Thrombin Binding Circular Aptamer and Use Thereof

20230056099 · 2023-02-23

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided is a thrombin binding circular aptamer, the nucleotide sequence thereof being at least one selected from a) to e): a) a nucleotide sequence in SEQ ID NO:1, wherein the 5′ end and 3′ end are connected to form a ring; b) a nucleotide sequence obtained by substitution in the nucleotide sequence in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin; c) a nucleotide sequence obtained by deletion in the nucleotide sequence in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin; d) a nucleotide sequence obtained by adding one or more nucleotides to the nucleotide sequence in SEQ ID NO:1; and e) a nucleotide sequence obtained by modification of the nucleotide sequence in SEQ ID NO:1 with a chemical group.

    Claims

    1. A thrombin binding circular aptamer, characterized in that, the thrombin binding circular aptamer has a nucleotide sequence of at least one selected from a) to e): a) a nucleotide sequence as shown in SEQ ID NO:1, wherein the 5′ end and 3′ end are connected to form a ring, the nucleotide sequence as shown in SEQ ID NO:1 being TABLE-US-00011 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGT TGGCTGACAATACTCGTTTTTGGTGTCTCGGAT-3′; b) a nucleotide sequence obtained by substitution in the nucleotide sequence as shown in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin, wherein the nucleotide sequence obtained by substitution in the nucleotide sequence as shown in SEQ ID NO:1 has over 80% homology with the SEQ ID NO:1; c) a nucleotide sequence obtained by deletion in the nucleotide sequence as shown in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin, wherein the nucleotide sequence obtained by deletion in the nucleotide sequence as shown in SEQ ID NO:1 has over 70% homology with the nucleotide sequence as shown in SEQ ID NO:1; d) a nucleotide sequence obtained by adding one or more nucleotides to the nucleotide sequence as shown in SEQ ID NO:1, the obtained nucleotide sequence being a circular DNA molecule capable of specific recognition of thrombin, wherein the nucleotide sequence obtained by adding one or more nucleotides to the nucleotide sequence as shown in SEQ ID NO:1 has over 80% homology with the nucleotide sequence as shown in SEQ ID NO:1; e) a nucleotide sequence obtained by modification of the nucleotide sequence as shown in SEQ ID NO:1 with a chemical group.

    2. The thrombin binding circular aptamer according to claim 1, characterized in that, the nucleotide sequence obtained by substitution in the nucleotide sequence as shown in SEQ ID NO:1 has over 90% homology with the SEQ ID NO:1.

    3. The thrombin binding circular aptamer according to claim 1, characterized in that, the nucleotide sequence obtained by substitution in the nucleotide sequence as shown in SEQ ID NO:1 comprises at least one from b1) to b5): b1) a nucleotide sequence as shown in SEQ ID NO:3, the nucleotide sequence as shown in SEQ ID NO:3 being TABLE-US-00012 5′-NNNNNNNCTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGT TGGCTGACAATACTCGTTTTTGGTGTCTCGGAT-3′; b2) a nucleotide sequence as shown in SEQ ID NO:4, the nucleotide sequence as shown in SEQ ID NO:4 being TABLE-US-00013 5′-ATCTCGANNNNNNNTAGGGGGCGCGAACATACGCGGTTGGTGTGGT TGGCTGACAATACTCGTTTTTGGTGTCTCGGAT-3′; b3) a nucleotide sequence as shown in SEQ ID NO:5, the nucleotide sequence as shown in SEQ ID NO:5 being TABLE-US-00014 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTT GGCTGACAANNNNNNNTTTTGGTGTCTCGGAT-3′; b4) a nucleotide sequence as shown in SEQ ID NO:6, the nucleotide sequence as shown in SEQ ID NO:6 being 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTTGGCTGACA ATACTCGTNNNNNNNGTCTCGGAT-3′; b5) a nucleotide sequence as shown in SEQ ID NO:7, the nucleotide sequence as shown in SEQ ID NO:7 being TABLE-US-00015 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTT GGCTGACAATACTCGTTTTTGGTNNNNNNNNN-3′; wherein, N represents at least one from A, T, C and G.

    4. The thrombin binding circular aptamer according to claim 3, characterized in that, the N represents T and/or A.

    5. The thrombin binding circular aptamer according to claim 1, characterized in that, the nucleotide sequence obtained by deletion in the nucleotide sequence as shown in SEQ ID NO:1 has over 80% homology with the SEQ ID NO:1.

