Variable domains of camelid heavy-chain antibodies directed against glial fibrillary acidic proteins
10155054 · 2018-12-18
Assignee
Inventors
Cpc classification
A61P29/00
HUMAN NECESSITIES
C07K2317/569
CHEMISTRY; METALLURGY
C12N5/0622
CHEMISTRY; METALLURGY
C07K2317/92
CHEMISTRY; METALLURGY
C07K2317/22
CHEMISTRY; METALLURGY
A61K2039/545
HUMAN NECESSITIES
International classification
A61K47/68
HUMAN NECESSITIES
A61K51/10
HUMAN NECESSITIES
Abstract
The present invention relates to the use of variable domains of camelid heavy-chain antibodies (VHH domains) directed against an intracellular target and having an isoelectric point of at least 8.5, for targeting said intracellular target or for the preparation of a peptide vector. Particularly, it concerns VHH domains directed against a glial fibrillary acidic protein and uses thereof for preparing therapeutic or diagnostic agents.
Claims
1. A method for screening a composition for transmigration across the blood-brain barrier (BBB) comprising: providing a composition comprising a substance of interest linked to a VHH antibody comprising an amino acid sequence selected from the group consisting of the consensus amino acid sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 6, and SEQ ID NO: 12; administering the composition to a mammal; and determining that the composition has crossed the BBB by detecting the presence of the VHH antibody on the cerebral side of the BBB.
2. The method of claim 1, wherein the mammal is a human.
3. The method of claim 1, wherein the composition is administered by intranasal, intravenous, intraperitoneal, intramuscular, or subcutaneous injection.
4. The method of claim 1, wherein the VHH antibody is directed against a glial fibrillary acidic protein (GFAP).
5. The method of claim 1, wherein the substance of interest is a fluorophore, a heavy metal chelate, or a radioisotope.
6. The method of claim 1, wherein the substance of interest is an enzyme.
7. The method of claim 1, wherein the isoelectric point of the VHH is calculated using a computer program.
8. A method for screening a composition for transmigration across the blood-brain barrier (BBB) comprising: providing a composition comprising a substance of interest linked to a VHH antibody comprising an amino acid sequence selected from the group consisting of the consensus amino acid sequence SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 6, and SEQ ID NO: 12; administering the composition to a mammal; and determining that the composition has crossed the BBB by detecting the presence of the substance of interest on the cerebral side of the BBB.
9. The method of claim 8, wherein the mammal is a human.
10. The method of claim 8, wherein the composition is administered by intranasal, intravenous, intraperitoneal, intramuscular, or subcutaneous injection.
11. The method of claim 8, wherein the VHH antibody is directed against a glial fibrillary acidic protein (GFAP).
12. The method of claim 8, wherein the substance of interest is a fluorophore, a heavy metal chelate, or a radioisotope.
13. The method of claim 8, wherein the substance of interest is an enzyme.
14. The method of claim 8, wherein the isoelectric point of the VHH is calculated using a computer program.
Description
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18) The following examples illustrate the invention but in no way limit it.
EXAMPLE 1: PRODUCTION OF ANTI-GFAP-VHHS
(19) 1) Materials and Methods
(20) Materials
(21) GFAP (gi:164694994 in the GENBANK database) from normal human brain was purchased from United States Biological, Inc. The anti-GFAP rabbit polyclonal antibody (GF 5) was obtained from Santa Cruz Biotechnology, Ca, USA.
(22) Primers:
(23) TABLE-US-00001 -CH2FORTA4(SEQIDNO:16): 5-CGCCATCAAGGTACCAGTTGA-3 -VHBACKA6(SEQIDNO:17): 5-GATGTGCAGCTGCAGGCGTCTGGRGGAGG-3 -VHBACKA4(SEQIDNO:18): 5-CATGCCATGACTCGCGGCCCAGCCGGCCATGGCCGAKGTSCAGC T-3 -VHFOR36(SEQIDNO:19): 5-GGACTAGTTGCGGCCGCTGAGGAGACGGTGACCTG-3 -LH(SEQIDNO:20): 5-GGACTAGTTGCGGCCGCTGGTTGTGGTTTTGGTGTCTTGGG-3 VHH-SPEF(SEQIDNO:21): 5GGAGATATATATCCATGAGAGGATCGCATCACCATCACCATCACGGAT CCGCCGAKGTSCAGCTG-3 -VHH-SPER(SEQIDNO:22): 5-CCATATAAAGCTTTGAGGAGACGGTGACCTG-3 -SDA-MRGS(SEQIDNO:23): 5AGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAA GGAGATATATCCATGAGAGGATCG-3 T7Cprimer(SEQIDNO:24): 5ATACGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCC TC-3 -VHH-link(SEQIDNO:25): 5-CAGGTCACCGTCTCCTCAAAGCTTTATATGGCCTCGGGGGCC-3 -TolAkurz(SEQIDNO:26): 5-CCGCACACCAGTAAGGTGTGCGGTTTCAGTTGCCGCTTTCTTTC T-3 -T7B(SEQIDNO:27): 5-ATACGAAATTAATACGACTCACTATAGGGAGACCACAACGG-3
(24) Antigen Preparation and Induction of a Humoral Immune Response in Alpaca
(25) 250 l of GFAP (1 mg/ml) was mixed with 250 l of Freund complete adjuvant for the first immunization, and with 250 l of Freund incomplete adjuvant for the following immunizations.
