and to the L. plantarum strain contained in the VSL#3 formula.

(54) 8. Production of Short Chain Fatty Acids

(55) A) Methods

(56) Strains were incubated overnight in a basal medium (see TABLE 5) supplemented with different fibers, each one (inulin, pectin and FOS) in a specific amount, under microaerophilic conditions (5% CO.sub.2) at 37 C. Next, cells were removed by centrifugation at 12.000 rpm for 10 min and supernatants were filtered and frozen in liquid nitrogen and kept at 80 C. until analyzed by gas chromatography, focusing on the amount of acetic, propionic and butyric acids.

(57) TABLE-US-00005 TABLE 5 COMPOUND CONCENTRATION Peptone 2 g/L Yeast extract 2 g/L NaCl 0.1 g/L K.sub.2HPO4 0.04 g/L KH.sub.2PO.sub.4 0.04 g/L MgSO.sub.47H.sub.2O 0.01 g/L CaCl.sub.26H.sub.2O 0.01 g/L NaHCO.sub.3 2 g/L Hemin 0.05 g/L HCl Cysteine 0.5 g/L Bile Salt 0.5 g/L Tween 80 2 g/L Vitamin K1 10 l Inulin 10 g/L Pectin 10 g/L FOS 10 g/L

(58) B) Results

(59) Short chain fatty acids (SCFAs) are the end products of anaerobic bacteria break down of carbohydrates in the large bowel. SCFAs, mainly acetate, propionate and butyrate account for approximately 80% of the colonic anion concentration and are produced in nearly constant molar ratio 62:22:15. Among their various properties, SCFAs, especially butyric acid, but also acetic and propionic acid, are readily absorbed by intestinal mucosa, are relatively high in caloric content, are metabolized by colonocytes and hepatocytes, stimulate sodium and water absorption in the colon and are trophic to the intestinal mucosa (D'Argenio G. et al., 1999). On the other hand, high amounts of acetic acid have long been known to be irritant to the intestinal mucosa (Yamada Y. et al., 1992). Strains F1033, F2064 and F2076 are strong producers of either acetic, propionic or butyric acid.

(60) TABLE-US-00006 TABLE 6 Acetic, propionic and butyric acid production by strains grown on basal medium enriched with inulin, pectin and FOS. Acetic Propionic Butyric Strain (mg/ml) (mg/ml) (mg/ml) L. rhamnosus GG n.d n.d 7.7 F1033 n.d n.d 21.4 F2064 n.d 30.2 9.7 F2076 46.5 n.d n.d (n.d. = non-detected)

(61) 9. Compatibility with IBD Treatments

(62) A) Method

(63) Supplemented broth was prepared by dissolving 5-aminosalycilic acid (Pentasa, Ferring Pharmaceuticals) at the maximal soluble concentration (0.84 gr/L) and half this concentration (0.42 gr/L) in MRS liquid broth. The strains of the invention were grown in standard MRS broth or 5-aminosalicylic acid-supplemented broth for 4 h at 37 C. in microaerophilic conditions (5% CO.sub.2), and growth was assessed by measuring optical density at 620 nm. Results are expressed as percent of growth in standard MRS medium.

(64) B) Results

(65) Prolonged treatment of mild to moderate IBD symptoms is usually carried out using oral aminosalycilates (5-ASA derivatives) (Katz J. A., 2007). Therefore it is of interest to evaluate if the probiotic strains of the invention can be co-administered with 5-ASA derivatives. Considering that growth of none of said strains is completely inhibited despite the high stringency of the conditions, we can conclude that co-administration of mesalazine is not likely to compromise the efficacy of the probiotic, even using saturated concentrations of mesalazine (0.84 g/L) as shown in TABLE 7:

(66) TABLE-US-00007 TABLE 7 4 h (% of growth) 8 h (% of growth) 0.42 g/L 0.84 g/L 0.42 g/L 0.84 g/L VSL#3 56.2 38.1 43.2 35.1 F1033 72.7 60.6 51.8 42.3 F2064 59.7 48.0 62.3 55.1 F2076 51.6 22.1 50.2 22.5

(67) 10. In Vivo Effect on Chemically-induced Gut Inflammation

(68) A) Methods

(69) The therapeutic effect of the composition of the invention on mild gut inflammation was investigated with a 5-day repetitive oral administration of dextran sodium sulfate (DSS) in the mouse (Okayasu I. et al., 1990). When used in a low dose (2.5-3%) for a short time (5 days), DSS produces mild colitis, with intestinal inflammation at the histological level but without significant macroscopic changes (e.g. colon shortening, mesenteric adherences).