    6. The thrombin binding circular aptamer according to claim 1, characterized in that, the nucleotide sequence obtained by deletion in the nucleotide sequence as shown in SEQ ID NO:1 comprises at least one from c1) to c3): c1) a nucleotide sequence as shown in SEQ ID NO:8, the nucleotide sequence as shown in SEQ ID NO:8 being TABLE-US-00016 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTT GGCTGACAATACTCGTGTCTCGGAT-3′; c2) a nucleotide sequence as shown in SEQ ID NO:9, the nucleotide sequence as shown in SEQ ID NO:9 being TABLE-US-00017 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTT GGCTGACAATACTCGT-3′; c3) a nucleotide sequence as shown in SEQ ID NO:10, the nucleotide sequence as shown in SEQ ID NO:10 being TABLE-US-00018 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGTGTGGTTG GCTGACAA-3′.

    7. The thrombin binding circular aptamer according to claim 1, characterized in that, the chemical group comprises: —NH.sub.2 or —F modified at the 2′-position of a pyrimidine ring, —OCH.sub.3 modified at the 2′-position of a purine ring, a phosphorothioate radical modified between adjacent nucleotides, and a pyrimidine analogue modified at the 5′-endpoint.

    8. A use of the thrombin binding circular aptamer according to claim 1 in preparation of thrombin inhibitors.

    9. A use of the thrombin binding circular aptamer according to claim 1 in preparation of drug products for prevention and/or treatment of diseases associated with thrombin.

    Description

    BRIEF DESCRIPTION OF DRAWINGS

    [0044] A more detailed description of exemplary embodiments of the present invention is provided in combination with drawings to demonstrate more clearly the above-mentioned and other objectives, features and advantages of the present invention.

    [0045] FIG. 1 shows the results of incubation of TBCA and thrombin binding aptamer (TBA) for different periods of time.

    [0046] FIG. 2 shows the results of inhibition of thrombin by the TBCA of the present invention and a random circular nucleic acid.

    [0047] FIG. 3 shows the results of inhibition of thrombin by the TBCA of the present invention.

    [0048] FIG. 4. shows the results of inhibition of thrombin by the TBCA of the present invention and an existing thrombin inhibitor Argatroban.

    DETAILED DESCRIPTION OF THE EMBODIMENTS

    [0049] Preferred embodiments of the present invention will be described in more detail below. While the present invention has been described in terms of the preferred embodiments of the present invention, it should be understood that the present invention may be embodied in a variety of forms and should not be limited by the embodiments set forth herein.

    [0050] See Table 1 for the nucleotide sequences of the DNA molecules used in the embodiments hereinafter:

    TABLE-US-00010 TABLE 1 Nucleotide sequences of DNA molecules Sequence Name Sequence Number Oligonucleotide Sequence TBCA SEQ ID NO: 1 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGT GTGGTTGGCTGACAATACTCGTTTTTGGTGTCTCGGAT-3′ TBA SEQ ID NO: 2 5′-GGTTGGTGTGGTTGG-3′ M1 SEQ ID NO: 3 5′-NNNNNNNCTAGTCATAGGGGGCGCGAACATACGCGGTTGGT GTGGTTGGCTGACAATACTCGTTTTTGGTGTCTCGGAT-3′ M2 SEQ ID NO: 4 5′-ATCTCGANNNNNNNTAGGGGGCGCGAACATACGCGGTTGGT GTGGTTGGCTGACAATACTCGTTTTTGGTGTCTCGGAT-3′ M3 SEQ ID NO: 5 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGT GTGGTTGGCTGACAANNNNNNNTTTTGGTGTCTCGGAT-3′ M4 SEQ ID NO: 6 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGT GTGGTTGGCTGACAATACTCGTNNNNNNNGTCTCGGAT-3′ M5 SEQ ID NO: 7 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGT GTGGTTGGCTGACAATACTCGTTTTTGGTNNNNNNNNN-3′ D1 SEQ ID NO: 8 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGT GTGGTTGGCTGACAATACTCGTGTCTCGGAT-3′ D2 SEQ ID NO: 9 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGT GTGGTTGGCTGACAATACTCGT-3′ D3 SEQ ID NO: 10 5′-ATCTCGACTAGTCATAGGGGGCGCGAACATACGCGGTTGGT GTGGTTGGCTGACAA-3′ Random SEQ ID NO: 11 5′-ATCTCGACTAGTCANNNNNNNNNNNNNNNNNNNNGGTTGGT circular GTGGTTGGNNNNNNNNNNNNNNNNNNNNTGTCTCGGAT-3′ nucleic acid (Lib) N in Table 1 represents a random nucleotide.

    [0051] Embodiment 1

    [0052] This present embodiment is provided to demonstrate that the thrombin binding circular aptamer (TBCA) of the present invention has a long half-life and a high biostability.