(26) One young adult male alpaca (Lama pacos) was immunized at days 0, 21 and 35 with 250 g of the immunogen. The alpaca was bled and the immune response was monitored by titration of serum samples by ELISA on GFAP (1 g/ml in PBS) immobilized on MaxiSorp plates (Nunc, Denmark), after dilution of the serum in PBS-Tween 0.1% containing 0.5% gelatin. The bound alpaca antibodies were detected with polyclonal rabbit anti-alpaca IgG (obtained by immunizing rabbits with alpaca immunoglobulins isolated with protein A and protein G columns [MUYLDERMANS et al., 1994, above-cited) and horseradish peroxidase-labeled goat anti-rabbit antibodies.
(27) Library Construction
(28) The blood of the immunized animal was collected and the peripheral blood lymphocytes were isolated by centrifugation on a Ficoll (Pharmacia) discontinuous gradient and stored at 80 C. until further use. Total RNA and cDNA was obtained as previously described by LAFAYE et al., 1995 (Res Immune., 146:373-82; Erratum in: Res Immunol., 1996, 147:61). DNA fragments encoding VHH domains were amplified by PCR using CH2FORTA4 and VHBACKA6 primers (described in International Application No. WO 2004/044204; LAFAYE, above-cited), which respectively anneal to the 3 and 5 flanking region of VH genes (ARBABI GHAHROUDI et al., 1997, FEBS Lett., 414:521-6). The amplified product of approximately 600 bp was subjected to a second round of PCR using either the primers VHBACKA4 and VHFOR36 or the primers VHBACKA4 and LH specific of the long hinge antibody (as described in International Application No. WO 2004/044204). The primers were complementary to the 5 and 3 ends of the amplified product and incorporated SfiI and NotI restriction sites at the ends of the VHH genes. The PCR products were digested and ligated into phage vector pHEN 1 (HOOGENBOOM and WINTER, 1992, above-cited). The resulting library was composed of two sublibraries, one derived from VHH DNA-encoding genes with no hinge and the other from long hinge antibody genes.
(29) The VHH domain population was converted to ribosome display format using PCR and transcribed to mRNA as follows (MOURATOU et al., 2007, Proc Natl Acad Sci USA., 104:17983-8). Clones from the VHH domain population were amplified using the primer VHH-SPEF that contained a 5 extension containing the prokaryotic Shine-Dalgarno sequence and the primer VHH-SPER. The 400 bp PCR product was then amplified using a mixture of SDA-MRGS primer (5 M), VHH-SPER primer (5 M) and T7C primer (5 M). The 450 bp product was purified with the Wizard SV purification kit (Promega).
(30) A peptide linker was added to ensure that the protein displayed on the ribosome was accessible to potential ligands. DNA encoding this linker, corresponding to a part of the E. coli protein TolA was PCR amplified by using the primers VHH-link and TolAkurz.
(31) Finally the library was assembled with the TolA linker by PCR assembly using primers TolAkurz and T7B.
(32) The final assembly product corresponded to a library of VHH with all of the 5 and 3 regions necessary to its use for ribosome display selections, as previously described (MOURATOU et al., 2007, see above).
(33) Ribosome Display Selection Rounds
(34) GFAP (10 g/ml) was bound in a MaxiSorp plate (Nunc, Denmark) and selections by ribosome display were performed at 4 C. Selection was performed according to MOURATOU et al. (2007, see above). The wells were blocked with 300 l 0.5% BSA in TBS for 1 hour at room temperature. Before the ribosome-display round, the wells were then extensively washed with washing buffer WBT (50 mM Tris acetic acid, pH7.5, 150 mM NaCl, 50 mm Mg (CH3COO.sup.).sub.2, 0.05% tween 20). A ribosome display round consisted of a 15 mn-prepanning step on a well coated with PBS and a 1 hour binding step on the target protein. After washing, RNA purification and reverse transcription (with primer VHH-SPER), a first PCR was done using the primers VHH-SPEF and VHH-SPER. This RT-PCR product was purified on an agarose gel and reamplified in a second PCR using T7C, SDA-MRGS and VHH-SPER primers. This PCR product was purified on an agarose gel and reamplified in a third PCR using T7B and TolAkurz primers. The third PCR product served as template for the next round of ribosome display. Three identical rounds of selection were performed to isolate high-affinity binders.