(70) External symptoms include weight loss and diarrhea, with rare occurrence of blood in feces. Therefore this model is representative of low-grade ulcerative colitis.

(71) Strains F1033, F2064 and F2076 were lyophilised in sterile water with 15% skim milk and 4% sucrose as cryoprotectants and mixed in equal amounts (ratio in concentration 1:1:1).

(72) Eight-week-old Balb/c mice (Charles River, Barcelona, Spain), weighing 20-25 g, were kept under specific pathogen-free (SPF) conditions in an isolator (Harlan Iberica, Barcelona, Spain) at constant temperature (22 C.) in a 12-hour of light/dark cycle. Two mice acted as littermates. Mice had free access to sterilized diets (laboratory's standard diet; Harlan Iberica, Barcelona, Spain) and to drinking fluid. Mice were kept for 7 days in the facility before the beginning of the experiments (quarantine). Mice were allocated to one of four groups: a) probiotic composition of the invention+DSS (n=8); b) VSL#3 (VSL Pharmaceuticals, USA)+DSS (n=8); c) vehicle+DSS (n=8); and d) vehicle+healthy controls (n=6).

(73) Probiotics (or vehicle) were administered by oral gavage for ten days before (day 10) starting DSS administration (day 0). Each mouse received daily 2.510.sup.8 cfus of probiotic in 0.1 mL of sterilized water (vehicle) by gavage. Non-probiotic treated mice received the same volume of vehicle (distilled water with 15% skim milk and 4% sucrose).

(74) Mice were fed with 3% (w/v) DSS (mol. Wt 40 kD, Applichem Lifescience, VWR, Barcelona) in their drinking water for 5 days (days 0 to 4, followed by three days without DSS) according to a previously described method with minor modifications (Okayasu I, et al. Gastroenterol 1990). Healthy controls never received DSS.

(75) Clinical signs were daily monitored. Disease Activity Index was calculated according to the following formula and interpretation table:
DAI=Score.sub.Weight Loss+Score.sub.Stool Blood+Score.sub.Stool Consistency

(76) Results are shown in TABLE 8:

(77) TABLE-US-00008 TABLE 8 Weight Loss Score Stool Blood Score Stool Consistency Score <1% 0 Absence 0 Formed and hard 0 1-5% 1 Formed but soft 1 5-10% 2 Presence 2 Loose stools 2 10-15%.sup. 3 Mild diarrhea 3 (watery) >15% 4 Gross bleeding 4 Gross diarrhea 4

(78) The Disease Activity Index score used hereby was first described by Cooper et al. and combines several clinical symptoms into one normalized score (Cooper H. S. et al., 1993). Maximum score is 12 points. This score has been widely used to evaluate the efficacy of experimental treatmentsprobiotics among themin animal models of IBD (Fitzpatrick L. R. et al., 2007; Grabig A. et al., 2006; Sasaki M. et al., 2005).

(79) After being sacrificed by anesthetic overdose of inhaled Halothane (Fluotane, Zeneca Ltd, UK), colon samples of the animals were harvested and washed in cold PBS. Colon weight/length ratio was recorded. Samples for cytokine measurements were frozen in liquid nitrogen and homogenized in 1 mL of cold PBS with inhibitor protein cocktail (Sigma-Aldrich Chem., Spain) and centrifuged (15000 g, 10 min). IL-6, IL-10, IL23p19, IFN- and TNF- concentrations were measured in colonic supernatants using Cytokine 6-Plex Assay (Procarta Cytokine Profiling Kit, PANOMICS, Spain) for the Luminex Platform (Luminex Co, Austin, USA). Fluorescent microparticle beads, pre-spotted with cytokine-specific antibodies, were incubated with 50 L 1:5 diluted supernatant. Specific-biotinylated secondary antibodies and streptavidin-phycoerythrin (S-PE) were sequentially added. Data were expressed as pg of cytokine per mg of protein (Quick Start Bradford Protein Assay, BIO-RAD, CA, USA). All measurements were done in duplicate.

