IMMUNOGENIC COMPOSITIONS CONTAINING BACTERIAL OUTER MEMBRANE VESICLES AND THERAPEUTIC USES THEREOF

Abstract

The present invention provides means and products for the stimulation of an immune response against tumors in a subject in need thereof. More specifically the invention provides immunogenic compositions containing bacterial outer membrane vesicles loaded with tumor antigens, fusion proteins comprising a bacterial protein and a tumor antigen, and isolated bacterial outer membrane vesicles (OMVs) containing said fusion proteins. The fusion proteins, OMVs and immunogenic compositions according to the invention are used in the prevention and treatment of tumors.

Claims

1. A fusion protein comprising a bacterial protein and one or more copies of a tumor antigen protein, wherein the bacterial protein is selected from: Factor H Binding Protein (fHbp), Neisseria heparin binding antigen (NHBA), Maltose Binding Protein (MBP), Outer Membrane Protein-F (ompF) and Aggregatibacter actinomycetemcomitans Factor H binding protein (Aa-fHbp).

2. A fusion protein according to claim 1, wherein said fHbp is either full length protein or a Domain A thereof (fHbpDomA).

3. A fusion protein according to claim 1, comprising from 1 to 20 copies of the tumor antigen protein, optionally spaced by a linker sequence.

4. A fusion protein according to claim 1, wherein said bacterial protein is selected from: fHbp, SEQ ID NO:1; fHbpDomA, SEQ ID NO:2; omp-F, SEQ ID NO:3; MBP, SEQ ID NO:4; NHBA, SEQ ID NO:109 and Aa-fHbp, SEQ ID NO:110.

5. A fusion protein according to claim 1, wherein the tumor antigen is linked to the carboxyl terminus of the bacterial protein or, when the bacterial protein is OMP, it is inserted in or replaces an external loop of the protein.

6. A fusion protein according to claim 1, wherein the tumor antigen is selected from hEGFRvIII, hFAT-1 and hMUC-1 and an immunogenic fragment thereof.

7. A fusion protein according to claim 6, wherein the hEGFRvIII immunogenic fragment is LEEKKGNYVVTDH (SEQ ID NO:5).

8. A fusion protein according to claim 6, wherein the hFAT-1 immunogenic fragment is IQVEATDKDLGPNGHVTYSIVTDTD (SEQ ID NO:6).

9. A fusion protein according to claim 6, wherein the hMUC-1 immunogenic fragment is GVTSAPDTRPAPGSTAPPAH (SEQ ID NO:7).

10. A fusion protein according to claim 1, which is selected from the group consisting of SEQ ID NO:8 through SEQ ID NO:25; SEQ ID NO:11 and SEQ ID NO:112.

11. An isolated bacterial outer membrane vesicle comprising a fusion protein according to claim 1, wherein said fusion protein carries one single tumor antigen or the outer membrane vesicle comprises a plurality of fusion proteins carrying different tumor antigens.

12. An isolated bacterial outer membrane vesicle according to claim 11, which is secreted by Escherichia coli.

13. An immunogenic composition comprising a bacterial outer membrane vesicle according to claim 11.

14. An immunogenic composition according to claim 13, comprising a mixture of outer membrane vesicles carrying different tumor antigens.

15. An immunogenic composition according to claim 13, further containing pharmaceutically acceptable adjuvants and excipients.

16. An immunogenic composition according to claim 15, which is in the form of a cancer vaccine.

17. A method of stimulating an immune response against tumor in a subject in need thereof with an isolated bacterial outer membrane vesicle comprising a fusion protein comprising a bacterial protein and one or more copies of a tumor antigen protein, wherein the bacterial protein is selected from: Factor H Binding Protein (fHbp), Neisseria heparin binding antigen (NHBA), Maltose Binding Protein (MBP), Outer Membrane Protein-F (ompF) and Aggregatibacter actinomycetemcomitans Factor H binding protein (Aa-fHbp); or an immunogenic composition comprising said bacterial protein; a cancer vaccine containing said immunogenic composition, said method comprising administering to said subject in need thereof an immunological effective amount of said isolated bacterial outer membrane, of said immunogenic composition or of said cancer vaccine.

18. Method of treating or preventing tumors in a subject in need thereof, said method comprising administering to said subject an immunological effective amount of an isolated bacterial outer membrane vesicle or an immunogenic composition or a cancer vaccine according to claim 17.

19. Method of claim 18 wherein said tumors is selected from breast, brain, head-and-neck, non-small cell lung, renal, ovarian, kidney, stomach, prostate and colon cancer, oral cancer, astrocytoma, glioblastoma, ductal carcinoma, cholangiocarcinoma, hepatocarcinoma, acute myeloid leukemia, acute lymphoblastic leukemia, melanoma and pancreatic cancer.

Description

DESCRIPTION OF THE FIGURES

[0106] FIG. 1. Strategies for decorating bacterial OMVs with the EGFRvIII peptide. (A) A peptide containing one or three copies of EGFRvIII is fused to the C-terminus of factor H binding protein (fHbp) from N. meningitidis MC58. (B) A peptide containing one or three copies of EGFRvIII is fused to the C-terminus of a truncated form of fHbp, lacking domains B and C (fHbpDomA). (C) A peptide containing one or three copies of EGFRvIII replaces one of OmpF external loops. (D) A peptide containing one copy of EGFRvIII is fused to the C-terminus of Maltose Binding Protein (MBP) from E. coli K12-MG1655. (E) A peptide containing one or three copies of EGFRvIII is fused to the C-terminus of neisseria heparin binding antigen (NHBA) from N. meningitidis MC58.

[0107] FIG. 2. Amino acid and nucleotide sequences of single and triple copy EGFRvIII. (A) Amino acid and nucleotide sequences of single copy EGFRvIII peptide (vIII). (B) Amino acid and nucleotide sequences of triple copy EGFRvIII peptide (vIIIx3). Three copies of EGFRvIII are separated and flanked by short linker sequences. To minimize the possibility of recombination between EGFRvIII coding DNA fragments, three different vIII nucleotide sequences were generated, taking advantage of codon degeneracy but considering E. coli BL21 codon usage.

[0108] FIG. 3. Cloning strategy used to fuse one copy of the EGRFvIII peptide to fHbp full length (A), fHbpDomA (B) and NHBA (C). To generate pET-fHbp, pET-fHbpDomA and pET-NHBA plasmids the sequence coding for fHbp full length, fHbpDomA or NHBA was amplified by PCR from N. meningitidis MC58 genomic DNA using primers fHbp-ss-F/fHbp R, fHbp-ss-F/fHbp A rev and NHBA-F/NHBA-R, respectively to generate extremities complementary to pET21 expression vector linear DNA, amplified with primers petrev/nohisflag (Table 1), using the polymerase incomplete primer extension (PIPE) cloning method (Klock et al, 2009). To clone one copy of the EGFRvIII peptide in translational fusion to fHbp, fHbpDomA and NHBA, pET-fHbp, pET-fHbpDomA and pET-NHBA plasmids were PCR amplified using primers vIII-single fh for/vIII-single fh-wt rev, vIII-single fh for/vIII-single fh-domA rev and NHBA_VIII_1XF/NHBA_VIII_1X_R, respectively. Each couple of primers carries partially complementary 5 tails which, when annealed, reconstitute the nucleotide sequence coding for the EGFRvIII peptide. PCR-amplification followed by E. coli HK-100 transformation generated pET-fHbpvIII, pET-fHbpDomAvIII and pET-NHBAvIII plasmids encoding chimeric proteins carrying one copy of EGFRvIII peptide fused to the C-terminus of fHbp, fHbpDomA and NHBA, respectively. LS: leader sequence; LP: lipobox; A: fHbp domain A; B: fHbp domain B; C: fHbp domain C.

[0109] FIG. 4. Cloning strategy to fuse three copies of the EGRFvIII peptide to fHbp full length, fHbpDomA and NHBA. (A) The DNA fragment coding for the tripeptide vIIIx3 was subcloned in pUC plasmid, generating plasmid pUC-vIIIx3. To fuse three copies of EGFRvIII to fHbp full length (B), fHbpDomA (B) and NHBA (C), pET-fHbp, pET-fHbpDomA and pET-NHBA plasmids were PCR-amplified using primers nohisflag/fHbp R2, nohisflag/fHbp A rev2 and NHBA-vIII-3x-v-r NHBA-vIII-3x-v-r, respectively (Table 1), while the vIIIx3 insert was PCR-amplified from pUC-vIIIx3 using primers vIII-triple fh-wt for/vIII-triple rev, vIII-triple fh-domA for/vIII-triple rev and NHBA-vIII-3x-i-F NHBA-vIII-3x-i-r, respectively. Finally, the PCR products were used to transform E. coli HK100 cells to allow the recombination of complementary ends, obtaining plasmids pET-fHbpvIIIx3, pET-fHbpDomAvIIIx3 and pET-NHBAvIIIx3. LS: leader sequence; LP: lipobox; A: fHbp domain A; B: fHbp domain B; C: fHbp domain C.

[0110] FIG. 5. Analysis of EGFRvIII expression in total lysates of BL21(DE3)/ompA strain transformed with pET-fHbpvIII, pET-fHbpDomAvIII and pET-NHBAvIII. Total extracts from recombinant clones expressing fHbpvIII, fHbpDomAvIII and pET-NHBAvIII in single (A) or in triple (B) copy were separated by SDS-PAGE and analysed by Western blot. Proteins were transferred from the gel to nitrocellulose membrane and analyzed with anti-EGFRvIII rabbit polyclonal antibody. Strains transformed with pET empty vector and pET-fHbp were used as negative controls.

[0111] FIG. 6. Western blot analysis of fHbpvIII and fHbpDomAvIII expression in OMVs. OMVs were purified by ultrafiltration and ultracentrifugation from the supernatants of recombinant strains transformed with pET-fHbpvIII (A), pET-fHbpvIIIx3 (B), pET-fHbpDomAvIII (C) and pET-fHbpDomAvIIIx3 (D) constructs. OMVs were collected from cultures induced with 1 mM IPTG for 2 hours. Vesicles were subjected to SDS-PAGE and Western Blot analysis using anti-EGFRvIII rabbit polyclonal antibody.

[0112] FIG. 7. Analysis of surface exposition of EGFRvIII in fHbpvIII, fHbpvIIIx3 (A), NHBAvIII and NHBAvIIIx3 (B) recombinant strains, evaluated by Fluorescence Activating Cell Sorting. EGFRvIII surface expression was evaluated on bacterial cells after 2 h induction with 1 mM IPTG. Cells were stained with anti-vIII polyclonal antibody followed by anti-rabbit-FITC secondary antibody. BL21(DE3)/ompA strain caning pET21 empty plasmid was used as a negative control.

[0113] FIG. 8. Analysis of vIII-specific IgG induced in mice immunized with fllbpvIIIx3 and fHbpDomAvIIIx3 OMVs. Antigen-specific IgG were measured by ELISA in sera from mice immunized with two (post2) or three (post3) doses of OMVs. As a control, antibody titers from mice immunized with empty OMVs were tested. Anti-mouse IgGs conjugated to alkaline phosphatase were used as secondary antibody. OD405 was measured for each serum dilution.

[0114] FIG. 9. Analysis of antigen expression in total lysates of BL21(DE3)/ompA strain transformed with pET-OmpFvIII constructs. Total extracts from recombinant clones expressing OmpFvIII were separated by SDS-PAGE and analyzed by Coomassie blue staining. Protein expression was induced by addition of 1 mM IPTG to the culture supernatants and extracts were prepared by collecting bacteria after 3 h induction.

[0115] FIG. 10. Analysis of antigen expression in total lysates of BL21(DE3)/ompA strain transformed with pET-OmpFvIIIx3 constructs. Total extracts from recombinant clones expressing OmpFvIIIx3 were separated by SDS-PAGE and analysed by Coomassie blue staining (A) and Western blot (B). Protein expression was induced by addition of 1 mM IPTG to the culture supernatants and extracts were prepared by collecting bacteria after 3 h induction. Strain expressing OmpF wt was used as a negative control. A few strains expressing vIII in single copy were used to compare induction levels.

