ENGINEERED PHAGEMIDS

20180355378 ยท 2018-12-13

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided herein, in some embodiments, are engineered phagemids that comprise at least one synthetic genetic circuit, wherein the at least one synthetic genetic circuit comprises gene sequences encoding at least one non-lytic antimicrobial peptides (AMPs) and/or antibacterial toxin proteins, a stable origin of replication, and a bacteriophage-packaging signal, wherein the engineered phagemid does not comprise some or all gene sequences encoding bacteriophage proteins required for assembly of a bacteriophage particle.

Claims

1. An engineered phagemid that comprises at least one synthetic genetic circuit, wherein the at least one synthetic genetic circuit comprises gene sequences encoding at least one non-lytic antimicrobial peptides (AMPs) and/or antibacterial toxin proteins, an origin of replication, and a bacteriophage-packaging signal; wherein the engineered phagemid does not comprise some or all gene sequences encoding bacteriophage proteins required for assembly of a bacteriophage particle.

2. The engineered phagemid of claim 1, wherein the phagemid does not comprise any gene sequences encoding bacteriophage proteins required for assembly of a bacteriophage particle.

3. The engineered phagemid of claim 1, further comprising a multiple cloning site (MCS).

4. The engineered phagemid of claim 1, wherein the phagemid is a high-copy-number phagemid.

5. The engineered phagemid of claim 1, wherein the origin of replication is an F1 origin of replication.

6. The engineered phagemid of claim 1, wherein the engineered phagemid is an M13-derived phagemid.

7. The engineered phagemid of claim 1, wherein the gene sequences encoding at least one non-lytic AMPs, at least one toxin protein, or at least one non-lytic AMP and at least one toxin protein comprises two tandem copies of the gene sequence.

8. The engineered phagemid of claim 1, wherein at least one of the gene sequences encoding at least one non-lytic AMPs, at least one toxin protein, or at least one non-lytic AMP and at least one toxin protein is/are operably linked to a tetR-repressed P.sub.LtetO promoter.

9. The engineered phagemid of claim 1, wherein the ribosome binding site (RBS) for each antibacterial gene is selected independently.

10. The engineered phagemid of claim 1, wherein the AMPs are selected from the group consisting of cecropin PR-39, apidaecin Ia, buforin II, dermaseptin and pleurocidin.

11. The engineered phagemid of claim 1, wherein the AMPs are selected from the group consisting of cecropin PR-39 and apidaecin Ia.

12. The engineered phagemid of claim 1, wherein the at least one synthetic genetic circuit comprises gene sequences encoding cecropin PR-39 and apidaecin Ia.

13. The engineered phagemid of claim 1, wherein the at least one synthetic genetic circuit comprises two copies of gene sequences encoding cecropin PR-39 and two copies of gene sequences encoding apidaecin Ia.

14. The engineered phagemid of claim 13, wherein the two copies of gene sequences encoding cecropin PR-39 and the two copies of gene sequences encoding apidaecin Ia are tandem copies of the gene sequences and are operably linked to a P.sub.LtetO promoter.

15. The engineered phagemid of claim 1, wherein the antibacterial toxin proteins are selected from the group consisting of CcdB, YeeV, YeeV truncated at the C terminus by 52 residues (YeeV) and ParE.

16. The engineered phagemid of claim 1, wherein the antibacterial toxin protein is CcdB, and wherein the at least one synthetic genetic circuit comprises two tandem copies of gene sequences encoding CcdB.

17. A phagemid particle comprising the engineered phagemid of claim 1.

18. A composition comprising the engineered phagemid of claim 1.

19. A composition comprising the phagemid particle of claim 17.

20. A method of treating a bacterial infection, comprising administering to a subject in need of treatment of a bacterial infection an effective amount of the engineered phagemid of claim 1.

21. A method of treating a bacterial infection, comprising administering to a subject in need of treatment of a bacterial infection an effective amount of the phagemid particle of claim 17.

22. A method of treating a bacterial infection, comprising administering to a subject in need of treatment of a bacterial infection an effective amount of the composition of claim 18.

23. A method of treating a bacterial infection, comprising administering to a subject in need of treatment of a bacterial infection an effective amount of the composition of claim 19.

24. A phagemid system comprising the engineered phagemid of claim 1; and a plasmid comprising a phagemid helper system that expresses bacteriophage proteins required for assembly of a bacteriophage particle, wherein the plasmid is not packaged in the bacteriophage particle.

25. A bacterial cell comprising the phagemid system of claim 24.

26. A method, comprising transforming a bacterial cell with the phagemid system of claim 24.

27. The method of claim 26 further comprising isolating phagemid particles secreted by the bacterial cell.

28. The method of claim 27 further comprising delivering the isolated phagemid particles to a target bacterial cell.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0008] The accompanying drawings are not intended to be drawn to scale. For purposes of clarity, not every component may be labeled in every drawing.

[0009] FIG. 1 shows an example of antibacterial phagemid construction. Phagemid plasmids, which carry an engineered antibacterial network, bacteriophage-packaging signal, and high-copy origin of replication, are first transformed into a production strain harboring a helper plasmid. Next, secreted phagemid particles are isolated from the production strain and purified. Resulting engineered phagemid particles are then used to infect target bacteria, causing expression of antibacterial proteins, which inhibit intracellular processes and cause non-lytic bacterial death.

[0010] FIGS. 2A-2B show an example of testing antibacterial peptide candidates in test and phagemid networks. (A) Five antibacterial networks, expressing cecropin, apidaecin, buforin II, dermaseptin, or pleurocidin genes, were cloned into the testing strain, mgpro, and tested for their ability to cause bacterial cell death following induction with 100 ng/mL anhydrotetracycline (aTc), which relieves the inhibition of the P.sub.LtetO promoter by tetR. (B) Antibacterial networks expressing either cecropin or apidaecin networks were introduced into phagemid and bacteriophage plasmids, and the resulting particles were tested against EMG2 E. coli for their ability to cause non-lytic bacterial death.

[0011] FIGS. 3A-3B show an example of bacteriophage resistance determination for phagemid and bacteriophage therapies. (A) EMG2 E. coli were infected with either bacteriophage or phagemid particles carrying the cecropin antibacterial network. Six hours post infection these cells were monitored for network functionality and diluted overnight. The following day a secondary infection of either bacteriophage or phagemid particles carrying a GFP expression network was administered. These cells, including an uninfected control, were then monitored for GFP expression 6 hours post infection. (B) Infection data from the primary infection with phagemid or bacteriophage particles carrying the cecropin network showed expected bacterial death. Reinfection data from the secondary infection with phagemid or bacteriophage particles carrying a GFP network show bacteriophage resistance formation in samples exposed to bacteriophage but not phagemid particles.

[0012] FIGS. 4A-4C show an example of modulation of AMP networks and enhancement by toxin networks. (A) Phagemids carrying synthetic networks that express combinations of cecropin and apidaecin antibacterial peptides were tested against EMG2 E. coli for their ability to cause bacterial death. These phagemid networks were designated .sub.I, .sub.II, and .sub.III respectively. (B) Three toxin networks, expressing ccdB, yeeV, or parE genes were designed under regulation of the P.sub.LTetO promoter. These networks were cloned into the MCS of the .sub.III plasmid, and purified particles were screened against EMG2 E. coli for possible synergy with cecropin and apidaecin networks. Purified phagemid particles were tested alongside .sub.III particles for induction of bacterial death. (C) An overexpressing ccdB network was cloned into the MCS of the .sub.IV plasmid. Purified phagemid particles were screened against EMG2 E. coli for their ability to cause non-lytic bacterial death. (D) Various final concentrations of .sub.III and .sub.IV phagemid particles were tested against target EMG2 bacteria. Bacterial cell viability was assessed 6 hours post infection.

[0013] FIGS. 5A-5B show an example of a murine peritonitis infection model with .sub.IV expressing phagemid particles. (A) Overview of murine model for bacterial peritoneal infection with EMG2 E. coli bacteria and subsequent phagemid treatment. (B) Survival data for murine infection model with phagemid treatments and controls. Mice were divided into three groups: untreated (n=22), vehicle only (n=12), and .sub.IV (n=10). Data were obtained from two separate experiments and significance was determined by a Mantel-Cox test.

[0014] FIG. 6 shows gene expression by bacteriophage- and phagemid-delivered networks. Differences in synthetic network expression of a constitutive GFP-expressing network delivered by either the M13 bacteriophage or by its phagemid. Bacteriophage and phagemid particles carrying a constitutive GFP expression network were purified from liquid culture and used to infect EMG2 E. coli. Resulting GFP expression was tracked over time for fluorescence.

[0015] FIG. 7 shows gene expression by bacteriophage- and phagemid-delivered networks. Effects of vehicle phagemid particles expressing no antibacterial genes against EMG2 bacteria.

DESCRIPTION

[0016] Antibiotic-resistant bacterial infections are an increasing concern in clinical and non-clinical settings. Current first-line treatments rely upon the administration of small-molecule antibiotics to induce bacterial cell death. These broad-spectrum treatments disrupt the patient's normal microflora, allowing resistant bacteria and fungal pathogens to take advantage of vacated niches. Bacteriophages offer several distinct advantages over traditional antibiotic treatment, including high bacterial target specificity and reduced collateral damage to the host microbiota. They also have the potential to deliver synthetic gene networks, which can be designed to disrupt bacterial structures and processes through the expression of antibacterial or sensitizing genes. Phage therapy has relied upon lytic bacteriophages, which cause bacterial cell death through the rupture of the bacterial cell membrane. However, bacterial lysis results in the release of expressed proteins and endotoxins into the surrounding environment. This in turn can lead to detrimental side effects, ranging from diarrhea to sepsis and even death.

[0017] Lysogenic bacteriophages, in contrast to their lytic counterparts, secrete mature bacteriophage particles without causing cellular lysis. Although lysogenic bacteriophages have been engineered to serve as adjuvants to antibiotics by overexpressing sensitizing proteins, their dependence upon antibiotics makes them inherently non-lethal and ineffective on their own. Lysogenic bacteriophage genomes become less reliable over time due to fluctuations in genome copy number as they become packaged into viral particles. Repeated infection-reinfection cycles can also render infected bacteria resistant to further bacteriophage infection as the target cell tries to escape superinfection, reducing the effect of repeated treatment. These limitations diminish the effectiveness of bacteriophage therapies as a viable treatment strategy.

[0018] The present disclosure provides a modular bacterial phagemid system, which expresses a variety of non-lytic antimicrobial peptides (AMPs) and toxin proteins, to address the rising need for non-traditional, antibacterial treatment solutions. Phagemids, which employ bacteriophage proteins but selectively package a synthetic plasmid, provide a marked benefit over standard bacteriophage therapies, lytic and lysogenic alike. This system limits the serious side effects linked to lytic bacteriophage approaches and improves upon lysogenic therapies by allowing for the direct delivery of specific high-copy plasmids to target cells in a single round of infection, ensuring consistent network expression levels and long-term stability (FIG. 6).

[0019] The phagemid system as provided herein, in some embodiments, relies upon the expression of two plasmids: the first plasmid carries a bacteriophage-packaging signal and the desired antibacterial gene network, while the second plasmid contains a phagemid helper system (Chasteen L et al. Nucleic Acids Research 2006, 34 (21), e145-e145), which generates the bacteriophage proteins required for particle assembly but is not packaged itself. Together, these plasmids produce bacteriophage particles that selectively package an engineered plasmid harboring a synthetic gene network and a stable origin of replication rather than the bacteriophage genome. This approach allows for sustained network expression and reduces the formation of bacteriophage resistance by avoiding bacteriophage particle replication and superinfection in target cells, for example.

[0020] This phagemid system is highly modular in part as due to a plug-and-play cloning platform (Litcofsky, K. D. et al. Nature Methods 2012, 9 (11), 1077-1080). This platform employs a high-copy plasmid that contains a large multiple cloning site (MCS) into which a range of engineered antibacterial networks were inserted along with the F1 origin of replication, which serves as the packaging signal for the M13 bacteriophage (Russel, M. et al. Journal of Virology 1989, 63 (8), 3284-3295). The fully constructed phagemid plasmid was then transformed into a production strain, carrying the M13cp phagemid helper plasmid. Phagemid particles produced by this strain were then used for single-round infection of the target Escherichia coli (E. coli) cells, leading to non-lytic bacterial cell death (FIG. 1).

