Use of 15 male fertility related proteins or combination thereof
10155008 ยท 2018-12-18
Assignee
Inventors
Cpc classification
A61K31/7105
HUMAN NECESSITIES
G01N33/5308
PHYSICS
G01N2800/367
PHYSICS
International classification
A61K31/7105
HUMAN NECESSITIES
A61K39/395
HUMAN NECESSITIES
Abstract
The present invention provides the use of the gene or protein of adenylate kinase 6 (AK6) or the combination of AK6 and other 14 genes or proteins related to male infertility for (i) preparing the agent or kit for detecting male infertility; and/or (ii) preparing the pharmaceutical composition for contraception.
Claims
1. A method for detecting or diagnosing male infertility and improving in vitro fertilization success rate comprising: (i) detecting expression and/or activity of a protein set or a gene set thereof in a sample from a test subject, wherein the protein set comprises: (a) AK6 protein, and optionally (b) one or more proteins listed in Table 1 and selected from the group consisting of LMNB2, HADH, UAP1, CALR, AKR7A2, CTSB, HSPA5, GPX5, KLHL15, HSPA1L, GP83, CLDN7, ALDH4A1, and ALDH2; (ii) determining whether the test subject has a higher probability of infertility than normal population by satisfying the following relationship: the ratio of the expression and/or activity of AK6 gene or protein in the sample from the test subject to the expression and/or the activity of AK6 gene or protein in normal population is 2; and/or the ratio of the expression and/or activity of one or more proteins selected from the group consisting of SEQ ID NOs.: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, and 30 in Table 1 in the sample from the test subject to the expression and/or the activity of that in normal population is 0.5; (iii) contacting in vitro a sperm capacitation liquid with one or more proteins listed in Table 1 and selected from the group consisting of LMNB2, HADH, UAP1, CALR, AKR7A2, CTSB, HSPA5, GPX5, KLHL15, HSPA1L, GP83, CLDN7, ALDH4A1, and ALDH2, and completing an in vitro fertilization process of sperms and eggs, wherein the sperm capacitation liquid contains the sperms from the test subject whose probability of infertility is higher than normal population.
2. The method of claim 1, wherein in step (i), further comprising detecting AK6 regulatory miRNA.
3. The method of claim 2, wherein a low expression of the AK6 regulatory miRNA indicates that the test subject has a higher probability of infertility than normal population.
4. The method of claim 2, wherein the AK6 regulatory miRNA is selected from the group consisting of miR-370, miR-544a, miR-27a, miR-27b, miR-128, miR-20a, miR-20b, miR-106b, miR-106a, miR-17, miR-200b, miR-200c, miR-93, miR-429, and miR-519d.
5. The method of claim 4 wherein in step (ii), if the expression of one or more microRNAs of miR-370, miR-544a, miR-27a, miR-27b, miR-128, miR-20a, miR-20b, miR-106b, miR-106a, miR-17, miR-200b, and miR-200c are decreased as compared with normal population, it indicates that the subject suffers from oligospermia.
6. The method of claim 4 wherein in step (ii), if the expression of miR-93 and miR-429 are decreased as compared with normal population, it indicates that the subject suffers from oligospermia.
7. The method of claim 4 wherein in step (ii), if the expression of miR-519d is significantly decreased as compared with normal population, it indicates that the subject suffers from asthenozoospermia or oligospermia.
8. The method of claim 1, wherein in step (i) further comprising detecting GPX5 regulatory miRNA, wherein the GPX5 regulatory miRNA selected from the group consisting of miR-419-5p, miR-299-3p, miR-296-3p, miR-194, miR-134, miR-383, and miR-206.
Description
DESCRIPTION OF FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
DETAILED DESCRIPTION OF INVENTION
(9) Upon comprehensive and intensive studies, the inventors discovered a close relationship between adenosine kinase 6 (AK6) protein and male infertility, that is, the expression level of AK6 and activity are increased in male infertility patients, and the expression level of AK6 and activity are also increased with age in normal population. Based on the experiment, the inventors further discovered that decreasing the expression level of AK6 and/or activity can enhance the success rate of male fertilization. In addition, the inventors further discovered that the combination of AK6 and 14 proteins in Table 1 is helpful for diagnosing male infertility. There will be therapeutic effects on male infertility, in particular, asthenozoospermia and oligo asthenozoospermia when decreasing the expression level and/or activity of AK6, or simultaneously increasing the expression level and/or activity of one or more proteins selected from 14 proteins in Table 1. Based on the above findings, the present invention is completed.
(10) Sperm Localization Proteins
(11) As used herein, the term the protein of the present invention, male fertility-associated proteins, sperm localization proteins of the present invention, sperm localization proteins and age-related sperm localization proteins can be used interchangeably, referring to the protein that is age-related and localized in sperms, and can be expressed in the testis and/or epididymis of male mammals (especially, humans). The relevant molecular biological materials include, but are not limited to, mutant proteins, any fragment of proteins, genes and any DNA fragment, mutant genes, mRNA, interfering RNA, antibodies thereof and the like. Representative sperm localization proteins include 14 down-regulated proteins and one up-regulated protein (AK6) shown in Table 1.