[0116] FIG. 11. Western blot analysis of OmpFvIII expression in OMVs. OMVs were purified by ultrafiltration and ultracentrifugation from the supernatants of recombinant strains transformed with pET-OmpFvIII constructs. OMVs were collected from cultures induced with 1 mM IPTG for 2 hours. OMVs were loaded on SDS-polyacrylamide gel and analyzed by Western blot using rabbit polyclonal antibody against purified synthetic EGFRvIII peptide. Strains transformed with empty pET vector and with pET-OmpF_wt plasmid were used as negative controls.

[0117] FIG. 12. SDS-PAGE analysis of OmpFvIIIx3 expression in OMVs. OMVs were purified by ultrafiltration and ultracentrifugation from the supernatants of recombinant strains transformed with pET-OmpFvIIIx3 constructs. OMVs were collected from cultures induced with 1 mM IPTG for 2 hours. OMVs were loaded on SDS-polyacrylamide gel and analyzed by Coomassie blue staining. Strains transformed with empty pET vector and with pET-OmpF_wt plasmid were used as negative controls.

[0118] FIG. 13. Analysis of surface exposition of vIII in OmpFvIII recombinant strains. Surface expression was evaluated on bacterial cells after 3 h induction with 1 mM IPTG. Cells were stained with 50 g/ml anti-vIII polyclonal antibody followed by anti-rabbit-FITC secondary antibody. BL21(DE3)/ompA strain overexpressing OmpF wt was used as a negative control. (A) Analysis of vIII surface exposition in strains overexpressing OmpFvIII_L2, OmpFvIII_L4 and OmpFvIII_L6. (B) Analysis of vIII surface exposition in strains overexpressing OmpFvIIIx3_L1 and OmpFvIIIx3_L4.

[0119] FIG. 14. Cloning strategy used to fuse one copy of the EGRFvIII peptide to MBP. The DNA sequence coding for MBP was amplified by PCR from E. coli K12-MG1655 genomic DNA using primers NdI-MalEf/R1-MalEr. The forward primer (NdI-MalEf) anneals to the 5 end of malE; the reverse primer (R1-MalEr) anneals to the 3 end of malE (excluding the stop codon) and its 5 tail contains nucleotides 1-17 of the vIII sequence. Then, in order to complete the vIII coding sequence at the 3 of malE, a second and a third polymerase chain reactions were performed using the same forward primer (NdI-MalEf) but different reverse primers. The reverse primer used in the second amplification step (R2-MalEr) anneals to a region containing the 3 end of malE and nucleotides 1-17 of the vIII sequence; its 5 tail contains nucleotides 18-31 of the vIII sequence. The reverse primer used in the third amplification step (XhI-R3-MalEr) anneals to nucleotides 2-31 of the vIII sequence; its 5 tail contains nucleotides 32-39 of the vIII sequence and the TAA stop codon. With the aim of cloning the fusion gene coding for MBPvIII in pET21 expression vector the PIPE cloning method was used (Klock and Lesley, 2009). Briefly, pET21 was amplified using primers petrev/nohisflag and the fusion gene coding for MBPvIII was reamplified using primers pET21-MalEf/pET21-R3-MalEr, which have 5 tails that generate extremities complementary to pET21 expression vector linear DNA. E. coli HK100 transformation leads to the generation of pET-MBPvIII plasmid.

[0120] FIG. 15. Analysis of antigen expression in total lysates of BL21(DE3)/ompA strain transformed with pET-MBPvIII. Total extracts from bacterial cells after induction with 1 mM IPTG were separated by SDS-PAGE and analysed by Coomassie blue staining (A) and by Western blot (B). For Western Blot analysis, proteins were transferred from the gel to nitrocellulose membrane and analyzed with anti-MBP mouse monoclonal antibody and anti-EGFRvIII rabbit polyclonal antibody raised against purified synthetic vIII peptide.

[0121] FIG. 16. Analysis of MBPvIII expression in OMVs. (A) OMVs were purified by ultrafiltration and ultracentrifugation from the supernatants of a recombinant strain transformed with pET-MBPvIII. OMVs were collected from cultures induced with 1 mM IPTG for 2 hours. 13 g of OMVs were loaded on SDS-polyacrylamide gel and analyzed by Coomassie blue staining. (B) The same OMVs preparations were analyzed by Western blot using rabbit polyclonal antibody against purified synthetic vIII peptide. TL, total lysates; OMVs, outer membrane vesicles.

[0122] FIG. 17. Analysis of EGFRvIII-specific IgG induced in mice immunized with OMVs expressing MBPvIII. Antigen-specific IgGs were measured by ELISA in sera from mice immunized with three doses of OMVs expressing MBPvIII. Anti-mouse IgGs conjugated to alkaline phosphatase were used as secondary antibody. OD405 was measured for each serum dilution.

[0123] FIG. 18. SDS-PAGE and Western Blot analyses of proteins preparations from BL21(DE3)ompA recombinant strains expressing fHbp-FAT1, fHbpDomA-FAT1 and MBP-FAT1 fusions proteins. A) Recombinant clones were grown in LB at 37 C and when the cultures reached OD600=0.6, the expression of the fusion proteins was induced by addition of 1 mM IPTG. After 2 hour growth, the equivalent in volume of 1 OD.sub.600 of each bacterial culture was collected, centrifuged at 13,000g for 5 minutes and pellets were lysed in 200 l of Bacterial protein Extraction Reagent (BPer) (Thermo Scientific, Cat. Number 78266), Lysozime 1 mg/ml, DNAase 10 U/ml and 0.1 mM MgCl.sub.2 for 30 minutes. The samples were centrifuged at 13.000g for 20 minutes to separate the supernatants (soluble fraction) from the pellets (insoluble fraction). The soluble fractions were collected (200 l) and diluted with 100 l of 4SDS-PAGE loading buffer while the pellets were re-suspended in 300 l of 2 loading buffer. 20 l of each sample were analyzed by SDS-PAGE. B) For Western blot analysis 5 l of the samples prepared as described in A) were loaded onto a 4-12% polyacrilamide gel, transferred to a nitrocellulose filter and fusion proteins carrying FAT1 peptide visualized by using the FAT1-specific mAb 198.3.

[0124] FIG. 19. SDS-PAGE and Western Blot analyses of OMVs preparations purified from BL21(DE3)ompA recombinant strains expressing fHbp-FAT1, fHbpDomA-FAT1 and MBP-FAT1 fusions proteins. A) BL21(DE3)/ompA (pET-fHbp-FAT1), BL21(DE3)/ompA (pET-fHbpDomA-FAT1) and BL21(DE3)/ompA (pET-MBP-FAT1) strains were grown in LB and when the cultures reached an OD.sub.600=0.6 1 mM IPTG was added. OMVs were purified from the culture supernatants by using ultrafiltration coupled to ultracentrifugation. 10 g of total proteins of each OMV preparation were analyzed by SDS-PAGE. B) For Western blot analysis the samples prepared as described in A) were loaded onto a 4-12% polyacrilamide gel, transferred to a nitrocellulose filter and fusion proteins carrying FAT1 peptide visualized by using the FAT1-specific mAb 198.3.

[0125] FIG. 20. Analysis of fHBP-FAT1 and fHBPDomA-FAT1 expression on the surface of E. coli BL21(DE3) ompA strain by FACS.

[0126] BL21(DE3)/ompA (pET-fHbp-FAT1) and BL21(DE3)/ompA (pET-fHbpDomA-FAT1) E. coli strains were grown in 10 ml LB medium at 37 C. and when the cultures reached OD.sub.600=0.6, the expression of the fusion proteins was induced by addition of 1 mM IPTG. After 2 hours growth bacteria were collected by centrifugation and incubated with 50 l of an appropriate dilution of anti-FAT1 mAb198.3 or, as negative controls, with PBS containing 1% BSA or with an unrelated mAb. After 1 hour, bacterial cells were washed with PBS containing 1% BSA and subsequently incubated for 30 minutes on ice with goat anti-mouse antibodies added at a final dilution of 1:200. Finally, after 2 wash steps, pellets were re-suspended in 200 l of PBS and analyzed with FACS CANTOII. Collected data were analyzed with FlowJo software.

[0127] FIG. 21. SDS-PAGE analysis of protein preparations from BL21(DE3)ompA recombinant strains expressing fHbpDomA-MUC1 and MBP-MUC1 fusion proteins. Recombinant clones were grown in LB at 37 C. and when the cultures reached OD600=0.6, the expression of the fusion proteins was induced by addition of 1 mM IPTG. After 2 hours growth, the equivalent in volume of 1 OD600 of each bacterial culture was collected, centrifuged at 13,000g for 5 minutes and pellets were lysed in 200 l of Bacterial Protein Extraction Reagent (Life Technologies), Lysozime 1 mg/ml, DNAase 10 U/ml and 0.1 mM MgCl2 for 30 minutes. The samples were centrifuged at 13,000g for 20 minutes to separate the supernatants (soluble fraction) from the pellets (insoluble fraction). The soluble fractions were collected (200 l) and diluted with 100 l of 4SDS-PAGE loading buffer while the pellets were re-suspended in 300 l of 2 loading buffer. 20 l of each sample were analyzed by SDS-PAGE. As a negative control, soluble and insoluble protein fractions were also prepared from BL21(DE3)ompA strain carrying pET21 cloning vector.

[0128] FIG. 22. SDS-PAGE analysis of OMV preparations purified from BL21(DE3)ompA recombinant strains expressing fHbpDomA-MUC1 and MBP-MUC1 fusions proteins. BL21(DE3)/ompA (pET-fHbpDomA-MUC1) and BL21(DE3)/ompA (pET-MBP-MUC1) strains were grown in LB and when the cultures reached an OD600=0.6 1 mM IPTG was added. OMVs were purified from the culture supernatants by using ultrafiltration coupled to ultracentrifugation. 10 g of total proteins of each OMV preparation were analyzed by SDS-PAGE. As a negative control, OMVs were also prepared from BL21(DE3)ompA strain carrying pET21 cloning vector.

[0129] FIG. 23. Antibody titers elicited in mice immunized with engineered OMVs carrying FAT1 and MUC1 fusion proteins. Engineered OMVs (20 g) were used to i.p. immunize CD1 mice (5 mice per group) three times at two-week intervals and after two weeks from the third immunization, sera were collected and pooled to analyze anti-MUC1 and anti-FAT1 antibody titers by ELISA. Plates were coated with the synthetic MUC1 peptide GVTSAPDTRPAPGSTAPPAH (A) and synthetic FAT1 peptide IQVEATDKDLGPNGHVTYSIVTDTD (B) and different dilutions of pooled sera were incubated at 37 C. for 2 hours. After three washes in PBST, 100 l of goat anti-mouse antibodies conjugated to alkaline phosphatase (SouthernBiotech, Cat. 1030-04, 1:2.000 dilution) were added to each well and incubated at 37 C. for 1 hour. Finally, after three washes, the phosphatase substrate (4-Nitrophenyl phosphate disodium salt) was added to each well at a concentration of 1 mg/ml (100 l/well) and after 30 minutes incubation at room temperature in the dark, substrate hydrolysis was measured spectrophotometrically at 405 nm.

[0130] FIG. 24. Expression, compartimentalization and surface localization of Aa-fHbp in BL21 ompA and derived OMVs.

[0131] (A) Protein sequence alignment of Nm-fHbp and Aa-fHbp. (B) SDS-PAGE analysis of total cell extracts (TL) and OMVs isolated from BL21ompA (pET_Aa-fHbp). (C) Western blot analysis of OMVs purified from BL21ompA (pET_Aa-fHbp). (D) Assessment of Aa-fHbp localization by FACS analysis. Aa-fHbp detection was carried out using anti-His-tag antibodies. (E) Assessment of Aa-fHbp localization by proteinase K surface shaving

DETAILED DESCRIPTION OF THE INVENTION

[0132] Engineered OMVs Expressing EGFRvIII Peptide

[0133] FIG. 1 schematizes the different approaches used to decorate bacterial OMVs with the EGFRvIII peptide. Three different strategies were used. Four strategies were designed to deliver the vIII peptide to the membrane compartment of OMVs. The rationale was that since fHbp, NHBA and OmpF are efficiently incorporated into OMVs they could serve as chaperones for the vIII peptide. To fuse the peptide to fHbp and NHBA, a DNA fragment encoding one copy (vIII) or three copies (vIIIx3) of LEEKKGNYVVTDH vIII peptide (FIG. 2) was cloned at the 3 end of the full length fHbp gene, full length NHBA gene and at the 3 end of the sequence coding for fHbp lacking domains B and C (fHbpDomA), thus generating chimeric proteins carrying the vIII peptide at their C-terminus (FIG. 1A, 1B, 1E). To fuse the vIII peptide to OmpF, the DNA coding for OmpF extracellular loops was replaced with synthetic DNA coding for one or three copies of the vIII peptide (FIG. 1C). Finally, the fifth strategy was designed to deliver the vIII peptide into the lumen of OMVs. To this aim, the synthetic DNA coding for one copy of the vIII peptide was fused to the 3 end of malE, the gene coding for MBP, to create an in frame C-terminal fusion (FIG. 1D).