(80) B) Results

(81) Disease Activity Index

(82) As shown in FIG. 2, the group receiving the probiotic formula of the invention displayed a significant improvement of the clinical symptoms when compared to DSS-treated controls, as assessed by the Disease Activity Index (p<0.05, two-tail ANOVA with Tukey-Kramer post-hoc test). Healthy controls also displayed a lower Disease Activity Index (p<0.05).

(83) Cytokine Levels

(84) Analysis of various cytokines in the intestinal mucosa revealed that probiotic formula of the invention significantly decreased IL-6 when compared to DSS-treated controls (p<0.01, two-tail ANOVA with Tukey-Kramer post-hoc test), while the effect of commercial probiotic formula VSL#3 failed to achieve significance (p>0.05). IL-6 is a marker of acute inflammation (FIG. 3). As expected, levels of IL-6 in healthy controls were also significantly lower than DSS-treated controls (p<0.05). A statistically significant correlation was found between clinical symptoms (DAI score) and IL-6 levels in the intestinal mucosa (p<0.05, Spearman ranks test) (data not shown). On the other hand, correlation between clinical symptoms and IL-10, IL-23, TNF or IFN was not statistically significant, and the probiotic formula of the invention did not significantly affect the levels of these cytokines.

(85) 11. In Vivo Effect on Spontaneous Gut Inflammation

(86) A) Methods

(87) The therapeutic effect of probiotic formula of the invention was also investigated in the IL-10 knock-out mouse model. This model spontaneously develops bowel inflammation at 8 to 12 weeks of age, with a penetrance of 80-90% (Scheinin T. et al., 2003). Interleukin 10 (IL-10) is an important regulatory cytokine that supresses effector functions of macrophage/monocytes, T helper 1 (Th1) cells, and natural killer cells. In addition, IL-10 augments proliferation and differentiation of B cells. Murine models lacking the IL-10 gene spontaneously develop inflammatory bowel disease and gastrointestinal tumors. The gastrointestinal flora has been implicated in the pathogenesis of these disease states as germ free animals do not develop disease. The IL-10 knock-out mouse has been widely used to evaluate new therapeutic options for IBD.

(88) Six-week-old C57B6J IL-10-deficient or wild type mice (Charles River, Barcelona, Spain) were kept under specific pathogen-free (SPF) conditions in an isolator (Harlan Ibrica, Barcelona, Spain) at constant temperature (22 C.) in a 12-hour of light/dark cycle. Mice had free access to sterilized diets (diet based in AIN-93 for maintenance of mice was composed by 12% of water, 14.5% of protein, 4% of fat, 4.5% of fibre and 4.7% of ash; Harlan Interfauna Ibrica S. A., Barcelona, Spain) and to drinking fluid.

(89) Mice were allocated to one of three groups: a) probiotic formula I.3.1 (n=12 IL-10/; n=5 wild type); b) VSL#3 (n=12 IL-10/; n=5 wild type); and c) vehicle (n=12 IL-10/; n=5 wild type). Each mouse in groups a and b received daily 10.sup.9 CFU of probiotic in sterilized drinking water (vehicle). Non-probiotic treated mice (Placebo group) received vehicle alone. Probiotics (or vehicle) were administered during ten weeks. Clinical signs were daily monitored. Disease Activity Index (Cooper H. S. et al., 1993) was calculated as in the model of DSS-induced gut inflammation (see above).

(90) Sixteen-weeks-old mice were sacrificed by anaesthetic overdose of inhaled Halothane (Fluotane, Zeneca Ltd, UK). Colon samples of the animals were harvested and washed in cold PBS. Blood samples were also collected by cardiac puncture to analyze hematocrit and hemoglobin concentration (Coulter MaxM Analyzer with autoloader, Izasa, Spain). Colon weight/length ratio was recorded. Then, colons were frozen in liquid nitrogen and cytokines IL-6, and IFN were measured using the same protocol as in the model of DSS-induced gut inflammation (see above).

(91) B) Results

(92) Disease Activity Index

(93) As shown in FIG. 4, a significant delay on the onset of the clinical symptoms was observed both in the group treated with the composition of the invention and the VSL#3 commercial formula when compared to vehicle-treated controls (p<0.01, two-tail ANOVA with Tukey-Kramer post-hoc test). Additionally, treated groups tended to display lower Disease Activity Index scores, although the difference did not reach significance (data not shown).