(12) As used herein, the term mammals refer to a mammalian species that is viviparous and the offspring are breast-fed a representative mammal belonging to vertebrates includes (but not limited to), for example, human, monkey sheep cow, rabbit, horse, mouse, rat and the like, in particular, human is preferred.
(13) Among the 14 proteins shown in Table 1, the contents of 14 proteins are low in the sperms of the old and the asthenozoospermia, classified as the down-regulating sperm localization proteins (SEQ ID NO.: 1-14) expressed in the old or the asthenozoospermia; the contents of another protein of the present invention (AK6) are high in the sperms of the old and the asthenozoospermia, classified as the up-regulating sperm localization protein expressed in the old or the asthenozoospermia.
(14) TABLE-US-00001 TABLE 1 15 age-related human sperm localization proteins Access Numbers SEQ Access Numbers of the ID gene of the reference present sperm No. Lab NO. NO.: name sequence invention localization 1 HEL-S-9a 4 LMNB2 NM_032737.2 GQ891286 acrosome 2 HTL-S-203a 6 HADH NM_005327.4 HM005616 acrosome 3 HTL-T-37a 8 UAP1 NM_003115.4 HM005660 acrosome 4 HEL-S-99n 10 CALR NM_004343.3 FJ224311 neck 5 HEL-S-166mP 12 AKR7A2 NM_003689.3 EU794591 middle section and main section of tail 6 HEL-S-158am 14 CTSB NM_001908.3 GQ891351 acrosome and middle section of tail 7 HEL-S-89n 16 HSPA5 NM_005347.4 EU794617 neck 8 HEL-S-75p 18 GPX5 NM_001509.2 FJ460514 post- acrosome 9 HEL-S-35a 20 KLHL15 NM_030624.2 GQ891312 acrosome 10 HEL-S-109n 22 HSPA1L NM_005527.3 GQ891337 neck 11 HEL-S-135P 24 GP83 NM_003817.3 GQ891358 main section of tail 12 HEL-S-127m 26 CLDN7 NM_001307.4 GQ891357 middle section of tail 13 HEL-S-174mP 28 ALDH4A1 NM_003748.2 GQ891378 main and middle section of tail 14 HEL-S-143P 30 ALDH2 NM_000690.2 GQ891366 main section of tail
(15) The nucleotide sequences encoding the proteins as set forth by SEQ ID NO.: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, and 30 are respectively set forth by SEQ ID NO.: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, and 29.
(16) Protein Set
(17) A protein set for diagnosing or treating male infertility is provided by the present invention, the protein set at least comprises AK6 and other male infertility-associated proteins, especially sperm localization proteins. Generally, as used herein, the term other male infertility-associated proteins refers to proteins found in the prior art that are associated with male infertility. Preferably, the protein set of the present invention comprise AK6 and one or more sperm localization proteins selected from Table 1. Wherein, AK6 protein in the present invention is a newly discovered protein which is closely related with male infertility and differentially expressed in the young people and the aged.
(18) It should be understood that the protein set of the present invention comprise (a) AK6 protein, and optionally one or more proteins selected from Table 1; or
(19) (b) any 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 of proteins selected from Table 1.
(20) Upon experiments, the inventors have found that the expression level and/or activity of AK6, any proteins selected from Table 1 or a combination thereof is significantly different between the sperms from the young people and the aged, so that it can be used as target proteins for determining sperm aging and hypofunction. Upon intensive studies, the inventors have further discovered the differential expression of some of these proteins between the patients who have already been diagnosed as asthenozoospermia and oligo asthenozoospermia and the normal populations (the young people).
(21) Based on the above experimental results, the protein set used for diagnosing or treating male infertility are obtained by the inventors. That is, it is helpful to determine or predict the probability of infertility in the test subject by combining Ak6 with proteins in the prior art (in particular, Table 1 of the present invention) to form the protein set and determining the expression level and/or activity of these protein set. Developing the antibodies against these protein set contributes to the treatment of male infertility or the development of contraceptive drugs. For example, for preparing monoclonal antibodies to AK6 proteins.
(22) It should be understood that the protein set of the present invention can be a set formed by Ak6 and any male infertility-associated proteins. By regulating the expression level and/or activity of Ak6 or other male infertility-associated proteins, pharmaceutical compositions for improving fertilization rate (promoting fertility) or decreasing fertilization rate (contraception) can be prepared respectively.
(23) In addition, a gene set for encoding the protein set of the present invention is provided, comprising cDNA, a complete gene sequence for encoding the proteins, or the nucleic acids having an identity of 70%, 80%, more preferably, 85%, 90%, 95%, comparing with the original encoded. By using the gene (or encoding nucleic acid) set, the antisense nucleic acids thereof can be prepared by the conventional means, or the mRNA thereof can be determined, or these genes can be qualitatively or quantitatively detected by detecting the corresponding miRNA.
(24) miRNA
(25) A target gene set for diagnosing or predicting/detecting infertility is provided, the expression level of the gene sets can be determined by using known miRNA of each gene in the gene sets of the present invention.
