METHOD FOR PRODUCING RNA
20230053382 · 2023-02-23
Assignee
Inventors
- Florian VON DER MÜLBE (Stuttgart, DE)
- Ladislaus REIDEL (Rottenburg am Neckar, DE)
- Thomas KETTERER (Gomaringen, DE)
- Lilia GONTCHAROVA (Reutlingen, DE)
- Susanne BAUER (Bodelshausen, DE)
- Steve PASCOLO (Zurich, CH)
- Jochen Probst (Wolfschlugen, DE)
- Andreas SCHMID (Sigmaringen, DE)
Cpc classification
C12N15/1003
CHEMISTRY; METALLURGY
International classification
C12N15/10
CHEMISTRY; METALLURGY
Abstract
The present invention relates to a method for producing RNA. In particular, the present invention relates to a method for producing RNA, which is scalable and provides RNA at a high purity. The present invention provides a method for producing RNA under GMP and/or cGMP-compliant conditions. The invention further provides specific processes for use as a quality control in the manufacturing of a template DNA and/or in a method for producing RNA, in particular by in vitro transcription.
Claims
1. A method for producing purified RNA comprising the following steps: a) providing a linearized plasmid template DNA comprising a nucleic acid sequence encoding a RNA sequence, said RNA sequence comprising a 5′ untranslated region (UTR), an open reading frame, a 3′ UTR and a poly(A) sequence, wherein the linearized plasmid DNA has been purified by chromatography and/or filtration, wherein the following steps are used to control the quality of the template DNA provided in step a): I) determining the concentration of the template DNA in a sample; II) determining the integrity of the template DNA; III) determining the identity of the template DNA; and IV) determining the purity of the template DNA by determining in a sample comprising the template DNA: the presence of endotoxin; and the presence of bacterial DNA; b) in vitro transcribing the template DNA in the presence of a cap analog in order to obtain a composition comprising capped RNA; c) treating the composition with a DNase; d) purifying the RNA by at least one step of chromatography or filtration to obtain purified RNA, wherein the following steps are used to assess the quality of the purified RNA obtained in step d): i) determining the concentration of the purified RNA in a sample; ii) determining the integrity of the purified RNA; iii) determining the identity of the purified RNA, by reverse transcription (RT)-PCR using the RNA as a template; iv) determining the purity of the purified RNA, by determining in a sample comprising the RNA the presence of endotoxin; and the presence of plasmid DNA; v) determining the poly(A) length of the purified RNA; and vi) determining the pH of a sample comprising the purified RNA.
2. The method of claim 1, wherein determining the poly(A) length of the purified RNA comprises a PCR assay.
3. The method of claim 1, wherein the following steps are used to control the quality of the template DNA provided in step a): I) determining the concentration of the template DNA in a sample; II) determining the integrity of the template DNA; III) determining the identity of the template DNA; and IV) determining the purity of the template DNA by determining in a sample comprising the template DNA: the presence of RNA; the presence of protein; the presence of endotoxin; and the presence of bacterial DNA.
4. The method of claim 1, wherein a) providing the linearized plasmid template DNA, comprises obtaining a plasmid DNA; and linearizing the molecule with an endonuclease.
5. The method of claim 1, wherein a) providing the linearized plasmid template DNA, comprises obtaining a plasmid DNA; purifying the plasmid DNA by chromatography and/or filtration; and linearizing the DNA molecule with an endonuclease.
6. The method of claim 5, wherein a) providing the linearized plasmid template DNA, comprises obtaining a plasmid DNA; purifying the plasmid DNA by chromatography and filtration; and linearizing the DNA molecule with an endonuclease.
7. The method of claim 1, further comprising, prior to step a) culturing bacteria comprising the plasmid DNA under selective conditions; isolating the template DNA from the bacteria and linearizing the DNA molecule with an endonuclease.
8. The method of claim 1, wherein the concentration of the template DNA provided in step a) is determined by photometric measurement.
9. The method of claim 1, wherein the poly(A) sequence is 50 to 300 adenine nucleotides.
10. The method of claim 1, wherein the DNase is DNase I.
11. The method of claim 1, wherein determining the poly(A) length of the RNA or the purified RNA comprises a PCR assay.
12. The method of claim 1, wherein b) in vitro transcribing the template DNA is in a reaction mixture that includes a cap analog, T7 polymerase, spermidine, an RNAse inhibitor and a HEPES buffer.
13. The method of claim 12, wherein b) in vitro transcribing the template DNA is in a reaction mixture that includes a cap analog and GTP in a ratio of about 10:1 to 1:1 (cap analog:GTP).
14. The method of claim 1, wherein b) in vitro transcribing the template DNA is in a reaction mixture that includes a modified nucleotide.
15. The method of claim 14, wherein the modified nucleotide is 1-methyl-pseudouridine.
16. The method of claim 1, further comprising determining the presence of bacterial DNA the RNA or the purified RNA.
17. The method of claim 1, wherein ii) determining the integrity of the purified RNA comprises a capillary gel electrophoresis assay.