[0134] The detailed description of the construction of the protein chimeras and the preparation of the engineered OMVs decorated with the different protein fusions are reported below.

[0135] OMV Engineering with fHBPvIII

[0136] Construction of pET-fHbpvIII and pET-fHbpDomAvIII Plasmids

[0137] In an attempt to express and deliver the EGFRvIII peptide to the membrane compartment of E. coli OMVs the Neisseria meningitidis fHbp lipoprotein was used as a carrier. To this purpose one or three copies of the EGFRvIII peptide were fused to the 3 end of either the full length fHbp or fHbpDomA. The first step to achieve this was to amplify the sequence coding for full length fHbp (fHbpFL) and fHbpDomA and to clone the amplified sequences into pET21 plasmid. fHbpFL and fHbpDomA coding sequences (SEQ ID NOs:85 and 86) were amplified by PCR from N. meningitidis MC58 genomic DNA using primers fHbp-ss-F/fHbp R and fHbp-ss-F/fHbp A rev, respectively (Table 1 and FIG. 3), to generate extremities complementary to pET21 expression vector linear DNA, amplified with primers petrev/nohisflag (Table 1), using the polymerase incomplete primer extension (PIPE) cloning method (Klock H. E. and Lesley S. A (2009) Methods Mol. Biol. 498, 91-103). Primer fHbp-ss-F was designed to include at the 5 end of the amplified products the sequence coding for the leader peptide for secretion and the lipobox. PCR products were then mixed together and used to transform E. coli HK-100 strain, generating plasmids pET-fHbp and pET-fHbpDomA. The correctness of the cloning of fHbp and fHbpDomA was verified by sequence analysis (SEQ ID NOs:85 and 86). To clone the EGFRvIII peptide as translational fusion to the C-terminus of fHbp and fHbpDomA, the polymerase incomplete primer extension (PIPE) cloning method was used. In particular, to fuse one copy of the EGFRvIII peptide, pET-fHbp and pET-fHbpDomA plasmids were PCR amplified using primers vIII-single fh for/vIII-single fh-wt rev and vIII-single fh for/vIII-single fh-domA rev respectively (Table 1). Each couple of primers carries partially complementary 5 tails which when annealed reconstitute the nucleotide sequence coding for the EGFRvIII peptide. PCR-amplification followed by E. coli HK-100 transformation generated pET-fHbpvIII and pET-fHbpDomAvIII plasmids encoding chimeric proteins carrying one copy of EGFRvIII peptide fused to the C-terminus of fHbp and fHbpDomA, respectively (FIG. 3). The correctness of the cloning of fHbp-vIII and fHbpDomA-vIII fusions was verified by sequence analysis (SEQ ID NOs: 87 and 88). To fuse three copies of the EGFRvIII peptide to the C-termini of full length fHbp and fHbpDomA, the strategy schematized in FIG. 4 was used. In brief, a DNA fragment, named vIIIx3, coding for three copies of vIII separated by the GlySer dipeptide and carrying single stranded 3 protruding ends complementary to the protruding single stranded 3 ends generated by EcoRI and BamHI restriction sites was chemically synthesized (FIG. 2) and cloned in pUC plasmid cut with EcoRI and BamHI. The synthetic DNA and the linear pUC were in vitro ligated and the ligation mixture was used to transform E. coli HK-100, thus generating plasmid pUC-vIIIx3. Subsequently, pET-fHbp and pET-fHbpDomA plasmids were PCR amplified using primers nohisflag/fHbp R2 and nohisflag/fHbp A rev2, respectively (Table 1), while the vIIIx3 insert was PCR-amplified from pUC-vIIIx3 using primers vIII-triple fh-wt for/vIII-triple rev and vIII-triple fh-domA for/vIII-triple rev, respectively (Table 1). Finally, the PCR products were mixed together and used to transform HK-100 competent cells, obtaining plasmids pET-fHbpvIIIx3 and pET-fHbpDomAvIIIx3. The correctness of the cloning of fHbp-vIIIx3 and fHbpDomA-vIIIx3 fusions was verified by sequence analysis (SEQ ID NOs: 89 and 90).

[0138] Expression of the fHbpvIII and fHbpDomAvIII Heterologous Proteins in E. coli BL21(DE3)/ompA Strain

[0139] The four recombinant plasmids encoding fHbp and fHbpDomA fused to one copy and three copies of the EGFRvIII peptide were used to transform E. coli strain BL21(DE3)/ompA. Four recombinant strains were obtained: BL21(DE3)/ompA(pETfHbpFL-vIII), BL21(DE3)/ompA (pETfHbpFLvIIIx3), BL21(DE3)/ompA(pETfHbpDomAvIII) and BL21(DE3)/ompA (pETfHbpDomAvIIIx3). Each strain was grown in LB medium and when cultures reached an OD.sub.600 value of 0.6, IPTG was added at 1 mM final concentration. After two additional hours of growth at 37 C., cells were collected and total protein extracts were analyzed by Western Blot. To this aim, 25 g of total proteins from each strain were separated by SDS-PAGE and proteins were transferred to nitrocellulose filters. The filters were blocked overnight at 4 C. by agitation in blocking solution (10% skimmed milk and 0.05% Tween in PBS), followed by incubation for 90 minutes at 37 C. with a 1:1,000 dilution of rabbit anti-vIII polyclonal antibodies in 3% skimmed milk and 0.05% Tween in PBS. After 3 washing steps in PBS-Tween, the filters were incubated in a 1:2,000 dilution of peroxidase-conjugated anti-rabbit immunoglobulin (Dako) in 3% skimmed milk and 0.05% Tween in PBS for 1 hour, and after 3 washing steps, bound conjugated IgGs were detected using the Super Signal West Pico chemo-luminescent substrate (Pierce). As shown in FIG. 5A and FIG. 5B, all four fusion proteins were found expressed

[0140] in the cell lysates. No immune reactive bands were detected in total lysates from E. coli cells carrying either pET-fHbp expressing full length fHbp or empty pET21 plasmid.

[0141] Analysis of fHbpvIII and fHbpDomAvIII Expression in OMVs

[0142] Having demonstrated that the four fusion proteins were expressed in E. coli BL21(DE3)/ompA strain, the presence of the antigens in the OMV fraction was analyzed. The four recombinant strains BL21(DE3)/ompA(pETfHbpFL-vIII), BL21(DE3)/ompA(pETfHbpFLvIIIx3), BL21(DE3)/ompA (pETfHbpDomAvIII) and BL21(DE3)/ompA(pETfHbpDomAvIIIx3) were grown in LB medium and when the cultures reached an OD.sub.600 value of 0.6, IPTG was added at 1 mM final concentration. After two additional hours of growth at 37 C., vesicles were purified from culture supernatants by using ultrafiltration coupled to ultracentrifugation. More specifically, OMVs were collected from culture supernatants by filtration through a 0.22 m pore size filter (Millipore) and by high-speed centrifugation (200.000g for 2 hours). Pellets containing OMVs were finally suspended in PBS. The presence of the antigens in OMVs preparations was verified by Western Blot analysis as described in the previous section (FIG. 6). Data indicate that both fHbp and fHbpDomA carrying either one or three copies of vIII peptide were incorporated into OMVs. The presence of high molecular weight bands seem to suggest that when fused to vIII peptide fHbp and fHbpDomA can also form stable homo-oligomers which did not easily dissociate even if OMV preparations were treated at 100 C. in the presence of 1% SDS and reducing agent (FIG. 6B, C, D).

TABLE-US-00001 TABLE1 OligonucleotideprimersusedforgenerationofpET-fHbpvIII,pET- fHbpDomAvIII,pET-OmpFvIII,pET-MalEvIII,pET-NHBA-1x-vIII,pET-NHBA-3x- vIIIandpET-Aa_fhbp_HIS8constructs vIII-triple GTGATGGTGATGTTATTAGCCGGAATGGTCGGTAACCAC rev vIII-triple CCAAGTATACAAACAAGGTTCCCTGGAAGAAAAGAAGGG fh-domAfor vIII-triple CTTGCCGCCAAGCAAGGTTCCCTGGAAGAAAAGAAGGG fh-wtfor vIII-single AACGTAGTTACCTTTTTTTTCTTCCAGTTGTTTGTATACTTGGA fh-domArev ACTCTCCACTCTC vIII-single TTAAACGTAGTTACCTTTTTTTTCTTCCAGTTGCTTGGCGGCA fh-wtrev AGGC vIII-single AAAGGTAACTACGTTGTTACCGACCACTAACATCACCATCAC fhfor CATCACGATTACAAAGA fHbpArev GTGATGGTGATGTTATTGTTTGTATACTTGGAACTCTCCACTC TC fHbp-R GTGATGGTGATGTTATTATTGCTTGGCGGCAAGGC fHbp-R2 TTATTGCTTGGCGGCAAGGC fHbpArev2 TTGTTTGTATACTTGGAACTCTCCACTCTC fHbp-SS-F GGAGATATACATATGGTGAATCGAACTGCCTTCTGCTGCC petrev CATATGTATATCTCCTTCTTAAAGTTAAAC nohisflag TAACATCACCATCACCATCACGATTACAAAGA NdI-MalEf ggaattccatatgAAAATAAAAACAGGTGCACGCATC R1-MalEr ccttttttttcttccagCTTGGTGATACGAGTCTGCG R2-MalEr taacaacgtagttaCCTTTTTTTTCTTCCAGCTTGGTGA XhI-R3- ccccgctcgagttagtggtcggTAACAACGTAGTTACCTTTTTTTTCTTCC MalEr pET21- ggagatatacatatgAAAATAAAAACAGGTGCACGCATC MalEf pET21-R3- gtgatggtgatgttagtggtcggTAACAACGTAGTTACCTTTTTTTTCTTCC MalEr NdI-OmpFf ggaattccatatgATGAAGCGCAATATTCTGGC XM-OmpFr ccccgctcgagTTAGAACTGGTAAACGATACCCAC pET21OmpF ggagatatacatatgATGAAGCGCAATATTCTGGC f pET21OmpF gtgatggtgatgttaGAACTGGTAAACGATACCCAC r Loop1Vf aaaggtaactacgttgttaccgaccacGGCGACATGACCTATGCCC Loop1Vr aacgtagttaccttttttttettccagAAAATAATGCAGACCAACAGCTTTACC G Loop2Vf aaaggtaactacgttgttaccgaccacGGTAACAAAACGCGTCTGGC Loop2Vr aacgtagttaccttttttttcttccagGTTACCCTGGAAGTTATATTCCCAC Loop4Vf aaaggtaactacgttgttaccgaccacAACGGCGACGGTGTTGGC Loop4Vr aacgtagttaccttttttttcttccagGTTTTTACCCAGGTACTGAACAGC Loop6Vf aaaggtaactacgttgttaccgaccacGCCAACAAAACGCAAGACGTTCTG Loop6Vr aacgtagttaccttttttttcttccagCGTAGCGTTACGGGTTTCACC Loop7Vf aaaggtaactacgttgttaccgaccacGTGAACTACTTTGAAGTGGGCG Loop7Vr aacgtagttaccttttttttcttccagTTTCGCTTTAGATTTGGTGTAAGCGAT Loop8Vf aaaggtaactacgttgttaccgaccacACCGTTGCTGTGGGTATCGTT Loop8Vr aacgtagttaccttttttttcttccagCTGGTTGATGATGTAGTCAACATAGG L1_3x_If GGTCTGCATTATTTTGGTTCCCTGGAAGAAAAGAAGGG L1_3x_Ir GGTCATGTCGCCGCCGGAATGGTCGGTAACCAC L4_3x_If GGGTAAAAACGGTTCCCTGGAAGAAAAGAAGGG L4_3x_Ir CCGTCGCCGTTGCCGGAATGGTCGGTAACCAC L1_3x_Vf GGCGACATGACCTATGCCCG L1_3x_Vr AAAATAATGCAGACCAACAGCTTTACCG L4_3x_Vf AACGGCGACGGTGTTGGCGG L4_3x_Vr GTTTTTACCCAGGTACTGAACAGC NHBA-F GGAGATATACATATGTTTAAACGCAGCGTAATC NHBA-R GTGATGGTGATGTTATCAATCCTGCTCTTTTTTG NHBA_VIII_ aacgtagttaccttttttttcttccagATCCTGCTCTTTTTTGCCGG 1XR NHBA_VIII_ AaaggtaactacgttgttaccgaccacTAACATCACCATCACCATCAC 1XF GATTACAAAGA NHBA-VIII- CCGGCAAAAAAGAGCAGGATggttccctggaagaaaagaaggg 3X-i-F NHBA-VIII- GTGATGGTGATGTTAgccggaatggtcggtaaccac 3X-i-R NHBA-VIII- ATCCTGCTCTTTTTTGCCGG 3xv-R NHBA-VIII- TAACATCACCATCACCATCACGATTACAAAGA 3x-v-f Ag_fHbp-F GaaggagatatacatATGGTTTACCCTGTTATAACG Ag_fHbp-R ATGGTGATGGTGATGTTCTTTTTTACCTGCCAAACC pET2-R CATATGTATATCTCCTTCTTAAAGTTAAACaaaattatttc pETHIS-F catcaccatcaccatcacTAAGATTACAAAGACGATGATGACAAGtga