(26) A preferred gene regulatory-associated miRNA is shown below:
(27) Among the AK6 gene regulatory-associated miRNAs, the expressions of miR-370, miR-544a, miR-27a, miR-27b, miR-128, miR-20a, miR-20b, miR-106b, miR-106a, miR-17, miR-200b, and miR-200c are decreased in the oligo asthenozoospermia group, the expressions of miR-93, miR-429 is decreased in the asthenozoospermia group, and the expression of miR-519d is significantly decreased in the aged, the asthenozoospermia and the oligo asthenozoospermia group. The sequences of AK6 gene regulatory-associated miRNAs are shown below:
(28) TABLE-US-00002 miRNA SEQIDNO Sequence hsa-miR-128 31 TCACAGTGAACCGGTCTCTTT hsa-miR-27a 32 TTCACAGTGGCTAAGTTCCGC hsa-miR-27b 33 TTCACAGTGGCTAAGTTCTGC hsa-miR-200b 34 TAATACTGCCTGGTAATGATGA hsa-miR-200c 35 TAATACTGCCGGGTAATGATGGA hsa-miR-429 36 TAATACTGTCTGGTAAAACCGT hsa-miR-370 37 GCCTGCTGGGGTGGAACCTGGT hsa-miR-544a 38 ATTCTGCATTTTTAGCAAGTTC hsa-miR-106b 39 TAAAGTGCTGACAGTGCAGAT hsa-miR-519d 40 CAAAGTGCCTCCCTTTAGAGTG hsa-miR-106a 41 AAAAGTGCTTACAGTGCAGGTAG hsa-miR-17 42 CAAAGTGCTTACAGTGCAGGTAG hsa-miR-20a 43 TAAAGTGCTTATAGTGCAGGTAG hsa-miR-20b 44 CAAAGTGCTCATAGTGCAGGTAG hsa-miR-93 45 CAAAGTGCTGTTCGTGCAGGTAG
(29) While among the GPX5 gene regulatory-associated miRNAs, the expressions of miR-419-5p, miR-299-3p, miR-296-3p, miR-194, miR-134, miR-383, miR-206 are significantly increased in the patients with asthenozoospermia and oligo asthenozoospermia. The sequences of GPX5 gene regulatory-associated miRNAs are shown below:
(30) TABLE-US-00003 miRNA SEQIDNO.: Sequence hsa-miR-194 46 TGTAACAGCAACTCCATGTGGA hsa-miR-134 47 TGTGACTGGTTGACCAGAGGGG hsa-miR-206 48 TGGAATGTAAGGAAGTGTGTGG hsa-miR-383 49 AGATCAGAAGGTGATTGTGGCT hsa-miR-296-3p 50 GAGGGTTGGGTGGAGGCTCTCC hsa-miR-299-3p 51 TATGTGGGATGGTAAACCGCTT hsa-miR-491-5p 52 AGTGGGGAACCCTTCCATGAGG
(31) Therefore, the skilled person in the art can determine every gene regulatory-associated miRNAs in the genomes of the present invention based on the teaching of the present invention and the miRNA-screening methods in the prior art, thereby developing more detection reagents or kits related with male infertility, and pharmaceutical compositions for treating male infertility.
(32) Detection Method
(33) In the present invention, a method for qualitatively or quantitatively detecting 15 sperm localization proteins of the present invention and the related molecular biological materials thereof is provided, wherein including (but not limited to): detection for human sperm localization proteins, gene mutation, mRNAs for gene transcription, regulatory-associated miRNA, mutein, and protein activity. The biological samples for the detection include (but are not limited to): sperm, semen, urine, blood, or prostatic fluid.
(34) Representative detection method includes (but not limited to): protein chip, antibody chip, DNA chip, liquid chip, ELISA, immunoblotting, RT-PCR, real time fluorescence quantitative PCR, immunohistochemistry, immunofluorescence, flow cytometry, mass spectrometry, capillary electrophoresis, immunoprecipitation, enzyme activity assay, and the like.
(35) Asthenozoospermia
(36) According to the fifth edition of the WHO Human Semen Laboratory Test Manual, it is deemed as asthenozoospermia when the percentage of progressive (PR) sperms is less than 32%. The asthenozoospermia of the present invention refers to the asthenozoospermia in young people with other indexes (such as teratospermia rate, sperm density, white blood cell numbers, semen volume, and the like) in semen routine substantially normal.
(37) Oligo Asthenozoospermia
(38) The term oligo asthenozoospermia of the present invention refers to those people having a progressive sperm percentage<32% in semen, a sperm concentration less than 1510.sup.6/ml or the sperm amounts for one ejaculation<3910.sup.6.
(39) Qualitative or Quantitative Detection for Sperm Localization Proteins on Human Sperm
(40) The qualitative or quantitative method for detecting human sperm localization proteins of the present invention is not specifically limited. It can be any instruments, software or means in the art for detecting fluorescence intensity or fluorescence value.
