FUSOKINES INVOLVING CYTOKINES WITH STRONGLY REDUCED RECEPTOR BINDING AFFINITIES

Abstract

The present invention relates to a fusion protein comprising at least two cytokines, of which at least one is a modified cytokine with a strongly reduced binding affinity to its receptor, or to one of its receptors. Preferably, both cytokines are connected by a linker, preferably a GGS linker. The invention relates further to said fusion protein for use in treatment of diseases.

Claims

1. A fusion protein comprising at least two cytokines, of which at least one cytokine is modified in such a way that it has a strongly reduced binding activity to its receptor,

2. The fusion protein according to claim 1, further comprising a GGS linker.

3. The fusion protein according to claim 1, wherein said cytokines are XCL1 and IFNa2.

4. The fusion protein according to claim 1, wherein said cytokines are CCL20 and ILβ.

5. The fusion protein according to claim 1, wherein said cytokines are TNF and leptin.

6. (canceled)

7. A method of treating cancer comprising administering to a subject in need thereof a fusion protein according to claim 1.

8. A method of modulating an immune response comprising administering to a subject in need thereof a fusion protein according to claim 1.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0023] FIG. 1: Schematic representation of the structural elements in the XCL1/IFNα2-Q124R fusion protein.

[0024] FIG. 2: Selective activity of the XCL1/IFNα2-Q124R fusion protein on XCR1 expressing cells.

[0025] STAT1 Y701 phosphorylation is measured in response to IFNα/β or XCL1/IFNα2-Q124R fusion protein in different mouse splenocyte subsets, characterized by the expression of CD11c and CD8α. First column: CD11c.sup.−CD8α.sup.+ subset; second column: CD11c.sup.−CD8α.sup.− subset; third column: CD11c.sup.medium CD8α.sup.− subset; fourth column: CD11c.sup.high CD8α.sup.+ subset; fifth column: CD11c.sup.high CD8α.sup.− subset.

[0026] FIG. 3: Schematic representation of the structural elements in the IL-1β-mutant/CCL20 fusion proteins.

[0027] FIG. 4: Selective activity of the IL-1β-mutant/CCL20 fusion proteins on CCR6 expressing cells.

[0028] (A) induction of NFκB activity by wild type and 5 different IL-1β mutants, fused to CCL20.

[0029] (B) concentration dependency of the induction of the NFκB activity by wild type and IL-1β Q148G mutant/CCL20 fusion proteins, in mock transfected cells, or cells transfected with CCR6.

[0030] (C) induction of the NFκB activity by wild type and IL-1β Q148G mutant/CCL20 fusion proteins (12.5 ng/ml), in mock transfected cells, or cells transfected with CCR6 as compared with induction by vehicle.

[0031] FIG. 5: Schematic representation of the structural elements in the scTNFα/Leptin-mutant fusion proteins.

[0032] FIG. 6: Selective activity of the scTNFα/Leptin mutant fusion proteins on leptin receptor expressing cells.

[0033] Leptin-dependent growth induced by indicated concentrations of scTNF-targeted WT or mutant leptin is measured by the XTT assay in Ba/F3-mLR cells (panel A) or Ba/F3-mLR-TNFR1ΔCyt cells (panel B).

[0034] FIG. 7: In vivo targeting of IFN activity on mouse spleen cells expressing XCR1.

[0035] C57BI/6 mice were injected iv with the indicated amount of XCL1-IFNα2-Q124R or with 1 000 000 units of natural murine IFNα/β or PBS. After 45 min, spleen cells were analyzed by FACS for CD11c and CD8α expression (first panel) and for P-STAT1 (further panels) in the following cell population: CD11c−CD8α− (line 1), CD11c−CD8α+ (line 2), CD11c+CD8α+ (line3), CD11c+CD8α− (line 4).

EXAMPLES

[0036] Materials & Methods to the Examples

[0037] Cloning and Production of the Fusokines

[0038] Cloning of the XCL1/IFNα2-Q124R Fusion Protein.

[0039] The XCL1 open reading frame was synthesized by PCR from the XCL1-encoding plasmid MR200473 (Origen Inc.), using the Expand High Fidelity PCR system (Roche Diagnostics) and the following primers:

TABLE-US-00001 Forward: 5′GGGGGGGAATTCATGAGACTTCTCCTCCTGAC3′ Reverse: 5′GGGGGGTCCGGAGGCCCAGTCAGGGTTATCGCTG3′

[0040] The PCR product was digested by EcoRI and BspEI and substituted to the EcoRI-BspEI fragment which encodes the nanobody in the pMET7 SIgK-HA-1R59B-His-PAS-ybbr-IFNA2-Q124R vector (PCT/EP2013/050787).