Phagemids, Phagemid Particles and Phagemid Systems

[0021] A phagemid is a filamentous phage-derived vector containing the replication origin of a plasmid and the packaging signal of a bacteriophage. An engineered phagemid is a phagemid that does not occur in nature. An engineered phagemid may be recombinant or synthetic. A recombinant phagemid is constructed by joining nucleic acids (e.g., isolated nucleic acids, synthetic nucleic acids or a combination thereof). A synthetic phagemid is amplified, chemically synthesized, or synthesized by other means. In some embodiments, an engineered phagemid is a phagemid that has been modified by genetic or chemical means.

[0022] Examples of phagemids that may be used in accordance with the invention include, without limitation, M13-derived phagemids containing the F1 origin for filamentous phage packaging such as, for example, pBluescript II SK (+/) and KS (+/) phagemids, pBC SK and KS phagemids, pADL and P1-based phagemids (see, e.g., Westwater C A et al., Microbiology 148, 943-50 (2002); Kittleson J T et al., ACS Synthetic Biology 1, 583-89 (2012); Mead D A et al., Biotechnology 10, 85-102 (1988)). In some embodiments, a phagemid is an M13-derived phagemid. Other phagemids may be used in accordance with the present disclosure.

[0023] Engineered phagemids of the present disclosure, in some embodiments, comprise an origin of replication, which is a particular nucleotide sequence at which replication is initiated. In some embodiments, the origin of replication is an F1 origin of replication, which is derived from an F1 phage (a class I filamentous phage). Other origins of replication may be used in accordance with the present disclosure.

[0024] Engineered phagemids of the present disclosure, in some embodiments, comprise a bacteriophage-packaging signal, which is a cis-active region of a bacteriophage genome that signals the bacteriophage genome encapsidation.

[0025] Some embodiments of the present disclosure provide phagemid particles comprising an engineered phagemid. A phagemid particle, as used herein, is a bacteriophage that contains an engineered phagemid but does not contain a bacteriophage genome. A bacteriophage is an obligate intracellular parasite that multiplies inside bacteria by making use of some or all of the host biosynthetic machinery. Though different phage may contain different materials, they all contain nucleic acid and protein, and may be covered by a lipid membrane. A bacteriophage genome typically consists of a single, linear or circular, double- or single-stranded nucleic acid. Depending on the phage, the nucleic acid can be either DNA or RNA.

[0026] In some embodiments, engineered phagemids do not comprise (lack, are free of) gene sequences encoding bacteriophage proteins required for assembly of a bacteriophage particle. Such genes vary among different types of bacteriophage. M13 bacteriophage, for example, is a filamentous bacteriophage composed of circular single stranded DNA (ssDNA) which is 6407 nucleotides long encapsulated in approximately 2700 copies of the major coat protein P8, and capped with 5 copies of two different minor coat proteins (P9, P6, P3) on the ends. The minor coat protein P3 attaches to the receptor at the tip of the F pilus of the host Escherichia coli. The phage coat is primarily assembled from P8. Thus, in some embodiments, engineered phagemids do not comprise gene sequences encoding M13 P8. In some embodiments, engineered phagemids do not comprise gene sequences encoding M13 P8, P9. P6 or P3. In some embodiments, an engineered phagemid may comprise some, but not all, gene sequences encoding bacteriophage proteins required for assembly of a bacteriophage particle. For example, engineered phagemids may comprise 1, 2, 3 or more gene sequences encoding bacteriophage proteins required for assembly of a bacteriophage particle.

[0027] Engineered phagemids of the present disclosure, in some embodiments, comprise a multiple cloning site, which is a short segment of DNA containing many (e.g., 10-30) restriction sites. Restriction sites within an MCS are typically unique, occurring only once within a given phagemid.

[0028] Engineered phagemids of the present disclosure, in some embodiments, are considered high-copy-number phagemids. Copy number refers to the average or expected number of copies of the phagemid per host cell (e.g., bacterial cell). Copy number can depend on the origin of replication and its constituents, the size of the phagemid and the synthetic genetic circuit, and culture conditions (e.g., factors that influence the metabolic burden on the host cell). For high-copy-number phagemids, typically there are 500-700 copies per cell, although there may be more or less. For medium-copy-number phagemids, typically there are 20-100 copies for cell, and for low-copy-number phagemids, typically there are 15-20 copies per cell.

[0029] Some embodiments provide phagemid systems that comprise an engineered phagemid and a plasmid comprising a phagemid helper system that expresses bacteriophage proteins required for assembly of a bacteriophage particle, wherein the plasmid is not packaged in the bacteriophage particle. A phagemid helper system (Chasteen L et al. Nucleic Acids Research 2006, 34 (21), e145-e145, incorporated herein by reference) includes cell lines that contain M13-based helper plasmids that express phage packaging proteins, which assemble phagemid particles as efficiently as helper phage, but without helper phage contamination. Thus, phagemid systems, in some embodiments, comprise (a) an engineered phagemid that comprises at least one synthetic genetic circuit, wherein the at least one synthetic genetic circuit comprises gene sequences encoding at least one non-lytic antimicrobial peptides (AMPs) and/or antibacterial toxin proteins, a stable origin of replication, and a bacteriophage-packaging signal, wherein the engineered phagemid does not comprise some or all gene sequences encoding bacteriophage proteins required for assembly of a bacteriophage particle, and (b) a plasmid comprising nucleic acids that encode (or a phagemid helper system that expresses) bacteriophage proteins required for assembly of a bacteriophage particle, wherein the plasmid is not packaged (encapsidated) in the bacteriophage particle.

Antimicrobial Peptides and Antibacterial Toxin Proteins

[0030] Engineered phagemids of the present disclosure, in some embodiments, comprise a (at least one) synthetic genetic circuit that comprises gene sequences encoding at least one non-lytic antimicrobial peptides (AMPs) and/or antibacterial toxin proteins.

[0031] Antimicrobial peptides are potent, broad spectrum antibiotics that can be divided into subgroups based on their amino acid composition and structure. Antimicrobial peptides generally, but not always, have between 12 and 50 amino acids. These peptides typically include two or more positively charged residues provided by arginine, lysine or, in acidic environments, histidine, and a large proportion (generally >50%) of hydrophobic residues. The secondary structures of AMPs are typically -helical, -stranded due to the presence of two or more disulfide bonds, -hairpin or looped due to the presence of a single disulfide bond and/or cyclization of the peptide chain, or extended. Many of these peptides are unstructured in free solution, and fold into their final configuration upon partitioning into biological membranes. In some instances, AMPs contain hydrophilic amino acid residues aligned along one side and hydrophobic amino acid residues aligned along the opposite side of a helical molecule. This amphipathicity of the antimicrobial peptides allows them to partition into the membrane lipid bilayer. The ability to associate with membranes is a feature of many antimicrobial peptides, although membrane permeabilization is not necessary.

[0032] Examples of AMPs for use as provided herein include, without limitation, anionic peptides (rich in glutamic and aspartic acid), linear cationic -helical peptides (lack in cysteine), cationic peptide enriched for specific amino acids (rich in proline, arginine, phenylalanine, glycine, tryptophan) and anionic and cationic peptides that contain cysteine and form disulfide bonds (contain 1-3 disulfide bond(s)). Non-limiting examples of anionic peptides include maximin H5 from amphibians, dermcidin from humans. Non-limiting examples of linear cationic -helical peptides include cecropins, andropin, moricin, ceratotoxin and melittin from insects, magainin, dermaseptin, bombinin, brevinin-1, esculentins and buforin II from amphibians, CAP18 from rabbits, and LL37 from humans. Non-limiting examples of cationic peptides enriched for specific amino acids include abaecin, apidaecins from honeybees, prophenin from pigs, indolicidin from cattle. Non-limiting examples of anionic and cationic peptides that contain cysteine and form disulfide bonds include brevinins (1 bond), protegrin from pig (2 bonds), tachyplesins from horseshoe crabs (2 bonds), defensins from humans (3 bonds), and drosomycin in fruit flies (more than 3 bonds). Antimicrobial peptides are produced by all known species, including peptides from bacteria, from fungi, from hydra, insects (e.g., mastoparan, poneratoxin, cecropin, moricin, melittin and others), frogs (e.g., magainin, dermaseptin and others), and mammals (e.g., cathelicidins, defensins and protegrins).

[0033] In some embodiments, AMPs are non-lytic (do not cause cell lysis). Examples of non-lytic AMPs include, without limitation, cecropin PR-39, apidaecin Ia, buforin II, dermaseptin and pleurocidin.

[0034] Antibacterial toxin proteins encompassed by the present disclosure include, without limitation, CcdB, YeeV, YeeV truncated at the C terminus by 52 residues (YeeV), ParE, Colicin (ColN) (including nuclease colicins (e.g., E3, D4, E6 (cleave rRNA), E5 and D (cleave tRNA), E2, E7, E8, E9 (cleave DNA) and pore-forming colicins (e.g., A, B, E1, Ia and Ib), Viriditoxin, RelE (and RelE-like proteins), YoeB, MqsR, YafQ and YgjN. Other antibacterial toxin proteins may be used in accordance with the present disclosure.

[0035] In some embodiments, the gene sequences encoding at least one non-lytic AMPs, at least one toxin protein, or at least one non-lytic AMP and at least one toxin protein comprises two (or three or four) tandem copies of the gene sequence.

Synthetic Gene Circuits

[0036] Engineered phagemids of the presents disclosure comprise at least one synthetic genetic circuit. An engineered phagemid is a phagemid (a filamentous phage-derived vector containing the replication origin of a plasmid and the packaging signal of a bacteriophage) that does not occur in nature. A genetic circuit is a collection of genetic elements (e.g., promoters, enhancers, terminators, and nucleic acids encoding proteins, such as AMPs) that interact with each other and with other substances or molecules in a cell to regulate gene expression.

[0037] An engineered nucleic acid is a nucleic acid (e.g., at least two nucleotides covalently linked together, and in some instances, containing phosphodiester bonds, referred to as a phosphodiester backbone) that does not occur in nature. Engineered nucleic acids include recombinant nucleic acids and synthetic nucleic acids. A recombinant nucleic acid is a molecule that is constructed by joining nucleic acids (e.g., isolated nucleic acids, synthetic nucleic acids or a combination thereof) and, in some embodiments, can replicate in a living cell. A synthetic nucleic acid is a molecule that is amplified, chemically synthesized, or synthesized by other means. A synthetic nucleic acid includes those that are chemically modified, or otherwise modified, but can base pair with (also referred to as binding to, e.g., transiently or stably) naturally-occurring nucleic acid molecules. Recombinant and synthetic nucleic acids also include those molecules that result from the replication of either of the foregoing.

[0038] While an engineered nucleic acid, as a whole, is not naturally-occurring, it may include wild-type nucleotide sequences. In some embodiments, an engineered nucleic acid comprises nucleotide sequences obtained from different organisms (e.g., obtained from different species). For example, in some embodiments, an engineered nucleic acid includes a murine nucleotide sequence, a bacterial nucleotide sequence, a human nucleotide sequence, a viral nucleotide sequence, or a combination of any two or more of the foregoing sequences.

[0039] In some embodiments, an engineered nucleic acid of the present disclosure may comprise a backbone other than a phosphodiester backbone. For example, an engineered nucleic acid, in some embodiments, may comprise phosphoramide, phosphorothioate, phosphorodithioate, O-methylphophoroamidite linkages, peptide nucleic acids or a combination of any two or more of the foregoing linkages. An engineered nucleic acid may be single-stranded (ss) or double-stranded (ds), as specified, or an engineered nucleic acid may contain portions of both single-stranded and double-stranded sequence. In some embodiments, an engineered nucleic acid contains portions of triple-stranded sequence. An engineered nucleic acid may comprise DNA (e.g., genomic DNA, cDNA or a combination of genomic DNA and cDNA), RNA or a hybrid molecule, for example, where the nucleic acid contains any combination of deoxyribonucleotides and ribonucleotides (e.g., artificial or natural), and any combination of two or more bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine, hypoxanthine, isocytosine and isoguanine.