(41) Generally, after the incubation of the specific antibodies with the test sample (sperm), the localization of the sperm localization proteins are determined by fluorescent labeled second antibodies, thereby calculating the localization rate and contents of the proteins by the scanning results through Laser Scanning Confocal Microscope. The method for quantifying the sperm protein expression by Laser Scanning Confocal Microscope is shown below: an immunofluorescence slide is observed at a magnification 400. The view containing sperms are observed sequentially (the view is required for the condition of no non-sperm cells, no overlap on the tail of the sperms, the tail of the sperms should be intact in the view) until the total number of the sperms in the view reaches 200. Background Fluorescence was measured in a blank area without sperms. Sperms with fluorescence values below or above the blank value (the mean value is approximately 10) were used for statistics of stained sperms ratio. LSM 510 META software (LSM 5 version 3.2) automatically measures the fluorescence values of all stained sperms, removes the fluorescence background threshold, and then obtains the mean immunofluorescence intensity values of the stained sperms. The detection results of this method are consistent with that obtained by flow cytometry. The detection method for the localization rate and contents of the proteins by flow cytometry is shown below: sperm washing and preparation is treated as the former, the fluorescence values of the sperm samples are determined by BD flow cytometry, counting 10,000 sperms, and the stained cell ratio and stained cell fluorescence intensity are analyzed by Cellquest software.
(42) The specific antibodies labeled with fluorescence can be dissolved in a solution and bind to the sperm surface, and the expression levels of the sperm surface proteins can be detected qualitatively or quantitatively by the detecting means such as flow cytometry; alternatively, the antibodies can be fixed on the supports (e.g., polyethylene plates, immune microspheres, glass slides, nitrocellulose (NC) membrane and PVDF film, etc.), and the percentage of the positive sperm can be detected qualitatively or quantitatively with an ordinary scanner; further, the antibodies can be coupled to the magnetic beads or plastic beads, and the sperm localization proteins in the samples such as semen or sperm lysate can be detected qualitatively or quantitatively by a dual-antibody sandwich assay through a liquid chip.
(43) Protein Chip and the Use Thereof for Sample Detection Such as Human Seminal Plasma
(44) The present invention also provides protein chips used for detecting sperm localization proteins. The chips can be used to qualitatively or quantitatively detect the content of sperm localization proteins in a test sample. The detection results can be used to aid the determination of sperm quality, functional level of the sperms and/or the cause for the decrease of sperm quality.
(45) The term protein arrays or protein chips can be used interchangeably and both refer to the arrays of capture reagents which can bind to the protein markers. Typically, the capture reagents can be polyclonal or monoclonal antibodies which can bind to the specific proteins. After the markers are captured and then detected by the labeled detectable molecules, thereby achieving the goals for the qualitatively or quantitatively (using the standards) detection.
(46) The protein chips of the invention are characterized in that the detection points for sperm localization proteins are set on the chips. As used herein, the term detection point refers to the spotting point used for detecting the corresponding protein on a protein chip. For example, the detection point used for detecting Protein AK6 is generally formed by spotting the monoclonal antibody of anti-AK6 protein on chip substrates or coupled to the magnetic beads or plastic beads.
(47) The protein chips suitable for the present invention are not particularly limited. Any blank protein chips with known structures in the art can be used. Generally, supports for these protein chips include: immune microspheres, glass sheets, plastic sheets, nitrocellulose (NC) film, and PVDF film, in which the immune microspheres and various substrates are particularly preferred. The purpose for detecting various proteins can be achieved by orderly fixing peptides, proteins or antibodies on various supports through the methods such as in-situ synthesis, mechanical spotting or covalent binding to form the chip for detection, fluorescence-marked antibodies or other components interacting with the chip, washing off the components which fail to bind to the complementary proteins on the chip by rinsing, and then using a fluorescence scanner or a confocal laser scanning technology to detect the fluorescence intensity of each point on the chip or other supports and the strength of markers for analyzing the content of each protein, thereby achieving the goals for the determination of each protein.
(48) Protein chip of the invention may comprise detection points for one or more sperm localization proteins shown in Table 1, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 sperm localization proteins disclosed for the first time in the invention. These 15 detection points can be used alone or in any combinations, or used in combination with sperms detection index in the prior art for evaluating the sperm quality or diagnosing male infertility, etc.
INDUSTRIAL APPLICATIONS
(49) Sperm production, maturation and aging are mainly reflected by the amount of protein molecules secreted by testicular epididymal and binded on the sperm. The increase, reduction or impairment of sperms will lead to dysmaturity or dysfunction, resulting in male infertility. Based on the present invention, the detection method and the detection means for sperm localization proteins can be used to detect the content of 15 age-related sperm localization proteins, thereby determining the sperm quality and diagnosing male infertility.
(50) For example, some detecting or diagnosing results, such as sperm quality, sperm healthy status, infertility or not, etc., are obtained by measuring the content of 14 down-regulated sperm localization proteins. In a word, high contents of the 14 sperm localization proteins indicates a good health condition, a good quality of the sperms or the sperms are from the normal young; low contents of the 14 sperm localization proteins indicates a poor health condition of the sperm or the sperms are from the aged.
(51) In addition, it is helpful for improving the healthy condition of the sperms and enhancing the sperm activity by supplementing one or more proteins selected from 14 down-regulated sperm localization proteins.