(94) Cytokine Levels

(95) Analysis of various cytokines revealed that probiotic composition of the invention significantly decreased IFN levels in knockout mice when compared both to vehicle-treated knock-outs (p<0.01, two-tail nonparametric ANOVA with Dunn post-hoc test) and to commercial formula VLS#3 (p<0.05). In fact, as it is shown in FIG. 5, the levels of IFN attained the same levels as those of wild-type healthy controls. Additionally, as it is derived from FIG. 6, there was also a clear tendency of probiotic formulas to reduce the levels of IL-6, although results did not reach significance due to the large standard deviation among vehicle knockout mice.

(96) A significant correlation was found between the severity of clinical symptoms (Disease Activity Index) and the levels of IFN at the end of the study in colonic mucosa measured after the sacrifice (p<0.05, Spearman rank's test) (data not shown).

(97) Safety of the Probiotic Formula

(98) Clinical signs (weight loss, altered behavior, fur aspect, diarrhoea and stool blood) were daily monitored in wild-type mice receiving daily doses of the probiotic formula of the invention, the VSL#3 formula or vehicle during 10 weeks. No morbidity signs were detected during the study. Upon sacrifice, animals were subjected to gross necropsy. Analysis of all major cavities and organs did not reveal any pathological alteration (data not shown).

(99) 12. In Vivo Efficacy on IBS Subjects

(100) A) Methods

(101) Study Design

(102) A multicenter randomized, double-blind, placebo-controlled clinical trial to study the effect of the composition of the invention on IBS patients was conducted.

(103) Hydroxymethyl propyl cellulose capsules were filled with: (1) 150 mg of maltodextrin, (2) 5 mg of magnesium stearate, (3) 5 mg of silicon dioxide and (4) 200 mg of a 1:1:1 mixture of the three strains of the invention (at a concentration 5.Math.10.sup.10 cfus/capsule). In addition a placebo was made with the same list of excipients and amounts but without including the composition of the invention. Content of the capsules throughout the study ranged from 5.Math.10.sup.10 to 1.Math.10.sup.10 cfus.

(104) 33 eligible adult patients of both sexes meeting Rome III criteria for irritable bowel syndrome (Longstreth G. F. et al., 2006) were enrolled and randomly allocated to one of the following treatments for 6 weeks: a) the capsule including the composition of the invention once daily (n=18); and b) the placebo capsule once daily (n=15). The study was conducted according to the Helsinki Declaration for Clinical Trials and approved by the appropriate Ethical Committee.

(105) Efficacy Assessment

(106) The primary endpoint of this study was the global effect on health-related quality of life (hereinafter also referred as HRQOL), as assessed using a specific questionnaire for IBS: the validated Spanish version of the IBSQOL questionnaire (Badia X. et al., 2000). Following the guidelines from the Spanish Gastroenterology Association, scores were standardized to a 0-100 scale. The secondary endpoint was the assessment of anxiety related to gastrointestinal sensations and symptoms by means of the validated Visceral Sensitivity Index questionnaire (hereinafter also referred as VSI) (Labus J. S. et al., 2004). Volunteers were asked to fill these questionnaires at baseline (day 1), on day 21 and on day 42. Data was assessed per intent to treat analysis. The results are shown in FIGS. 7 and 8.

(107) B) Results

(108) Baseline Characteristics

(109) No significant differences were evident between the groups in terms of baseline characteristics, as can be seen in Table 9, indicating that subjects in both groups were comparable in terms of the variables assessed. Groups were also comparable in terms of baseline standard blood biochemical parameters, anthropometric parameters, age and sex.

(110) TABLE-US-00009 TABLE 9 Baseline scores for the two treatment groups Capsule including the composition of Placebo Group the invention (n = 15) IBSQOL 45.7 7.9 48.2 19.2 VSI 34.9 13.3 41.2 11.8

(111) Improvement of Health-related Quality of Life (FIG. 7)

(112) The composition of the invention significantly improved health-related quality of life compared to placebo when assessed both after 21 days and 42 days of treatment (p<0.05, T-test). Therefore, it is demonstrated that the composition of the present invention significantly reduces morbility and improves the quality of life of IBS subjects well above the placebo effect. The positive effects of the composition include the food-related distress, anxiety, interference in daily activities and sleep disturbance domains of the HRQOL questionnaire. The improvements in these scales suggest a reduction in abdominal pain, discomfort and altered bowel habits. To our knowledge, this is the first time that it is shown a probiotic composition displaying a significant effect on the global health-related quality of life of IBS patients.