[0041] Production of the XCL1 / IFNα2-Q124R Fusion Protein.

[0042] Hek 293T cells were transfected with the protein fusion construct using the standard lipofectamin method (Invitrogen). 48 hours after the transfection culture medium were harvested and stored at −20° C. The IFN activity was assayed on the human HL116 and the murine LL171 cell lines as described (Uzé et al. J. Mol. Biol. 1994) using the purified Nanobody GFP-IFNα2-Q124R preparation (described in PCT/EP2013/050787) as a standard.

[0043] Cloning of IL-1β/CCL20 Fusion Proteins.

[0044] A codon-optimized sequence encoding the mature human IL-16/CCL20 fusion protein was generated via gene synthesis (Invitrogen Gene Art). Briefly, a sequence was synthesized in which the mature human IL-1β protein, preceded by the SigK leader peptide, and equipped with an N-terminal HA, was fused at its C-terminus to a 13×GGS linker sequence, followed by the sequence for mature human CCL20 with a C-terminal HIS tag (FIG. 3).

[0045] IL-1β mutants expected to have reduced binding affinity for the IL-1R were selected based on literature and analysis of published crystal structures of human IL-1β complexed with its receptor. Mutations in the hIL-1β moiety were created via site-directed mutagenesis (QuickChange, Stratagene) using the mutagenesis primers as indicated in the table:

TABLE-US-00002 Fw primer Rev primer R120G GCGGCAGCGCCCCTGTCGGA GCAGGGTGCAGTTCAAGCTT AGCTTGAACTGCACCCTGC CCGACAGGGGCGCTGCCGC Q131G CTGCGGGACAGCCAGGGGA CGCTCATGACCAGGCTCTTC AGAGCCTGGTCATGAGCG CCCTGGCTGTCCCGCAG H146A CGAGCTGAAGGCACTGGCT CCATGTCCTGGCCCTGAAGA CTTCAGGGCCAGGACATGG GCCAGTGCCTTCAGCTCG Q148G GAAGGCACTGCATCTGGGT GCTGTTCCATGTCCTGGCCA GGCCAGGACATGGAACAGC CCCAGATGCAGTGCCTTC K209A CCCCAAGAACTACCCCAAG GTTGAACACGAAGCGCTTTT GCAAAGATGGAAAAGCGCT CCATCTTTGCCTTGGGGTAG TCGTGTTCAAC TTCTTGGGG

[0046] Production of IL-1β-mutant: CCL20 Fusion Proteins.

[0047] IL-1β-CCL20 fusion proteins were produced in HEK293T cells. For small-scale production, HEK293T cells were seeded in 6-well plates at 400000 cells/well in DMEM supplemented with 10% FCS. After 24 hours, culture medium was replaced by medium with reduced serum (DMEM/5% FCS) and cells were transfected using linear PEI. Briefly, PEI transfection mix was prepared by combining 1 μg expression vector with 5 μg PEI in 160 μl DMEM, incubated for 10 minutes at RT and added to the wells dropwise. After 24 hours, transfected cells were washed with DMEM and layered with 1.5 ml OptiMem/well for protein production. Conditioned media were recuperated after 48 hours, filtered through 0.45 p filters and stored at −20° C. IL-1β content in the conditioned media was determined by ELISA according to the manufacturer's instructions (R&D Systems).

[0048] Cloning of the scTNF/Leptin Fusion Proteins.

[0049] The coding sequences of the wild-type (WT), L86S and L86N leptin were synthesized by PCR from pMet7 plasmids expressing WT Leptin, Leptin L86S or Leptin L86N, respectively, using the following primers:

TABLE-US-00003 forward 5′-GCAGATCTGTCGACATCCAGAAAGTCCA            GGATGACACC-3′, reverse 5′-CGATGCGGCCGCACATTCAGGGCTAACA            TCCAACTGT-3′.