(52) For the normal population, it will be helpful for contraception by reducing the expression or activity of 14 down-regulated sperm localization proteins through antibody blocking or siRNA interference, etc.
(53) As for different fields, the representative applications include (but not limited to):
(54) (a) The evaluation of the sperm quality and health condition: the sperm health condition and quality are evaluated by determining the content of the proteins of the present invention on the sperm or in the seminal plasma. The content of 14 down-regulated proteins is low or zero, the content of one up-regulated protein (such as protein AK6) is high, indicating a poor sperm health condition, low sperm quality and sperm impairment; otherwise, indicating a good sperm health condition and high sperm quality.
(55) (b) The diagnosis for male infertility: the male infertility is diagnosed by determining the content of the protein of the present invention on the sperm or in the seminal plasma. The content of 14 down-regulated proteins is low or zero, the content of one up-regulated protein is high, indicating the possible occurrence of infertility.
(56) (c) The evaluation for the environmental pollution: a preventive detection for reproductive health or an environmental pollution evaluation is performed by determining the protein contents of the present invention on the sperm. For those living in different places, the lower the protein content is, the worse the living environment is. It is helpful to estimate the environment problems by statistical analysis on a large number of people.
(57) (d) Management of human health: determining the protein contents of the present invention in human samples (such as blood, urine, seminal plasma, tissue, etc.). A result beyond normal range indicates a possible health problem, which needs a further inspection or diagnosis.
(58) (e) Age identification: for example, in the field of forensic medicine, age can be identified or assisted determined by determining the protein contents of the present invention.
(59) (f) Healthcare and therapeutic application: By supplementing the protein of the present invention, diseases related to the function of the protein can be treated, and the sperm motility can be enhanced and the male infertility can be treated. For example, a suppository can be prepared and non-invasively used for female reproductive tract; or an injection can be prepared for male (local injection, subcutaneous injection, etc.).
(60) (g) Contraception: preparations (such as suppositories) can be made for contraception by using the antibodies against the protein of the present invention.
(61) (h) Drug target and Screening: the protein of the present invention can be used as a drug target for screening contraceptive drugs or therapeutic drugs for male infertility.
(62) (i) Evaluation of therapeutic effect: The content variation of the protein of the present invention can be used as an auxiliary index for evaluating the curative effect on treating male infertility.
(63) (j) Toxicity test: the effect of drugs, chemicals, cosmetics, etc. on reproduction can be evaluated by determining the content variation of the protein in animal sperms or seminal plasma.
(64) The above applications can be achieved not only by determining content viaration of 15 proteins in human samples, but also by detecting gene mutations, transcription levels, amino acid changes, addition or deletion of the nucleotides or amino acids, regulatory-associated miRNA level, antibodies, and the like.
(65) The main advantages of the invention mainly include:
(66) (a) A detection result of contents of age-related sperm localization proteins can be rapidly and effectively obtained.
(67) (b) The protein-related molecule biological materials and the detection methods thereof of the present invention contribute to the promotion of the diagnosis, treatment, or preventionrelated medical technologies for male infertility and the development of diagnostic agents, therapeutic agents, prophylactic drugs or contraceptives.
(68) (c) The protein of the present invention can also be used to determine the age of human or other mammals, or evaluate the cells aging and sperm and cell quality, or develop anti-aging products.
(69) The present invention will be further illustrated below with reference to specific examples. It should be understood that these examples are only to illustrate the present invention but not to limit the scope of the present invention. The experimental methods with no specific conditions described in the following examples are generally performed under conventional conditions, such as the conditions described in Sambrook et al, molecular cloning: the Laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacture's instruction.
(70) General Method
(71) Gene Cloning, Prokaryotic Expression and Protein Purification
(72) The protein product of the above-mentioned 15 genes can be obtained by the following method. Based on the gene sequence, a pair of specific primers for amplifying the mature coding region was synthesized. Human epididymal cDNA library prepared by the conventional method was used as a template, the target gene was directly amplified by PCR, and then cloned into a commercially available vector pGM-T vector (available from Shanghai Beibo Biotech Co., Ltd.) for sequencing and identification. The sequenced and identified genes were cloned into the expression vector pET32b(+) (available from Shanghai Beibo Biotech Co., Ltd.) by restriction enzyme sites, rendering it consistent with the reading frame of the fusion tag. The recombinant expression vector was transformed into E. coli BL21(DE3), induced expression by IPTG, the thallus was ultrasonic fragmented, the recombinant protein was separated and purified according to the His-tag of the vector by two-step nickel affinity chromatography.