[0040] Engineered nucleic acids of the present disclosure may be produced using standard molecular biology methods (see, e.g., Green and Sambrook, Molecular Cloning, A Laboratory Manual, 2012, Cold Spring Harbor Press). In some embodiments, nucleic acids are produced using GIBSON ASSEMBLY Cloning (see, e.g., Gibson, D. G. et al. Nature Methods, 343-345, 2009; and Gibson, D. G. et al. Nature Methods, 901-903, 2010, each of which is incorporated by reference herein). GIBSON ASSEMBLY typically uses three enzymatic activities in a single-tube reaction: 5 exonuclease, the 3 extension activity of a DNA polymerase and DNA ligase activity. The 5 exonuclease activity chews back the 5 end sequences and exposes the complementary sequence for annealing. The polymerase activity then fills in the gaps on the annealed regions. A DNA ligase then seals the nick and covalently links the DNA fragments together. The overlapping sequence of adjoining fragments is much longer than those used in Golden Gate Assembly, and therefore results in a higher percentage of correct assemblies. Other methods of producing engineered nucleic acids are known in the art and may be used in accordance with the present disclosure.

[0041] Expression of nucleic acids, including gene sequences, is typically driven by a promoter operably linked to the nucleic acid. A promoter refers to a control region of a nucleic acid at which initiation and rate of transcription of the remainder of a nucleic acid sequence are controlled. A promoter drives transcription or of the nucleic acid sequence that it regulates, thus, it is typically located at or near the transcriptional start site of a gene. A promoter, in some embodiments, is 100 to 1000 nucleotides in length. A promoter may also contain sub-regions at which regulatory proteins and other molecules may bind, such as RNA polymerase and other transcription factors. Promoters may be constitutive (e.g., CAG promoter, cytomegalovirus (CMV) promoter), inducible (also referred to as activatable), repressible, tissue-specific, developmental stage-specific or any combination of two or more of the foregoing.

[0042] A promoter is considered to be operably linked when it is in a correct functional location and orientation relative to a sequence of nucleic acid that it regulates (e.g., to control (drive) transcriptional initiation and/or expression of that sequence).

[0043] A promoter, in some embodiments, is naturally associated with a nucleic acid and may be obtained by isolating the 5 non-coding sequence(s) located upstream of the coding region of the given nucleic acid. Such a promoter is referred to as an endogenous promoter.

[0044] A promoter, in some embodiments, is not naturally associated with a nucleic acid. Such a promoter is referred to as a heterologous promoter and includes, for example, promoters that regulate other nucleic acids and promoters obtained from other cells. A heterologous promoter may be synthetic or recombinant. Synthetic heterologous promoters, in some embodiments, contain various elements obtained from known transcriptional regulatory regions. Synthetic heterologous promoters, in some embodiments, contain mutations that alter expression through methods of genetic engineering that are known in the art. Recombinant heterologous promoters, in some embodiments, are produced by recombinant cloning, nucleic acid amplification (e.g., polymerase chain reaction (PCR)), or a combination of recombinant cloning and nucleic acid amplification (see U.S. Pat. No. 4,683,202 and U.S. Pat. No. 5,928,906).

[0045] A promoter, in some embodiments, is an inducible promoter. An inducible promoter regulates (e.g., activates or inactivates) transcriptional activity of a nucleic acid to which it is operably linked when the promoter is influenced by or contacted by a corresponding regulatory protein.

[0046] Examples of inducible promoters include, without limitation, chemically- or biochemically-regulated and physically-regulated promoters, such as alcohol-regulated promoters, tetracycline-regulated promoters (e.g., anhydrotetracycline (aTc)-responsive promoters and other tetracycline-responsive promoter systems, which include a tetracycline repressor protein (tetR), a tetracycline operator sequence (tetO) and a tetracycline transactivator fusion protein (tTA)), steroid-regulated promoters (e.g., promoters based on the rat glucocorticoid receptor, human estrogen receptor, moth ecdysone receptors, and promoters from the steroid/retinoid/thyroid receptor superfamily), metal-regulated promoters (e.g., promoters derived from metallothionein (proteins that bind and sequester metal ions) genes from yeast, mouse and human), pathogenesis-regulated promoters (e.g., induced by salicylic acid, ethylene or benzothiadiazole (BTH)), temperature/heat-inducible promoters (e.g., heat shock promoters), and light-regulated promoters (e.g., light responsive promoters from plant cells).

[0047] In some embodiments, inducible promoters of the present disclosure function in prokaryotic cells (e.g., bacterial cells). Examples of inducible promoters for use prokaryotic cells include, without limitation, bacteriophage promoters (e.g. Pls1con, T3, T7, SP6, PL) and bacterial promoters (e.g., Pbad, PmgrB, Ptrc2, Plac/ara, Ptac, Pm), or hybrids thereof (e.g. PLlacO, PLtetO). Examples of bacterial promoters for use in accordance with the present disclosure include, without limitation, positively regulated E. coli promoters such as positively regulated 70 promoters (e.g., inducible pBad/araC promoter, Lux cassette right promoter, modified lamdba Prm promote, plac Or2-62 (positive), pBad/AraC with extra REN sites, pBad, P(Las) TetO, P(Las) CIO, P(Rh1), Pu, FecA, pRE, cadC, hns, pLas, pLux), S promoters (e.g., Pdps), 32 promoters (e.g., heat shock) and 54 promoters (e.g., glnAp2); negatively regulated E. coli promoters such as negatively regulated 70 promoters (e.g., Promoter (PRM+), modified lamdba Prm promoter, TetR-TetR-4C P(Las) TetO, P(Las) CIO, P(Lac) IQ, RecA_DlexO_DLacO1, dapAp, FecA, Pspac-hy, pcI, plux-cI, plux-lac, CinR, CinL, glucose controlled, modified Pr, modified Prm+, FecA, Pcya, rec A (SOS), Rec A (SOS), EmrR_regulated, BetI_regulated, pLac_lux, pTet_Lac, pLac/Mnt, pTet/Mnt, LsrA/cI, pLux/cI, LacI, LacIQ, pLacIQ1, pLas/cI, pLas/Lux, pLux/Las, pRecA with LexA binding site, reverse BBa_R0011, pLacI/ara-1, pLacIq, rrnB P1, cadC, hns, PfhuA, pBad/araC, nhaA, OmpF, RcnR), S promoters (e.g., Lutz-Bujard LacO with alternative sigma factor 38), 32 promoters (e.g., Lutz-Bujard LacO with alternative sigma factor 32), and 54 promoters (e.g., glnAp2); negatively regulated B. subtilis promoters such as repressible B. subtilis A promoters (e.g., Gram-positive IPTG-inducible, Xyl, hyper-spank) and B promoters. Other inducible microbial promoters may be used in accordance with the present disclosure.

[0048] In some embodiments, at least one of the gene sequences encoding at least one non-lytic AMPs, at least one toxin protein, or at least one non-lytic AMP and at least one toxin protein is/are operably linked to a tetR-repressed P.sub.LtetO promoter.

[0049] In some embodiments, the ribosome binding site (RBS) for each antibacterial gene is selected independently. A ribosomal binding site (RBS) is a sequence on mRNA that is bound by the ribosome when initiating protein translation. In prokaryotes it is a region referred to as the Shine-Dalgarno sequence, 6-7 nucleotides upstream of a start codon. The sequence is complementary to the 3 end of the rRNA. The ribosome searches for this site and binds to it through base-pairing of nucleotides. Once the ribosome has bound, it recruits initiation factors and begins the translation process.

Bacterial Cells

[0050] Some embodiments provide bacterial cells comprising a phagemid system of the present disclosure. Bacteria are small (typical linear dimensions of around 1 micron), non-compartmentalized, with circular DNA and ribosomes of 70S. As used herein, the term bacteria encompasses all variants of bacteria, including endogenous bacteria. Endogenous bacteria naturally reside in a closed system (e.g., bacterial flora) and are typically non-pathogenic. The present disclosure encompasses non-pathogenic and/or pathogenic bacteria. Bacterial cells may be Eubacteria cells. Eubacteria can be further subdivided into Gram-positive and Gram-negative Eubacteria, which depend on a difference in cell wall structure. Also included herein are those classified based on gross morphology alone (e.g., cocci, bacilli). In some embodiments, the bacterial cells are Gram-negative cells, and in some embodiments, the bacterial cells are Gram-positive cells. Examples of bacterial cells include, without limitation, Yersinia spp., Escherichia spp., Klebsiella spp., Bordetella spp., Neisseria spp., Aeromonas spp., Franciesella spp., Corynebacterium spp., Citrobacter spp., Chlamydia spp., Hemophilus spp., Brucella spp., Mycobacterium spp., Legionella spp., Rhodococcus spp., Pseudomonas spp., Helicobacter spp., Salmonella spp., Vibrio spp., Bacillus spp., Erysipelothrix spp., Salmonella spp., Streptomyces spp., Bacteroides spp., Prevotella spp., Clostridium spp., Bifidobacterium spp., or Lactobacillus spp. In some embodiments, the bacterial cells are Bacteroides thetaiotaomicron, Bacteroides fragilis, Bacteroides distasonis, Bacteroides vulgatus, Clostridium leptum, Clostridium coccoides, Staphylococcus aureus, Bacillus subtilis, Clostridium butyricum, Brevibacterium lactofermentum, Streptococcus agalactiae, Lactococcus lactis, Leuconostoc lactis, Actinobacillus actinobycetemcomitans, cyanobacteria, Escherichia coli, Helicobacter pylori, Selnomonas ruminatium, Shigella sonnei, Zymomonas mobilis, Mycoplasma mycoides, Treponema denticola, Bacillus thuringiensis, Staphylococcus lugdunensis, Leuconostoc oenos, Corynebacterium xerosis, Lactobacillus plantarum, Lactobacillus rhamnosus, Lactobacillus casei, Lactobacillus acidophilus, Streptococcus Enterococcus faecalis, Bacillus coagulans, Bacillus ceretus, Bacillus popillae, Synechocystis strain PCC6803, Bacillus liquefaciens, Pyrococcus abyssiSelenomonas nominantium, Lactobacillus hilgardii, Streptococcus ferus, Lactobacillus pentosus, Bacteroides fragilis, Staphylococcus epidermidis, Zymomonas mobilis, Streptomyces phaechromogenes, or Streptomyces ghanaenis. In some embodiments, the bacterial cells are of the E. coli strains BL21, DH5, DH10B, BW25113, Nissle 1917 and/or MG1655 and/or derivatives of any of the foregoing strains (e.g., a modified strain with, for example, a mutation, insertion and/or plasmid).

[0051] In some embodiments, the bacterial cells are of a phyla selected from Actinobacteria, Aquificae, Armatimonadetes, Bacteroidetes, Caldiserica, Chlamydiae, Chloroflexi, Chrysiogenetes, Cyanobacteria, Deferribacteres, Deinococcus-Thermus, Dictyoglomi, Elusimicrobia, Fibrobacteres, Firmicutes (e.g., Bacillus, Listeria, Staphylococcus), Fusobacteria, Gemmatimonadetes, Nitrospirae, Planctomycetes, Proteobacteria (e.g., Acidobacillus, Aeromonas, Burkholderia, Neisseria, Shewanella, Citrobacter, Enterobacter, Erwinia, Escherichia, Klebsiella, Kluyvera, Morganella, Salmonella, Shigella, Yersinia, Coxiella, Rickettsia, Legionella, Avibacterium, Haemophilus, Pasteurella, Acinetobacter, Moraxella, Pseudomonas, Vibrio, Xanthomonas), Spirochaetes, Synergistets, Tenericutes (e.g., Mycoplasma, Spiroplasma, Ureaplasma), Thermodesulfobacteria and Thermotogae.