18. A method for producing purified RNA comprising the following steps: a) providing a linearized plasmid template DNA comprising a nucleic acid sequence encoding a RNA sequence, said RNA sequence comprising a 5′ untranslated region (UTR), an open reading frame, a 3′ UTR and a poly(A) sequence, wherein the linearized plasmid DNA has been purified by chromatography and/or filtration, and wherein the following steps are used to control the quality of the template DNA provided in step a): I) determining the concentration of the template DNA in a sample; II) determining the integrity of the template DNA; III) determining the identity of the template DNA; and IV) determining the purity of the template DNA by determining in a sample comprising the template DNA: the presence of RNA; the presence of protein; the presence of endotoxin; and the presence of bacterial DNA; b) in vitro transcribing the template DNA to obtain a composition comprising RNA; c) treating the composition with a DNase; d) purifying the RNA by at least one step of chromatography or filtration to obtain purified RNA, wherein the following steps are used to assess the quality of the RNA obtained in step b) or the purified RNA obtained in step d): i) determining the concentration of the RNA or the purified RNA in a sample; ii) determining the integrity of the RNA or the purified RNA; iii) determining the identity of the RNA or the purified RNA, by reverse transcription (RT)-PCR using the RNA as a template; iv) determining the purity of the RNA or the purified RNA, by determining in a sample comprising the RNA the presence of endotoxin; and the presence of plasmid DNA; and v) determining the pH of a sample comprising the RNA or the purified RNA.
19. The method of claim 18, wherein a) providing the linearized plasmid template DNA, comprises obtaining a plasmid DNA; and linearizing the molecule with an endonuclease.
20. The method of claim 19, wherein a) providing the linearized plasmid template DNA, comprises obtaining a plasmid DNA; purifying the plasmid DNA by chromatography and filtration; and linearizing the DNA molecule with an endonuclease.
21. The method of claim 18, further comprising, prior to step a) culturing bacteria comprising the plasmid DNA under selective conditions; isolating the template DNA from the bacteria and linearizing the DNA molecule with an endonuclease.
22. The method of claim 18, wherein the concentration of the template DNA provided in step a) is determined by photometric measurement.
23. The method of claim 18, wherein the poly(A) sequence is 50 to 300 adenine nucleotides.
24. The method of claim 18, wherein step b) comprising in vitro transcribing the template DNA in a reaction mixture that includes a cap analog in order to obtain a composition comprising capped RNA.
25. The method of claim 18, wherein b) in vitro transcribing the template DNA is in a reaction mixture that includes a modified nucleotide.
26. The method of claim 25, wherein the modified nucleotide is 1-methyl-pseudouridine.
27. The method of claim 18, wherein step wherein step b) comprises a step of enzymatically capping the RNA.
28. The method of claim 18, further comprising determining the poly(A) length of the RNA or the purified RNA.
29. The method of claim 28, wherein determining the poly(A) length of the RNA or the purified RNA comprises a PCR assay.
30. The method of claim 18, further comprising determining the presence of bacterial DNA the RNA or the purified RNA.
Description
BRIEF DESCRIPTION OF THE FIGURES
[0620] The figures shown in the following are merely illustrative and shall describe the present invention in a further way. These figures shall not be construed to limit the present invention thereto.
[0621] Figures:
[0622]
[0623]
[0624]
[0625]
[0626]
[0627]
[0628]
[0629]
[0630]
[0631]
[0632]
[0633]
[0634]
[0635]
[0636]
[0637]
[0638]
EXAMPLES
[0639] The Examples shown in the following are merely illustrative and shall describe the present invention in a further way. These Examples shall not be construed to limit the present invention thereto.
Example 1: Sequence of the Template DNA Plasmid
[0640] P0624 (P0624-pCV26-HsKLK3(GC)-muag-A64-N5-C30-histoneSL-N5) was used for RNA production. The Figures illustrate the respective plasmid map (
Example 2: Restriction Analysis of the Initial Plasmid DNA (OK 1-1)
[0641] The identity and quality of the initial plasmid DNA was analyzed using restriction digest. Restriction analysis with one single restriction enzyme (HindIII, SpeI and EcoRI): [0642] 1 μl plasmid DNA (1.2 g/l) [0643] 1.5 μl 10× reaction buffer [0644] 1 μl restriction enzyme (1 U/μl) [0645] 11.5 μl WFI (water for injection)
[0646] The reaction mix was incubated for 2 h at 37° C.
[0647] Restriction analysis with two restriction enzymes (HindIII and SpeI, BsrGI and NsiI, BsrGI and HindIII): [0648] 1 μl plasmid DNA (1.2 g/l) [0649] 1.5 μl 10× reaction buffer [0650] 1 μl restriction enzyme 1 (1 U/μl) [0651] 1 μl restriction enzyme 2 (1 U/μl) [0652] 10.5 μl WFI (water for injection)
[0653] The reaction mix was incubated for 2 h at 37° C.