[0050] This introduces a Bglll and a Notl site at the amino and carboxy terminus, respectively, of the leptin coding sequence. The PCR product was digested with Bglll and Notl and cloned into pMET7-SIgK-HA-scTNF WT-6×GGS-FLAG (WT scTNF was generated by gene synthesis, GeneArt) opened with BgIII and NotI, which reside in between the 6×GGS and FLAG. This generated pMET7-SIgK-HA-scTNF WT-6×GGS-mLeptin-FLAG, pMET7-SIgK-HA-scTNF WT-6×GGS-m Leptin L86S-FLAG and pMET7-SIgK-HA-scTNF WT-6×GGS-mLeptin L86N-FLAG.

[0051] Production of the scTNF/Leptin Fusion Proteins.

[0052] HekT cells were transfected with the different fusion protein constructs using the standard calcium phosphate precipitation method. 48 hours after the transfection culture mediums were harvested and stored at −20° C. The concentration was determined with a commercial hTNFα ELISA (DY210, R&D systems).

[0053] Cell Lines

[0054] Hek 293T, HL116 and LL171 cell line were grown in DMEM supplemented with 10% FCS. Ba/F3-mLR and Ba/F3-mLR-TNFR1ΔCyt cells were maintained in RPMI supplemented with 10% heat-inactivated FCS and 10Ong/mlleptin.

[0055] Assays

[0056] Phospho STAT1 Assay.

[0057] Single-cell suspensions were prepared from spleens isolated from C57B1/6 mice. Erythrocytes were depleted using red blood cell lysis buffer (Lonza). Splenocytes were treated for 30 min with mouse IFNα/β or XCL1-IFNα2-Q124R fusion protein in RPMI 5% fetal calf serum at 37° C. and then labelled with the BD Phosflow PE mouse anti-STAT1 (pY701) together with the Alexa Fluor 488-labelled anti-mouse CD11c (eBioscience #53-0114-80) and APC-labelled anti mouse CD8α (BD Bioscience #553035) or anti-mouse CD11c and Alexa 488-labelled anti-mouse CD8α according to BD Biosciences instructions. FACS data were acquired using a BD FACS Canto and analyzed using either Diva (BD Biosciences) software.

[0058] NF-κB Reportergene Assay.

[0059] To assess IL-1R activation, we used HEK-Blue™ IL-18 cells that stably express the IL-1R (Invivogen) and transfected them transiently with an NF-κB luciferase reportergene. Briefly, HEK-Blue™ IL-1β cells were seeded in culture medium (DMEM/10% FCS) in 96-well plates (10000 cells/well) and transfected the next day using the calciumphosphate precipitation method with the indicated amounts of expression plasmids and 5 ng/well of the 3κB-Luc reportergene plasmid (Vanden Berghe et al., 1998). 24 hours post-transfection, culture medium was replaced by starvation medium (DMEM) and 48 hours post-transfection, cells were induced for 6 hours with IL1-CCL20 fusion proteins. After induction, cells were lysed and luciferase activity in lysates was determined using the Promega Firefly Luciferase Assay System on a Berthold centro LB960 luminometer.

[0060] Cell Proliferation Assay.

[0061] The Ba/F3-mLR cell line was generated by electroporation of Ba/F3 cells with the pMet7-mLR vector. Stably expressing cells were selected by growing them on leptin instead of IL-3. Indeed, growth of Ba/F3 cells is dependent on IL-3, but when they express mLR, they also proliferate with leptin. To obtain the Ba/F3-mLR-TNFR1ΔCyt cell line, Ba/F3-mLR cells were co-transfected with pMet7-HA-hTNFR1ΔCyt and pIRESpuro2 (Clontech) followed by puromycin selection and FACS sorting of hTNFR1ΔCyt-expressing cells.

[0062] To assess cell proliferation, Ba/F3-mLR and Ba/F3-mLR-TNFR1ΔCyt cells were washed, seeded in RPMI/10% iFCS in 96-well plates (10.000 cells/well) and stimulated with the indicated amounts of leptin or fusion proteins. Four days later, 50 ul XTT (XTT Cell Proliferation Kit II, Roche, 11 465 015 001) was added and incubated for 4 hrs before measuring absorbance at 450 nm.