Example 1 Quantitative Analysis of 15 Sperm Localization Proteins in Table 1 on Human Sperms of Different Ages
(73) 30 semen samples (30, 40, 50, 60, 65, 702 years old) of normal populations with different ages were respectively collected, all without the record of reproductive system diseases. After the semen was completely liquefied, 1 ml semen was added into a 15 ml sterile conical bottom tube, and then PBS was added to 8 ml, respectively, and the mixture was gently blown and mixed and centrifuged at 500 g for 15 min. The supernatant was discarded, and then washed twice with PBS (500 g, 10 min), the supernatant was discarded. The collected sperm precipitation was adjusted to a sperm concentration of 110.sup.6 cells/ml with PBS containing 3% (w/v) BSA, and plated on the slides coated with 0.1% gelatin, dried at the room temperature, fixed with methanol for 10 min at 20 C., washed three times with PBS for 5 min after drying; and then a primary antibody against the target protein was dropwise added (diluted with PBS containing 3% BSA as 1:50), and incubated at the room temperature for 1h. PBS was used for washing for 3 times, 5 min for each. A second antibody labeled with FITC (diluted with PBS containing 3% BSA as 1:100) was added and subjected to incubation in room temperature for 1 h. PBS was used for washing for 3 times, 5 min for each. Counterstain was conducted with PI. The product was washed twice with distilled water, 10 min for each, sealed with buffer glycerol, and respectively subjected to Meta 510 laser confocal microscope (Zeiss, Germany) for protein localization and quantification analysis.
(74) Results are shown in
(75) However, sperm localization protein Ak6 of No. 15 in Table 1 is upregulated, and the localization rate and contents of which on sperms from the old are significantly higher than that from the young people (see
Example 2 Identification of Recombinant Proteins
(76) 15 purified recombinant proteins were quantitative identified by Bradford method (Bradford 1976), and then freeze-dried for storage.
(77) The purified recombinant protein is identified as the protein of the present invention.
Example 3 Analysis of Sperm-Associated Proteins in Asthenozoospermia
(78) 102 cases of young asthenozoospermia samples were collected, the localization rate and contents of CTSB, HSPA5, ALDH4A1 and AK6 on sperms with asthenozoospermia were quantitatively analyzed. The specific method is the same as that in Example 1, the results are shown in
(79) The results show that the percentage of significant lost of those three proteins, ie, CTSB, HSPA5 and ALDH4A1 is 45.1%, 45.1% and 57.8%, respectively, with a total coverage rate reaching 85.5%. That is, over 85% sperms with asthenozoospermia have expression defection in at least one of the above-mentioned proteins, while AK6 shows an increasing trend. It can be seen that it is helpful to diagnose asthenozoospermia and male infertility by quantitatively detecting the 4 proteins on sperms.
Example 4 Preparation and Application for Monoclonal Antibodies
(80) 4.1 Preparation for Monoclonal Antibodies
(81) The monoclonal antibodies against the proteins of the present invention can be obtained by the conventional preparation method; preferably, the present example can be obtained by the following method: each purified recombinant protein of the present invention was used to immunize BALB/C mice respectively. Each mouse was injected on the first day with 50 g of recombinant protein and the same amount of Complete Freund's Adjuvant (CFA). Then, 25 g of recombinant protein and the same amount of Incomplete Freund's Adjuvant (IFA) were injected on the 15th, 30th and 45th days for booster immunization. 3 to 4 days after the last immunization, spleen cells were separated and mixed with Sp2 myeloma cell strains and PEG was added for cell fusion, the fused cells were diluted properly and placed into well plate respectively for culture. Generally, they were diluted to 0.8 cells/well. When the cells had been cultured to cover 20% of the well bottom, the supernatant was drawed and detected for the content of antibodies by ELISA. Screened positive cells were inoculated intraperitoneally into mice, and the ascites was collected. The antibodies were riched to the affinity column which was prepared by staphylococcal protein A and eluted, thereby recovering the monoclonal antibodies.
(82) 4.2 Immunofluorescence Localization of the Proteins Using Monoclonal Antibodies of 4.1
(83) Sperms were collected, washed with PBS, and then smeared on the slides coated with 1% gelatin, naturally dried and fixed for 10 minutes with methanol. Slides with sperms were blocked for 1 hour with 3% BSA at room temperature, and then each monoclonal antibodies obtained by 4.1 were added (1:200) and kept overnight at 4 C. The product was washed for three times with PBST (PBS containing 0.1% Tween-20), and the corresponding secondary antibodies (1:200) of FITC-labeled goat anti-mouse IgG were added. The slides were washed for three times with PBST, and 80% glycerol was used for blocking. Olympus BX-52 microscope was used to observe the results. The results are shown in Table 1. Proteins located at the tail, neck and acrosome and other parts of the mature sperm respectively.
Example 5 Preparation for the Protein Chips
(84) Protein chips No. 1-3 were prepared by the following method:
(85) a Slide Chip No. 1
(86) (1) a high-speed spotting instrument was used for directly and intensively spotting the protein samples (antibodies against the proteins of the present invention) in the multi-well plate on the slides which have been chemically treated and have activated aldehyde groups on the surface. There are 15 sample spots (corresponding to 15 proteins No. 1-15 of Table 1 respectively) for each array, and the diameter of each sample spot is 0.4 mm;
(87) (2) incubating the slides at room temperature overnight or at 37 C. for 1 hour for fixing the sample through the condensation reaction between the amino groups on the protein and the aldehyde groups on the slide;
(88) (3) activated aldehyde groups not occupied by the proteins on slides were reduced and the slides were washed thoroughly and dried at room temperature;
(89) (4) finally, the slides were sealed with photophobic materials and stored under 4 C.