TABLE-US-00005 TABLE 1 Performed restriction enzyme with respective expected band sizes as indicated Restriction endonuclease Expected band size [bp] HindIII 3040 SpeI 3040 EcoRI 3040 HindIII and Spe I 2243 and 797 BsrGI and NsiI 2837 and 733 BsrGI and HindIII 2307 and 733
[0654] Agarose Gelelectrophoresis:
[0655] Samples were prepared for agarose gelelectrophoresis by adding 3 μl of DNA loading dye (6×Orange DNA Loading Dye)to each reaction. Band-separation occurred using a common agarose gelelectrophoresis method. An agarose gel was prepared comprising 0.8 g agarose in 100 ml 1×TBE buffer and 3 μl ethidium bromide. As running buffer, 1×TBE buffer was used. The results are shown in
[0656] Results:
[0657] The observed band pattern was in accordance to the theoretically expected pattern (see Table 1).
Example 3: Sequencing of the RNA Coding Region on the Plasmid DNA (QK3-4)
[0658] The RNA coding region in the initial plasmid DNA obtained was sequenced with an AB13130XL sequencer, using M13-universal primer: 5′-CGCCAGGGTTTTCCCAGTCACGAC (SEQ ID NO: 7) and suitable sequence specific primers.
[0659] Results:
[0660] 3′-UTR: sequence correct
[0661] ORF: sequence correct
[0662] 5′-UTR: sequence correct
Example 4: Transformation
[0663] Heat-Shock Transformation
[0664] For amplification of plasmid DNA in bacteria, the chemically competent bacteria cells (Escherichia coli DH5α) were defrosted in the fridge (4° C.). After defrosting, 4 ng of the plasmid DNA solution (P0624, pCV26, insert HsKLK3sl(GC), SEQ ID NO: 1) were added to 50 μl of the competent cells, mixed gently, and incubated for 30 minutes at 4° C. Then, cells were heat-shocked for 20 seconds at 42° C. Following heat shock, cells were put back to 4° C. for 2 minutes. Then, 900 μl pre-warmed (37° C.) LB-bouillon medium without antibiotics was added to the cells and incubated for 1 hour at 37° C. in a shaking incubator (170 rpm).
[0665] Then, 10 μl, 100 μl and 800 μl of the sample were plated on LB agar plates containing 100 μg/ml ampicillin and incubated for 16 hours at 37° C. The number of bacterial colonies was counted on each plate (see Table 2). Moreover, plates were inspected for contaminations (e.g., colony shape, colony color, smell).
[0666] Results:
TABLE-US-00006 TABLE 2 Manual inspection of agar plates Volume of plated cells Number of colonies Contaminations 10 μl 3 NO 100 μl 64 NO 800 μl 270 NO
Example 5: Fermentation
[0667] Inoculation of First Pre-Culture
[0668] One bacterial colony of the transformation (see example above) was picked and used to inoculate 5 ml LB-Bouillon containing 100 μg/ml ampicillin as an antibiotic. The first pre-culture was incubated in a 37° C. shaking incubator (170 rpm) for 16 hours.
[0669] Inoculation of a Second Pre-Culture
[0670] 1 ml of the first pre-culture (OD.sub.600=3.64) was used to inoculate a larger second 50 ml pre-culture and incubated in a 37° C. shaking incubator for 7 hours. 2 ml of the culture were used for determination of cell-density (OD.sub.600=2.52).
[0671] Fermentation Process
[0672] 48 ml of the second pre-culture were used to inoculate 81 LB medium comprising ampicillin (100 μg/ml) at 37° C. To obtain optimal bacteria growth, feeding solution (LB medium comprising ampicillin (100 μg/ml) with 2% glucose) was constantly fed into the fermenter tank. During fermentation, standard parameters were precisely regulated and continuously monitored (e.g. pH: 7.0, temperature: 37° C.). The cell density was controlled by photometric determination at 600 nm. The fermentation procedure was stopped after 21 hours of incubation time. The final volume of the culture was determined to be 11950 ml, with a cellular density of OD.sub.600=4.66. After fermentation, 1 ml of the culture was taken for quality control and cells were centrifuged at 11,000 rcf at room temperature for 2 minutes. The supernatant was discarded and the cell pellet was stored at −20° C.
[0673] Cell Harvest
[0674] 11950 ml of bacterial culture (OD600=4.66) were split into 7 different batches (approximately 1707 ml per batch). The bacterial culture batches were spun down at 6000 g for 15 minutes at room temperature, the supernatant was discarded and the cell pellet was frozen at −20° C.
Example 6: Plasmid Preparation (Mini-Preparation)
[0675] The mini-preparation was performed using a Mini Plasmid Kit according to the manufacturer's instructions. Following that, the content of dsDNA was determined. The value was used to estimate the total amount of dsDNA produced during the fermentation.
[0676] Photometric Determination of the dsDNA Content:
[0677] The concentration of the isolated plasmid DNA (dsDNA) was determined by a standard photometric method for nucleic acids via measurement of the absorption at 260 nm (OD260). Measurements were performed in triplicates.