EXAMPLE 1

IFN Activity of the XCL1 / IFNα2-Q124R Fusion Protein is Restored on Cells Expressing XCR1

[0063] Mouse splenocytes were treated for 30 minutes with 1 nM XCL1-IFNα2-0124R or with 10000 units/ml mouse IFNα/β. Cells were then fixed, permeabilized and stained with an anti-phospho STAT1 (PE), anti CD11c (Alexa Fluor 488) and anti CD8α (APC) and analyzed by FACS. FIG. 2 shows that mouse IFN α/β induced STAT1 phosphorylation in all splenocyte subsets analysed. In contrast the XCL1-IFNα2-Q124R fusion protein induced an IFN response only in the majority of cells belonging to the CD11c.sup.+CD8α.sup.+ subset and in a minority of cells belonging to the CD11c.sup.+CD8α.sup.− subset. The distribution of the splenocyte subsets responding to the XCL1-IFNα2-Q124R fusion protein matches perfectly the expected distribution of XCR1, the XCL1 receptor (Dorner et al. 2009).

EXAMPLE 2

IL1β Activity is Restored on Cells Expressing CCR6

[0064] HEK-Blue™ IL-113 cells, which stably express the IL-1R, were transiently transfected with an NF-κB reportergene plasmid (5 ng/well) and an empty vector or hCCR6 expression plasmid (10 ng/well). Mock- and CCR6-transfected cells were next treated for 6 hours with wild type or mutant IL1β-CCL20 fusion proteins (25 ng/ml), after which cells were lysed and NF-κB reportergene activity was determined. As evident from FIG. 4A, cells expressing CCR6 responded with increased NF-κB reportergene activity to all investigated mutant IL1β-CCL20 fusion proteins as compared to mock-transfected cells. To evaluate the effect of the IL-1β-Q148G mutant, for which the targeting effect was most apparent, in more detail, mock-transfected or CCR6-expressing HEK-Blue™ IL-1β cells were treated for 6 hours with increasing doses of WT IL-1β or IL-1βQ148G-CCL20 fusion protein. FIG. 4B demonstrates that overexpression of CCR6 increased the activity of the WT IL-1β-CCL20 fusion, but had a stronger potentiating effect for the IL-1βQ148G-CCL20 fusion. The targeting effect was most prominent when IL1-β-CCL20 was applied to the cells at 12.5 ng/ml (FIG. 4C).

EXAMPLE 3

Leptin Activity is Restored on Cells Expressing the TNFR

[0065] The proliferation of Ba/F3-mLR and Ba/F3-mLR-TNFR1ΔCyt cells after 4 days of stimulation with the indicated amounts of leptin or the leptin-scTNF fusion proteins was assessed. As shown in FIG. 6A, both cell lines do not proliferate in growth medium supplemented only with heat-inactivated serum. Moreover, the ability of leptin to induce Ba/F3 proliferation is reduced when it is coupled to scTNF. Mutating L86 within WT leptin into either a serine (L86S) or an asparagine (L86N) results in a moderate or a strong reduction of the affinity towards the mouse leptin receptor, respectively. This reduction in affinity translates in a 3 versus 10 times less potent induction of proliferation of Ba/F3-mLR cells for leptin L86S versus L86N, respectively. Additional transfection of Ba/F3-mLR cells with the human TNF-R1 lacking its intracellular domain (hTNFR1ΔCyt) introduces a non-functional receptor, which can function as a membrane bound extracellular marker. Clearly, the proliferative response upon stimulation with the L86S and L86N leptin mutants coupled to scTNF is completely restored in Ba/F3-mLR cells that express the hTNFR1ΔCyt (FIG. 6B).

EXAMPLE 4

In Vivo Targeting of an XCR1 Expressing Cell Population

[0066] According to Bachem et al. (Frontiers in Immunology 3, 1-12. 2012), XCR1 expressing cells represent the major part of CD11c+CD8α+ spleen cell population and a minor part of CD11c+CD8α− spleen cell population. C57BI/6 mice were injected iv with the indicated amount of XCL1-IFNα2-Q124R or with 1 000 000 units of natural murine IFNα/β or PBS. After 45 min, spleen cells were analyzed by FACS for P-STAT1 in the following cell population: CD11c−CD8α−, CD11c−CD8α+, CD11c+CD8α+, CD11c+CD8α−. The results are shown in FIG. 7. From these results, it is clear that the fusion construct can target and induce a response in a minor fraction of the population (about 0.1% of the total cells), whereas the IFN sensitive cells that do not express the marker are not affected. Indeed, wild type IFN is also affecting the CD11c+CD8α− cells, whereas those cells are not affected by the fusion construct, clearly proving the specific action of the fusion.