(113) Improvement in the Visceral Sensitivity Index (FIG. 8)

(114) The composition of the present invention significantly reduced the gastrointestinal symptom-specific visceral sensitivity of IBS subjects compared to placebo. The effect was close to significant after 21 days of treatment, and clearly significant after 42 days of treatment (p<0.01, T-test), further confirming the usefulness of the composition of the present invention in treating IBS. The most pronounced improvement was observed in abdominal discomfort and bloating-related items of the questionnaire. Particularly, TABLE 10 shows the numbers of subjects reporting a significant improvement related to bloating and distension (as defined by an increase of at least two points compared to baseline in the 6-point scale of the VSI questionnaire that measures bloating and distension-related anxiety) at the end of the treatment. The difference between the two groups is statistically significant (p<0.05, Fisher's exact test).

(115) TABLE-US-00010 TABLE 10 Effect on abdominal bloating and distension-related anxiety, according to the VSI questionnaire, after 42 days of treatment Capsule including the Bloating and distension- composition of the Placebo related anxiety invention (n = 18) (n = 15) Subjects reporting an 7 1 improvement compared to baseline Subjects not reporting 11 14 an improvement compared to baseline

(116) From the results obtained, therefore it is concluded that the composition of the invention is effective in treating abdominal distension and bloating.

(117) 13. Effect on Abdominal Bloating and Reduced Bowel Movements

(118) A 25 years old woman was suffering from chronic abdominal bloating and altered intestinal motility, reporting sometimes as few as on bowel movement per week. Diagnostic revealed a hypotonic and hypokinetic stomach, without evidence of other structural alterations in the gastrointestinal tract.

(119) The patient undertook a treatment of one capsule per day (as those described in example 12). After one week of treatment the patient reported a significant reduction of abdominal bloating and distension and a normalization of bowel habits. Symptoms reappeared after stopping the treatment for a few days. After restarting of the treatment in the form of one capsule every two days, the patient reported again a noticeable and long-lasting positive effect both on bloating and bowel habits.

(120) This example further supports the use of the composition of the invention to treat abdominal bloating and altered intestinal motility in subjects which are not classified as having Irritable Bowel Syndrome.