[0678] Results:
TABLE-US-00007 TABLE 3 Values of the photometric determination of dsDNA in the pDNA sample value 1 value 2 value 3 average Sample [μg/μl dsDNA] [μg/μl dsDNA] [μg/μl dsDNA] [μg/μl dsDNA] Plasmid 0.1915 0.1923 0.2024 0.1954 DNA sample
[0679] Calculation of the Total Yield of the Fermentation Process:
0.1954 μg/μl*50 μl (volume of plasmid DNA preparation)=9.77 μg
[0680] The culture volume used for the mini preparation was 1 ml. Therefore, 1 ml of bacterial culture contained 9.77 μg plasmid DNA. The expected total plasmid DNA yield of the whole fermentation culture (11.950 ml) is therefore 116752 μg plasmid DNA.
Example 7: Restriction Analysis of the Plasmid DNA Obtained from the Miniprep
[0681] To analyze the plasmid DNA obtained from the mini preparation (see example above), a test digest using suitable restriction endonucleases was performed according to Example 2.
[0682] Results:
[0683] The obtained band pattern was in accordance to the theoretically expected pattern (see
Example 8: Plasmid Giga Preparation
[0684] The giga-preparation was performed using an Endotoxin-free plasmid DNA purification kit according to the manufacturer's instructions.
Example 9: Determination of the Plasmid DNA Concentration and OD260/280 (QK3-1)
[0685] Plasmid DNA concentration (dsDNA) of the DNA sample obtained from the giga preparation was determined photometrically according to Example 6. The measurements were performed in triplicates. Moreover, the OD 260/280 value was determined, which is a measure for nucleic acid purity.
[0686] Results:
TABLE-US-00008 TABLE 4 Values of the photometric determination of dsDNA in the pDNA sample value 1 value 2 value 3 average Sample [μg/μl dsDNA] [μg/μl dsDNA] [μg/μl dsDNA] [μg/μl dsDNA] Plasmid 1.0464 1.1077 1.0789 1.08 DNA
TABLE-US-00009 TABLE 5 Values of the photometric determination of OD .sub.260/280. value 1 value 2 value 3 Sample [OD .sub.260/280] [OD .sub.260/280] [OD .sub.260/280] average Plasmid DNA 1.81 1.82 1.81 1.81
[0687] The concentration of the plasmid DNA preparation was determined to be 1.08 μg/μl. The total yield of the giga-preperation was 30.24 mg.
[0688] Moreover, the OD 260/280 value was determined to be 1.81.
Example 10: Determination of RNA Contamination using RNAse Treatment
[0689] Plasmid DNA was checked for RNA contamination. Therefore the plasmid DNA was incubated with RNase A. Afterwards the concentration of the purified plasmid DNA was determined again and the difference before and after RNase treatment was calculated.
[0690] Therefore a sample of the plasmid DNA solution obtained from the giga preparation was adjusted to a concentration of 0.4 g/l. Following that, the DNA concentration was determined (dsDNA) photometrically according to Example 6 The measurements were performed in triplicates.
[0691] Following that, 38 μl of the plasmid DNA solution were incubated with 1 μl RNase A (1 g/l) and incubated for 1 h at 37° C. The RNAse treated solution was then added on a Sephadex-column to separate nucleotides. After centrifugation at 2000 rpm for 2 minutes, the eluate was used for photometric determination of the DNA content at 260 nm according to Example 6. The values before and after RNAse treatment were used to calculate the percentage of DNA in the sample:
[0692] Calculation of the percentage of plasmid DNA contained in the plasmid preparation:
[0693] Results:
TABLE-US-00010 TABLE 6 Results of the photometric DNA determination The dsDNA values (in triplicates) are indicated before and after treatment with RNase A. The percentage of plasmid DNA was calculated. value 1 value 2 value 3 Sample [μg/μl dsDNA] [μg/μl dsDNA] [μg/μl dsDNA] average Before 0.4262 0.4190 0.4095 0.4182 RNase treatment After 0.3921 0.3476 0.3727 0.3708 RNase treatment. Percentage plasmid DNA: 88.66%
[0694] The percentage of plasmid DNA was 88.66%.
Example 11: Test Restriction Digestion of pDNA
[0695] To analyze the plasmid DNA obtained from the giga-preparation, a test digest using suitable restriction endonucleases was performed according to Example 2 (see Table 1 for expected band sizes and used enzymes;
Example 12: Sequencing of the RNA Coding Region on the Plasmid DNA
[0696] The RNA coding region in the plasmid DNA obtained from the giga preparation was sequenced with an AB13130XL sequencer, using M13-universal primer: 5′-CGCCAGGGTTTTCCCAGTCACGAC (SEQ ID NO: 7).
[0697] Results:
[0698] 3′-UTR: sequence correct
[0699] ORF: sequence correct
[0700] 5′-UTR: sequence correct
Example 13: Determination of the Bacterial Endotoxin Level in the Plasmid DNA Solution
[0701] Plasmid DNA solution (0.5 g/l) was analysed for bacterial endotoxin content (expressed as endotoxin units, EU) using the LAL-test (kinetic-turbidimetric method) according to Ph. Eur., 7th Edition, 2.6.14.