REFERENCES

[0067] Acosta-Rodriguez E V, Napolitani G, Lanzavecchia A and Sallusto F. (2007) Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Nat Immunol. 8, 942-9. [0068] Acres B, Gantzer M, Remy C, Futin N, Accart N, Chaloin O, Hoebeke J, Balloul J M and Paul S. (2005). Fusokine interleukin-2/interleukin-18, a novel potent innate and adaptive immune stimulator with decreased toxicity. Cancer Res. 65, 9536-46. [0069] Baba M, Imai T, Nishimura M, Kakizaki M, Takagi S, Hieshima K, Nomiyama H and Yoshie O. (1997). Identification of CCR6, the specific receptor for a novel lymphocyte-directed CC chemokine LARC. J Biol Chem. 272,14893-8. [0070] Bachem A, Hartung E, Güttler S, Mora A, Zhou X, Hegemann A, Plantinga M, Mazzini E, Stoitzner P, Gurka S, Henn V, Mages H W and Kroczek R A. (2012). Expression of XCR1 Characterizes the Ban-Dependent Lineage of Dendritic Cells Capable of Antigen Cross-Presentation. Front Immunol. 3, 214. doi: 10.3389. [0071] Ben-Sasson S Z, Caucheteux S, Crank M, Hu-Li J and Paul W E. (2011). IL-1 acts on T cells to enhance the magnitude of in vivo immune responses. Cytokine, 56, 122-5. [0072] Bono M R, Benech P, Coullin P, Alcaide-Loridan C, Grisard M C, Join H, Fischer D G and Fellous M. (1989). Characterization of human IFN-gamma response using somatic cell hybrids of hematopietic and nonhematopoietic origin. Somat. Cell Mol. Genet. 15, 513-23. [0073] Brecht A., Gauglitz G., Polster J. (1993). Interferometric immunoassay in a FIA-system—A sensitive and rapid approach in label-free immunosensing. , Biosens Bioelectron 8: 387-392. [0074] Crozat K, Guiton R, Contreras V, Feuillet V, Dutertre C A, Ventre E, Vu Manh T P, Baranek T, Storset A K, Marvel J, Boudinot P, Hosmalin A, Schwartz-Cornil I and Dalod M. (2010). The XC chemokine receptor 1 is a conserved selective marker of mammalian cells homologous to mouse CD8alpha+ dendritic cells. J. Exp. Med. 207, 1283-1292. [0075] Donahue R E, Seehra J, Metzger M, Lefebvre D, Rock B, Carbone S, Nathan D G, Garnick M, Sehgal P K, Laston D, et al. (1988). Human IL-3 and GM-CSF act synergistically in stimulating hematopoiesis in primates. Science 241, 1820-1823 [0076] Dorner B G, Dorner M B, Zhou X, Opitz C, Mora A, Guttler S, Hutloff A, Mages H W, Ranke K, Schaefer M, Jack R S, Henn V and Kroczek R A. (2009). Selective expression of the chemokine receptor XCR1 on cross-presenting dendritic cells determines cooperation with CD8+ T cells. Immunity 31, 823-833. [0077] Dunne A, Ross P J, Pospisilova E, Masin J, Meaney A, Sutton C E, Iwakura Y, Tschopp J, Sebo P and Mills K H. (2010) Inflammasome activation by adenylate cyclase toxin directs Th17 responses and protection against Bordetella pertussis. J Immunol. 185, 1711-9. [0078] Fuertes M B, Kacha A K, Kline J, Woo S R, Kranz D M, Murphy K M and Gajewski T F (2011). Host type I IFN signals are required for antitumor CD8+ T cell responses through CD8{alpha}+dendritic cells J. Exp. Med. 208, 2005-2016. [0079] Gaffen S L. (2011). Recent advances in the IL-17 cytokine family. Curr Opin Immunol. 23, 613-9. [0080] Gajewski T F, Fuertes M B and Woo S R (2012). Innate immune sensing of cancer: clues from an identified role for type I IFNs. Cancer Immunol Immunother. 