[0143] Analysis of Cellular Localization of fHbpvIII and fHbpvIIIx3

[0144] The localization of recombinant fHbpvIII and fHbpvIIIx3 fusion proteins was evaluated by flow cytometry. To this aim, recombinant E. coli strains BL21(DE3)/ompA (pETfHbpFL-vIII), BL21(DE3)/ompA (pETfHbpFLvIIIx3) and E. coli BL21(DE3)/ompA(pET21), as negative control, were grown at 37 C. under agitation. When cultures reached an OD.sub.600 value of 0.6, IPTG was added at a final concentration of 1 mM and bacteria were grown for 2 additional hours. Subsequently, bacteria cells corresponding to those contained in 1 ml culture at OD.sub.600=1 were collected by centrifugation at 13,000g for 5 minutes and pellets were re-suspended in 50 ml of PBS containing 1% BSA. 50 l of cell suspensions were incubated with 50 l of an appropriate dilution of anti-vIII rabbit polyclonal antibodies raised against the vIII peptide conjugated to Keyhole Limpet Hemocyanin (KLH) or with 50 l of PBS containing 1% BSA as negative control. After 1 hour, 100 l of PBS containing 1% BSA were added and the suspensions were centrifuged at 3,000g for 10 minutes and supernatants discarded. Pellets were washed with 200 l of PBS containing 1% BSA and bacteria subsequently incubated for 30 minutes on ice with goat anti-rabbit antibodies (Alexa flour488, Life Technology) added at a final dilution of 1:2,000. Finally, After 2 wash steps, pellets were re-suspended in 200 l of PBS and analyzed with FACS CANTOII evaluating collected data with FlowJo software. As shown in FIG. 7A, in the presence of anti-vIII antibodies, a clear shift in fluorescence intensity was observed in a substantial fraction of bacterial cells expressing both fHbpvIII and fHbpvIIIx3. No difference in fluorescence intensity was observed when E. coli BL21(DE3)/ompA were incubated with anti-vIII antibodies. These data indicate not only that fHbvIII and fHbpvIIIx3 were expressed in E. coli BL21(DE3)/ompA and localized in OMVs, but also that the fused proteins associated to the outer membrane, with their C-terminal portion carrying the vIII peptide exposed to the extracellular compartment.

[0145] Engineered OMVs Carrying Recombinant fHbpvIII and fHbpDomAvIII Fusion Proteins Induce High Antibodies Titers in Immunized Mice

[0146] To test whether OMVs purified from fHbpvIIIx3 and fHbpDomAvIIIx3 recombinant strains were capable of inducing vIII-specific antibody responses, CD1 mice were i.p. immunized three times at two-week intervals with 10 g of OMVs formulated in Alum. Blood samples were collected nine days after second dose (post2) and seven days after third dose (post3) administration and anti-vIII IgGs were detected by using plates coated in each well with 0.5 g of synthetic vIII peptide conjugated to Keyhole limpet hemocyanin (vIII-KHL). Serum deriving from mice immunized with empty OMVs was used as negative control. More specifically, coating was carried out by incubating plates overnight at 4 C. with 100 l of conjugated peptide (5 g/ml). Subsequently, wells were washed three times with PBST (0.05% Tween 20 in PBS, pH 7.4), incubated with 100 l of 1% BSA in PBS for 1 h at room temperature and washed again three times with PBST. Serial dilutions of serum samples in PBST containing 1% BSA were added to the plates, incubated 2 h at 37 C., and washed three times with PBST. Then 100 l/well of 1:2.000 diluted, alkaline phosphatase-conjugated goat anti-mouse IgGs were added and left for 2 h at 37 C. After triple PBST wash, bound alkaline phosphatase-conjugated antibodies were detected by adding 100 l/well of 3 mg/ml para-nitrophenyl-phosphate disodium hexahydrate (Sigma-Aldrich) in 1M diethanolamine buffer (pH 9.8). After 10 minute incubation at room temperature, the reaction was stopped with 100 l 7% EDTA and substrate hydrolysis was analyzed at 405 nm in a microplate spectrophotometer.

[0147] As shown in FIG. 8, OMVs carrying fHbpvIIIx3 and fHbpDomAvIIIx3 fusion proteins were able to induce high anti-vIII IgG titers in mice. In particular, OMV carrying fHbpDomA3xvIII induced maximum antibody responses even after only two immunizations.

[0148] OMV Engineering with NHBAvIII

[0149] Construction of pET-NHBAvIII Plasmids

[0150] In order to express and deliver the EGFRvIII peptide to the membrane compartment of E. coli OMVs the Neisseria meningitidis NHBA lipoprotein was used as a carrier. To this purpose one or three copies of the EGFRvIII peptide were fused to the 3 end of the full length NHBA. The first step to achieve this was to amplify the sequence coding for full length NHBA and to clone the amplified sequences into pET21 plasmid. NHBA coding sequences (SEQ ID NO:113) were amplified by PCR from N. meningitidis MC58 genomic DNA using primers NHBA-F/NHBA-R (Table 1 and FIG. 3C), to generate extremities complementary to pET21 expression vector linear DNA, amplified with primers petrev/nohisflag (Table 1), using the polymerase incomplete primer extension (PIPE) cloning method (Klock H. E. and Lesley S. A (2009) Methods Mol. Biol. 498, 91-103). Primer NHBA-F was designed to include at the 5 end of the amplified products the sequence coding for the leader peptide for secretion and the lipobox. PCR products were then mixed together and used to transform E. coli HK-100 strain, generating plasmids pET-NHBA. The correctness of the cloning of NHBA was verified by sequence analysis (SEQ ID NO:113). To clone the EGFRvIII peptide as translational fusion to the C-terminus of NHBA the polymerase incomplete primer extension (PIPE) cloning method was used. In particular, to fuse one copy of the EGFRvIII peptide, pET-NHBA plasmid was PCR amplified using primers NHBA_VIII_1XF/NHBA_VIII_1X_R (Table 1). These primers carries partially complementary 5 tails which when annealed reconstitute the nucleotide sequence coding for the EGFRvIII peptide. PCR-amplification followed by E. coli HK-100 transformation generated pET-NHBAvIII plasmid encoding chimeric proteins carrying one copy of EGFRvIII peptide fused to the C-terminus of NHBA (FIG. 3C). The correctness of the cloning of NHBA-vIII fusion was verified by sequence analysis (SEQ ID NO:114). To fuse three copies of the EGFRvIII peptide to the C-termini of full length NHBA, was used the strategy schematized in FIG. 4. In brief, a DNA fragment, named vIIIx3, coding for three copies of vIII separated by the GlySer dipeptide and carrying single stranded 3 protruding ends complementary to the protruding single stranded 3 ends generated by EcoRI and BamHI restriction sites was chemically synthesized and cloned in pUC plasmid cut with EcoRI and BamHI. The synthetic DNA and the linear pUC were in vitro ligated and the ligation mixture was used to transform E. coli HK-100, thus generating plasmid pUC-vIIIx3 (FIG. 4A). Subsequently, pET-NHBA plasmid was PCR amplified using primers NHBA-vIII-3x-v-f/ NHBA-vIII-3x-v-r (Table 1), while the vIIIx3 insert was PCR-amplified from pUC-vIIIx3 using primers NHBA-vIII-3x-i-f/ NHBA-vIII-3x-i-r (Table 1). Finally, the PCR products were mixed together and used to transform HK-100 competent cells, obtaining plasmids pET-NHBAvIIIx3 FIG. 4D). The correctness of the cloning of NHBA-vIIIx3 fusion was verified by sequence analysis (SEQ ID NO:115).

[0151] Expression of the NHBAvIII Heterologous Protein in E. coli BL21(DE3)/ompA Strain

[0152] The two recombinant plasmids encoding NHBA fused to one copy and three copies of the EGFRvIII peptide were used to transform E. coli strain BL21(DE3)/ompA. Two recombinant strains were obtained: BL21(DE3)/ompA(pET-NHBA-vIII) and BL21(DE3)/ompA(pET-NHBAvIIIx3). Each strain was grown in LB medium and when cultures reached an OD.sub.600 value of 0.6, IPTG was added at 1 mM final concentration. After two additional hours of growth at 37 C., cells were collected and total protein extracts were analyzed by Western Blot. To this aim, 25 g of total proteins from each strain were separated by SDS-PAGE and proteins were transferred to nitrocellulose filters. The filters were blocked overnight at 4 C. by agitation in blocking solution (10% skimmed milk and 0.05% Tween in PBS), followed by incubation for 90 minutes at 37 C. with a 1:1,000 dilution of rabbit anti-vIII polyclonal antibodies in 3% skimmed milk and 0.05% Tween in PBS. After 3 washing steps in PBS-Tween, the filters were incubated in a 1:2,000 dilution of peroxidase-conjugated anti-rabbit immunoglobulin (Dako) in 3% skimmed milk and 0.05% Tween in PBS for 1 hour, and after 3 washing steps, bound conjugated IgGs were detected using the Super Signal West Pico chemo-luminescent substrate (Pierce). As shown in FIG. 5A and FIG. 5B, both fusion proteins were found expressed in the cell lysates. No immune reactive bands were detected in total lysates from E. coli cells carrying either pET-NHBA expressing full length NHBA or empty pET21 plasmid.

[0153] Analysis of Cellular Localization of NHBAvIII and NHBAvIIIx3

[0154] The localization of recombinant NHBAvIII and NHBAvIIIx3 fusion proteins was evaluated by flow cytometry. To this aim, recombinant E. coli strains BL21(DE3)/ompA (pET-NHBAvIII), BL21(DE3)/ompA (pET-NHBAvIIIx3) and E. coli BL21(DE3)/ompA(pET21), as negative control, were grown at 37 C. under agitation. When cultures reached an OD.sub.600 value of 0.6, IPTG was added at a final concentration of 1 mM and bacteria were grown for 2 additional hours. Subsequently, bacteria cells corresponding to those contained in 1 ml culture at OD.sub.600=1 were collected by centrifugation at 13,000g for 5 minutes and pellets were re-suspended in 50 ml of PBS containing 1% BSA. 50 l of cell suspensions were incubated with 50 l of an appropriate dilution of anti-vIII rabbit polyclonal antibodies raised against the vIII peptide conjugated to Keyhole Limpet Hemocyanin (KLH) or with 50 l of PBS containing 1% BSA as negative control. After 1 hour, 100 l of PBS containing 1% BSA were added and the suspensions were centrifuged at 3,000g for 10 minutes and supernatants discarded. Pellets were washed with 200 l of PBS containing 1% BSA and bacteria subsequently incubated for 30 minutes on ice with goat anti-rabbit antibodies (Alexa flour488, Life Technology) added at a final dilution of 1:2,000. Finally, After 2 wash steps, pellets were re-suspended in 200 l of PBS and analyzed with FACS CANTOII evaluating collected data with FlowJo software. As shown in FIG. 7B, in the presence of anti-vIII antibodies, a clear shift in fluorescence intensity was observed in a substantial fraction of bacterial cells expressing both NHBAvIII and NHBAvIIIx3. No difference in fluorescence intensity was observed when E. coli BL21(DE3)/ompA were incubated with anti-vIII antibodies. These data indicate not only that NHBAvIII and NHBAvIIIx3 were expressed in E. coli BL21(DE3)/ompA and that the fused proteins are associated to the outer membrane with their C-terminal portion carrying the vIII peptide exposed to the extracellular compartment.