[0702] Result:
[0703] The endotoxin value of the plasmid DNA solution was determined to be <0.2 EU/ml.
Example 14: Determination of Protein Contamination in the Plasmid DNA Solution
[0704] To determine the protein contamination in the plasmid DNA, a commercially available Bradford test and/or BCA-test was used. The test was performed according to the manufacturer's instructions.
[0705] Photometric Determination of Protein Contamination:
[0706] The measurements were performed in a standard photometer, using UV cuvettes. The measurements were performed in dublicates per sample (standards and plasmid DNA sample) at 595 nm (Bradford) or 562 nm (BCA). The protein concentration in the plasmid DNA sample was determined using a BSA standard curve.
[0707] Results:
TABLE-US-00011 TABLE 7 Results of the OD measurement of the plasmid DNA. OD Sample Plasmid DNA OD OD OD average dilution C protein probe Value 1 Value 2 average corrected factor [μg/ml] 0 0.262 0.187 0.225 0.056 1 1.6
[0708] The respective OD value of the plasmid DNA sample was determined twice, and an average was calculated. The OD value was used to determine the protein contamination in the sample, using a standard curve.
[0709] The protein contamination in the plasmid DNA sample was determined to be 1.6 μg/ml.
Example 15: Determination of the Bioburden in the Plasmid DNA Sample using a Plate Count Method
[0710] For determination of the bioburden, the presence of bacteria was tested under aerobic or anaerobic conditions after plating the plasmid DNA on agar and glucose plates and incubating the plates for 5 and 7 days, using a plate count method (according to PhEur 2.6.12.).
[0711] The bioburden is typically monitored by counting the growth of bacteria clones/colonies (colonie forming units (CFU)) on bacteria agar plates over a certain timespan. For this purpose, soybean casein digest agar (CSA) and sabouraud glucose (2%) agar plates were prepared. 100 μl of plasmid DNA were plated on respective agar plates under sterile conditions and incubated at approximately 22° C. (SG, Sabouraud Glucose plates) or at 32° C. under aerobic or anaerobic conditions (CSA plates).
[0712] Results:
TABLE-US-00012 TABLE 8 Results of the plate count assay Day 2 Day 5 Day 6 Day 7 CFU CFU CFU CFU Plate ID 1 2 2 Plate ID 2 9 14 Plate ID 3 1 1 1
[0713] The plate count assay resulted in the indicated numbers of CFUs.
[0714] In total, 17 CFUs were counted after plating 100 μl of plasmid DNA solution on the respective agar plates, grown under conditions explained above
[0715] The bioburden of the plasmid DNA solution was therefore 1.7 CFU/ml.
Example 16: Determination of Residual E. coli DNA by Quantitative PCR
[0716] Quantitative PCR was performed to determine the contamination with genomic Escherichia coli DNA. For this purpose the E. coli specific gene uidA was amplified and quantified using a LightCycler qPCR thermocycle (Roche).
[0717] The following probes and primers were used in the experiment:
TABLE-US-00013 (SEQ ID NO: 8) Primer EC 679U: GGACAAGGCACTAGCG (SEQ ID NO: 9) Primer EC 973 L: ATGCGAGGTACGGTAGGA (SEQ ID NO: 10) Probe EC1 FL: CATCCGGTCAGTGGCAGT-FL (SEQ ID NO: 11) Probe EC1 LC: LC640-AAGGGCGAACAGTTCCTGA-ph
[0718] Results:
[0719] The quantitative PCR determined an E. coli copy number of 281 in 10 pg of the plasmid DNA preparation. This results in an E. coli copy number of 28.1 per pg plasmid DNA.
Example 17: Linearization of the Plasmid DNA
[0720] To generate a linear template DNA for enzymatic RNA in vitro transcription, plasmid DNA obtained by giga-preparation (see Example 8) was linearized using restriction endonuclease EcoRI.
[0721] Plasmid DNA Linearization:
[0722] 27.5 ml plasmid DNA [1.08 mg/ml], 9 ml EcoRI restriction enzyme [10 U/μl], 15 ml 10× restriction buffer and 98.5 ml WFI (water for injection) were mixed and divided evenly into 6 reactions. The reactions were incubated for 4 hours at 37° C.
[0723] Plasmid DNA Extraction
[0724] 17.5 ml phenol/chloroform/isoamylalcohol (25/24/1) were added to each reaction and mixed by vortexing for 5 minutes. Subsequently, the reactions were centrifuged at 3000 rcf at 10° C. for 10 minutes. The upper aqueous phase of the reaction was carefully transferred to a new reaction tube.
[0725] Plasmid DNA Precipitation
[0726] 17.5 ml isopropyl alcohol was added to each reaction, mixed by vortexing for 10 seconds, and centrifuged for 60 minutes at 3000 rcf. The supernatant was discarded. DNA pellets were washed with 10 ml ethanol (75%) for 10 minutes at 3000 rcf. After discarding the supernatant, the pellets were centrifuged again (1 minute) and residual ethanol was carefully removed with a pipette.