    [0053] Incubation of 0.5 μM of TBCA and TBA each (nucleotide sequences thereof are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively) was performed in 50% serum at a temperature of 37° C. Samples were taken for electrophoresis at 0 min, 1 min, 2 min, 5 min, 10 min, 30 min, 60 min (1 h), 120 min (2 h), 240 min (4 h), 480 min (8 h), 720 min (12 h) and 1440 min (24 h), respectively. The gray values of the electrophoretic bands were analyzed at the end and the results are shown in FIG. 1. FIG. 1 shows the mass remaining of TBCA and TBA after incubation together in 50% serum at 37° C. for a certain amount of time. As shown in FIG. 1, the half-life of TBA was approximately 2 min, whereas the half-life of TBCA was up to about 8 hours. It is hence demonstrated that the biostability of TBCA is significantly higher than that of TBA.

    [0054] Embodiment 2

    [0055] The present embodiment is provided to demonstrate that TBCA is capable of specific recognition of thrombin and has a highly efficient inhibition of thrombin.

    [0056] Thrombin (0.1 nM) and fibrinogen (2 μM) were incubated with TBCA and Lib of different concentrations separately in buffer systems (total reaction volume of 100 μL) for a certain amount of time (till reaction equilibrium was reached), and the IC.sub.50 values of TBCA and Lib were calculated by fitting of the absorbance of the reaction system measured at 350 nm on a microplate reader.

    [0057] The inhibition of thrombin-catalyzed conversion of fibrinogen to fibrin by TBCA and the random circular nucleic acid (Lib) was compared. Please refer to FIG. 2 for the results of inhibition of thrombin by the TBCA of the present invention and the random circular nucleic acid. As shown in FIG. 2, at a thrombin concentration of 0.1 nM, the IC.sub.50 of TBCA was 0.15 nM, whereas the IC.sub.50 of Lib was 72.14 nM. It is hence demonstrated that the inhibition of thrombin by TBCA is significantly better than that by the random circular nucleic acid (Lib).

    [0058] Embodiment 3

    [0059] The present embodiment is provided to demonstrate that the thrombin binding circular aptamer (TBCA) of the present invention has an efficient inhibition of thrombin.

    [0060] Thrombin (0.1 nM) and fibrinogen (2 μM) were incubated with TBCA, M1, M2, M3, M4, M5, D1, D2 and D3 of different concentrations separately in buffer systems (total reaction volume of 100 μL) for a certain amount of time (till reaction equilibrium was reached), and the IC.sub.50 values of TBCA, M1, M2, M3, M4, M5, D1, D2 and D3 were calculated by fitting of the absorbance of the reaction system measured at 350 nm on a microplate reader.

    [0061] Please refer to FIG. 3 for the results of inhibition of thrombin by the TBCA of the present invention. As shown in FIG. 3, at a thrombin concentration of 0.1 nM, the IC.sub.50 values of TBCA, M1, M2, M3, M4, M5, D1, D2 and D3 were 0.15 nM, 0.37 nM, 0.36 nM, 0.18 nM, 0.10 nM, 0.11 nM, 0.15 nM, 0.09 nM and 0.13 nM, respectively. It is hence demonstrated that, the thrombin binding circular aptamer (TBCA) of the present invention is capable of specific recognition of thrombin and has an efficient inhibition of thrombin.

    [0062] Embodiment 4

    [0063] The present embodiment is provided to demonstrate that the thrombin binding circular aptamer (TBCA) of the present invention has a more efficient inhibition of thrombin compared to existing thrombin inhibitors.

    [0064] Thrombin (0.1 nM) and fibrinogen (2 μM) were incubated with TBCA, TBA and Argatroban of different concentrations separately in buffer systems (total reaction volume of 100 μL) for a certain amount of time (till reaction equilibrium was reached), and the IC.sub.50 values of TBCA, TBA and Argatroban were calculated by fitting of the absorbance of the reaction system measured at 350 nm on a microplate reader.

    [0065] Please refer to FIG. 4 for the results of inhibition of thrombin by the TBCA of the present invention and the existing thrombin inhibitors, wherein the existing thrombin inhibitors were TBA and Argatroban, respectively. As shown in FIG. 4, the inhibition of thrombin by TBCA was significantly better than that by the existing thrombin binding aptamer and the anticoagulant chemical drug. TBCA, TBA that specifically targets α-thrombin, and Argatroban, a currently commonly used anticoagulant that specifically targets thrombin, were used as examples to determine the IC.sub.50 values by measuring the inhibition of thrombin-catalyzed conversion of fibrinogen to fibrin by these anticoagulants. At a thrombin concentration of 0.1 nM, the IC.sub.50 values of TBA and Argatroban were 1.3 nM and 3.0 nM, respectively, demonstrating that the inhibition effect on thrombin of TBCA was 13 times as high as that of the existing TBA that specifically targets a-thrombin, and 30 times as high as that of Argatroban.

    [0066] The embodiments of the present invention have been described above, and the foregoing description is illustrative, not limiting, and not limited to the disclosed embodiments. Numerous modifications and changes will be apparent to those skilled in the art without departing from the scope and spirit of the illustrated embodiments.