[0155] OMV Engineering with OmpFvIII

[0156] Construction of pET-OmpFvIII Plasmids

[0157] With the aim of expressing EGFRvIII peptide on the OMVs surface, the fusion of vIII peptide to Outer Membrane Protein F (OmpF) was attempted. OmpF is a protein embedded in the outer membrane with eight loops (L) exposed to the extracellular compartment (FIG. 1C). Therefore, if extracellular loops are removed and replaced with vIII peptide, the peptide should theoretically be delivered to the membrane surface. To test this hypothesis, the coding sequence of the extracellular loops L1, L2, L4, L6, L7, L8 was substituted with the nucleotide sequence coding for the 13 amino acid EGFRvIII peptide (FIG. 2A), thus generating six constructs, each construct having one loop substituted. The first step to obtain the six engineered OmpF constructs was to clone the OmpF gene into pET21 plasmid. To this aim, the entire OmpF coding sequence was amplified from E. coli K12-MG1655 genomic DNA using primers NdI-OmpFf/XhI-OmpFr (Table 1). Then, the resulting fragment was re-amplified with primers pET21OmpFf/pET21OmpFr (Table 1) to make the extremities complementary to pET21 expression vector which was amplified with primers petrev/nohisflag (Table 1), using the polymerase incomplete primer extension (PIPE) method. The two linear DNAs were mixed together and used to transform the highly competent E. coli strain strain HK-100, to obtain the pET-OmpF plasmid. The correctness of the cloning of the ompF gene in pET21 was verified by sequence analysis (SEQ ID NO:91).

[0158] To substitute loops L1, L2, L4, L6, L7 and L8 with EGFRvIII, the polymerase incomplete primer extension (PIPE) cloning method was used. pET-OmpF was amplified by PCR using the primer couples Loop1Vf/Loop1Vr, Loop2Vf/Loop2Vr, Loop4Vf/Loop4Vr, Loop6Vf/Loop6Vr, Loop7Vf/Loop7Vr and Loop8Vf/Loop8Vr, respectively (Table 1). Each couple was designed to anneal to the flanking regions of a selected loop and to carry complementary tails that when annealed reconstituted the sequence coding for vIII peptide. PCR-amplification followed by E. coli HK100 transformation resulted in replacement of the loop with the DNA sequence coding for EGFRvIII. Plasmids pET-OmpFvIII_L1, pET-OmpFvIII_L2, pET-OmpFvIII_L4, pET-OmpFvIII_L6, pET-OmpFvIII_L7 and pET-OmpFvIII_L8 were obtained. The correctness of the replacement of each loop coding sequence with the small fragment coding for the vIII peptide was verified by sequence analysis (SEQ ID NOs:92, 94, 95, 97, 98 and 99).

[0159] In an attempt to maximize the exposure of the peptide to the extracellular milieu two other constructs were generated, in which L1 or L4 were substituted with three copies of EGFRvIII (FIG. 2B). To obtain pET-OmpFvIIIx3_L1, the vIIIx3 coding sequence was amplified from pUC-vIIIx3 (see previous section) using primers L1_3x_If/L1_3x_Ir (Table 1). The primers carried 5 ends complementary to the sequences preceding and following the region coding for L1. In parallel, pET-OmpF plasmid was amplified using primers L1_3x_Vf/L1_3x_Vr. The two DNA fragments were mixed together and used to transform E. coli HK-100 competent cells, thus obtaining a clone carrying plasmid pET-OmpFvIIIx3_L1. A similar strategy was used to obtain pET-OmpFvIIIx3_L4 plasmid. The vIIIx3 coding sequence was amplified from pUC-vIIIx3 (see previous section) using primers L4_3x_If/L4_3x_Ir (Table 1). The primers carried 5 ends complementary to the sequences preceding and following the region coding for L4. In parallel, pET-OmpF plasmid was amplified using primers L4_3x_Vf/L4_3x_Vr (Table 1). The two DNA fragments were mixed together and used to transform E. coli HK-100 competent cells, thus obtaining a clone carrying plasmid pET-OmpFvIIIx3_L4. The correctness of the replacement of Loop 1 and Loop4 with the small fragment coding for three copies of the vIII peptide was verified by sequence analysis (SEQ ID NOs: 93 and 96).

[0160] Expression of OmpFvIII and OmpFvIIIx3 Heterologous Proteins in E. coli BL21(DE3)/ompA

[0161] The eight plasmids: pET-OmpFvIII_L1, pET-OmpFvIII_L2, pET-OmpFvIII_L4, pET-OmpFvIII_L6, pET-OmpFvIII_L7, pET-OmpFvIII_L8, pET-OmpFvIIIx3_L1 and pET-OmpFvIIIx3_L4 were used to transform E. coli strain BL21(DE3)/ompA. Expression of engineered OmpF carrying the vIII peptide in each loop was analyzed in bacterial lysates by SDS-PAGE and Western Blot. E. coli BL21(DE3)/ompA strains carrying each plasmid encoding engineered OmpF were grown in LB medium and when cultures reached an OD.sub.600 value of 0.6, IPTG was added at 1 mM final concentration. After two additional hours of growth at 37 C., cells were collected and 25 g of total protein extracts were analyzed by SDS-PAGE. As shown in FIG. 9 and FIG. 10A, a protein band with the electrophoretic mobility similar to OmpF accumulated in all protein extracts prepared after IPTG induction. In the case of the two strains carrying plasmid pET-OmpFvIIIx3_L1 and plasmid pET-OmpFvIIIx3_L4, respectively, the bands had an electrophoretic mobility slightly higher than OmpF, in line with the fact that three copies of vIII were used to replace Loop 1 and Loop 4, respectively. Western Blot of total cell extracts was also carried out to confirm the expression of the engineered OmpF proteins in strains carrying plasmids pET-OmpFvIII_L2, pET-OmpFvIII_L4, pET-OmpFvIII_L6, pET-OmpFvIIIx3_L1 and pET-OmpFvIIIx3 L4. To this aim, 13 g of total proteins from each strain were separated by SDS-PAGE and proteins were transferred to nitrocellulose filters. The filters were blocked overnight at 4 C. by agitation in blocking solution (10% skimmed milk and 0.05% Tween in PBS), followed by incubation for 90 minutes at 37 C with a 1:1.000 dilution of rabbit anti-vIII polyclonal antibodies in 1% skimmed milk and 0.05% Tween in PBS. After 3 washing steps in PBS-Tween, the filters were incubated in a 1:5.000 dilution of peroxidase-conjugated anti-mouse immunoglobulin (Dako) in 1% skimmed milk and 0.05% Tween in PBS for 1 hour at room temperature, and after 3 washing steps, bound conjugated IgGs were detected using the Super Signal West Pico chemo-luminescent substrate (Pierce). As shown in FIG. 10B intense immune reactive bands with electrophoretic mobility identical to the corresponding engineered OmpF proteins visible in SDS-polyacrylamide gel stained with Coomassie Blue were detected.

[0162] Expression of OmpFvIII and OmpFvIIIx3 Heterologous Proteins into OMVs

[0163] Having demonstrated that engineered OmpF carrying one or three copies of vIII peptide in correspondence of one of the OmpF external loops were expressed in E. coli BL21(DE3)/ompA, the presence of engineered OmpF in the OMV fraction was analyzed. To this aim, the recombinant strains BL21(DE3)/ompA(pET-OmpFvIII_L1), BL21(DE3)/ompA (pET-OmpFvIII_L2), BL21(DE3)/ompA (pET-OmpFvIII_L4), BL21(DE3)/ompA (pET-OmpFvIII_L6), BL21(DE3)/ompA (pET-OmpFvIII_L7), and BL21(DE3)/ompA (pET-OmpFvIII_L8) were grown in LB medium and when the cultures reached an OD.sub.600 value of 0.6, IPTG was added at 1 mM final concentration. After two additional hours of growth at 37 C., vesicles were purified from culture supernatants by using ultrafiltration coupled to ultracentrifugation. More specifically, OMVs were collected from culture supernatants by filtration through a 0.22 m pore size filter (Millipore) and by high-speed centrifugation (200,000g for 2 hours). Pellets containing OMVs were finally suspended in PBS. The presence of the engineered OmpF proteins in each OMV preparation was verified by Western Blot analysis as already described using anti-vIII polyclonal antibodies. As shown in FIG. 11, all OMVs purified from the supernatants of the six recombinant strains carried the respective engineered OmpF proteins. In particular, the OmpF proteins carrying the vIII peptide in place of Loop 1, Loop 2 and Loop 4 appear to accumulate in OMVs with remarkably high efficiency. As far as the two engineered OmpF proteins carrying three copies of vIII peptide in loop 1 and 4 are concerned, their presence in OMVs was verified by SDS-PAGE. BL21(DE3)/ompA (pET-OmpFvIIIx3_L1), and BL21(DE3)/ompA (pET-OmpFvIIIx3 L4) strains were grown in LB medium and when the cultures reached an OD.sub.600 value of 0.6, IPTG was added at 1 mM final concentration. After two additional hours of growth at 37 C., vesicles were purified from culture supernatants by using ultrafiltration coupled to ultracentrifugation as described above. 25 g of OMVs were separated on an SDS-polyacrylamide gel and after protein separation the gel was stained with Coomassie Blue. As shown in FIG. 12, a protein band with an apparent molecular weight slightly higher than OmpF was clearly visible in both OMV preparations. The simultaneous presence of both wild type and engineered OmpF in OMVs was in line with the fact that both protein species were expressed in the strains, the wild type OmpF being encoded by the chromosomal DNA while the engineered OmpF being encoded by the recombinant plasmid.

[0164] Analysis of vIII Expression on the Surface of OmpFvIII and OmpFvIIIx3 Recombinant Strains

[0165] Finally, the surface expression of the vIII peptide was analyzed by Flow Cytometry in BL21(DE3)/ompA(pET-OmpFvIII_L2), BL21(DE3)/ompA (pET-OmpFvIII_L4), BL21(DE3)/ompA (pET-OmpFvIII_L6), BL21(DE3)/ompA (pET-OmpFvIIIx3_L1), and BL21(DE3)/ompA (pET-OmpFvIIIx3_L4), strains. Bacterial cultures were grown at 37 C. under agitation. When cultures reached an OD600 value of 0.6, IPTG was added at a final concentration of 1 mM and bacteria were grown for 3 additional hours. Subsequently, 1 ml bacteria cells were collected by centrifugation at 5,000g for 5 minutes. After a wash in 1% BSA/PBS bacteria were resuspended in 5 ml 1% BSA/PBS. 50 l of cell suspensions were incubated with 5 l of an appropriate dilution of rabbit anti-vIII polyclonal antibodies raised against the vIII peptide conjugated to Keyhole Limpet Hemocyanin (KLH) or, as negative control, with 5 l of PBS containing 1% BSA. After 1 hour, the suspensions were centrifuged at 5.000g for 5 minutes and supernatants discarded. Pellets were washed with 100 l of PBS containing 1% BSA and bacteria subsequently incubated for 1 hour at 4 C. with goat anti-rabbit antibodies (Alexa flour488, Life Technology) added at a final dilution of 1:200. Finally, after a wash step, pellets were fixed with 100 l 4% formaldehyde/PBS, re-suspended in 100 l of PBS and analyzed with FACS CANTOII evaluating collected data with FlowJo software. As shown in FIG. 13, in the presence of anti-vIII antibodies, a clear shift in fluorescence intensity was observed in a substantial fraction of bacterial cells expressing the engineered OmpF proteins. No difference in fluorescence intensity was observed when E. coli BL21(DE3)/ompA expressing OmpF wt was incubated with anti-vIII antibodies. These data indicate that when used to replace the OmpF external loops, vIII peptide appeared on the surface of bacteria expressing the engineered OmpF proteins. Surface exposition was particularly pronounced when three copies of vIII peptide were used to replace the L1 and L4 loops of OmpF.