(90) b PDVF Film Chip No. 2
(91) (1) a high-speed spotting instrument was used for spotting the protein samples (antibodies against the proteins of the present invention) in the multi-well plate on the PDVF film. There are 15 sample spots (ibid) for each array, and the diameter of each sample spot is 0.4 mm;
(92) (2) the film was washed for 2-3 times with buffer solution, 3-6 minutes for each time;
(93) (3) 5% calf serum or skimmed milk powder was used for blockage for 1-2 hours at room temperature;
(94) (4) the film was washed for 2-3 times with buffer solution again, 3-6 minutes for each time;
(95) (5) the film was dried, sealed with photophobic materials and stored under 4 C.
(96) c Liquid Chip No. 3
(97) (1) A pair of antibodies against the test proteins was prepared, one of them was used as a capture antibodies, and the other was used as a detection antibodies.
(98) (2) Coupling the capture antibody to the magnetic beads. One capture antibody corresponded to a serial number of beads.
(99) (3) The detection antibodies were labeled with fluorescence.
(100) (4) The capture antibodies and detection antibodies were optimized and sorted, in order to prevent cross-reaction occurring between the different proteins to be tested.
Example 6 Formula and Preparation Process for Suppository
(101) 5.1 Formula
(102) TABLE-US-00004 composition amount HSPA5 protein 5 mg -CD 10 mg Tween 80 2 mg semi-synthetic fatty acid enzyme type 36 40 mg
(103) 5.2 Preparation Process:
(104) 1. Suitable amount of ethanol were added into -CD and the product were stirred homogenously to form a paste. HSPA5 protein was added, grinded for clathration for 45 minutes, ready to use.
(105) 2. The semi-synthetic fatty acid enzyme type 36 was heated to dissolve, and the temperature was maintained as 38 C. The clathration of the main drug, tween 80 were added, stirred to homogenous and subjected to insulation.
(106) 3. The insulated product which was mixed to homogenous was filled into mould and cooled for molding.
Example 8 Preparation of Drugs for Improving In Vitro Fertilization Success Rate
(107) The proteins with lower-content were determined by detecting the content of 15 above-mentioned proteins on sperms for in vitro fertilization. The sperm localization proteins obtained from Example 2 or a composition containing various of proteins were subjected to a sperm capacitation liquid, and then the fertilization process of sperms and eggs was completed in the protein-containing capacitation liquid. For the patients suffering male infertility disorders and asthenozoospermia, sperm motility was improved 30 minutes after the proteins had been added, and the number of progressive sperms was increased as well, therefore, the success rate of fertilization in vitro was improved.
Example 9 Quantitative Detection for mRNAs Corresponding to Sperm Localization Proteins
(108) Semen samples from 305 years old of normal young people, asthenozoospermia patients, oligo asthenozoospermia patients, and 702 years old of the old were collected, 10 cases for each group. The samples were washed with PBS for three times and subjected to microscopic counting. Sperm RNA was extracted from the centrifuged sperm by Trizol. The sperm RNA samples were screened with CD52 and CDH1 genes and then subjected to Real-time PCR.
(109) Three parallel experiments were performed on each sample. The reactions were performed according to the instruction of Platinum SYBR Green qPCR SuperMix-UDG reaction kit (Invitrogen). The fluorescence quantitative PCR was performed using Rotor-Gene Q (QIAGEN). Reaction condition: 50 C. for 10 min, 95 C. for 10 min, 95 C. for 15 s, 60 C. for 45 s, 40 cycles. The relative expression level of the target gene was calculated using the 2-CT method (Kenneth J, et al). CT=(Ct(target gene of the test group)Ct(reference gene of the test group))(Ct(target gene of the control group)Ct (reference gene of the control group)). GAPDH was selected as the reference gene.