[0727] Re-Suspension of DNA
[0728] DNA pellets were dissolved in 5 ml WFI each. The six separate samples were pooled and used for photometric determination of dsDNA via measurement of the absorption at 260 nm (OD260) (final volume: 30 ml).
TABLE-US-00014 TABLE 9 Photometric determination of the dsDNA content value 1 value 2 value 3 average [μg/μl [μg/μl [μg/μl [μg/μl Sample dsDNA] dsDNA] dsDNA] dsDNA] linearized 0.77 0.77 0.76 0.767 DNA
[0729] The total amount of linearized dsDNA was (0,767 mg/ml * 30 ml) =23.01 mg.
Example 18: Determination of the Linearization Quality via Agarose Gelelectrophoresis
[0730] To analyze the quality of the restriction digest, linearized template DNA was analyzed via agarose gel electrophoresis. The result is shown in
[0731] Result: A complete linearization of the plasmid DNA could be detected by agarose gelelectrophoresis.
Example 19: Test for RNase Contamination of the Linear DNA Template
[0732] To test the obtained linear DNA template for RNase contamination, a reference RNA molecule was incubated with the linear DNA template.
[0733] 2 μl RNA reference (RNA R488, expected size 507 bases) were incubated with 6 μl linear DNA (concentration adjusted to 0.5 g/l), and 2 μl RNA reference with 6 μl WFI as a negative control were incubated for 1 hour at 37° C.
[0734] Subsequently, the samples were analyzed using RNA gel electrophoresis.
[0735] RNA Agarose Gel Electrophoresis:
[0736] A 50 ml RNA gel (1.2%) was prepared to determine the presence of the reference RNA. 0.6 g agarose and 5 ml 10× MOPS buffer (20 mM EDTA, 200 mM MOPS, 50 mM sodium acetate pH 7.0) were added to 45 ml water and incubated at 65° C. for 15 minutes. After agarose had been completely dissolved, 0.9 mL formaldehyde solution (37%) were added, and the liquid was poured into a horizontal gel-chamber. After the gel solidified, RNA running buffer was added to the gel chamber (1× MOPS buffer, 0.74% formaldehyde).
[0737] The RNA samples and 10 μl of an RNA size ladder (500-6000b; single RNAs in the size of 492, 742, 992, 1490, 1992, 2991, 3964, and 6001 b, 1 μg/ml) were substituted with 2 μl gel loading buffer and were run on the agarose gel (
[0738] Results:
TABLE-US-00015 TABLE 10 Summary and analysis of the test for RNA contamination Integrity values Integrity of RNA incubated with DNA (IN.sub.P) 84.0% Integrity of RNA negative control (IN.sub.C) 89.2% Relative Difference (IN.sub.P − IN.sub.C)/IN.sub.C 5.8% Specific length Specific length of the RNA, incubated with DNA (SL.sub.P) −0.03 Specific length of RNA negative control (SL.sub.C) −0.04 Absolute Difference (SL.sub.P − SL.sub.C) 0.01
[0739] The incubation of a reference RNA with the linear plasmid DNA resulted in an integrity of 84% compared to an integrity of 89.2% of the control RNA and therefore was applicable for in vitro transcription.
Example 20: Large-Scale RNA In Vitro Transcription
[0740] A large scale in vitro RNA transcription reaction using the linear template DNA was conducted.
[0741] RNA In Vitro Transcription
[0742] 29.7 ml linear template DNA [0.77 g/l], 92 ml Cap/NTP-mix (20 mM ATP, 20 mM CTP, 20 mM UTP, 7.25 mM GTP, 29 mM m7G(5′)ppp(5′)G-Cap-analog, 92 ml 5× transcription buffer (containing 400 mM HEPES, 120 mM MgCl.sub.2, 10 mM spermidine, 200 mM DTT, 25 U/ml inorganic pyrophosphatase), 2.3 ml RNase inhibitor [40 U/μl], 11.5 ml T7 RNA polymerase [200 U/μl] and 232.5 ml WFI were gently mixed and divided to 36 different 50 ml reaction tubes. The reactions were incubated at 37° C.
[0743] DNA Template Removal: DNase I Treatment
[0744] To digest DNA template, 3.83 ml DNase I [1 U/μl] and 127 μl 0.1M CaCl.sub.2 were added to each reaction tube (36 reactions in total) and incubated at 37° C.
[0745] Precipitation of RNA
[0746] After DNase digest, 15.33 ml WFI and 15.97 ml 8M LiCl.sub.2 were added to the reaction and well mixed via vortexing for 15 seconds. The 36 reactions were incubated over night at −20° C. and subsequently centrifuged at 4° C. The supernatant was discarded, and the RNA pellets were washed with 10 ml 75% ethanol and centrifuged for 10 minutes at 4° C. The supernatant was discarded, and the RNA pellets were again washed with 10 ml 75% ethanol and centrifuged for 1 minute. After discarding the supernatant, the remaining ethanol was carefully removed with a pipette. Following that, the RNA pellets were dried at room temperature.