[0166] OMV Engineering with MBPvIII

[0167] pET-MBPvIII Plasmid Construction

[0168] In an attempt to deliver EGFRvIII peptide to the lumen of OMVs, the Maltose binding protein (MBP), which is naturally delivered to the periplasm, was used as a carrier (FIG. 1D). In essence, a fusion protein was designed constituted by the whole MBP carrying the 13 amino acid vIII peptide at its carboxyl terminus (FIG. 2A). For this purpose, the DNA sequence coding for MBP was amplified by PCR from E. coli K12-MG1655 genomic DNA, using primers NdI-MalEf and R1-MalEr. The forward primer (NdI-MalEf) anneals to the 5 end of malE, the gene coding for MBP; the reverse primer (R1-MalEr) anneals to the 3 end of malE (excluding the stop codon) and its 5 tail contains nucleotides 1-17 of the vIII sequence. Then, in order to complete the vIII coding sequence at the 3 of malE, a second and a third polymerase chain reactions were performed using the same forward primer (NdI-MalEf) but different reverse primers. The reverse primer used in the second amplification step (R2-MalEr) anneals to a region containing the 3 end of malE and nucleotides 1-17 of the vIII sequence; its 5 tail contains nucleotides 18-31 of the vIII sequence. The reverse primer used in the third amplification step (XhI-R3-MalEr) anneals to nucleotides 2-31 of the vIII sequence; its 5 tail contains nucleotides 32-39 of the vIII sequence and the TAA stop codon (Table 1 and FIG. 14). With the aim of cloning the fusion gene coding for MBPvIII in pET21 expression vector the PIPE cloning method was used (Klock and Lesley, 2009). Briefly, pET21 was amplified using primers petrev/nohisflag and the fusion gene coding for MBPvIII was reamplified using primers pET21-MalEf/pET21-R3-MalEr, which have 5 tails that generate extremities complementary to pET21 expression vector linear DNA (Table 1 and FIG. 14). E. coli HK100 transformation leads to the generation of pET-MBPvIII plasmid. The correctness of the cloning of the MBPvIII fusion in pET21 was verified by DNA sequencing (SEQ ID NO:101).

[0169] Expression of MBPvIII Heterologous Protein in E. coli BL21(DE3)/ompA

[0170] The recombinant plasmid encoding MBP fused to one copy of the EGFRvIII peptide was used to transform E. coli strain BL21(DE3)/ompA.

[0171] One recombinant strain was obtained: BL21(DE3)/ompA(pET-MBPvIII). The strain was grown in LB medium and when culture reached an OD600 value of 0.6, IPTG was added at 1 mM final concentration.

[0172] After two additional hours of growth at 37 C., cells were collected and 25 g of total protein extracts were analyzed by SDS-PAGE. As shown in FIG. 15A, a protein band with an electrophoretic mobility corresponding to MBPvIII accumulated in the protein extract prepared after IPTG induction. Western Blot of total cell extracts was also carried out to confirm the expression of MBPvIII. To this aim, 13 g of total proteins from each strain were separated by SDS-PAGE and proteins were transferred to nitrocellulose filters. The filters were blocked for 2 h at room temperature by agitation in blocking solution (10% skimmed milk and 0.05% Tween in PBS), followed by incubation for 90 minutes at 37 C. with a 1:1.000 dilution of rabbit anti-vIII polyclonal antibodies or mouse anti-MBP monoclonal antibody in 1% skimmed milk and 0.05% Tween in PBS. After 3 washing steps in PBS-Tween, the filters were incubated in a 1:5,000 dilution of peroxidase-conjugated anti-rabbit or anti-mouse immunoglobulin (Dako) in 1% skimmed milk and 0.05% Tween in PBS for 1 hour at room temperature, and after 3 washing steps, bound conjugated IgGs were detected using the Super Signal West Pico chemo-luminescent substrate (Pierce). As shown in FIG. 15B, EGFRvIII fused to MBP was found expressed in the cell lysates. No immune reactive bands were detected in total lysates from E. coli cells carrying empty pET21 plasmid.

[0173] Expression of MBPvIII into OMVs

[0174] Having demonstrated that MBPvIII was expressed in E. coli BL21(DE3)/ompA strain, the presence of the antigen in the OMV fraction was analyzed. Strain BL21(DE3)/ompA(pET-MBPvIII) was grown in LB medium and when the culture reached an OD600 value of 0.6, IPTG was added at 1 mM final concentration. After two additional hours of growth at 37 C., vesicles were purified from culture supernatants by using ultrafiltration coupled to ultracentrifugation. More specifically, OMVs were collected from culture supernatants by filtration through a 0.22 m pore size filter (Millipore) and by high-speed centrifugation (200,000g for 2 hours). Pellets containing OMVs were finally suspended in PBS. The presence of the antigens in OMVs preparations was verified by SDS-PAGE and Western Blot analyses as described in the previous section. Data indicate that MBP carrying one copy of vIII peptide was incorporated into OMVs (FIGS. 16A and B).

[0175] Antibody Titers Elicited in Mice Immunized with MBPvIII in Engineered OMVs

[0176] To test whether OMVs purified from BL21(DE3)/ompA strain expressing MBPvIII were able to induce EGFRvIII-specific antibody responses, CD1 mice were i.p. immunized three times at two-week interval with 10 g OMVs in Alum. Blood samples were collected nine days after third dose administration and anti-vIII IgGs were detected by using plates coated in each well with 0.5 g of synthetic vIII peptide conjugated to Keyhole limpet hemocyanin (vIII-KHL). PBS containing 1% BSA was used as negative control. More specifically, coating was carried out by incubating plates overnight at 4 C. with 100 l of conjugated peptide (5 g/ml). Subsequently, wells were washed three times with PBST (0.05% Tween 20 in PBS, pH 7.4), incubated with 100 l of 1% BSA in PBS for 1 h at room temperature and washed again three times with PBST. Serial dilutions of serum samples in PBST containing 1% BSA were added to the plates, incubated 2 h at 37 C., and washed three times with PBST. Then 100 l/well of 1:2,000 diluted, alkaline phosphatase-conjugated goat anti-mouse IgGs were added and left for 2 h at 37 C. After triple PBST wash, bound alkaline phosphatase-conjugated antibodies were detected by adding 100 l/well of 3 mg/ml para-nitrophenyl-phosphate disodium hexahydrate (Sigma-Aldrich) in 1M diethanolamine buffer (pH 9.8). After 10 minute incubation at room temperature, the reaction was stopped with 100 l 7% EDTA and substrate hydrolysis was analyzed at 405 nm in a microplate spectrophotometer. As shown in FIG. 17, OMVs carrying MBPvIII fusion protein were able to induce high anti-vIII IgG titers in mice.

[0177] Engineered OMVs Expressing FAT1 Peptide

[0178] Two strategies were designed to deliver the FAT1 peptide to the E. coli OMVs. The first strategy envisaged the fusion of FAT1 peptide to the carboxyl terminus of either full length fHbp or fHbpDomA. For this purpose, a synthetic DNA fragment encoding three copies of IQVEATDKDLGPNGHVTYSIVTDTD peptide was ligated to the 3 end of the full length fHbp gene and to the DNA sequence coding for the Domain A of fhbp (fHbpDomA), thus generating chimeric proteins carrying the FAT1 peptide at their C-terminus.

[0179] The second strategy was designed to deliver the FAT1 peptide into the lumen of OMVs. To this aim, the synthetic DNA coding for three copies of the FAT1 peptide was fused to the 3 end of the MBP gene to create an in frame C-terminal fusion.

[0180] Construction of pET21_FL-fHbp-FAT1 and pET21_fHbp-DomA-FAT1 Plasmids

[0181] The fusion of three copies of the FAT1 peptide to full length fHbp (FL-fHbp) and to fHbp-DomA was carried out in two main steps. First, the DNA fragments encoding FL-fHbp and fHbp-DomA were cloned into plasmid pET21, thus generating plasmids pET21-fHbp and pET21-fHbp-DomA. Subsequently, the two plasmids were linearized to clone the synthetic DNA encoding three copies of FAT1 peptide (FAT1 Minigene) at the end of fHbp and fHbp-DomA coding sequences. The sequence of FAT1 Minigene was designed taking into consideration BL21 E. coli codon usage (SEQ ID NO:102).

[0182] pET21 FL-fHbp and pET21 fHbp-DomA were generated as described in section 5.1.1.

[0183] To generate pET21_FL-fHbp-FAT1 and pET21_fHbp-DomA-FAT1 plasmids, pET21-fHbp and pET21-fHbp-DomA were linearized by PCR amplification using the two couples of primers FHBP-F/FHBPFL-R and FHBP-F/FHBPDA-R (Table 2) and the linear fragments were combined with the synthetic DNA coding for FAT1 Minigene (Table 2, Sequence 18). FAT1 Minigene was constructed by assembling six complementary oligonucleotides the sequence of which is reported in Table 2 and the assembled DNA fragment was amplified with primers F-FATFH/R-FATFH F-FATDomA/R-FATFH (Table 2) to make its extremities complementary to linearized pET21 FL-fHbp and pET21_FL-fHbpDomA, respectively. The DNA mixtures were then used to transform E. coli HK100 competent cells and clones carrying pET21_FL-fHbp-FAT1 and pET21_fHbp-DomA-FAT1 plasmids were selected on LB agar plates supplemented with 100 g/ml Amplicillin. From one clone of each transformation the plasmid was purified and the correctness of the fHbp-FAT1 and fHbpDomA-FAT1 gene fusions was verified by DNA sequencing (SEQ ID NOs:104 and 103).

[0184] pET-MBP-FAT1 Plasmid Construction

[0185] To express FAT1 peptide in the lumen of OMVs, the Maltose binding protein (MBP) which is naturally delivered to the periplasm was used as a carrier and the FAT1 Minigene was cloned as an in frame fusion to the 3 end of the MBP gene. For this purpose, plasmid pET-MBPvIII (see Section 5.1.3) has been used as template for a PCR reaction carried out according to the PIPE method (Klock H. E. and Lesley S. A (2009) Methods Mol. Biol. 498, 91-103), using primers pET21-MBPF and pET21-MBPR (see Table 2) to generate a linear fragment missing the vIII coding sequence. Then, the linear fragment was ligated to FAT1 Minigene, which was assembled in vitro using the six synthetic oligonucleotides reported in Table 2 and subsequently amplified with primers MBPFA-F and MBPFA-R. The DNA mixture was used to transform MK-100 competent cells and clones carrying pET-MBP-FAT1 plasmid were selected on LB agar plates supplemented with 100 g/ml of Ampicillin. The correctness of the MBP and FAT1 Minigene fusion in pET-MBP-FAT1 plasmid purified from one of the Ampicillin resistant clones was verified by DNA sequencing (SEQ ID NO:105).

[0186] Expression of fHBP-FAT1 and MBP-FAT1 Peptide in E. coli BL21(DE3)ompA

[0187] Plasmids pET21 FL-fHbp-FAT1, pET21_fHbp-DomA-FAT1 and pET-MBP-FAT1 were used to transform BL21(DE3) ompA strain. Recombinant clones were grown in 200 ml LB medium at 37 C and when the cultures reached OD600=0.6, the expression of the fusion proteins was induced by addition of 1 mM IPTG. After 2 hour growth, the expression of protein fusions was assessed by SDS-PAGE and Western Blot. To this aim, the equivalent in volume of 1 OD.sub.600 of each bacterial culture was collected, centrifuged at 13,000g for 5 minutes and pellets were lysed in 200 l of BPer Reagent, Lysozime 1 mg/ml, DNAase 10 U/ml and 0.1 mM MgCl.sub.2 for 30 minutes. Then the samples were centrifuged at 13.000g for 20 minutes to separate the supernatants (soluble fraction) from the pellets (insoluble fraction). The soluble fraction was collected (200 l) and diluted with 100 l of 4SDS-PAGE loading buffer while the pellets were re-suspended in 300 l of 2 loading buffer. 20 l of each sample were loaded onto an SDS-polyacrylamide gel and the proteins separated by electrophoresis (SDS-PAGE).