(35) VHH Expression Either with a His-Tag or with a CH2 Domain, Allowing its Recognition by Anti-Tag or Anti-Alpaca Antibodies
(36) VHH Expression with a His-Tag in the pET System
(37) The coding sequence of the VHH was subcloned in vector pET 22 using the NcoI and NotI restriction sites according to the manufacturer's instructions (Novagen, Darmstadt, Germany). Transformed E. coli BL 21 (DE3) cells expressed VHHs in the periplasm after induction by IPTG 1 mM for 18 hours at 15 C. Periplasmic extracts were obtained by spheroplasting cells, suspended in 50 mM sodium phosphate buffer pH 8 containing 20% sucrose and 1 mM EDTA, and hydrolysing the peptidoglycan with 5 mg/ml lysozyme for 20 min at 4 C., in the presence of protease inhibitors (Complete, Boehringer Mannheim, Germany). The suspension was then centrifuged 2 min at 10,000 rpm. The supernatant corresponding to the periplasmic extract was kept at 4 C. Purified VHHs were obtained by IMAC using a chelating agarose column charged with Ni.sup.2+ (Superflow Ni-NTA, Qiagen Ltd, UK) according to manufacturer's instructions. Purified VHH were dialysed against PBS and the protein content was measured using the Bradford reagent. The purity of the final preparation was evaluated by SDS-PAGE with Coomassie staining and by Western blot.
(38) Expression of VHH with the CH2 Domain
(39) Anti-His tag antibodies may prove to be difficult to use in immunohistochemistry experiments. This is why VHHs coupled with the CH2 domain were also prepared. Specific and sensitive rabbit anti-alpaca antibodies directed against the CH2 domain are available (LAFAYE et al., 2009, Mol Immunol., 46:695-704). Secondary anti-rabbit antibodies conjugated with horseradish peroxidase are routinely used in Neuropathology laboratories. The alpaca Immunoglobulin CH2 domain was amplified by RT-PCR using primer CH2-Fwd-Not and CH2-Rev-Xho (LAFAYE et al., 2009, cited above). These primers contain respectively a NotI and a XhoI site allowing the cloning of CH2 domain in pET 22 vector in frame with VHH gene. The expression and purification of VHH were performed as described in LAFAYE et al., 2009 (cited above).
(40) Nucleotide Sequencing
(41) Nucleic acid sequences were determined using double-stranded DNA and the appropriate primers (LAFAYE et al., 1995, Res Immune., 146:373-82; Erratum in: Res Immunol., 1996, 147:61 and EHSANI et al., Plant Mol. Biol., 2003, 52:17-29).
(42) Enzyme-Linked ImmunoSorbent Assay (ELISA)
(43) A modified version of a standard ELISA was used to test for the presence of VHH in culture supernatants. Microtiter plates (Nunc, Denmark) were coated by incubation overnight at 4 C. with 5 g/ml of antigen diluted in PBS. Plates were washed four times with buffer A (0.1% Tween 20 in PBS), and VHHs were diluted in buffer 13 (0.5% gelatin in buffer A). The plates were incubated for 2 hours at 37 C. and washed again, before adding a horseradish peroxidase-labeled rabbit anti-c-myc (A14) (Santa Cruz Biotechnology, Ca, USA) or with a rabbit anti-His tag antibody (Santa Cruz, Ca, USA). Then, the plates were washed with buffer A, and freshly prepared 0.2% orthophenylenediamine (Dakopatts A/S, Glostrup, Denmark), 0.03% H.sub.2O.sub.2 in 0.1 M citrate buffer, pH 5.2, were added to each well. The peroxidase reaction was stopped by adding 3 M HCl, and the optical density was measured at 490 nm.
(44) Determination of Dissociation Constants by ELISA
(45) The binding affinity of VHHs was determined as described by FRIGUET et al. (1985, J Immunol Methods, 77:305-319). Briefly, various concentrations of GFAP were incubated in solution overnight at 4 C. with a known quantity of VHH until equilibrium was reached. The VHH concentration had been determined by preliminary ELISA calibrations. 100 l of solution was transferred to a well of a microtiter plate previously coated with GFAP and was incubated for 20 min at 4 C. The plates were washed with PBS-Tween 0.1%. VHHs were detected with rabbit anti-His tag antibodies (eBiosciences, San Diego, Calif.) followed by adding -galactosidase-conjugated goat anti-rabbit Igs (Biosys, Compigne, France) and 4-methylumbelliferyl -D galactoside (Sigma Aldrich, Saint-Quentin Fallavier, France). Fluorescence was read at 460 nm, after excitation at 355 nm. K.sub.D was estimated from the slope of the regression curve obtained by plotting the reciprocal of the fraction of bound antibody versus the reciprocal of the molar concentration of antigen.