[0747] Re-Suspension of RNA
[0748] Each dried RNA pellet was re-suspended in 10 ml WFI. Following that, the 36 reactions were pooled. The RNA concentration of the sample was determined photometrically (Table 11).
[0749] Results:
TABLE-US-00016 value 1 value 2 value 3 average Sample [μg/μl RNA] [μg/μl RNA] [μg/μl RNA] [μg/μl RNA] RNA 2.1 2.1 2.1 2.1
[0750] Table 11: Photometric Determination of the RNA Concentration
[0751] Measurements were performed in triplicates, and average was calculated.
[0752] The RNA concentration of the solution was determined to be 2.1 μg/μl. Therefore, the total yield of the large-scale RNA in vitro transcription (360 ml volume) reaction was 756 mg.
Example 21: Analysis of the In Vitro Transcribed RNA (Large-Scale Reaction) by Agarose Gel Electrophoresis
[0753] The size and the band uniqueness of the in vitro transcribed RNA were determined by performing RNA agarose gel electrophoresis according to Example 19).
[0754] Result:
[0755] The determined RNA length was in accordance with the expected length (see
Example 22: Preparative HPLC Purification of In Vitro Transcribed RNA
[0756] The in vitro transcribed RNA was purified by a size-selective HPLC based technique as described in WO2008077592. The purified RNA was concentrated by alcohol precipitation and re-suspended in water for injection. The concentration of the RNA was determined by photometry.
[0757] Preparative HPLC:
[0758] A porous, nonalkylated polystyrene/divinylbenzene (polystyrenedivinylbenzene) matrix was used (PLRP-S 4000 Å 8 μm 50×25 mm column) as a stationary phase. The column had a particle size of 8 μm and a pore size of 4000 Å.
[0759] The eluent buffers, eluent A (100 mM triethylammonium acetate in WFI, pH 7.0) and eluent B (100 mM Triethylammoniumacetat in 25% acetonitrile, pH 7.0), were de-gassed with helium.
[0760] 360 ml of a 2.1 mg/ml RNA solution obtained from the large-scale in vitro RNA transcription and 40 ml of 1M triethylammonium acetate (TEAA) were mixed. The RNA was step-wise purified and fractionated. The HPLC fractions were collected, and the product-containing fractions (fractions 1-5 in
[0761] Detection proceeded with an UV detector at 254 nm with a reference measurement at 600 nm.
[0762] Pool 1: fraction 1
[0763] Pool 2: fraction 2-3
[0764] Pool 3: fraction 4-5
[0765] All 3 product pools were used for precipitation, freeze-drying (lyophilization) and subsequent quality controls.
[0766] The RNA lyophilisate was re-suspended in WFI to obtain a final RNA concentration of approximately 5.0 g/l. Following that, RNA solution was sterile-filtered.
[0767] Determination of the RNA Concentration:
[0768] The RNA concentration of the RNA was determined photometrically according to Example 20 to be 4.80 g/l. Therefore, the total yield of the large scale in vitro transcription, after purification was 458.4 mg.
[0769] End-Product Controls:
Example 23: RNA Identity Test Using RNase A Treatment
[0770] To determine the identity of the product, 8 μl WFI and 1 μg (1 μg/μl) RNA were treated with 1 μl RNase A (10 μg/μl). Additionally, one untreated control was prepared (1 μl RNA (1 μg/μl and 9 μl WFI). Both reactions were incubated for 1 h at 37° C. and subsequently analyzed via conventional RNA gel electrophoresis according to Example 21.
[0771] The results are shown in
[0772] Results:
[0773] As can be seen from
Example 24: RNA Identity Test using RT-PCR
[0774] RNA identity was determined by RT-PCR (Reverse transcription PCR) using M-MuLV Reverse Transcriptase for cDNA generation by reverse transcription and a conventional PCR using gene-specific primers (primer pair I: 204-AS-FW+205-AS-RV; 799-AS-FW and 792-AS-RV).
[0775] Reverse Transcription:
[0776] 2 μl RNA (50 ng/μl) were added to 9 μl WFI and 1 μl oligo dT Primer (dT).sub.18 (5 μmol/μl) and incubated for 5 min at 65° C. in a heating block and subsequently put on ice.
[0777] 4 μl 5×reaction buffer, 1 μl RNase inhibitor (20 U/μl), 2 μl dNTP mix (10 mM) and 1 μl M-MuLV Reverse Transcriptase (200 U/μl) were added, mixed and incubated for 60 min at 42° C. The reaction was stopped by incubation at 70° C. for 5 min. Subsequently, the reaction was cooled on ice.
[0778] PCR:
[0779] 2 μl of the RT reaction were added to 25 μl 2×PCR Master Mix, 5 μl Forward-Primer (5 pmol/μl), 5 μl Reverse-Primer (5 pmol/μl), 11.5 μl WFI and 1.5 μl DMSO (100%).