BIBLIOGRAPHIC REFERENCES

(121) Altschul, S. F., et al. Basic local alignment search tool, J. Mol. Biol., 1990, vol. 215, p. 403-410. Anadn, A., et al. Opinion of the Scientific Panel on Additives and Products or Substances used in Animal Feed on the updating of the criteria used in the assessment of bacteria for resistance to antibiotics of human veterinary importance, The EFSA Journal, 2005, vol. 233, p. 1-12. Andreoletti, O., et al. The maintenance of the list of QPS microorganisms intentionally added to food or feed. Question no: EFSA-Q-2008-006, The EFSA Journal, 2008, vol. 923, p. 1-48. Araya, M., et al. (2002) Guidelines for the Evaluation of Probiotics in FoodJoint FAO/WHO Working Group. FAO/WHO, Ontario, Canada. Badia, X., et al. Adaptacin al espaol del cuestionario IBSQoL para la medicin de la calidad de vida en pacientes con sndrome de intestino irritable., Rev Esp Enferm Dig, 2000, vol. 92, p. 637-643. Bories, G., et al. Update on the criteria used in the assessment of bacterial resistance to antibiotics of human or veterinary importance, The EFSA Journal, 2008, vol. 732, p. 1-15. Collado, M., et al. Probiotic Strains and Their Combination Inhibit In Vitro Adhesion of Pathogens to Pig Intestinal Mucosa, Current Microbiology, 2007, vol. 55, p. 260-265. Cooper, H. S., et al. Clinicopathologic study of dextran sulfate sodium experimental murine colitis, Lab Invest., 1993, vol. 69, p. 238-249. D'Argenio, G. and Mazzacca, G. Short-chain fatty acid in the human colon. Relation to inflammatory bowel diseases and colon cancer, Adv Exp Med Biol, 1999, vol. 472, p. 149-158. Daniel, C., et al. Selecting Lactic Acid Bacteria for Their Safety and Functionality by Use of a Mouse Colitis Model, Appl. Environ. Microbiol., 2006, vol. 72, p. 5799-5805. Dean, B. B., et al. Impairment in work productivity and health-related quality of life in patients with IBS, Am J Manag Care., 2005, vol. 11, p. S17-26. Fitzpatrick, L. R., et al. Effects of the probiotic formulation VSL#3 on colitis in weanling rats, J Pediatr Gastroenterol Nutr., 2007, vol. 44, p. 561-570. Fukumoto, S., et al. Short-chain fatty acids stimulate colonic transit via intraluminal 5-HT release in rats, Am J Physiol Regul Integr Comp Physiol, 2003, vol. 284, p. R1269-1276. Grabig, A., et al. Escherichia coli Strain Nissle 1917 Ameliorates Experimental Colitis via Toll-Like Receptor 2- and Toll-Like Receptor 4-Dependent Pathways, Infect. Immun., 2006, vol. 74, p. 4075-4082. Guarner, F. and Schaafsma, G. J. Probiotics, Int J Food Microbiol., 1998, vol. 39, p. 237-238. Jacobsen, C. N., et al. Screening of Probiotic Activities of Forty-Seven Strains of Lactobacillus spp. by In Vitro Techniques and Evaluation of the Colonization Ability of Five Selected Strains in Humans, Appl. Environ. Microbiol., 1999, vol. 65, p. 4949-4956. Katz, J., A. Management of inflammatory bowel disease in adults, Journal of Digestive Diseases, 2007, vol. 8, p. 65-71. Labus, J. S., et al. The Visceral Sensitivity Index: development and validation of a gastrointestinal symptom-specific anxiety scale, Alimentary Pharmacology & Therapeutics, 2004, vol. 20, p. 89-97. Longstreth, G. F., et al. Functional Bowel Disorders, Gastroenterology, 2006, vol. 130, p. 1480-1491. Maslowski, K. M., et al. Regulation of inflammatory responses by gut microbiota and chemoattractant receptor GPR43, Nature, 2009, vol. 461, p. 1282-1286. Okayasu, I., et al. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mic, Gastroenterology., 1990, vol. 98, p. 694-702. Pathmakanthan, S., et al. Lactobacillus plantarum 299: Beneficial in vitro immunomodulation in cells extracted from inflamed human colon, Journal of Gastroenterology and Hepatology, 2004, vol. 19, p. 166-173. Rezaie, A., et al. Oxidative Stress and Pathogenesis of Inflammatory Bowel Disease: An Epiphenomenon or the Cause?, Digestive Diseases and Sciences, 2007, vol. 52, p. 2015-2021. Rodas, A. M., et al. Polyphasic study of wine Lactobacillus strains: taxonomic implications, Int J Syst Evol Microbiol, 2005, vol. 55, p. 197-207. Roessner, A., et al. Oxidative stress in ulcerative colitis-associated carcinogenesis, Pathol Res Pract., 2008, vol. 204, p. 511-524. Sasaki, M., et al. Reversal of experimental colitis disease activity in mice following administration of an adenoviral IL-10 vector, Journal of Inflammation, 2005, vol. 2, p. 13. Scheinin, T., et al. Validation of the interleukin-10 knockout mouse model of colitis: antitumour necrosis factor-antibodies suppress the progression of colitis., Clin Exp Immunol, 2003, vol. 133, p. 38-43. Tazoe, H., et al. Roles of short-chain fatty acids receptors, GPR41 and GPR43 on colonic functions, J Physiol Pharmacol., 2008, vol. 59, p. 251-262. Tedelind, S., et al. Anti-inflammatory properties of the short-chain fatty acids acetate and propionate: a study with relevance to inflammatory bowel disease, World J Gastroenterol., 2007, vol. 13, p. 2826-2832. Vanhoutvin, S. A., et al. The effects of butyrate enemas on visceral perception in healthy volunteers, Neurogastroenterology & Motility, 2009, vol. 21, p. 952-e976. Wang, Q., et al. Naive Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy, Appl. Environ. Microbiol., 2007, vol. 73, p. 5261-5267. Weisburg, W. G., et al. 16S ribosomal DNA amplification for phylogenetic study, J. Bacteriol., 1991, vol. 173, p. 697-703. Yamada, Y., et al. A comparative analysis of two models of colitis in rats, Gastroenterology, 1992, vol. 102, p. 1524-1534. Zhang, L., et al. Alive and Dead Lactobacillus rhamnosus GG Decrease Tumor Necrosis Factor-alpha-Induced Interleukin-8 Production in Caco-2 Cells, J. Nutr., 2005, vol. 135, p. 1752-1756. WO96/29083 EP 554418 EP 415941 U.S. Pat. No. 7,195,906