(46) Polyacrylamide Gel Electrophoresis and Western Blot
(47) Murine brain proteins (300 mg) were extracted in a potter with 600 l of NuPage LDS sample buffer (Invitrogen) and kept for 10 mn at 70 C. An aliquot was diluted 1:10 (v/v) with the same sample buffer then treated at 70 C. for 10 min. Following separation by polyacrylamide gel electrophoresis (PAGE) using NuPAGE Novex 4-12% Bis-tris gel (Invitrogen), semi-dry transfer onto Hybond-C (Amersham) and western blotting were carried out using the Xcell II blot module (Invitrogen). Prior to the immunochemical reaction, membranes were blocked in a 4% skimmed milk solution. Immunoblotting of membranes was accomplished with the different VHHs, and revealed by peroxidase-labeled rabbit anti-His tag (Santa Cruz, Ca, USA) followed by peroxidase labeled goat anti-rabbit immunoglobulins. Finally, peroxidase activity was visualized using a chemiluminescent kit (Amersham).
(48) 2) Results
(49) VHHs were amplified by PCR and three successive rounds of selection were performed. After the third round of selection, DNA was purified and cloned in the pET22 vector for periplasmic expression of soluble VHHs. Twenty clones were chosen for screening by ELISA and all of these clones bind specifically to GFAP. These clones have been sequenced and three sequences (VHH-E3, -E9 and -A10) have been obtained (
(50) The nucleotide sequences encoding VHH-E3, -E9 and -A10 are listed in the herewith attached sequence listing as SEQ ID NO: 7, 10 and 4.
(51) Yields of 1-2 mg of VHH/l of bacterial culture were obtained after immobilized metal affinity chromatography of periplasmic extracts. The single domain products were shown to be highly pure and homogenous by SDS-PAGE.
(52) The specificity of the different VHHs was tested by ELISA and by Western blot. All the VHHs were specific for GFAP by ELISA (
(53) VHH-A10 and VHH-E9 have an affinity of respectively 3.1 10.sup.9 M and 5.6 10.sup.9 M while VHH-E3 affinity is in the micromolar range.
EXAMPLE 2: VHH-A10 (SEQ ID NO: 5) RECOGNIZES GFAP ON MOUSE AND HUMAN BRAIN SECTIONS
(54) 1) Materials and Methods
(55) Subjects
(56) Human cortical brain tissue was obtained from the Hpital Piti-La Salpetrire, Paris, France.
(57) Female Balb/C mice, 6 to 8 weeks old, were euthanized with sodic pentotbarbital (Ceva), and brains were fixed by intra-aortic perfusion of 200 ml 4% paraformaldehyde in PBS.
(58) Immunocytochemistry
(59) Mice were killed with sodium pentobarbital (Ceva). Brains were fixed by intra-aortic perfusion of 200 ml 4% paraformaldehyde in PBS. The free-floating sections method was used for the immunolabelling. Vibratome sections obtained from the fixed brains were treated successively for: neutralization of free aldehydes remaining in the tissues, neutralization of endogenous peroxidases, saturation of non-specific binding sites, and permeabilization of cells in the nervous tissue with Triton as the detergent.
(60) Immunostaining of human brain tissue was performed on 5 m thick paraffin sections. Sections were de-paraffinized in xylene, rehydrated through ethanol (100%, 96%, and 90%) and finally brought to water. They were incubated with 3% hydrogen peroxyde and 20% methanol, to quench for endogenous peroxydases, and washed in water. Non-specific binding was blocked by incubating the sections for 10 minutes in 2% bovine serum albumin in TBS plus 0.5% Tween.
(61) Appropriate dilutions of primary antibodies were applied overnight in a humidified chamber at room temperature (typically 1 g/ml for VHH, and 1:200 for rabbit-anti GFAP polyclonal antibodies). Slides were washed with TBS-Tween and incubated with secondary antibodies (rabbit anti-His Tag or rabbit anti alpaca immunoglobulin) in TBS-Tween at room temperature for 2 hours. Slides were then incubated with peroxidase goat anti-rabbit immunoglobulins, and developed with diaminobenzidine (DAB) for 2 minutes. After washing with TBS-Tween, slides were counter-stained with haematoxylin.