TABLE-US-00017 Primer Pair I for PCR reaction 1: (SEQ ID NO: 16) Forward-Primer 204-AS-FW: CACTGCATCCGGAACAAG (SEQ ID NO: 17) Reverse-Primer 205-AS-RV: CACGTCGTTGCTGATCAC Primer Pair II for PCR reaction 2: (SEQ ID NO: 18) Forward-Primer 799-AS-FW: CCAGAAGGTGACCAAGTTCA (SEQ ID NO: 19) Reverse-Primer.792-AS-RV: GCTCTGAAAAGAGCCTTTGG
[0780] PCR Program for PCR 1:
TABLE-US-00018 Cycles Temperature Time [min:s] 1 95° C. 2:00 30 95° C. 0:30 55° C. 0:30 72° C. 0:30 72° C. 10:00 1 4° C. ∞
[0781] PCR Program for PCR 2:
TABLE-US-00019 Cycles Temperature Time [min:s] 1 95° C. 2:00 35 95° C. 0:30 55° C. 0:30 72° C. 0:30 72° C. 10:00 1 4° C. ∞
[0782] The results of the PCR reactions were analysed by DNA gel electrophoresis according to Example 2. The results are shown in
[0783] Results:
TABLE-US-00020 PCR reaction 1: expected size: 357 bp determined size: 341 bp PCR reaction 2: expected size: 412 bp determined size: 378 bp
Example 25: RNA Identity and Integrity Test Via RNA-Gel Electrophoresis
[0784] Size, band uniqueness, and integrity of the pure RNA pools was determined by performing RNA agarose gel electrophoresis according to Example 21. Results are shown in Table 12.
TABLE-US-00021 TABLE 12 Results of the RNA agarose gel electrophoresis Additional bands visible? Band Intergity Pure RNA No 82.7
[0785] Results:
[0786] For the pure RNA, no additional band was determined. Moreover band integrity met the quality requirements.
Example 26: Photometric Determination of the RNA Content
[0787] The RNA concentration of the pure RNA sample was again determined photometrically according to Example 20.
[0788] Results:
[0789] The RNA concentration of the pure RNA sample was determined to be 5.1 g/l.
Example 27: Determination of the pH
[0790] Potentiometric determination of the pH content was performed using a commercially available volt-meter according to the European pharmacopedia (PhEur) 2.2.3.
[0791] Results:
[0792] The pH of the RNA solution was determined to be 6.43.
Example 28: Determination of the Osmolality
[0793] The measurement of the osmolality was performed according to European pharmacopedia (PhEur) 2.2.35, using a commercially available osmometer.
[0794] Results:
[0795] The osmolality was determined to be 3.7 mOsmol/kg.
Example 29: Determination of Sterility/Bioburden using a Plating Assay
[0796] For determination of the bioburden the presence of bacteria was tested under aerobe and anaerobe conditions after plating the RNA to agar- and glucose plates and incubation for 5 and 7 days, using a plate count method (according to PhEur 2.6.12.). The -test was performed according to Example 15.
Example 30: Determination of the Endotoxin Content of the Pure RNA
[0797] For determination of the endotoxin levels the LAL-test (kinetic-turbidimetric method) according to Ph. Eur., 7th Edition,2.6.14 .was performed.
[0798] Results:
[0799] The endotoxin-level of the pure RNA was determined to be 0.25 EU/ml.
Example 31: Determination of the Protein Content of the Pure RNA
[0800] The protein content of the pure RNA sample was determined according to Example 14.
[0801] Results:
[0802] The protein content was determined to be 2.4 μg/ml.
Example 32: Determination of Residual Plasmid DNA
[0803] Residual plasmid DNA was detected via quantitative PCR using specific primers and probes for the ampicillin gene hosted in the production vector. Quantitative PCR to determine the contamination with template pDNA was performed using a LightCycler and LightCycler Master Mix (Roche Diagnostics) according to the manufacturer's instructions.
[0804] The following primers and probes were used:
TABLE-US-00022 (SEQ ID NO: 12) Sense-Primer bla13U: GATACCGCGAGACCCAC (SEQ ID NO: 13) Antisense-Primer bla355L: GGAACCGGAGCTGAATG (SEQ ID NO: 14) Probe BL04FL: GCCAGCCGGAAGGGCC-FL (SEQ ID NO: 15) Probe BL04LC: LC Red640-GCGCAGAAGTGGTCCTGCA-Ph
[0805] Results:
[0806] The copy number of pDNA in the RNA was determined to be 2.5 E+03 copies/μg RNA.
Example 33: Determination of Residual Genomic Bacteria DNA
[0807] Residual bacterial genomic DNA was determined according to Example 16.
[0808] Results:
[0809] Genomic DNA of E. coli was undetectable in the RNA sample.
Example 34: Determination of Residual Solvents
[0810] The determination of residual solvents in the RNA was determined using quantitative gas-chromatography with flame ionization detector (GC-FID).
[0811] Results:
TABLE-US-00023 TABLE 13 Residual solvents as detected by quantitative GC. Solvent Detected by GC-FID TEAA 43 ppm Isopropanol <50 ppm Chlorophorm <60 ppm Acetonitrile <40 ppm Phenol <20 ppm