61, 1343-7. [0081] Gillies S D, Lan Y, Brunkhorst B, Wong W K, Li Y, Lo K M. (2002). Bi-functional cytokine fusion proteins for gene therapy and antibody-targeted treatment of cancer. Cancer Immunol Immunother 51, 449-460 [0082] Halaas J L, Gajiwala K S, Maffei M, Cohen S L, Chait B T, Rabinowitz D, Lallone R L, Burley S K and Friedman J M. (1995). Weight-reducing effects of the plasma protein encoded by the obese gene. Science, 269, 543-6. [0083] Hehlgans, T and Pfeffer, K (2005). The intriguing biology of the tumour necrosis factor/tumour necrosis factor receptor superfamily: players, rules and the games. Immunology. 115, 1-20. [0084] Hieshima K, Imai T, Opdenakker G, Van Damme J, Kusuda J, Tei H, Sakaki Y, Takatsuki K, Miura R, Yoshie O and Nomiyama H. (1997). Molecular cloning of a novel human CC chemokine liver and activation-regulated chemokine (LARC) expressed in liver. Chemotactic activity for lymphocytes and gene localization on chromosome 2. J Biol Chem. 272, 5846-53. [0085] Higgins S C, Jarnicki A G, Lavelle E C and Mills K H. (2006). TLR4 mediates vaccine-induced protective cellular immunity to Bordetella pertussis: role of IL-17-producing T cells. J Immunol. 177, 7980-9. [0086] Idriss H T & Naismith J H (2000). TNF alpha and the TNF receptor superfamily: structure-function relationship(s). Microscopy research and technique 50, 184-95. [0087] likuni N, Lam Q L, Lu L, Matarese G, La Cava A. (2008). Leptin and Inflammation. Curr Immunol Rev. 4, 70-79. [0088] Jahn T, Zuther M, Friedrichs B, Heuser C, Guhlke S, Abken H, Hombach A A (2012). An IL12-IL2-antibody fusion protein targeting Hodgkin's lymphoma cells potentiates activation of NK and T cells for an anti-tumor attack. PLoS One 7:e44482. [0089] Khader S A, Bell G K, Pearl J E, Fountain J J, Rangel-Moreno J, Cilley G E, Shen F, Eaton S M, Gaffen S L, Swain S L, Locksley R M, Haynes L, Randall T D and Cooper A M. (2007). IL-23 and IL-17 in the establishment of protective pulmonary CD4+ T cell responses after vaccination and during Mycobacterium tuberculosis challenge. Nat Immunol. 8, 369-77. [0090] Krippner-Heidenreich A, Grunwald I, Zimmermann G, Kühnle M, Gerspach J, Sterns T, Shnyder S D, Gill J H, Männel DN, Pfizenmaier K and Scheurich P. (2008). Single-chain TNF, a TNF derivative with enhanced stability and antitumoral activity. J Immunol. 180, 8176-83. [0091] Lu J, Peng Y, Zheng Z J, Pan J H, Zhang Y, Bai Y (2008). EGF-IL-18 fusion protein as a potential anti-tumor reagent by induction of immune response and apoptosis in cancer cells. Cancer Lett 260, 187-197. [0092] Murzin A G, Lesk A M & Chothia C (1992). β-Trefoil fold: Patterns of structure and sequence in the Kunitz inhibitors interleukins-1β and 1α and fibroblast growth factors. Journal of Molecular Biology 223, 531-543. [0093] Nicola N A & Hilton D J (1998). General classes and functions of four-helix bundle cytokines. Advances in protein chemistry 52, 1-65. [0094] Nomiyama H, Osada N and Yoshie O. (2013). Systematic classification of vertebrate chemokines based on conserved synteny and evolutionary history. Genes Cells. 18,1-16. [0095] O'Shaughnessy J A, Tolcher A, Riseberg D, Venzon D, Zujewski J, Noone M, Gossard M, Danforth D, Jacobson J, Chang V, Goldspiel B, Keegan P, Giusti R and Cowan K H. (1996). Prospective, randomized trial of 5-fluorouracil, leucovorin, doxorubicin, and cyclophosphamide chemotherapy in combination with the interleukin-3/granulocyte-macrophage colony-stimulating factor (GM-CSF) fusion protein (PIXY321) versus GM-CSF in patients with advanced breast cancer. Blood 87, 2205-2211 [0096] Penafuerte C, Bautista-Lopez N, Boulassel M R, Routy J P and Galipeau J (2009). The human ortholog of granulocyte macrophage colony-stimulating factor and interleukin-2 fusion protein induces potent ex vivo natural killer