Methods of Treatment

[0052] Also provided herein are methods of treating a bacterial infection, such as a Actinobacteria, Aquificae, Armatimonadetes, Bacteroidetes, Caldiserica, Chlamydiae, Chloroflexi, Chrysiogenetes, Cyanobacteria, Deferribacteres, Deinococcus-Thermus, Dictyoglomi, Elusimicrobia, Fibrobacteres, Firmicutes (e.g., Bacillus, Listeria, Staphylococcus), Fusobacteria, Gemmatimonadetes, Nitrospirae, Planctomycetes, Proteobacteria (e.g., Acidobacillus, Aeromonas, Burkholderia, Neisseria, Shewanella, Citrobacter, Enterobacter, Erwinia, Escherichia, Klebsiella, Kluyvera, Morganella, Salmonella, Shigella, Yersinia, Coxiella, Rickettsia, Legionella, Avibacterium, Haemophilus, Pasteurella, Acinetobacter, Moraxella, Pseudomonas, Vibrio, Xanthomonas), Spirochaetes, Synergistets, Tenericutes (e.g., Mycoplasma, Spiroplasma, Ureaplasma), Thermodesulfobacteria or Thermotoga infection.

[0053] In some embodiments, the methods comprise administering (delivering) to a subject in need of treatment of a bacterial infection an effective amount of an engineered phagemid as provided herein.

[0054] In some embodiments, the methods comprise administering (delivering) to a subject in need of treatment of a bacterial infection an effective amount of phagemid particle as provided herein.

[0055] In some embodiments, the methods comprise administering (delivering) to a subject in need of treatment of a bacterial infection an effective amount of a composition comprising an engineered phagemid or phagemid particle as provided herein.

[0056] A subject may be a mammalian subject, such as a human subject.

[0057] In some embodiments, an effective amount is an amount effective to produce non-lytic bacterial cell death in a subject.

[0058] Provided herein, in some embodiments, is a synthetic biology platform for producing non-lytic, bacterial cellular death without reliance upon traditional antibiotics. By designing and applying phagemid constructs containing selected AMPs, alone or in combination with bacterial toxins, an approach was developed that achieved over a 5.0 log reduction in bacterial cell viability in vitro and resulted in over 80% survival in a virulent mouse model of peritonitis. While the approach presented here relies on M13 bacteriophage for phagemid production, similar systems can be produced using alternative bacteriophage systems to expand the repertoire of targetable bacteria. The modular nature of this system allows for the replacement and addition of individual components or whole networks within the engineered phagemid for the targeting of specific bacteria. When a packaging signal becomes characterized for a desired bacteriophage, it can be swapped with the F1 origin of replication in the synthetic antibacterial phagemid plasmid and cloned into a production strain that expresses the proper phage proteins. This enables production of both targeted and broad-spectrum antibacterial treatments, depending upon bacteriophage selection. While some toxins tested herein had little effect on the target E. coli strain, the selected toxins have a broad-range activity across many bacterial species. Additionally, since the choices for antibacterial peptides are broad spectrum, this system provides a therapeutic that can be readily modified to suit its target and will therefore function in many target bacteria. Due to the stable nature of phagemids and decreased likelihood of resistance formation through superinfection, the system of the present disclosure provides a marked advantage for targeting bacterial infections over current bacteriophage techniques.

[0059] With the benefits and importance of healthy bacterial microbiomes as well as the rapid rise in antibiotic resistance, targeted therapies such as those provided herein, which do not rely on classical antibiotics, could provide an invaluable tool for treating bacterial infections and reducing the prevalence of antibiotic-resistant bacterial strains without producing significant collateral damage in the commensal bacterial population.

[0060] The following numbered paragraphs are also encompassed by the present disclosure.

[0061] 1. An engineered phagemid that comprises a (at least one) synthetic genetic circuit, wherein the synthetic genetic circuit comprises gene sequences encoding a (at least one) non-lytic antimicrobial peptides (AMPs) and/or antibacterial toxin proteins, an origin of replication, and a bacteriophage-packaging signal, wherein the engineered phagemid does not comprise some or all gene sequences encoding bacteriophage proteins required for assembly of a bacteriophage particle.

[0062] 2. The engineered phagemid of paragraph 1, wherein the phagemid does not comprise any gene sequences encoding bacteriophage proteins required for assembly of a bacteriophage particle.

[0063] 3. The engineered phagemid of paragraph 1 or 2, further comprising a multiple cloning site (MCS).

[0064] 4. The engineered phagemid of any one of paragraphs 1-3, wherein the phagemid is a high-copy-number phagemid.

[0065] 5. The engineered phagemid of any one of paragraphs 1-4, wherein the origin of replication is an F1 origin of replication.

[0066] 6. The engineered phagemid of any one of paragraphs 1-5, wherein the engineered phagemid is an M13-derived phagemid.

[0067] 7. The engineered phagemid of any one of paragraphs 1-6, wherein the gene sequences encoding a (at least one) non-lytic AMP, a (at least one)toxin protein, or a (at least one) non-lytic AMP and a (at least one) toxin protein comprises two tandem copies of the gene sequence.

[0068] 8. The engineered phagemid of any one of paragraphs 1-7, wherein at least one of the gene sequences encoding a (at least one) non-lytic AMPs, a (at least one)toxin protein, or a (at least one)non-lytic AMP and a (at least one)toxin protein is/are operably linked to a tetR-repressed P.sub.LtetO promoter.

[0069] 9. The engineered phagemid of any one of paragraphs 1-8, wherein the ribosome binding site (RBS) for each antibacterial gene is selected independently.

[0070] 10. The engineered phagemid of any one of paragraphs 1-9, wherein the AMPs are selected from the group consisting of cecropin PR-39, apidaecin Ia, buforin II, dermaseptin and pleurocidin.

[0071] 11. The engineered phagemid of any one of paragraphs 1-10, wherein the AMPs are selected from the group consisting of cecropin PR-39 and apidaecin Ia.

[0072] 12. The engineered phagemid of any one of paragraphs 1-11, wherein the synthetic genetic circuit comprises gene sequences encoding cecropin PR-39 and apidaecin Ia.

[0073] 13. The engineered phagemid of any one of paragraphs 1-12, wherein the synthetic genetic circuit comprises two copies of gene sequences encoding cecropin PR-39 and two copies of gene sequences encoding apidaecin Ia.

[0074] 14. The engineered phagemid of paragraph 13, wherein the two copies of gene sequences encoding cecropin PR-39 and the two copies of gene sequences encoding apidaecin Ia are tandem copies of the gene sequences and are operably linked to a P.sub.LtetO promoter.

[0075] 15. The engineered phagemid of any one of paragraphs 1-14, wherein the antibacterial toxin proteins are selected from the group consisting of CcdB, YeeV, YeeV truncated at the C terminus by 52 residues (YeeV) and ParE.

[0076] 16. The engineered phagemid of any one of paragraphs 1-15, wherein the antibacterial toxin protein is CcdB, and wherein the synthetic genetic circuit comprises two tandem copies of gene sequences encoding CcdB.

[0077] 17. A phagemid particle comprising the engineered phagemid of any one of paragraphs 1-16.

[0078] 18. A composition comprising the engineered phagemid of any one of paragraphs 1-16.

[0079] 19. A composition comprising the phagemid particle of paragraph 17.

[0080] 20. A method of treating a bacterial infection, comprising administering to a subject in need of treatment of a bacterial infection an effective amount of the engineered phagemid of any one of paragraphs 1-16.

[0081] 21. A method of treating a bacterial infection, comprising administering to a subject in need of treatment of a bacterial infection an effective amount of the phagemid particle of paragraph 17.

[0082] 22. A method of treating a bacterial infection, comprising administering to a subject in need of treatment of a bacterial infection an effective amount of the composition of paragraph 18.

[0083] 23. A method of treating a bacterial infection, comprising administering to a subject in need of treatment of a bacterial infection an effective amount of the composition of paragraph 19.

[0084] 24. A phagemid system comprising the engineered phagemid of any one of paragraphs 1-16, and a plasmid comprising a phagemid helper system that expresses bacteriophage proteins required for assembly of a bacteriophage particle, wherein the plasmid is not packaged in the bacteriophage particle.

[0085] 25. A bacterial cell comprising the phagemid system of paragraph 24.

[0086] 26. A method, comprising transforming a bacterial cell with the phagemid system of claim 24.

[0087] 27. The method of paragraph 26 further comprising isolating phagemid particles secreted by the bacterial cell.

[0088] 28. The method of paragraph 27 further comprising delivering the isolated phagemid particles to a target bacterial cell.

EXAMPLES

Example 1

[0089] In order to initially screen AMPs that cause non-lytic bacterial cell death, a test network expressing two tandem copies of the antibacterial gene of interest under regulation of the tetR-repressed P.sub.LtetO promoter was developed. This design allows for activation of antibacterial networks in target wildtype (WT) strains, but represses these networks in tetR (Tet repressor protein) expressing test and production strains. Synthetic design of the ribosome binding site (RBS) (Salis, H. M. et al. Nature biotechnology 2009, 27 (10), 946-950) for each antibacterial gene allowed for the independent tuning of expression levels. Five AMPscecropin PR-39 (Boman, H. G. et al. Infection and Immunity 1993, 61 (7), 2978-2984), apidaecin Ia (Li, W. F. et al. Peptides 2006, 27 (9), 2350-2359), buforin II (Park, C. B. et al. PNAS 2000, 97 (15), 8245-8250), dermaseptin (Jouenne, T. et al. Journal of Antimicrobial Chemotherapy 1998, 42 (1), 87-90), and pleurocidin (Cole, A. M. et al. Journal of Biological Chemistry 1997, 272 (18), 12008-12013)were selected for their reported ability to rapidly disrupt intracellular processes and induce non-lytic bacterial death (Brogden, K. A. Nature Reviews Microbiology 2005, 3 (3), 238-250) (Table 1). Together with their P.sub.LtetO promoter, synthetic RBS, and terminator, these AMP genes were transformed into the test strain, mgpro, and their efficacy for bacterial death was measured upon anhydrotetracycline (aTc) induced expression (FIG. 2A). Cecropin PR-39 (cecropin) and apidaecin Ia (apidaecin) were effective at inducing bacterial cell death; cecropin inhibits septum formation as well as DNA and protein production, while apidaecin inhibits the enzyme DnaK and binds to bacterial lipopolysaccharide. The remaining AMPs tested did not induce bacterial cell death, possibly due to post-translational modifications or microenvironmental differences with previous studies that our growth conditions did not replicate. Based on these results, cecropin and apidaecin were used for subsequent experiments.

TABLE-US-00001 TABLE 1 List of AMPs Antimicrobial Peptide Organism Size (AA) Mechanism of Action Cecropin PR-39 Pig 39 Inhibits Septum Formation, DNA Production, and Protein Production Apidaecin la Honeybee 18 Inhibits Enzyme DnaK and Binds to Bacterial LPS Buforin II Frog 21 Binds Nonspecifically to DNA and RNA Dermaseptin Frog 32 Inhibits DNA Production and Protein Production Pleurocidin Flounder 25 Inhibits DNA Production and Protein Production

[0090] To examine the efficacy of cecropin and apidaecin as antibacterial therapeutics, these AMP expression networks were introduced into the phagemid system. After transforming the system into the phagemid production strain (DH5pro) carrying the M13 helper plasmid, the purified phagemid particles were collected and screened against the target bacterial strain. Additionally, these antibacterial networks were introduced into the M13 bacteriophage system in order to compare their antibacterial effects. Treatment with phagemid particles harboring networks expressing cecropin or apidaecin reduced bacterial cell viability by 2-3 orders of magnitude (FIG. 2B). This effect persisted for several hours post infection. In contrast, target cells infected with bacteriophage particles carrying the same AMP expression networks failed to produce the same level of bacterial death. Although initial killing was observed, the cell population recovered after approximately four hours of infection, possibly due to inconsistent network expression.

Example 2

[0091] In addition to the ability of the phagemid to sustain bacterial death, it was tested whether this approach induced resistance in target cells at a level comparable to that seen with bacteriophage therapy. Target bacteria were first infected with either phagemid or bacteriophage particles expressing the cecropin AMP network and then subsequently re-infected with phagemid or bacteriophage particles expressing a GFP network (FIG. 3A). Bacteria first infected with bacteriophage particles expressing the cecropin network were found to be resistant to a repeated bacteriophage infection with a GFP-expressing network (FIG. 3B). In contrast, bacteria first infected with phagemid particles carrying the cecropin network maintained their ability to be re-infected with a second round of GFP-expressing phagemid particles. These results highlight both the unreliability of bacteriophage therapy and the increased risk of resistance formation, which are avoided or reduced through the use of phagemids.