(62) Double Labeling
(63) Paraffin sections of human samples were pretreated as previously. They were left overnight in a solution containing the anti-GFAP VHH and a mouse anti-GFAP monoclonal antibody at the appropriate dilutions in a humidified chamber at room temperature (1 g/ml for anti-GFAP VHH, and 1:500 for mouse anti-GFAP monoclonal antibodies M0756, Dako). Slides were washed with TBS-Tween and incubated for 2 hours in a TBS-Tween solution containing rabbit anti-His Tag (1:300) at room temperature. The slides were then incubated in a solution of goat anti-rabbit and goat anti-mouse immunoglobulins coupled respectively with CY2 and CY3 (Cy2 AffiniPure F(ab)2 Fragment Goat Anti-Rabbit IgG, Cy3 AffiniPure F(ab)2 Fragment Goat Anti-Mouse IgG, all from Jackson ImmunoResearch), washed in TBS-Tween, dehydrated and mounted in Mowiol.
(64) Diffusion Analysis of VHH and mAb
(65) Blocks of the frontal cortex were sliced with a vibratome at 70 m of thickness. The sections were pretreated with 3% hydrogen peroxide for 30 min at room temperature. They were permeabilized and blocked in a PBS solution containing 0.1% Triton X-100 (PBST), 2% bovine serum albumin and 5% normal goat serum for 30 min at room temperature. The sections (covering an area of approximately 4 cm.sup.2) were mounted between two coverslips and left for the night in the solution of the primary antibody (VHH-His, 1 g/ml in PBS or monoclonal mouse Anti-GFAP antibody, 1:500). Coverslips were used to limit the diffusion to the edges of the section by preventing contact of the primary antibody with the 2 sides of the section (the technique is disclosed by GABBOT and SOMOGYI (1984, J Neurosci Methods, 11:221-230).
(66) Coverslips adhesion was obtained by the removal of excess solution and of air bubble. After incubation during the night, one of the coverslips was gently taken off by slowly rotating a cutter blade interposed in the space that separates them. The following steps were performed on the free floating sections. A rabbit anti-His antibody, at a dilution of 1:10 000, was used to revealed the VHH. The rabbit anti-His antibody or the mouse anti-GFAP antibody were revealed by Dako REAL System Kit (peroxidase/DAB). The sections were dehydrated through graded ethanol (70%, 90%, and 100%) and xylene. They were mounted in DPX Neutral mounting medium.
(67) Statistical Analysis
(68) The distance between the pia matter and the deepest immunostained astrocyte (diffusion distance) was evaluated 18 times in 4 sections. The mean diffusion distances were calculated for the mouse mAb and the llama VHH. The diffusion distances were compared by a Student t test as pairs VHH/mAb immunohistochemistry at the same location of mirror sections (N=18).
(69) 2) Results
(70) The distribution of VHH-specific immunoreactivity in mouse and human brains sections were examined after aldehyde fixation and membranes permeabilization, using standard procedure for immunostaining. Immunohistochemistry experiments were performed with VHH-A10 (SEQ ID NO: 5) or VHH domain of SEQ ID NO: 3 fused in frame with the Ig CH2 domain and the His tag (SEQ ID NO: 29) were both used. With this construction, the signal could be amplified by using rabbit anti-alpaca Ig polyclonal antibodies as secondary antibodies, in turn labelled by an anti-rabbit goat polyclonal antibody. As previously reported (LAFAYE et al, 1995, above-cited), the results obtained were similar with the His-tagged antibody. VHH-A10 revealed a strong immunoreactivity in astrocytes. GFAP-positive astrocytes were seen in mouse brain mostly in the glia limitans and in the white matter. Only very few astrocytes were observed in grey matter (
(71) Immunolabeling in Human Brain:
(72) VHH-A10 fused with the CH2 domain immunolabeled astrocytes in human brain sections from controls and Alzheimer patients (
(73) Normal Cortical Samples:
(74) Fibrous GFAP positive astrocytes were seen in the white matter and in the subpial region. The labeling was strong in the processes and in the cell body close to the plasma membrane while the perinuclear region was not labeled (
(75) Alzheimer Disease Samples:
(76) The number of positive astrocytes was much larger in the samples from Alzheimer patients. This was particularly striking in the grey matter of the isocortex and hippocampus. The processes were numerous and strongly labeled. These processes circumscribed senile plaques (
(77) Astrocytoma Samples:
(78) Cellular body and processes of reactive and tumoral binucleated astrocytes were labeled (
(79) Double Labelling with a Mouse Anti-GFAP mAb and VHH-A10
(80) Colocalisation was seen in almost all the immunolabeled astrocytes (
(81) VHH-A10 Diffuses More Efficiently in Tissues than Anti-GFAP mAb
(82) Astrocytes were labelled with each one of the two antibodies in two sequential sections. Diffusion distance (over a period of 8 hours) was 19617 m (meanSEM) for mAb and 42224 m for VHH-A10 (i.e.; 24.5 m/hour and 52.75 m/hour respectively). The mean difference was 226 m (=28.25 m/h), N=18, t=9.3 and p<0.0001) (
EXAMPLE 3: STEREOTAXIC, INTRANASAL OR INTRAVENOUS ADMINISTRATION OF VHH-A10 (SEQ ID NO: 5)
(83) 1) Materials and Methods
(84) Stereotaxic and Intranasal or Intravenous Administration of VHH
(85) Female Balb/C mice, 6 to 8 weeks old, were used for subsequent experiments. Before the stereotaxic and intranasal administration, mice were anesthesized with a single intra-peritoneal administration of a mixture of ketamine hydrochloride (Imalgen) and xylazine (Rompun).