TABLE-US-00002 TABLE2 PrimersusedtofuseFAT1andMUC1tofHbpandfHbpDomAusingplasmids pET21_fHbpFLandpET21_fHbpDomA fHbp-F TAACATCACCATCACCATCACGATTACAAAGA fHbpFL-R TTATTGCTTGGCGGCAAGGC fHbpDomA-R TTGTTTGTATACTTGGAACTCTCCACTCTC PrimersusedtofuseFAT1andMUC1toMBPusingplasmidpET21-MBPvIII pET21-MBPF CATCACCATCACCATCACGATTAC pET21-MBPR CTTGGTGATACGAGTCTGCGCGTC Oligosusedtoassemblethesyntheticgene(FAT1Minigene)codingfor threecopiesFAT1peptide F1-FAT ATTCAAGTGGAAGCGACTGACAAAGATCTGGGCCCGAATG GCCAT R1-FAT ATCTGTATCCGTAACGATTGAATAAGTTACATGGCCATTCG GGCC F2-FAT ACGGATACAGATATCCAGGTAGAGGCAACCGATAAAGATT TAGGTCCC R2-FAT GGTATCCGTTACGATACTATATGTGACGTGGCCATTGGGAC CTAAATC F3-FAT GTAACGGATACCGACATTCAGGTGGAAGCTACCGATAAAG ACCTGGGTCCG R3-FAT ATCTGTATCGGTAACAATAGAATACGTCACGTGACCATTCG GACCCAGGTC PrimerstoinsertFAT1MinigenegeneintopET21_fHbpFL,pET21_fHbpDomA andpET21_MBP F-FATFH CTTGCCGCCAAGCAAATTCAAGTGGAAGCG F-FATDomA CAAGTATACAAACAAATTCAAGTGGAAGCG R-FATFH GTGATGGTGATGGTGATGTTAATCTGTATCGGTAAC MBPFA-F CGCGCAGACTCGTATCACCAAGATTCAAGTGGAAGCG MBPFA-R TCGTGATGGTGATGGTGATGTTAATGCGCCGGCGGAGC

[0188] Then the gel was stained with Coomassie blue overnight at room temperature. For Western blot analysis 5 l of the same samples were loaded onto a 4-12% polyacrilamide gel (Invitrogen). After electrophoretic separation proteins were transferred onto nitrocellulose filter by standard methods. The filters were blocked overnight at 4 C. by agitation in blocking solution (10% skimmed milk and 0.1% Tween in PBS), followed by incubation for 90 minutes at 37 C. with anti-FAT1 mAb198.3 at 3 g/ml in 1% skimmed milk and 0.1% Tween in PBS. After three washing steps in PBS-Tween, the filters were incubated in a 1:5.000 dilution of peroxidase-conjugated anti-mouse immunoglobulin (PerkinElmer) in 1% skimmed milk and 0.1% Tween in PBS for an hour, and after three washing steps, bound conjugated IgGs were detected using the Super Signal West Pico chemo-luminescent substrate (Pierce) and the resulting signal was detected by using the Western lighting plus ECL (PerkinElmer).

[0189] As shown in FIG. 18A and FIG. 18B, protein species with apparent molecular mass corresponding fHbp-FAT1, fHbpDomA-FAT1 and MBP-FAT1 were clearly visible after Coomassie Blue staining of SDS-polyacrylamide gels. The proteins largely compartmentalized in the insoluble fraction and were expressed after IPTG induction. The Western Blot analysis using anti-FAT1 mAb198.3 confirmed that the proteins expressed after IPTG induction carried the FAT1 peptide (FIG. 18C).

[0190] Expression of fHbp-FAT1, fHbpDomA-FAT1 and MBP-FAT1 into OMVs

[0191] Having demonstrated that fHbp-FAT1, fHbpDomA-FAT1 and MBP-FAT1 peptide were expressed in E. coli BL21(DE3)/ompA, the presence of the fusions in the OMV fraction was analyzed. 200 ml of the bacterial cultures BL21(DE3)/ompA (pET-fHbp-FAT1), BL21(DE3)/ompA (pET-fHbpDomA-FAT1) and BL21(DE3)/ompA (pET-MBP-FAT1) were grown in LB and when the cultures reached an OD.sub.600=0.6 were induced with 1 mM IPTG. Vesicles were purified from the culture supernatants by using ultrafiltration coupled to ultracentrifugation. Briefly, cultures were centrifuged at 4000g for 15 min, and the supernatants were concentrated using a membrane with a cut off of 100 kDA (Amicon) until a final volume of 30 ml was reached. Then an ultracentrifugation step was performed at 160.000g for 2 hours. The pellets were re-suspended in 200 l of PBS. Protein quantization was performed by DC Protein Assay (BioRad). The presence of the specific antigen in OMVs preparation was verified by Western Blot and SDS-PAGE analysis as already described by loading 10 g of total proteins of each OMV preparation. As shown in FIG. 19A the three fusion constructs compartmentalized in OMVs with bands corresponding to the expected molecular mass visible by Coomoassie Blue staining of the gels.

[0192] The presence of FAT1 peptide in the three fusion proteins was also confirmed by Western Blot, where the anti FAT1 mAb198.3 recognized the three protein species visible in the OMVs preparations by Coomassie Blue staining (FIG. 19B).

[0193] Analysis of fHBP-FAT1 Expression on the Surface of E. coli BL21(DE3) ompA by FACS

[0194] In order to confirm the ability of fHbp to deliver the FAT1 peptide on the outer membrane of E. coli ompA, FAT1 expression on the bacterial surface was analyzed by FACS.

[0195] BL21(DE3)/ompA (pET-fHbp-FAT1) and BL21(DE3)/ompA (pET-fHbpDomA-FAT1) E. coli strains were grown in 10 ml LB medium at 37 C and when the cultures reached OD.sub.600=0.6, the expression of the fusion proteins was induced by addition of 1 mM IPTG. After 2 hour growth bacteria cells corresponding to those contained in 1 ml culture at OD.sub.600=1 were collected by centrifugation at 13.000g for 5 minutes and pellets were re-suspended in 50 ml of PBS containing 1% BSA. 50 l of cell suspensions were incubated with 50 l of an appropriate dilution of anti-FAT1 mAb198.3 or, as negative control, with 50 l of PBS containing 1% BSA. After 1 hour, 100 l of PBS containing 1% BSA were added and the suspensions were centrifuged at 3.000g for 10 minutes and supernatants discarded. Pellets were washed with 200 l of PBS containing 1% BSA and bacteria subsequently incubated for 30 minutes on ice with goat anti-mouse antibodies (Alexa flour488, Life Technology) added at a final dilution of 1:200. Finally, After 2 wash steps, pellets were re-suspended in 200 l of PBS and analyzed with FACS CANTOII evaluating collected data with FlowJo software. As shown in FIG. 20, the FAT1 peptide, fused to fHbpDomA and fHbpFL, was clearly expressed on the surface of E. coli as indicated by the shift in fluorescence intensity observed after incubation of bacterial cells with anti-FAT1 specific monoclonal antibody.

[0196] Antibody Titers Elicited in Mice Immunized with fHbp-FAT1, fHbpDomA-FAT1 and MBP-FAT1 in Engineered OMVs

[0197] To test whether OMVs purified from BL21(DE3)/ompA strain expressing fHbpFLFAT1, fHbpDomA-FAT1 and MBP-FAT1 were capable of inducing FAT1 peptide-specific antibody responses, groups of CD1 mice (5 mice per group) were i.p. immunized three times at two-week interval with 20 ug OMVs in Alum. After two weeks from the third immunization, sera were collected and pooled to analyze anti-FAT1 antibody titers by ELISA. ELISA was performed using plates coated with synthetic FAT1 peptide conjugated to the carrier protein Keyhole limpet hemocyanin (KLH). Coating was carried out at room temperature for 14 hours by adding to each well 100 l of conjugated peptide at a concentration of 5 g/ml. After three washes with 200 l/well of PBS supplemented with 0.05% Tween 20 (PBST) the plates were incubated one hour at 37 C with 100 l/well of PBS containing 1% BSA and subsequently washed three times with PBST. Different dilutions of sera in PBST containing 0.1% BSA were added in duplicate in a final volume of 100 l/well and plates were stored at 37 C for 2 hours. After three washes in PBST, 100 l of goat anti-mouse antibodies conjugated to alkaline phosphatase (SouthernBiotech, Cat. 1030-04, 1:2.000 dilution) were added to each well and incubated at 37 C for 1 hour. Finally, after three washes, the phosphatase substrate (4-Nitrophenyl phosphate disodium salt) was added to each well at a concentration of 1 mg/ml (100 ml/well) and after 30 minutes incubation at room temperature in the dark, substrate hydrolysis was measured spectrophotometrically at 405 nm. As shown in FIG. 23B, OMV engineered with FAT1 induced high concentrations of anti-FAT1 antibodies detectable even at serum dilutions higher them 1:24.000. In particular, OMV expressing fHbpFL-FAT1 and MBP-FAT1 induced antibodies titers which at the highest dilution (1:24.000) still gave saturating OD values similar to what observed with the anti-FAT1 mAb 198.3 which at 1:24.000 dilution corresponded to a concentration of 100 ng/ml. No significant titer against conjugated FAT1 was detected using sera from mice immunized with OMV engineered with the uncorrelated peptide MUC1.

[0198] Engineered OMVs Expressing MUC1 Peptide

[0199] Two strategies were designed to deliver the MUC1 peptide to E. coli OMVs. The first strategy was designed to deliver MUC1 peptide to the membrane of the vesicles by fusing MUC1 to the C-terminus of fHbpDomA. To achieve this, a synthetic DNA fragment encoding five copies of the MUC1 peptide GVTSAPDTRPAPGSTAPPAH was ligated to the 3 end of the gene coding for Domain A of fHbp (fHbpDomA).

[0200] The second strategy was designed to deliver the MUC1 peptide into the lumen of OMVs. To this aim, the synthetic DNA coding for five copies of the peptide was fused to the 3 end of the MBP gene to create an in frame C-terminal fusion.

[0201] OMV Engineering with fHbpDomA-MUC1 Peptide

[0202] The fusion of five copies of the MUC1 peptide to fHbp-DomA was carried out in two main steps. First, the DNA fragment encoding fHbp-DomA were cloned into plasmid pET21 thus generating plasmid pET21 fHbp-DomA as already described. Subsequently, the plasmid was linearized by PCR and ligated to the synthetic DNA fragment encoding five copies of MUC1 peptide (MUC1 Minigene). The sequence coding for MUC1 Minigene was designed taking into consideration the E. coli codon usage. More specifically, pET21 fHbp-DomA was generated as follows. The fHbpDomA gene was amplified by PCR from Neisseria meningitidis serogroup B strain MC58 genome. The primers were designed to amplify the gene with its natural leader sequence for secretion and the lipobox. The polymerase incomplete primer extension (PIPE) cloning method (Klock H. et al., 2009) was used to insert the PCR product into plasmid pET21b which was amplified using primers pet-rev/nohisflag (Table 2). In so doing plasmid pET21 fHbp-DomA was generated (see also above for additional details).

[0203] To generate pET21 fHbp-DomA-FAT1 plasmid the PIPE cloning method was used. pET21_fHbp-DomA was linearized by PCR amplification using primers FHBP-F and FHBPDA-R (Table 2) and the linear fragment was combined with the synthetic DNA coding for MUC1 Minigene (Table 2 and Sequence 22). MUC1 Minigene was constructed by assembling ten complementary oligonucleotides the sequence of which is reported in Table 3 and the assembled DNA fragment was amplified with primers RMUCFH and FMUCDomA (Table 3) to make its extremities complementary to the amplified vector. The DNA mixture was then used to transform E. coli HK100 competent cells and clones carrying pET21_fHbp-DomA-MUC1 plasmid were selected on LB agar plates supplemented with 100 g/ml Amplicillin. From one clone the plasmid was purified and the correctness of the fHbpDomA-MUC1 gene fusion was verified by DNA sequencing (SEQ ID NO:107).