Example 3

[0092] After distinguishing phagemids as a superior therapy option over bacteriophages, the modular nature of the phagemid system was next studied by examining whether simultaneous targeting could increase phagemid-induced bacterial cell death (cecropin and apidaecin target distinct intracellular processes). Three combination networks expressing both AMPs together were generated (FIG. 4A). Two of these networks (designated .sub.I and .sub.II) expressed a single copy of each AMP in varying order, while a third network (designated .sub.III) expressed two copies of each AMP with a P.sub.LtetO promoter driving each set. The combined phagemid networks had an enhanced effect upon the target bacteria, with the .sub.IIInetwork producing a 3.5 log reduction in bacterial cell viability.

[0093] To potentially increase the antibacterial efficacy of the phagemid treatment, the effects of three bacterial toxinsCcdb, YeeV and ParEwere evaluated by introducing networks expressing the toxin genes into the modular .sub.III phagemid platform. The first toxin, CcdB, is a topoisomerase inhibitor that interferes with DNA gyrase and results in the breakdown of bacterial DNA (Couturier, M. et al. Trends in Microbiology 1998, 6 (7), 269-275; Callura, J. M. et al. PNAS 2010, 107 (36), 15898-15903; and Dwyer, D. J. et al. Molecular Systems Biology 2007, 3 (91), 1-15), leading to cell death. YeeV is a toxin that inhibits cellular division by targeting two cytoskeletal proteins, FtsZ and MreB (Tan, Q. et al. Molecular Microbiology 2011, 79 (1), 109-118); however, this dual inhibition causes cells to balloon and lyse, which is undesirable for purposes of these experiments. Sole inhibition of FtsZ can be accomplished by expression of a modified version of the YeeV protein truncated at the C terminus by 52 residues (designated YeeV), which results in filamented cells that do not lyse (Tan, Q. et al. Molecular Microbiology 2011, 79 (1), 109-118). The last toxin, ParE, acts by halting the F1* formation from both chromosomal and plasmid DNA replication origins by inhibiting bacterial gyrase, causing filamentation and cell death (Jiang, Y. et al. Molecular Microbiology 2002, 44 (4), 971-979). Infection of target cells with phagemid particles carrying the combined AMP-CcdB network resulted in increased bacterial cell death, leading to a 4.0 log reduction in bacterial cell viability within the first two hours (FIG. 4B). The addition of yeeV resulted in bacterial cell death comparable to that of .sub.III alone, while the addition of parE led to reduced killing, possibly due to direct interaction with our phagemid plasmid's ability to replicate.

[0094] With these results, a final synthetic network employing the most productive toxin was generated. This construct, designated .sub.IV, overexpressed ccdB through tandem gene expression in order to maximize its antibacterial effect and was combined with the .sub.III AMP network. Purified phagemid particles were then tested against the target bacteria for induced bacterial cell death (FIG. 4C). Expression of .sub.IV provided almost an order of magnitude of increased bacterial cell death compared to .sub.III alone. This difference was further enhanced by increasing the virion particle dose, resulting in over 5.0 log reduction in bacterial survival after 6 hours of exposure to the .sub.IV network (FIG. 4D). Taken altogether, our screen identified that the combined phagemid-based expression of two copies of cecropin PR-39, apidaecin Ia, and ccdB genes resulted in robust killing of target E. coli bacteria.

Example 4

[0095] The in vivo efficacy of this system was tested next by employing a murine model for E. coli peritonitis (Domenech, A. et al. Microbial Drug Resistance 2004, 10 (4), 346-353). Seven-week-old C57Bl/6 female mice were administered 10.sup.6 colony forming units (CFUs) of the target bacteria via intraperitoneal (IP) injection. After 1 hour, mice were treated with IP injections of phagemids expressing the .sub.IV antibacterial-toxin network (FIG. 5A). Mice were either not treated, injected with phagemid particles that do not express any genes (vehicle), or injected with phagemid particles containing the .sub.IV network (FIG. 5B). Mice given the .sub.IV phagemid treatment had an average survival rate of 80% over the course of the experiment, compared to 27% survival in the untreated group, an increase that was statistically significant (p=0.003). The vehicle group experienced an improved survival of 58%, which was not statistically significant when compared to the untreated group (p=0.08). This effect was not observed in vitro (FIG. 7), suggesting that the increased survival was due to interactions with the host. A survival advantage provided by phage particles has been previously reported (Duerkop, B. A. et al. Nat. Immunol. 2013, 14 (7), 54-659) and may be associated with type I interferon and other proinflammatory gene induction upon exposure to phage capsid proteins. This proinflammatory effect is beneficial for treatment of bacterial infections, as phagemid particles prime the host immune system against unwanted bacteria. Taken together, our results show that engineered phagemids can effectively target and produce highly effective non-lytic killing of E. coli in vitro and in vivo, without the use of antibiotics.

Experimental Details

[0096] Strains and Culture Conditions.

[0097] Bacterial cultures were grown in a 37 C. shaking incubator with Luria-Bertani (LB) medium (Fisher Scientific). Bacterial strains used were either MG1655 containing the pro cassette (mgpro, spectinomycin resistant), EMG2, or DH5 cells carrying the pro cassette (DH5pro). When needed, antibiotics were added to the growth medium at the following final concentrations: kanamycin (Km) 50 g/ml, ampicillin (Am) 50 g/ml, and chloramphenicol (Cm) 34 g/ml.

[0098] TSS Transformation Assay.

[0099] Overnight cultures of the desired cell type were diluted 1:100 in fresh LB and grown to an optical density (OD600) of approximately 0.5-0.6. These cultures were then split into 1 ml aliquots and spun at 3500 rpm for 10 minutes at 4 C. The supernatant was then aspirated and the pellets were resuspended in 1/10th the original volume of TSS buffer. After approximately 50 ng of ligated or plasmid DNA was added to the cells, the aliquots were incubated on ice for 30 minutes before heat shocking for 30 seconds at 42 C. Next, 300 l of LB was added and the aliquots were incubated at 37 C. for 1 hrl. Finally 100 l of competent cells were plated on the appropriate agar plate and incubated overnight at 37 C. To make TSS buffer 5 g PEG 8000, 2.4 ml DMSO, and 1.5 ml of 1M magnesium chloride was added to LB at a final volume of 50 ml. Next, it was filtered through a 0.22 m filter and stored at 20 C. A working stock was kept at 4 C.

[0100] Primer Design.

[0101] The PCR primers used for plasmid constriction and modification (Table 2) were designed according to the following algorithm. Each primer began (5) with six bases arbitrarily selected to create primers with similar Tm, calculated using OligoCalc (basic.northwestern.edu/biotools/oligocalc.html). The next six bases (5-3) comprised the desired restriction enzyme recognition site. The remainder of the primer, the 3 end, consisted of either the Forward Primer Homology or the Reverse Primer Homology sequences, annotated in the component sequence entries. Thus, the final primer design was 5six arbitrary bases+six bases for recognition site+fw./rev. primer homology3. For genes, a ribosomal binding site (RBS) was added as determined by the RBS calculator designed by the Salis Lab. All RBS were designed to operate at a translation rate of 100,000 arbitrary units. The primers were ordered from Integrated DNA Technologies (IDT).

[0102] Antibacterial Peptide Plasmid Construction.

[0103] In order to generate the antibacterial peptide plasmids, the breadboard plasmid pKE3_MCS described by Litcofsky et al.8 was used. The PLtet0 promoter and T0 terminator parts were amplified from the library plasmids pKLi008 and pKLi027, respectively, using PCR. Primers added the proper restriction and the parts were cloned into the multiple cloning site (MCS) of the pKE3_MCS plasmid using standard cloning methods to create the general cloning plasmid pRJK034 (kanamycin resistant) (GenBank accession number KT003672). Plasmids were transformed into the desired cell type using the TSS competent cell protocol. Antimicrobial peptides (AMPs) were synthesized by Genewiz and amplified using primers designed to add proper restriction sites and the appropriate RBS. These PCR products were then digested and cloned into the MCS of the general cloning plasmid pRJK034 in order to create the AMP test networks pRJK037 (KT003673), pRJK046 (KT003674), pRJK055 (KT003675), pRJK062 (KT003676), and pRJK070 (KT003677) respectively for cecropin PR-39, apidaecin Ia, buforin II, dermaseptin, and pleurocidin networks.

[0104] Test Network Induction Assays.

[0105] Overnight cultures of the AMP test networks were diluted 1:100 in fresh LB and grown to an optical density (OD600) of approximately 0.2-0.3. Cultures were then induced as appropriate with 100 ng/ml of aTc. Cultures were then grown for 8 hours post induction, with time points taken every 2 hours to track the cellular growth and determine colony forming units. All conditions were performed in triplicate.

[0106] Colony Forming Unit (CFU) Determination.

[0107] In order to determine the CFUs, 300 l of culture was placed into the top well of a 96-well plate (Costar). The culture was serially diluted 1:10 into phosphate-buffered saline (Fisher Scientific) a total of 7 times. Five l of each dilution was then plated onto a dry LB agar plate and put into a 30 C. static incubator overnight. Colonies were counted in the first dilution that allowed for distinguishable colonies and the CFUs were determined. All conditions were performed in triplicate.

[0108] Phagemid Network Construction.

[0109] To create the phagemid networks, the F1 origin was first synthesized from Genewiz with XhoI/SspI restriction sites on either end. This was then introduced into the general cloning plasmid pRJK034 to create the phagemid plasmid pPh034. The AMP PCR products of cecropin PR-39 and apidaecin Ia were cloned into this plasmid in order to make the phagemid plasmids pPh037 and pPh046. To make the combined AMP phagemid networks I and II, the second AMP cassette from both pPh037 (GenBank accession number KT003678) and pPh046 (KT003679) were digested out of the plasmid and replaced with the AMP cassette of the other corresponding AMP network. To make the combined AMP phagemid III, the AMP network from pPh037 was amplified using PCR and subsequently digested and cloned into the slot in the MCS of pPh046 to create the pPh079 plasmid (KT003680).

[0110] Phagemid Purification and Characterization.

[0111] Phagemid plasmids were transformed into DH5pro bacteria, which contained the m13cp plasmid (chloramphenicol resistant) using the TSS protocol. This was then plated on LB agar plates containing 50 g/ml Km and 34 g/ml Cm. A single colony was then grown up and spun at 4000 rpm for 10 minutes at 4 C. The supernatant was sent through a 0.2 m filter (Fisher Scientific) and the resulting phagemid particles were stored at 4 C. To quantify the concentration, samples were read on a spectrophotometer for absorbance at 269 and 320 nm. From this, the concentration was calculated using the formula established by G. Smith (abdesignlabs.com/technicalresources/bacteriophage-spectrophotometry/).

[0112] Phagemid Network Induction Assays.

[0113] Overnight cultures of EMG2 were diluted 1:100 in fresh LB and grown to an optical density of approximately 0.2-0.3. Cultures were treated with approximately 510.sup.11 phagemid particles per ml culture. Cultures were then grown for 8 hours post infection with time points taken every 2 hours unless otherwise stated. All conditions were performed in triplicate.

[0114] Reinfection Assay.

[0115] Overnight cultures of EMG2 were diluted 1:100 in fresh LB and grown to an optical density of approximately 0.2-0.3. Cultures were treated with approximately 510.sup.11 bacteriophage or phagemid particles per ml culture. Cultures were then grown for 6 hours and plated for CFU determination. Cultures were then diluted 1:1000 and grown overnight. The following day, overnight cultures were diluted 1:100 in fresh LB and grown to an optical density of approximately 0.2-0.3. Cultures were then treated with approximately 510.sup.11 bacteriophage or phagemid particles per ml culture. Cultures were then grown for 6 hours and read for fluorescence.

[0116] Toxin Plasmid Construction.

[0117] Effector genes were synthesized from Genewiz to create ccdB, yeeV, and parE DNA sequences. These genes were amplified by PCR and cloned into the pRJK034 general cloning plasmid using the proper restriction enzymes and normal cloning methods. The completed networks were amplified by PCR and cloned into the phagemid plasmid pPh079 in order to create the toxin networks pPh110 (GenBank accession number KT003681), pPh112 (KT003682), pPh113 (KT003683), and pPh115 (KT003684) (expressing the YeeV mutant, ParE, two copies of CcdB, or a single copy of CcdB, respectively).