(86) For stereotaxic injection, mice were positioned on a stereotaxic frame (Kopf). Through a hole drilled in the cranium, a metallic canula was positioned into the rostro-dorsal striatum (x=1.3(0.2) mm; y=Bregma+1.54; z=3; PAXINOS and FRANKLIN, The mouse Brain in Stereotaxic Coordinates, Compact 2nd edition, Elsevier Academic Press, San Diego, 2004). Using a Harvard pump, 3 l of VHH (1 mg/ml) were injected into the striatum at a rate of 0.2 l/min. Penetration of the VHH was then allowed for 4, 7.5, or 14 hours before euthanasia and perfusion as described above in the method for immunohistochemistry.
(87) For nasal instillation, VHH (1 mg/ml) were placed in the nostril using a gel-loading tip. Each mouse received a total of 40 g in 10 l drops to alternating nares every 2-3 min. Penetration of the VHH was then allowed for time ranging from 1 to 24 hours before euthanasia and perfusion.
(88) 2) Results
(89) Intracranial Stereotaxic Administration of VHH Labels Astrocytes
(90) In this experiment, the VHH-A10 was first stereotaxically injected into the live rostro-dorsal striatum. It was allowed to diffuse in the cerebral tissue before processing for the aldehydic perfusion followed by the standard procedure for its immunostaining. The injected VHH showed diffuse distribution through the striatum 5 hours after the stereotaxic injection (
(91) Intranasal Administration of VHH Labels Astrocytes
(92) In this experiment, the VHH-A10 was administrated to the live brain tissue before histological treatments. Intranasal instillation of 40 g of VHH resulted in significant staining of astrocytes throughout the CNS (
EXAMPLE 4: VHH-E9 CROSSES THE BLOOD BRAIN BARRIER AND LABELS SPECIFICALLY GFAP
(93) 1) Materials and Methods
(94) Obtaining, Purification and Characterization of VHH-E9
(95) The expression and purification of anti-GFAP VHH-E9 was performed according to Example 1 above. SDS-PAGE was performed using NuPAGE Novex 4-12% Bis-tris gel according to manufacturer's instructions (Invitrogen). Western blotting were performed according to Example 1 above.
(96) Isoelectric focusing was performed using PhastSystem with PhastGel IEF 3-9. The pI Calibration Kit (Biorad) was used as standards. The pI calculation of the VHHs has been performed using EMBOSS iep software (at SOURCEFORGE).
(97) The heat denaturation of VHH-E9 was adapted to the method described in OLICHON et al. (2007, BMC Biotechnol., 7:7). VHHs are re-suspended in PBS/NaCl 300 mM and are heated for 15 minutes at 75 C. then cooled down at 4 C. for 20 minutes. The binding affinity of VHHs was determined by ELISA as described in Example 1 above.
(98) Site-Directed Mutagenesis
(99) The Quick change site directed mutagenesis kit (Stratagene) was used. The mutagenesis was performed according to manufacturer's instructions/with the following primers:
(100) TABLE-US-00002 Mutationsofcysteine22; -E9C22Ssens(SEQIDNO:30): 5-GGGTCTCTGAGACTCTCCTCTGCAGCCTC1GG-3 -E9C22Srev(SEQIDNO:31): 5-CCAGAGGCTGCAGAGGAGAGTCTCAG-3 Mutationsofcysteine96 -E9C96Ssens(SEQIDNO:32): 5-CTACCTTGTTGCGTGATCGCAGAGTAATACACGGCCGT-3 -E9C96Srev(SEQIDNO:33): 5-ACGGCCGTGTATTACTCTGCGATCACGCAACAAGGTAGC-3
(101) The plasmids containing the VHH were sequenced by ATGC using T7 promoter and T7 terminator primers.