cell activation and maturation. Cancer Res 69, 9020-9028 [0097] Rafei M, Wu J H, Annabi B, Lejeune L, Francois M and Galipeau J (2007). A GMCSF and IL-15 fusokine leads to paradoxical immunosuppression in vivo via asymmetrical JAK/STAT signaling through the IL-15 receptor complex. Blood 109, 2234-2242 [0098] Rafei M, Hsieh J, Zehntner S, Li M, Forner K, Birman E, Boivin M N, Young Y K, Perreault C and Galipeau J. (2009a). A granulocyte-macrophage colony-stimulating factor and interleukin-15 fusokine induces a regulatory B cell population with immune suppressive properties. Nat Med 15, 1038-1045 [0099] Rafei M, Campeau P M, Wu J H, Birman E, Forner K, Boivin M N and Galipeau J. (2009b) Selective inhibition of CCR2 expressing lymphomyeloid cells in experimental autoimmune encephalomyelitis by a GM-CSF-MCP1 fusokine. J Immunol. 182, 2620-7. [0100] Rafei M, Berchiche YA, Birman E, Boivin M N, Young Y K, Wu J H, Heveker N, and Galipeau J. (2009c) An engineered GM-CSF-CCL2 fusokine is a potent inhibitor of CCR2-driven inflammation as demonstrated in a murine model of inflammatory arthritis. J Immunol. 183, 1759-66. [0101] Rafei M, Deng J, Boivin MN, Williams P, Matulis S M, Yuan S, Birman E, Forner K, Yuan L, Castellino C, Boise L H, MacDonald T J and Galipeau J. (2011) A MCP1 fusokine with CCR2-specific tumoricidal activity. Mol Cancer. 10:121. doi: 10.1186/1476-4598-10-121. [0102] Shaw M H, Kamada N, Kim YG and Núñez G. (2012) Microbiota-induced IL-1β, but not IL-6, is critical for the development of steady-state TH17 cells in the intestine. J Exp Med. 209, 251-8. [0103] Singh S P, Zhang H H, Foley J F, Hedrick M N and Farber J M. (2008) Human T cells that are able to produce IL-17 express the chemokine receptor CCR6. J Immunol. 180, 214-21. [0104] Scatchard G. (1949). Ann New York Acad Sci 51, 660-72. [0105] Stagg J, Wu J H, Bouganim N and Galipeau J. (2004). Granulocyte-macrophage colony-stimulating factor and interleukin-2 fusion cDNA for cancer gene immunotherapy. Cancer Res 64, 8795-8799 [0106] Sun P D & Davies D R. (1995). The cystine-knot growth-factor superfamily. Annual review of biophysics and biomolecular structure 24, 269-91. [0107] Sutton C, Brereton C, Keogh B, Mills K H and Lavelle E C. (2006). A crucial role for interleukin (IL)-1 in the induction of IL-17-producing T cells that mediate autoimmune encephalomyelitis. J Exp Med. 203, 1685-91. [0108] Weber H, Valenzuela D, Lujber G, Gubler M and Weissmann C. (1987). Single amino acid changes that render human IFN-alpha 2 biologically active on mouse cells. EMBO J. 6, 591-8. [0109] Williams P, Bouchentouf M, Rafei M, Romieu-Mourez R, Hsieh J, Boivin M N, Yuan S, Forner K A, Birman E and Galipeau J. (2010a). A dendritic cell population generated by a fusion of GM-CSF and IL-21 induces tumor-antigen-specific immunity. J Immunol. 185, 7358-66. [0110] Williams P, Rafei M, Bouchentouf M, Raven J, Yuan S, Cuerquis J, Forner K A, Birman E and Galipeau J. (2010b). A fusion of GMCSF and IL-21 initiates hypersignaling through the IL-21Ralpha chain with immune activating and tumoricidal effects in vivo. Mol Ther 18, 1293-1301. [0111] Ye P, Rodriguez F H, Kanaly S, Stocking K L, Schurr J, Schwarzenberger P, Oliver P, Huang W, Zhang P, Zhang J, Shellito J E, Bagby G J, Nelson S, Charrier K, Peschon J J and Kolls J K. (2001). Requirement of interleukin 17 receptor signaling for lung CXC chemokine and granulocyte colony-stimulating factor expression, neutrophil recruitment, and host defense. J Exp Med. 194, 519-27.