[0118] Murine Peritonitis Model.

[0119] Seven-week-old female mice weighing an average of 16.6 grams were injected with 8.610.sup.5 CFU/mouse of EMG2 bacteria via intraperitoneal (IP) injection. One hour later, the mice received either 200 l of phage treatment (approximately 310.sup.10 virons/l), 200 l of vehicle (approximately 310.sup.10 virons/l), or no treatment. These treatments were administered via intraperitoneal injection. The mice were monitored daily for survival for 5 days. Two different experiments were combined to obtain the statistics shown using a Mantel-Cox test (untreated n=22, vehicle only n=12, CcdB phagemid n=10, CcdB/LexA3 phagemid n=12).

[0120] Data Analysis and Statistics.

[0121] For the CFU determination experiments, the results of biological triplicates were imputed into Excel and the geometric mean and standard deviation were determined. For the murine model, the results of the two experiments were entered into Prism 6.0 software, which computed the Mantel-Cox Test p-value for the survival curves compared to the untreated group.

TABLE-US-00002 TABLE2 Listofdesignedprimers Plasmid Part Name Sequence SEQIDNO: Site pPh034 P.sub.LTetOPromoter fpRJK035 GCCCGCAAGCTTTCCCTATCAGTGATA 1 HindIII GAGATTGACA P.sub.LTetOPromoter rpRJK035 ATTTTTGGTACCGGTCAGTGCGTCCTG 2 KpnI CTGATGTGCT T0Terminator fpRJK039 TATTTAGGATCCCGAGAATTGGCTTGG 3 BamHI ACTCCTGTTG T0Terminator rpRJK039 GATTATGAGCTCTGACTACTGCTTGGA 4 SacI TTCTCACCAA F1Origin fpRJK042 TATTTACTCGAGAGCGCCCTGTAGCGG 5 XhoI CGCATT F1Origin rpRJK042 GGCGCGAATATTTAATTCGCGTTAAAT 6 SspI TTTTGTTAAATCAGCTCATTTTTTAAC CAATAG pPh037 CecropinPR-39 fpRJK037 AATTTAGGTACCCTATAAGTTACACAA 7 KpnI CATAAGGAGGAATATAATGCGTCGTCG TCCGCGTCC CecropinPR-39 rpRJK037a AGAATTCCGCGGTTACGGGAAACGCGG 8 SacII CGGGAAACGC CecropinPR-39 fpRJK038 ATTTATTGTACATTCTATCAAAGTATC 9 BsrGI ATAAGGAGGAGAATAATGCGTCGTCGT CCGCGTCC CecropinPR-39 rpRJK038a GAGGTCGGATCCTTACGGGAAACGCGG 10 BamHI CGGGAAACGC pPh046 ApidaecinIa fpRJK044 ATTTATGGTACCCAACAGGGATTCGTT 11 KpnI AATTTAAGGAGGTCTCCAAATGGGCAA CAACCG ApidaecinIa rpRJK044a ATTTATCCGCGGTTAAATGCGCGGATG 12 SacII CGGCG ApidaecinIa fpRJK045 ATTGCGTGTACAGAGGTACAACTCAAC 13 BsrGI TAATATAAGGAGGTTCAAAATGGGCAA CAACCG ApidaecinIa rpRJK045a ATCGCGGGATCCTTAAATGCGCGGATG 14 BamHI CGGCG pPh054 BuforinII fpRJK046 ATTTTTGGTACCCGACTAACAACTCTA 15 KpnI TAAGGAGGTCCATAAATGACCCGCAGC AGC BuforinII rpRJK046a ATTGCCCCGCGGTTATTTGCGCAGCAG 16 SacII GCGAT BuforinII fpRJK047 ATTTATTGTACAGAGGTACAACTCAAC 17 BsrGI TAATATAAGGAGGTTCAAAATGACCCG CAGCAG BuforinII rpRJK047a GCGCCCGGATCCTTATTTGCGCAGCAG 18 BamHI GCGAT pPh062 Dermaseptin fpRJK048 ATTTATGGTACCTAAAAGAGGAGACTC 19 KpnI ACCCTTAAGGAGGTATAAGATGGCGCT GTGGAA pPh062 Dermaseptin rpRJK048a ATTCCCCCGCGGTTAGCTTTCCGCGCC 20 SacII CACCA Dermaseptin fpRJK049 ATTTATTGTACACAAGTACAGAGGAGT 21 BsrGI AAGGAGGTAAAGTATGGCGCTGTGGAA AAACAT Dermaseptin rpRJK049a CCTGCGGGATCCTTAGCTTTCCGCGCC 22 BamHI CACCA pPh070 Pleurocidin fpRJK050 ATTTATGGTACCAACGGTAAGAGGCAT 23 KpnI AATTTAAGGAGGTAACACATGGGCTGG GGCAG Pleurocidin rpRJK050a CGCCGCCCGCGGTTACAGATAATGGGT 24 SacII CAGCG Pleurocidin fpRJK051 ATTGTTTGTACAGATTTATAAAATCGG 25 BsrGI AATAGATAAGGAGGTACACATGGGCTG GGGCAG Pleurocidin rpRJK051a CGCCGCGGATCCTTACAGATAATGGGT 26 BamHI CAGCG pPh079 Cecropin fpRJK052 AATCATCTGCAGTCCCTATCAGTGATA 27 PstI Network GAGATTGACATCCCT Cecropin rpRJK052 GGCCCGGAATTCTGACTACTGCTTGGA 28 EcoRI Network TTCTCACCAATAAAA pPh080 LexA3 fpRJK053 TATAATGGTACCCAGGGAGGGAAAGTC 29 KpnI AATAAGGACGGATATTATGAAAGCGTT AACGGCCAG LexA3 rpRJK053 CCGGCCGGATCCTTACAGCCAGTCGCC 30 BamHI GTTGCGAATA pPh082 SoxR fpRJK054 ATTTATCCGCGGGCCTACTAGAAACTA 31 SacII ATAAGGAGACTACCGAGAATGGAAAAG AAATTACCC SoxR rpRJK054 ATTTATGGATCCTTAGTTTTGTTCATC 32 BamHI TTCCAGCAAGCGTGCGCCGG pPh084 CedB fpRJK055 ATTTATGGTACCTATCCATCATTAACG 33 KpnI ACCAAATCAAGGAGGACGTATGCAGTT TAAGGTTTACAC CedB rpRJK055 GGCCGCGGATCCTTATATTCCCCAGAA 34 BamHI CATCAGGTTAATGGCGTTTT pPh086 CsrA fpRJK056 ATTTATGGTACCGCCCCAACGAACAAT 35 KpnI ATTACTAAGGAGGAAAGATATGCTGAT TCTGACTCGT CsrA rpRJK056 GGCATTGGATCCTTAGTAACTGGACTG 36 BamHI CTGGGATTTTTCAGCCTGGATA Effector Effector fpRJK059 ATTGGCCTTAAGTCCCTATCAGTGATA 37 AflIII Phagemid Networks GAGATTGACATCC Networks Effector rpRJK059a ATTTCCCCTAGGTGACTACTGCTTGGA 38 AvrII Networks TTCTCACCAATAA Effector rpRJK059b ATTTTTGGCGCCTGACTACTGCTTGGA 39 KasI Networks TTCTCACCAATAA Effector rpRJK059c ATTCAGCAATTGTGACTACTGCTTGGA 40 MfeI Networks TTCTCACCAATAA pPh110 YeeVMutant fpRJK063 TATATTGGTACCCAAGAAGATAGAGGA 41 KpnI GGTAATATACAAGAGAATGAACACCCT GCCGGATACCCATG YeeVMutant rpRJK063 GGGCGGCCGCGGTTATTTTTCCACCAG 42 SacII AAAGTTCACCGCATC YeeVMutant fpRJK064 ATTTATTGTACAAGCCTAACGGAAGTC 43 BsrGI GACTAGTAAGGAGAACTAAATGAACAC CCTGCCGGATA pPh110 YeeVMutant rpRJK064 GGGCGGGGATCCTTATTTTTCCACCAG 44 BamHI AAAGTTCACCGCATC pPh112a ParE fpRJK066 ATTTATGGTACCTCACAATCAAATCTA 45 KpnI AGGAGTTACAAATGACCGCGTATATTC TGACCGTCG ParE rpRJK066 ATTGATCCGCGGTTAGCCTTTCAGGCG 46 SacII ATCCGCCAGG ParE fpRJK067 ATTTATTGTACATACACTATATTAACC 47 BsrGI TAAAAAGGAGCGTAACGAATGACCGCG TATATTCTGACCGCTG ParE rpRJK067 GGCGCGGGATCCTTAGCCTTTCAGGCG 48 BamHI ATCCGCCAGG pPh113 CcdB fpRJK065 AATTATCCGCGGTACCAACCCCCCTAT 49 SacII TAGAATAAGGAGTATCACGCATGCAGT TTAAGGTTTACA CcdB rpRJK065a CAGGGGCCGCGGTTATATTCCCCAGAA 50 SacII CATCAGGTTAATGGCGTTTT CcdB rpRJK065b CCGGGGGGATCCTTATATTCCCCAGAA 51 BamHI CATCAGGTTAATGGCGTTTT pPh114 LexA3Network fpRJK069 ATTTATGGCGCCTCCCTATCAGTGATA 52 KasI GAGATTGACATCCCTATCAGTGATAGA G LexA3Network rpRJK069 ATTCAGGATATCTGACTACTGCTTGGA 53 EcoRV TTCTCACCAATAAAAAACGCCCGG LexA3Network rpRJK069a ATTCAGCCTAGGTGACTACTGCTTGGA 54 AvrII TTCTCACCAATAAAAAACGCCCGG