(102) Transport Across a Blood Brain Barrier In Vitro Model
(103) Immortalized human brain endothelial cells hCMEC/D3 have been previously described in detail by WEKSLER et al. (2005, The FASEB Journal, 19:1872-1874). Cell viability in the presence of VHH was assessed by MTT assay. The permeability of hCMEC/D3 cell monolayers to VHH was measured on transwell polycarbonate insert filters (pore size 3 m, Corning, Brumath, France). hCMEC/D3 cells were seeded on the filters at a confluent density of 210.sup.5 cells/cm.sup.2 in EGM-2 medium. Transport studies were performed at 3 days post-seeding. Experiments were initiated by adding VHH to the upper chamber containing either collagen, coated inserts without cells, hCMEC/D3 cells or hCMEC/D3 cells pre-exposed to various pharmacological modulators for 30 min. Transport studies were conducted at 37 C. The lower chamber was sampled at various time intervals (10, 30 and 60 min) and the presence of VHH was determined by ELISA and Western Blot.
(104) Immunohistochemistry on Histological Sections
(105) Adult females C57B16 mice were euthanized with sodium pentobarbital i.p. (Ceva). Brains were fixed by intra-aortic perfusion with 150 ml 4% paraformaldehyde in PBS 0.1M pH 7.4, and postfixed in the same fixative overnight at 4 C.
(106) Vibratome sections, 70 m in thickness, were collected in PBS 0.1M, pH 7.4. Free floating brain sections were treated to neutralize free aldehydes, endogenous peroxidases, and non-specific binding sites, prior to immunolabeling. The primary antibody VHH, diluted 1 g/ml in PBS with 1% BSA, 1% normal goat serum, and 0.1% Triton-X100, was incubated overnight at 4 C. In the sections the VHH were decorated, successively, with rabbit anti-His tag antibodies (eBiosciences, USA) overnight at 4 C., then at room temperature with goat biotinylated anti-Rabbit IgG(H+L) (Vector BA-1000) for 2 hours, and ABC complex (Vector) for 30. DAB was used as chromogen. Sections were collected on superfrost glass slides, dehydrated in graded ethanol solutions, and mounted in DPX neutral mounting medium (Aldrich).
(107) Carotidian Injections of VHH In Vivo
(108) Before intra-carotidian injections, mice were anesthetized with a single intra-peritoneal administration of a ketamine hydrochloride (Imalgen) and xylazine (Rompun) mixture.
(109) The common carotid arteries were exposed with the aid of a microscope and cannulated with fine silicon tubing (PP25100FT, Portex, UK). The perfusion fluid containing VHH was infused in the carotid at a constant rate by a peristaltic pump (Model PHD 2000, Harvard apparatus, Harvard, Mass.). Some animals were transiently perfused with mannitol 30% (200 l for 30 s) to disrupt the BBB (RAPOPORT et al., 1980, American Journal of Physiology, 238:R421-R431), prior to the injection of VHH. Allowing diverse times for intra-tissular diffusion, the mice were then perfused. The presence of the VHH-His.sub.6 putative intrabody in the cerebral tissue was detected using the standard immunohistochemical procedure described above.
(110) Parasite infection: A central feature of Cerebral Malaria pathology after infection with Plasmodium berghei ANKA line is the alteration and opening of the BBB (BEGHDADI et al., 2008, Journal of Experimental Medicine, 205:395-408). C57/B16 mice were inoculated i.p. with 10.sup.6 infected erythrocytes Pb ANKA per mice. At day 5 after infection, mice were injected with VHH via the carotide artery.
(111) 2) Results
(112) Characterization of VHH-E9
(113) A single 46 Kda band corresponding to the size of GFAP were revealed on the immunoblots of murine brain extracts (see
(114) The pI of VHH-E9 was determined by isoelectric focusing (IEF) (see
(115) The labeling of GFAP in murine astrocytes using standard immunohistochemical procedure on free floating brain sections was analyzed. GFAP-positive astrocytes were seen mostly in the white matter, hippocampus, glia limitans, and some in the gray matter of the cerebral cortex (
(116) The affinity of VHH-E9 heated at 75 C. for 15 minutes, was measured at 3.8.10.sup.9 M, suggesting that VHH-E9 is thermostable.
(117) Capacity of VHH-E9 to Cross the BBB In Vitro
(118) The capacity of VHH-E9 to cross the BBB, was tested in the in vitro BBB model developed by WEKSLER et al. (2005, The FASEB Journal, 19:1872-1874), using a monolayer of hCMEC/D3 cells. VHH-E9 was not toxic to these cells even at very high concentration (1 mg/ml). The upper chamber received 10-20 g/ml of VHH-E9 and the rate of passage of VHH-E9 from the luminal to the abluminal side of the monolayer was measured.