[0204] pET-MBP-MUC1 Plasmid Construction

[0205] To express MUC1 peptide in the lumen of OMVs, the Maltose binding protein (MBP) which is naturally delivered to the periplasm was used as a carrier and the MUC1 Minigene was cloned as an in frame fusion to the 3 end of the MBP gene. For this purpose, plasmid pET-MBPvIII (see Section 5.1.3) has been used as template for a PCR reaction carried out according to the PIPE method (Klock H. E. and Lesley S. A (2009) Methods Mol. Biol. 498, 91-103), using primers pET21-MBPF and pET21-MBPR (see Table 2) to generate a linear fragment missing the vIII coding sequence. Then, the linear fragment was ligated to MUC1 Minigene constructed as described above and amplified with primers MBPMU-F and MBPMU-R (Table 3) to make its extremities complementary to the amplified vector. The DNA mixture was then used to transform E. coli HK100 competent cells and clones carrying pET21_MBP-MUC1 plasmid were selected on LB agar plates supplemented with 100 g/ml Amplicillin. From one clone the plasmid was purified and the correctness of the MBP-MUC1 gene fusion was verified by DNA sequencing (SEQ ID NO:108).

TABLE-US-00003 TABLE3 SyntheticoligonucleotidesusedforassemblingtheMUC1Minigene codingfrom5copiesofMUC1 F1-MUC GGGGTGACGAGCGCGCCAGATACACGTCCGGCTCCT R1-MUC ATGCGCCGGCGGGGCCGTCGAGCCAGGAGCCGGACG F2-MUC CCGCCGGCGCATGGAGTAACGTCAGCACCAGACACGCGCC CG R2-MUC GTGGGCAGGGGGAGCGGTGGATCCCGGTGCCGGGCGCG TGTC F3-MUC CCCCCTGCCCACGGTGTTACTAGTGCGCCCGATACCCGT CCA R3-MUC ATGCGCCGGCGGCGCGGTGGAGCCCGGTGCTGGACGGG TATC F4-MUC CCGCCGGCGCATGGAGTCACGTCAGCACCGGACACTCGT CCA R4-MUC GTGTGCTGGAGGCGCGGTTGAACCCGGGGCTGGACGAGT GTC F5-MUC CCTCCAGCACACGGCGTCACCTCAGCTCCAGATACGCGC CCG R5-MUC ATGTGCCGGCGGAGCGGTACTGCCTGGGGCCGGGCGCGT ATC PrimersusedtoinsertMUC1MinigeneintopET21_fHbpDomAandpET21_MBP R-MUCFH GTGATGGTGATGGTGATGTTAATGCGCCGGCGGAGC F-MUCDomA CAAGTATACAAACAAGGGGTGACGAGCGCG MBPMU-F CGCGCAGACTCGTATCACCAAGGGGGTGACGAGCGCG MBPMU-R TCGTGATGGTGATGGTGATGTTAATGCGCCGGCGGAGC

[0206] Expression of fHbpDomA-MUC1 and MBP-MUC1 Fusions in E. coli BL21(DE3) ompA

[0207] Plasmids pET21_fHbp-DomA-MUC1 and pET-MBP-MUC1 were used to transform BL21(DE3) ompA strain. Recombinant clones were grown in 200 ml LB medium at 37 C and when the cultures reached OD600=0.6, the expression of the fusion proteins was induced by addition of 1 mM IPTG. After 2 hour growth, the expression of protein fusions was assessed by SDS-PAGE. To this aim, the equivalent in volume of 1 OD.sub.600 of bacteria culture was collected, centrifuged at 13.000g for 5 minutes and pellets were lysed in 200 l of BPer Reagent, Lysozime 1 mg/ml, DNAase 10 U/ml and 0.1 mM MgCl.sub.2 for 30 minutes. Then the samples were centrifuged at 13.000g for 20 minutes to separate the supernatants (soluble fraction) from the pellets (insoluble fraction). The soluble fractions were collected (200 ul) and diluted with 100 l of 4SDS-PAGE loading buffer while the pellets were re-suspended in 300 l of 2 loading buffer. 20 l of each sample were loaded onto an SDS-polyacrylamide gel and proteins separated by electrophoresis (SDS-PAGE). Then the gel was stained with Coomassie blue overnight at room temperature. As shown in FIG. 21, protein species with apparent molecular mass corresponding fHbpDomA-MUC1 and MBP-MUC1 were visible after Coomassie Blue staining of SDS-polyacrylamide gels. The proteins largely compartmentalized in the insoluble fractions and were expressed after IPTG induction.

[0208] Compartmentalization of fHbpDomA-MUC1 and MBP-MUC1 Fusions into OMVs

[0209] Having demonstrated that fHbpDomA-MUC1 and MBP-MUC1 were expressed in E. coli BL21(DE3)/ompA, the presence of the fusions in the OMV compartment was analyzed. To this aim, 200 ml of the bacterial cultures BL21(DE3)/ompA (pET-fHbpDomA-MUC1) and BL21(DE3)/ompA (pET-MBP-MUC1) were grown in LB and when the cultures reached an OD.sub.600=0.6 were induced with 1 mM IPTG. Vesicles were purified from the culture supernatants by using ultrafiltration coupled to ultracentrifugation. Briefly, cultures were centrifuged at 4.000g for 15 min, and the supernatants were concentrated using a membrane with a cut off of 100 kDA (Amicon) until a final volume of 30 ml was reached. Then an ultracentrifugation step was performed at 160.000g for 2 hours. The pellets were re-suspended in 200 l of PBS. Protein quantization was performed by DC Protein Assay (BioRad). The presence of the fusion proteins in the OMVs preparation was verified by SDS-PAGE analysis as already described by loading 10 g of total proteins of each OMV preparation. As shown in FIG. 22, the two fusion constructs compartmentalized in OMVs as indicated by the appearance of protein bands corresponding to the expected molecular mass.

[0210] Antibody Titers Elicited in Mice Immunized with Engineered OMVs Carrying fHbpDomA-MUC1 and MBP-MUC1

[0211] To test whether OMVs purified from BL21(DE3)/ompA (pET-fHbpDomA-MUC1) and BL21(DE3)/ompA (pET-MBP-MUC1) strains were capable of inducing MUC1-specific antibody responses, CD1 mice (5 mice per group) were i.p. immunized three times at two-week intervals with 20 g of engineered OMVs in Alum. After two weeks from the third immunization, sera were collected and pooled to analyze anti-MUC1 antibody titers by ELISA. ELISA was performed using plates coated with the synthetic MUC1 peptide GVTSAPDTRPAPGSTAPPAH. Coating was carried out at room temperature for 14 hours by adding to each well 100 l of a solution of synthetic MUC1 peptide at a concentration of 5 g/ml. After three washes with 200 l/well of PBS supplemented with 0.05% Tween 20 (PBST) the plates were incubated one hour at 37 C with 100 l/well of PBS containing 1% BSA and subsequently washed three times with PBST. Different dilutions of sera in PBST containing 0.1% BSA were added in duplicate in a final volume of 100 l/well and plates were stored at 37 C for 2 hours. After three washes in PBST, 100 l of goat anti-mouse antibodies conjugated to alkaline phosphatase (SouthernBiotech, Cat. 1030-04, 1:2.000 dilution) were added to each well and incubated at 37 C for 1 hour. Finally, after three washes, the phosphatase substrate (4-Nitrophenyl phosphate disodium salt) was added to each well at a concentration of 1 mg/ml (100 l/well) and after 30 minute incubation at room temperature in the dark, substrate hydrolysis was measured spectrophotometrically at 405 nm. As shown in FIG. 23A, OMV engineered with MUC1 induced high concentrations of anti-MUC1 antibodies detectable even at serum dilutions higher them 1:24.000. In particular, both engineered OMV expressing fHbpDomA-MUC1 and MBP-MUC1 induced antibodies titers which at the highest dilution (1:24.000) still gave saturating OD values. No relevant titers against MUC1 peptide was detected using sera from mice immunized with OMV engineered with the uncorrelated peptide FAT1.

[0212] Engineered OMVs Expressing Aa-fHbp

[0213] pET-Aa-fHbp-HIS8 Plasmid Construction

[0214] The gene encoding the 828 bp lipoprotein gna1870 like-protein was chemically synthetized (GeneArt Gene Synthesis, Thermo Fisher Scientific) using the reported gene sequence (EnsemblBacteria gene ID HMPREF9996_00541) from Aggregatibacter actinomycetemcomitans Y4 with the exception that the natural GTG start codon was replaced by an ATG start codon. The synthetic gene (SEQ ID NO:116) was cloned into pET21b.sup.+ fused to a 8-HIS tag at the C-term for subsequent detection of the protein using an anti-HIS polyclonal antibody. For cloning: the synthetic gene was amplified by PCR using the AgfHbp_F and AgfHbp_R primers, and annealed to pET21b.sup.+ plasmid backbone amplified with pET HIS-F and pET 2-R primers (Table1).

[0215] Expression of the Aa-fHbp Heterologous Protein in E. coli BL21(DE3)/ompA Strain

[0216] To investigate whether Aa-fHbp was surface-associated when expressed in E. coli, the pET_Aa-fHbp-Hiss recombinant plasmid was used to transform E. coli BL21ompA and the expression and localization of Aa-fHbp was analyzed as described previously. Each strain was grown in LB medium and when cultures reached an OD.sub.600 value of 0.6, IPTG was added at 1 mM final concentration. After two additional hours of growth at 37 C., cells were collected and total protein extracts were analyzed by SDS-PAGE followed by Coomassie staining. No bands were visible in total lysates from E. coli cells carrying empty pET21 plasmid. A band corresponding to the Aa-fHbp protein is detected in the total lysate of the strain carrying the pET_Aa-fHbp-Hiss recombinant plasmid as detected by Coomassie.

[0217] Analysis of Aa-fHbp Expression in OMVs

[0218] Having demonstrated that the exogenous Aa-fHbp protein was well expressed in E. coli BL21(DE3)/ompA strain, we then analysed its cellular localization and compartimentalization to the OMV fraction. The recombinant strain BL21(DE3)/ompA(pETAa-fHbp-_HIS8) was grown in LB medium and when the cultures reached an OD.sub.600 value of 0.6, IPTG was added at 1 mM final concentration. After two additional hours of growth at 37 C., vesicles were purified from culture supernatants by using ultrafiltration coupled to ultracentrifugation. More specifically, OMVs were collected from culture supernatants by filtration through a 0.22 m pore size filter (Millipore) and by high-speed centrifugation (200.000g for 2 hours). Pellets containing OMVs were finally suspended in PBS. The presence of the Aa-fHbp_HIS8 fusion protein in OMVs preparations was verified by Coomassie and Western Blot analysis as described in the previous section (FIG. 24). Data indicate that the recombinant protein was incorporated into OMVs as shown by the presence of the corresponding correct molecular weight band in the Coomassie stained SDS-PAGE and a specular specific band in the western blot analysis probed by anti-His tag antibody.

[0219] Analysis of Cellular Localization of Aa-fHbp

[0220] The localization of recombinant Aa-fHbp protein was evaluated by flow cytometry. To this aim, recombinant E. coli strains BL21(DE3)/ompA(pET-Aa-fHbp-HIS8) and E. coli BL21(DE3)/ompA(pET21), as negative control, were grown at 37 C. under agitation. When cultures reached an OD.sub.600 value of 0.6, IPTG was added at a final concentration of 1 mM and bacteria were grown for 2 additional hours. Subsequently, bacteria cells corresponding to those contained in 1 ml culture at OD.sub.600=1 were collected by centrifugation at 13,000g for 5 minutes and pellets were re-suspended in 50 ml of PBS containing 1% BSA. 50 l of cell suspensions were incubated with 50 l of an appropriate dilution of anti-His-tag antibody with 50 l of PBS containing 1% BSA as negative control. After 1 hour, 100 l of PBS containing 1% BSA were added and the suspensions were centrifuged at 3,000g for 10 minutes and supernatants discarded. Pellets were washed with 200 l of PBS containing 1% BSA and bacteria subsequently incubated for 30 minutes on ice with goat anti-mouse antibodies (Alexa flour488, Life Technology) added at a final dilution of 1:2,000. Finally, After 2 wash steps, pellets were re-suspended in 200 l of PBS and analyzed with FACS CANTOII evaluating collected data with FlowJo software. As shown in FIG. 24, in the presence of anti-his-tag antibody, a clear shift in fluorescence intensity was observed in a substantial fraction of bacterial cells expressing Aa-fHbp-HIS8 fusion protein. No difference in fluorescence intensity was observed when E. coli BL21(DE3)/ompA were incubated with anti-his-tag antibody. Taken together these data indicate not only that AafHbp is expressed in E. coli BL21(DE3)/ompA and is associated to the outer membrane but is also capable of exposing a foreign tag fused to its C-terminal portion to the extracellular compartment.