TABLE-US-00003 Sequences >pRJK034[organism= cloningvector] SEQIDNO:55 gacgtctgtgcaagtactactgttctgcagtcacttgaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtaccactttgccgcggagtatttgtacatttgaaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggact gcttaagtcgctccatatgctcgttcccgggactacacaattgtcccccggcgccagggttgatatctatcgccctagggaccgtctc gagagaatcaatattaatccaacgcgtggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgttt gtcggtgaacgctctcctgagtaggacaaatccgccgccctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaagg cggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaa ggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccg acaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgt ccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagct gggctgtctgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgac ttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggccta actacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatc cggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcct ttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatggctagtgcttggattctcacca ataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaa gccaattctcgaaccccagagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgata ccgtaaagcacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggt ccgccacacccagccggccacagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccgtgggt cacgacgagatcctcgccgtcgggcatacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccaga tcatcctgatcgacaagaccggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccg gatcaagcgtatgcagccgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccc cggcacttcgcccaatagcagccagtcccttcccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagc cacgatagccgcgctgcctcgtcttgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctg acagccggaacacggcggcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagccgccggaga acctgcgtgcaatccatcttgttcaatcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatc cttggcggcaagaaagccatccagtttactttgcagggcttcccaaccttaccagagggcggcccaactggcaattcc >pRJK037[organism= cloningvector] SEQIDNO:56 gacgtctgtgcaagtactactgttctgcagtcacttgaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtaccctataagttacacaacataaggaggaatataatgcgtcgtcgtccgcgtccgccgtacctgccgcgtccgcgtccgccgccg ttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaaccgcggagtatttgta cattctatcaaagtatcataaggaggagaataatgcgtcgtcgtccgcgtccgccgtacctgccgcgtccgcgtccgccgccgttctt cccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaaggatcccgagaattggcttgg actcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggt gagaatccaagcagtagtcagagctcggactgcttaagtcgctccatatgctcgttcccgggactacacaattgtcccccggcgccag ggttgatatctatcgccctagggaccgtctcgagagcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgt gaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaa gctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcac gtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactgg aacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatt taacaaaaatttaacgcgaattaaatattaatccaacgcgtggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgt tttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctagacttaggcgttcggctgcggcgagcggtatc agctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggcc aggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcaga ggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgct taccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtc gttcgctccaagctgggctgtctgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacc cggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttctt gaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagtt ggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggat ctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatggctagtgc ttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctat caacaggagtccaagccaattctcgaaccccagagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaat cgggagcggcgataccgtaaagcacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctat gtcctgatagcggtccgccacacccagccggccacagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcag gcatcgccgtgggtcacgacgagatcctcgccgtcgggcatacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgat gctcttcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaa tgggcaggtagccggatcaagcgtatgcagccgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgac aggagatcctgccccggcacttcgcccaatagcagccagtcccttcccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgc ccgtcgtggccagccacgatagccgcgctgcctcgtcttgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgg gcgaccctgcgctgacagccggaacacggcggcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacc caagccgccggagaacctgcgtgcaatccatcttgttcaatcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccc tgcgccatcagatccttggcggcaagaaagccatccagtttactttgcagggcttcccaaccttaccagagggcggcccaactggcaa ttcc >pRJK046[organism= cloningvector] SEQIDNO:57 gacgtctgtgcaagtactactgttctgcagtcacttgaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtacccaacagggattcgttaatttaaggaggtctccaaatgggcaacaaccgcccggtgtatattccgcagccgcgcccgccgcat ccgcgcatttaaccgcggagtatttgtacagaggtacaactcaactaatataaggaggttcaaaatgggcaacaaccgcccggtgtat attccgcagccgcgcccgccgcatccgcgcatttaaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggact gcttaagtcgctccatatgctcgttcccgggactacacaattgtcccccggcgccagggttgatatctatcgccctagggaccgtctc gagagcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgccc gctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttcc gatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttt tcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattct tttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaaatattaa tccaacgcgtggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcc tgagtaggacaaatccgccgccctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatcc acagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgt ttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagata ccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcg ggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaac cccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagc agccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactaga aggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccg ctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggg gtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcg gcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaacccc agagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaa gcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccgg ccacagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgc cgtcgggcatacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaag accggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagc cgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaata gcagccagtcccttcccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgc ctcgtcttgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcg gcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccat cttgttcaatcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagc catccagtttactttgcagggcttcccaaccttaccagagggcggcccaactggcaattcc >pRJK055[organism= cloningvector] SEQIDNO:58 gacgtctgtgcaagtactactgttctgcagtcacttgaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtacccgactaacaactctataaggaggtccataaatgacccgcagcagccgcgcgggcctgcagtttccggtgggccgcgtgcatc gcctgctgcgcaaagactacaaagacgacgacgacaaataaccgcggagtatttgtacagaggtacaactcaactaatataaggaggt tcaaaatgacccgcagcagccgcgcgggcctgcagtttccggtgggccgcgtgcatcgcctgctgcgcaaagactacaaagacgacga cgacaaataaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaac gctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggactgcttaagtcgctccatatgctcgttc ccgggactacacaattgtcccccggcgccagggttgatatctatcgccctagggaccgtctcgagagaatcaatattaatccaacgcg tggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtagga caaatccgccgccctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatca ggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccata ggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtt tccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtg gcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaaccccccgttc agcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactgg taacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagta tttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcg gtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgc tcagtggaacgaaaactcacgttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcggcaaccgag cgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaaccccagagtcccg ctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaagcggtcagc ccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccggccacagtcg atgaatccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgccgtcgggca tacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccggcttc catccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgcatt gcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatagcagccagt cccttcccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcttg cagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcggcatcagag cagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccatcttgttcaa tcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagccatccagtt tactttgcagggcttcccaaccttaccagagggcggcccaactggcaattcc >pRJK062[organism= cloningvector] SEQIDNO:59 gacgtctgtgcaagtactactgttctgcagtcacttgaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtacctaaaagaggagactcacccttaaggaggtataagatggcgctgtggaaaaacatgctgaaaggcattggcaaactggcgggc aaagcggcgctgggcgcggtgaaaaaactggtgggcgcggaaagctaaccgcggagtatttgtacacaagtacagaggagtaaggagg taaagtatggcgctgtggaaaaacatgctgaaaggcattggcaaactggcgggcaaagcggcgctgggcgcggtgaaaaaactggtgg gcgcggaaagctaaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttca gaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggactgcttaagtcgctccatatgctc gttcccgggactacacaattgtcccccggcgccagggttgatatctatcgccctagggaccgtctcgagagaatcaatattaatccaa cgcgtggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagt aggacaaatccgccgccctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacaga atcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttc cataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccagg cgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaag cgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaacccccc gttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagcca ctggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggac agtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggt agcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctg acgctcagtggaacgaaaactcacgttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcggcaac cgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaaccccagagt cccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaagcggt cagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccggccaca gtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgccgtcg ggcatacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccgg cttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccg cattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatagcagc cagtcccttcccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcctcgt cttgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcggcatc agagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccatcttgt tcaatcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagccatcc agtttactttgcagggcttcccaaccttaccagagggcggcccaactggcaattcc >pRJK070[organism= cloningvector] SEQIDNO:60 gacgtctgtgcaagtactactgttctgcagtcacttgaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtaccaacggtaagaggcataatttaaggaggtaacacatgggctggggcagcttttttaaaaaagcggcgcatgtgggcaaacatg tgggcaaagcggcgctgacccattatctgtaaccgcggagtatttgtacagatttataaaatcggaatagataaggaggtacacatgg gctggggcagcttttttaaaaaagcggcgcatgtgggcaaacatgtgggcaaagcggcgctgacccattatctgtaaggatcccgaga attggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgtt ttttattggtgagaatccaagcagtagtcagagctcggactgcttaagtcgctccatatgctcgttcccgggactacacaattgtccc ccggcgccagggttgatatctatcgccctagggaccgtctcgagagaatcaatattaatccaacgcgtggcatcaaataaaacgaaag gctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctagactt aggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaac atgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagc atcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgt gcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgc tgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaaccccccgttcagcccgaccgctgcgccttat ccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgag gtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctg aagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagc agcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacg ttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatg gagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaaccccagagtcccgctcagaagaactcgtcaagaa ggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaagcggtcagcccattcgccgccaagctcttc agcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccggccacagtcgatgaatccagaaaagcggcca ttttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgccgtcgggcatacgcgccttgagcctggcga acagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctcgctc gatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgcattgcatcagccatgatggatact ttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatagcagccagtcccttcccgcttcagtgacaa cgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcttgcagttcattcagggcaccgga caggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcggcatcagagcagccgattgtctgttgtgcc cagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccatcttgttcaatcatgcgaaacgatcctcatc ctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagccatccagtttactttgcagggcttcccaac cttaccagagggcggcccaactggcaattcc >pPh037[organism= cloningvector] SEQIDNO:61 gacgtctgtgcaagtactactgttctgcagtcacttgaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtaccctataagttacacaacataaggaggaatataatgcgtcgtcgtccgcgtccgccgtacctgccgcgtccgcgtccgccgccg ttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaaccgcggagtatttgta cattctatcaaagtatcataaggaggagaataatgcgtcgtcgtccgcgtccgccgtacctgccgcgtccgcgtccgccgccgttctt cccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaaggatcccgagaattggcttgg actcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggt gagaatccaagcagtagtcagagctcggactgcttaagtcgctccatatgctcgttcccgggactacacaattgtcccccggcgccag ggttgatatctatcgccctagggaccgtctcgagagcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgt gaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaa gctctaaatcgggggctccctttagggttccgatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcac gtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactgg aacaacactcaaccctatctcggtctattcttttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatt taacaaaaatttaacgcgaattaaatattaatccaacgcgtggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgt tttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgccctagacttaggcgttcggctgcggcgagcggtatc agctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggcc aggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcaga ggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgct taccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtc gttcgctccaagctgggctgtctgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacc cggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttctt gaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagtt ggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggat ctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatggctagtgc ttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctat caacaggagtccaagccaattctcgaaccccagagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaat cgggagcggcgataccgtaaagcacgaggaagcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctat gtcctgatagcggtccgccacacccagccggccacagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcag gcatcgccgtgggtcacgacgagatcctcgccgtcgggcatacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgat gctcttcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaa tgggcaggtagccggatcaagcgtatgcagccgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgac aggagatcctgccccggcacttcgcccaatagcagccagtcccttcccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgc ccgtcgtggccagccacgatagccgcgctgcctcgtcttgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgg gcgaccctgcgctgacagccggaacacggcggcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacc caagccgccggagaacctgcgtgcaatccatcttgttcaatcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccc tgcgccatcagatccttggcggcaagaaagccatccagtttactttgcagggcttcccaaccttaccagagggcggcccaactggcaa ttcc >pPh046[organism= cloningvector] SEQIDNO:62 gacgtctgtgcaagtactactgttctgcagtcacttgaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtacccaacagggattcgttaatttaaggaggtctccaaatgggcaacaaccgcccggtgtatattccgcagccgcgcccgccgcat ccgcgcatttaaccgcggagtatttgtacagaggtacaactcaactaatataaggaggttcaaaatgggcaacaaccgcccggtgtat attccgcagccgcgcccgccgcatccgcgcatttaaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggact gcttaagtcgctccatatgctcgttcccgggactacacaattgtcccccggcgccagggttgatatctatcgccctagggaccgtctc gagagcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgccc gctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttcc gatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttt tcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattct tttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaaatattaa tccaacgcgtggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcc tgagtaggacaaatccgccgccctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatcc acagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgt ttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagata ccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcg ggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaac cccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagc agccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactaga aggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccg ctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggg gtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcg gcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaacccc agagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaa gcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccgg ccacagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgc cgtcgggcatacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaag accggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagc cgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaata gcagccagtcccttcccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgc ctcgtcttgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcg gcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccat cttgttcaatcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagc catccagtttactttgcagggcttcccaaccttaccagagggcggcccaactggcaattcc >pPh079[organism= cloningvector] SEQIDNO:63 gacgtctgtgcaagtactactgttctgcagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatca gcaggacgcactgaccggtaccctataagttacacaacataaggaggaatataatgcgtcgtcgtccgcgtccgccgtacctgccgcg tccgcgtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaa ccgcggagtatttgtacattctatcaaagtatcataaggaggagaataatgcgtcgtcgtccgcgtccgccgtacctgccgcgtccgc gtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaaggatc ccgagaattggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccg ggcgttttttattggtgagaatccaagcagtagtcagaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtacccaacagggattcgttaatttaaggaggtctccaaatgggcaacaaccgcccggtgtatattccgcagccgcgcccgccgcat ccgcgcatttaaccgcggagtatttgtacagaggtacaactcaactaatataaggaggttcaaaatgggcaacaaccgcccggtgtat attccgcagccgcgcccgccgcatccgcgcatttaaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggact gcttaagtcgctccatatgctcgttcccgggactacacaattgtcccccggcgccagggttgatatctatcgccctagggaccgtctc gagagcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgccc gctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttcc gatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttt tcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattct tttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaaatattaa tccaacgcgtggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcc tgagtaggacaaatccgccgccctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatcc acagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgt ttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagata ccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcg ggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaac cccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagc agccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactaga aggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccg ctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggg gtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcg gcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaacccc agagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaa gcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccgg ccacagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgc cgtcgggcatacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaag accggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagc cgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaata gcagccagtcccttcccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgc ctcgtcttgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcg gcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccat cttgttcaatcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagc catccagtttactttgcagggcttcccaaccttaccagagggcggcccaactggcaattcc >pPh110[organism= cloningvector] SEQIDNO:64 gacgtctgtgcaagtactactgttctgcagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatca gcaggacgcactgaccggtaccctataagttacacaacataaggaggaatataatgcgtcgtcgtccgcgtccgccgtacctgccgcg tccgcgtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaa ccgcggagtatttgtacattctatcaaagtatcataaggaggagaataatgcgtcgtcgtccgcgtccgccgtacctgccgcgtccgc gtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaaggatc ccgagaattggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccg ggcgttttttattggtgagaatccaagcagtagtcagaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtacccaacagggattcgttaatttaaggaggtctccaaatgggcaacaaccgcccggtgtatattccgcagccgcgcccgccgcat ccgcgcatttaaccgcggagtatttgtacagaggtacaactcaactaatataaggaggttcaaaatgggcaacaaccgcccggtgtat attccgcagccgcgcccgccgcatccgcgcatttaaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggact gcttaagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgaccggtaccc aagaagatagaggaggtaatatacaagagaatgaacaccctgccggatacccatgtgcgcgaagcgagccgctgcccgagcccggtga ccatttggcagaccctgctgacccgcctgctggatcagcattatggcctgaccctgaacgataccccgtttgcggatgaacgtgtgat tgaacagcatattgaagcgggcattagcctgtgcgatgcggtgaactttctggtggaaaaataaccgcggagtatttgtacaagccta acggaagtcgactagtaaggagaactaaatgaacaccctgccggatacccatgtgcgcgaagcgagccgctgcccgagcccggtgacc atttggcagaccctgctgacccgcctgctggatcagcattatggcctgaccctgaacgataccccgtttgcggatgaacgtgtgattg aacagcatattgaagcgggcattagcctgtgcgatgcggtgaactttctggtggaaaaataaggatcccgagaattggcttggactcc tgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaa tccaagcagtagtcacaattgtcccccggcgccagggttgatatctatcgccctagggaccgtctcgagagcgccctgtagcggcgca ttaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttccctt cctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggcacct cgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttggagtcc acgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggattttgc cgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaaatattaatccaacgcgtggcatcaaataa aacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgccgcc ctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcag gaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccc tgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagc tccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcata gctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaaccccccgttcagcccgaccgctg cgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagc agagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcg ctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgt ttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaa aactcacgttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaacaaa tccagatggagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaaccccagagtcccgctcagaagaactc gtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaagcggtcagcccattcgccgcca agctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccggccacagtcgatgaatccagaaa agcggccattttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgccgtcgggcatacgcgccttgag cctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgt gctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgcattgcatcagccatga tggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatagcagccagtcccttcccgcttc agtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcttgcagttcattcagg gcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcggcatcagagcagccgattgtct gttgtgcccagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccatcttgttcaatcatgcgaaacga tcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagccatccagtttactttgcagggc ttcccaaccttaccagagggcggcccaactggcaattcc >pPh112[organism= cloningvector] SEQIDNO:65 gacgtctgtgcaagtactactgttctgcagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatca gcaggacgcactgaccggtaccctataagttacacaacataaggaggaatataatgcgtcgtcgtccgcgtccgccgtacctgccgcg tccgcgtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaa ccgcggagtatttgtacattctatcaaagtatcataaggaggagaataatgcgtcgtcgtccgcgtccgccgtacctgccgcgtccgc gtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaaggatc ccgagaattggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccg ggcgttttttattggtgagaatccaagcagtagtcagaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtacccaacagggattcgttaatttaaggaggtctccaaatgggcaacaaccgcccggtgtatattccgcagccgcgcccgccgcat ccgcgcatttaaccgcggagtatttgtacagaggtacaactcaactaatataaggaggttcaaaatgggcaacaaccgcccggtgtat attccgcagccgcgcccgccgcatccgcgcatttaaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggact gcttaagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgaccggtacct cacaatcaaatctaaggagttacaaatgaccgcgtatattctgaccgctgaagcggaagcggatctgcgcggcattattcgctatacc cgccgcgaatggggcgcggcgcaggtgcgccgctatattgcgaaactggaacagggcattgcgcgcctggcggcgggcgaaggcccgt ttaaagatatgagcgaactgtttccggcgctgcgcatggcgcgctgcgaacatcattatgtgttttgcctgccgcgcgcgggcgaacc ggcgctggtggtggcgattctgcatgaacgcatggatctgatgacccgcctggcggatcgcctgaaaggctaaccgcggagtatttgt acatacactatattaacctaaaaaggagcgtaacgaatgaccgcgtatattctgaccgctgaagcggaagcggatctgcgcggcatta ttcgctatacccgccgcgaatggggcgcggcgcaggtgcgccgctatattgcgaaactggaacagggcattgcgcgcctggcggcggg cgaaggcccgtttaaagatatgagcgaactgtttccggcgctgcgcatggcgcgctgcgaacatcattatgtgttttgcctgccgcgc gcgggcgaaccggcgctggtggtggcgattctgcatgaacgcatggatctgatgacccgcctggcggatcgcctgaaaggctaaggat cccgagaattggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgcc gggcgttttttattggtgagaatccaagcagtagtcacaattgtcccccggcgccagggttgatatctatcgccctagggaccgtctc gagagcgccctgtagcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgccc gctcctttcgctttcttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttcc gatttagtgctttacggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttt tcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattct tttgatttataagggattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaaatattaa tccaacgcgtggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcc tgagtaggacaaatccgccgccctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatcc acagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgt ttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagata ccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcg ggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaac cccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagc agccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactaga aggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccg ctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggg gtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcg gcaaccgagcgttctgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaacccc agagtcccgctcagaagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaa gcggtcagcccattcgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccgg ccacagtcgatgaatccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgc cgtcgggcatacgcgccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaag accggcttccatccgagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagc cgccgcattgcatcagccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaata gcagccagtcccttcccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgc ctcgtcttgcagttcattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcg gcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccat cttgttcaatcatgcgaaacgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagc catccagtttactttgcagggcttcccaaccttaccagagggcggcccaactggcaattcc >pPh113[organism= cloningvector] SEQIDNO:66 gacgtctgtgcaagtactactgttctgcagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatca gcaggacgcactgaccggtaccctataagttacacaacataaggaggaatataatgcgtcgtcgtccgcgtccgccgtacctgccgcg tccgcgtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaa ccgcggagtatttgtacattctatcaaagtatcataaggaggagaataatgcgtcgtcgtccgcgtccgccgtacctgccgcgtccgc gtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaaggatc ccgagaattggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccg ggcgttttttattggtgagaatccaagcagtagtcagaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtacccaacagggattcgttaatttaaggaggtctccaaatgggcaacaaccgcccggtgtatattccgcagccgcgcccgccgcat ccgcgcatttaaccgcggagtatttgtacagaggtacaactcaactaatataaggaggttcaaaatgggcaacaaccgcccggtgtat attccgcagccgcgcccgccgcatccgcgcatttaaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggact gcttaagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgaccggtacct atccatcattaacgaccaaatcaaggaggacgtatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtgg atgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccg tgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggg gaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaccgcggtaccaac ccccctattagaataaggagtatcacgcatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgta cagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaac tttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaaga agtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaggatcccgagaattggct tggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttatt ggtgagaatccaagcagtagtcacaattgtcccccggcgccagggttgatatctatcgccctagggaccgtctcgagagcgccctgta gcggcgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgcttt cttcccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgcttta cggcacctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgt tggagtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagg gattttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaaatattaatccaacgcgtggca tcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaat ccgccgccctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcagggga taacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctc cgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttcccc ctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgct ttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaaccccccgttcagccc gaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaaca ggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttgg tatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggt ttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagt ggaacgaaaactcacgttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttc tgaacaaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaaccccagagtcccgctcag aagaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaagcggtcagcccatt cgccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccggccacagtcgatgaa tccagaaaagcggccattttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgccgtcgggcatacgc gccttgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccggcttccatcc gagtacgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgcattgcatc agccatgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatagcagccagtccctt cccgcttcagtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcttgcagtt cattcagggcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcggcatcagagcagcc gattgtctgttgtgcccagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccatcttgttcaatcatg cgaaacgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagccatccagtttactt tgcagggcttcccaaccttaccagagggcggcccaactggcaattcc >pPh115[organism= cloningvector] SEQIDNO:67 gacgtctgtgcaagtactactgttctgcagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatca gcaggacgcactgaccggtaccctataagttacacaacataaggaggaatataatgcgtcgtcgtccgcgtccgccgtacctgccgcg tccgcgtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaa ccgcggagtatttgtacattctatcaaagtatcataaggaggagaataatgcgtcgtcgtccgcgtccgccgtacctgccgcgtccgc gtccgccgccgttcttcccgccgcgtctgccgccgcgtatcccgccgggtttcccgccgcgtttcccgccgcgtttcccgtaaggatc ccgagaattggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccg ggcgttttttattggtgagaatccaagcagtagtcagaattcgatacccagctgggtggagtgcaccaaggagcatgcgaaggaaacg tttcgcagaagctttccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgacc ggtacccaacagggattcgttaatttaaggaggtctccaaatgggcaacaaccgcccggtgtatattccgcagccgcgcccgccgcat ccgcgcatttaaccgcggagtatttgtacagaggtacaactcaactaatataaggaggttcaaaatgggcaacaaccgcccggtgtat attccgcagccgcgcccgccgcatccgcgcatttaaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcagagctcggact gcttaagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcacatcagcaggacgcactgaccggtacct atccatcattaacgaccaaatcaaggaggacgtatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtgg atgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccg tgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggg gaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataaggatcccgagaat tggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttcagaacgctcggttgccgccgggcgtttt ttattggtgagaatccaagcagtagtcaggcgcctccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac atcagcaggacgcactgaccggtacctatccatcattaacgaccaaatcaaggaggacgtatgcagtttaaggtttacacctataaaa gagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgc acgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatg gccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgt tctggggaatataaggatcccgagaattggcttggactcctgttgatagatccagtaatgacctcagaactccatctggatttgttca gaacgctcggttgccgccgggcgttttttattggtgagaatccaagcagtagtcacctagggaccgtctcgagagcgccctgtagcgg cgcattaagcgcggcgggtgtggtggttacgcgcagcgtgaccgctacacttgccagcgccctagcgcccgctcctttcgctttcttc ccttcctttctcgccacgttcgccggctttccccgtcaagctctaaatcgggggctccctttagggttccgatttagtgctttacggc acctcgaccccaaaaaacttgattagggtgatggttcacgtagtgggccatcgccctgatagacggtttttcgccctttgacgttgga gtccacgttctttaatagtggactcttgttccaaactggaacaacactcaaccctatctcggtctattcttttgatttataagggatt ttgccgatttcggcctattggttaaaaaatgagctgatttaacaaaaatttaacgcgaattaaatattaatccaacgcgtggcatcaa ataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctcctgagtaggacaaatccgc cgccctagacttaggcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataac gcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcc cccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctgg aagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttct catagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtctgcacgaaccccccgttcagcccgacc gctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggat tagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatc tgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggttttt ttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaa cgaaaactcacgttaagggattttggtcatggctagtgcttggattctcaccaataaaaaacgcccggcggcaaccgagcgttctgaa caaatccagatggagttctgaggtcattactggatctatcaacaggagtccaagccaattctcgaaccccagagtcccgctcagaaga actcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcggcgataccgtaaagcacgaggaagcggtcagcccattcgcc gccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccgccacacccagccggccacagtcgatgaatcca gaaaagcggccattttccaccatgatattcggcaagcaggcatcgccgtgggtcacgacgagatcctcgccgtcgggcatacgcgcct tgagcctggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccggcttccatccgagt acgtgctcgctcgatgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgcattgcatcagcc atgatggatactttctcggcaggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatagcagccagtcccttcccg cttcagtgacaacgtcgagcacagccgcgcaaggaacgcccgtcgtggccagccacgatagccgcgctgcctcgtcttgcagttcatt cagggcaccggacaggtcggtcttgacaaaaagaaccgggcgaccctgcgctgacagccggaacacggcggcatcagagcagccgatt gtctgttgtgcccagtcatagccgaatagcctctccacccaagccgccggagaacctgcgtgcaatccatcttgttcaatcatgcgaa acgatcctcatcctgtctcttgatcagatcttgatcccctgcgccatcagatccttggcggcaagaaagccatccagtttactttgca gggcttcccaaccttaccagagggcggcccaactggcaattcc

[0122] All references, patents and patent applications disclosed herein are incorporated by reference with respect to the subject matter for which each is cited, which in some cases may encompass the entirety of the document.

[0123] The indefinite articles a and an, as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to mean at least one.

[0124] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one step or act, the order of the steps or acts of the method is not necessarily limited to the order in which the steps or acts of the method are recited.

[0125] In the claims, as well as in the specification above, all transitional phrases such as comprising, including, carrying, having, containing, involving, holding, composed of, and the like are to be understood to be open-ended, i.e., to mean including but not limited to. Only the transitional phrases consisting of and consisting essentially of shall be closed or semi-closed transitional phrases, respectively, as set forth in the United States Patent Office Manual of Patent Examining Procedures, Section 2111.03.