(110) Using the above method, the mRNA transcription levels of 15 genes in Table 1 in normal sperms from the young people were detected, and as a result, 7 genes can be detected. The transcription levels of them in the sperms from the old, the asthenozoospermia, and the oligo asthenozoospermia were further analysed. It was found that the level of mRNA of AK6 in the sperms from the old was twice as much as that from the normal young, the level of mRNA of AK6 in the sperms of the oligo asthenozoospermia was 8 times as much as that from the normal young, the level of mRNA of GPX5 in the sperms from the old is 0.12 times as much as that from the normal young, the level of mRNA of GPX5 in the sperms from the oligo asthenozoospermia is 0.07 times as much as that from the normal young. The contents of mRNAs of UAP1, CTSB, HSPA1L, HSPA5, or CALR in the sperms from the normal young and the old, the asthenozoospermia, and the oligo asthenozoospermia are not significantly different. The statistical results are shown in
Example 10 Quantitative Detection of AK6 Gene Regulatory-Associated miRNA on Sperms
(111) Two softwares, TargetScan (http://www.targetscan.org/) and miRanda (http://www.microrna.org/microrna/home.do), were simultaneously used to predict miRNA molecules that regulate AK6 transcription. TargetScan predicted 53 miRNAs and miRanda predicted 17 miRNAs, wherein 15 miRNAs were overlapped in two databases. The quantitative detection of the levels of the 15 miRNAs on sperms was carried out. The method was shown below: The total RNA was extracted from 10 sperms devoted from the normal population, the asthenozoospermia, the old (702 years), and the oligo asthenozoospermia, respectively. For each miRNA reverse transcription reaction, miRNA-specific stem-loop primers, 1 ng-1 g of total RNA, and ReverTra Ace reverse transcriptase (Toyobo) were used. PCR was performed using miRNA-specific forward primers and universal reverse primer (URP) with QIAGEN's Roter-Gene Q. In a 20 L reaction system, 1 L cDNA template was included. The PCR condition was: 95 C. for 5 minutes, 95 C. for 10 seconds, and 60 C. for 45 seconds, 40 cycles in total. The enzyme used in the PCR was Platinum SYBR Green qPCR SuperMix-UDG, commercially available from Life Technologies (Cat. No. 11733-038). U6 snRNA was used as a reference gene. The 2.sup.Ct method was used to calculate the difference in miRNA levels between the samples. All experiments were done triplicated. The results are shown in
(112) The results shows that compared with the normal sperms group, the expressions of miR-370, miR-544a, miR-27a, miR-27b, miR-128, miR-20a, miR-20b, miR-106b, miR-106a, miR-17, miR-200b, and miR-200c were decreased in the oligo asthenozoospermia group, the expressions of miR-93 and miR-429 were decreased in the asthenozoospermia group, the expression of miR-519d was significantly decreased in the old, the asthenozoospermia and the oligo asthenozoospermia patients. It is expected to achieve the auxiliary diagnosis for oligozoospermia and male infertility, etc. by quantitatively detecting these 15 miRNAs.
Example 11 Quantitative Detection of GPX5 Gene Regulatory-Associated miRNA on Sperms
(113) The prediction of GPX5 transcriptional regulation-related miRNAs and the quantitative detection method thereof on sperms were the same as in Example 11. 9 GPX5 transcriptional regulation-related miRNAs were predicted, and the quantitative detection results thereof in the sperms from the normal young, the old (702 years), the asthenozoospermia, the oligo asthenozoospermia were shown in
(114) The results show that compared with the normal sperms group, the expressions of the 9 miRNAs in the old and the oligo asthenozoospermia patients were increased at least by 2.5 times. Wherein the expressions of miR-419-5p, miR-299-3p, miR-296-3p, miR-194, miR-134, miR-383, and miR-206 in the oligo asthenozoospermia group were increased at least by 66 times, and were increased in the asthenozoospermia group at least by 2.4 times.
(115) Discussion
(116) At present, a few of seminal plasma proteins have been used for the auxiliary diagnosis and treatment of infertility Combined detection with a number of markers can screen and improve the positive rate of the diagnosis. Commonly used immunological detection methods include radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), or chemiluminescence immunoassay (CLIA). Although these techniques have their own advantages, all of these techniques have a common limitation, that is, only one infertility protein marker can be detected for each time, which obviously fails to meet the clinical need for the combined detection of multiple markers of infertility. Gene chips and protein chips can not only be used to analyze a variety of different genes or proteins simultaneously in the same samples, but also detect multiple samples at the same time. Therefore, the work efficiency can be greatly improved additionally with high sensitivity and accuracy, good signal to noise ratio, and only a small sample is needed. It is easy to operate and the repeatability is good.
(117) 15 age-related human sperm localization proteins, molecular biological materials thereof, such as genes, antibodies, mRNA, and miRNAs which regulate the transcription of these genes, including interference RNA, any fragments of proteins or genes, vaccine, etc. were screened and obtained by the present invention for the first time. A detection method for the transcription level, expression level, gene mutation, amino acid variations, adding and deleting, regulation for the associated miRNA level, antibodies of one or more genes selected from 15 male fertility-associated proteins is established, and a pharmaceutical composition containing one or more proteins in Table 1 and AK6 is prepared. In addition, based on proteomics of testis and epididymal sperm maturation microenvironment, proteomic analysis of testis and epididymis 2D-DIGE differential proteomics of different age groups and protein immunofluorescence localization and quantification of sperms were conducted. The results show that the quantitative localization of 15 proteins in the sperms of the old is significantly different from that of the young adults (wherein 14 of which are significantly decreased and 1 is significantly increased). In addition, the difference will be more significant with aging, indicating that senile sperm dysfunction or loss of function is associated with these sperm localization proteins, in particular with the reduction of the 14 down-regulated expression proteins or the reduction of the 14 down-regulated expression proteins will lead to impaired fertility or loss of function to some extent. The present invention contributes to promote the development of the medical technology related with the diagnosis, treatment, prevention for the male infertility, and the development of the diagnostic agents, therapeutic agents, prophylactic drugs and contraceptives. The present invention also contributes to promote the development of anti-aging products and medical cosmetic technologies.
(118) All literatures mentioned in the present application are incorporated by reference herein, as though individually incorporated by reference. Additionally, it should be understood that after reading the above teaching, many variations and modifications may be made by the skilled in the art, and these equivalents also fall within the scope as defined by the appended claims.