(119)
(120) It is now agreed that ionic interactions between cationic proteins and negative charges present on cell membranes trigger an adsorptive-mediated endocytosis (AME) (VORBRODT, 1989, Journal of Neurocytology, 18:359-368). The contribution of AME to VHH-E9 transcytosis was then assessed. HCMEC/D3 were preincubated for 30 mn either with highly cationic protamine sulfate (40 g/ml) or poly-lysine (300 M), both previously shown to inhibit AME, prior to assessing VHH-E9 uptake and transport. Both cationic peptides inhibit the transendothelial migration of VHH-E9 suggesting that the transmigration is charge-dependant (
(121) These observations strongly suggest that VHH-E9 is transported through the endothelial cell monolayer by an intracellular endocytic mechanism rather than via inter-cellular pathway.
(122) Capacity of VHH-E9 to Cross the BBB In Vivo
(123) VHH-E9 was then tested in vivo for its ability to cross the BBB, in both normal and pathological conditions. Different amounts of VHH-E9 were injected via the left carotide of untreated mice, during 60 minutes. One mouse received 200 l of VHH-E9 at the concentration of 2 mg/ml (0.4 mg); a second one received 200 l of VHH-E9 at the concentration of 20 mg/ml (4 mg); a third one received 500 l of VHH-E9 at the concentration of 50 mg/ml (25 mg). After the injection, the diffusion of VHH-E9 in the cerebral tissue was allowed for 1 hour before mice were euthanized and perfused with fixative. Immunostaining of astrocytes were observed only with mice that received 4 mg and 25 mg of VHH-E9 (
(124) Pathological opening of the BBB observed in neurological (inflammatory, infectious, neoplasic) and neurodegenerative diseases, allows circulation of plasma, electrolytes, drugs, proteins, blood cells, into the cerebral tissue, with detrimental effects. The ability of VHH-E9 to go through altered BBB was investigated using either osmotic stress or cerebral malaria. The tight junctions of the cerebrovascular endothelium can be reversibly opened, in vivo, under osmotic stress. 250 l of an hypertonic solution of mannitol 30% was injected for 30 seconds in the carotid, prior to injection of 200 l of VHH-E9 at the concentration of 2 mg/ml, for 60 min. Significant staining of astrocytes was observed throughout the CNS (
(125) Cerebral malaria, a clinically complex syndrome of coma and encephalopathy, is correlated with the rupture of BBB integrity. In an experimental model, C57BL/6 mice developed similar neuropathological signs, five days after i.v. injection of Plasmodium berghei ANKA infected erythrocytes (BEGHDADI et al., 2008, Journal of Experimental Medicine, 205:395-408). Intracarotidian injection of 200 l VHH-E9 (2 mg/ml) (400 g) during 60 min, in two infected mice, resulted in significant staining of astrocytes (
(126) Characterization of VHH-E9 SS-Free
(127) A fully functional cysteine-free derivative of VHH E9 was generated by replacing the disulfide forming cysteine residues (Cys 22 and Cys 96) with the amino acid combination serine-serine. VHH-E9 SS-free had an affinity of 12.Math.10.sup.9 M, only reduced twice compared to the affinity of native VHH-E9, suggesting that the antigen binding properties were not affected by removal of disulfide bonds.
CONCLUSION
(128) The capacity of GFAP specific-VHHs to act as transbodies and intrabodies in vitro as well as in vivo has been demonstrated. These transbodies need to fulfill a set of requirements not observed with conventional antibodies and corresponding fragments; namely: 1) they cross the BBB, 2) diffuse in brain tissues, 3) penetrate into cells, 4) are intracellularly stable, and 5) bind specifically to intracellular antigens. Once GFAP specific-VHH has penetrated into the cells, it specifically labels GFAP, suggesting that it remains active in spite of the reducing properties of the cytosol.
(129) Antibody domains carry an internal disulfide bond, which connects both -sheets of the -sandwich structure and is strictly conserved during evolution, witnessing its important contribution to their stability (ALZARI et al., 1988, Annual Review of Immunology, 6:555-580; PROBA et al., 1997, Journal of Molecular Biology, 265:161-172). Genetic removal of the disulfide bonds in the variable domains of antibody fragments (Fab, Fv or scFv) yields no functional protein, suggesting a severe loss of stability. Normal antibody fragments do not form disulfide bonds in the cytoplasm and usually are unable to achieve a stable native folding in the absence of the disulfide bonds (BIOCCA et al., 1995, Bio/Technology, 13:1110-1115).
(130) VHHs directed against a GFAP make them interesting agents for brain imaging and new therapeutic strategies to target intracerebral antigens such as amyloid proteins, to reach intracerebral tumor cells, or to cure infections caused by viruses, bacteria or parasites.