Klebsiella sp. strain and method for preparing microbial flocculant from same

Abstract

The example of the present invention discloses a klebsiella sp. strain and a method for preparing a microbial flocculant from the same. This strain is a Klebsiella sp. strain LDX1-1 which has been preserved in the China General Microbiological Culture Collection Center on Sep. 7, 2015, and the preservation number is CGMCC No. 11330. This strain can be used for preparing a microbial flocculate in an activated fermentation way.

Claims

1. A Klebsiella sp. strain LDX1-1, the preservation number of which is CGMCC No. 11330.

2. Application of the Klebsiella sp. strain LDX1-1 of claim 1 in preparing a microbial flocculant.

3. A method for preparing a microbial flocculant from the Klebsiella sp. strain LDX1-1 of claim 1, the method comprises: (1) liquid spawn culture activated slant spawn is inoculated into a liquid spawn culture medium, and then cultured while shaking at 150-180 r/min at 24-30 C. for 10-18 h to obtain a liquid spawn for later use; and the liquid spawn culture medium contains the following components in gram per liter: 10-15 g/L of sugar, 1.5-2.5 g/L of NH.sub.4NO.sub.3, 0.8-1.3 g/L of K.sub.2HPO.sub.4, 0.3-0.8 g/L of MgSO.sub.4, 0.3-0.8 g/L of NaCl, and 0.01-0.04 g/L of FeSO.sub.4; and (2) fermentation the liquid spawn is inoculated into a fermentation medium in a volume ratio of 2-4% and then fermented in a fermentation tank for 24-32 h to eventually obtain a fermentation broth at the end of fermentation, and the fermentation broth is filtered to remove impurities to eventually obtain a microbial flocculant; and the fermentation medium contains the following components in gram per liter: 15-30 g/L of sugar, 1.5-4.5 g/L of NH.sub.4NO.sub.3, 0.8-2.0 g/L of K.sub.2HPO.sub.4, 0.2-0.7 g/L of MgSO.sub.4, 0.2-0.8 g/L of NaCl, 0.01-0.04 g/L of FeSO.sub.4, 0.01-0.05 g/L of MnSO.sub.4, 0.1-0.4 g/L of extract of pine needles, 6-12 g/L of corn starch, 1-3 g/L of corn steep, and 0.018-0.040 g/L of ZnSO.sub.4.

4. The method for preparing a microbial flocculant according to claim 3, wherein the fermentation control conditions in the step (2) are as follows: temperature: 24-30 C.; air volume/culture volume/min: 0.25-0.8 VVM; and stirring speed: 200-600 r/min.

5. The method for preparing a microbial flocculant according to claim 3, wherein the liquid spawn culture medium contains the following components in gram per liter: 12 g/L of sugar, 2 g/L of NH.sub.4NO.sub.3, 0.8 g/L of K.sub.2HPO.sub.4, 0.5 g/L of MgSO.sub.4, 0.4 g/L of NaCl, and 0.013 g/L of FeSO.sub.4.

6. The method for preparing a microbial flocculant according to claim 3, wherein the fermentation medium contains the following components in gram per liter: 23 g/L of sugar, 2 g/L of NH.sub.4NO.sub.3, 1.2 g/L of K.sub.2HPO.sub.4, 0.5 g/L of MgSO.sub.4, 0.4 g/L of NaCl, 0.015 g/L of FeSO.sub.4, 0.02 g/L of MnSO.sub.4, 0.2 g/L of extract of pine needles, 7 g/L of corn starch, 1.8 g/L of corn steep, and 0.03 g/L of ZnSO.sub.4.

7. The method for preparing a microbial flocculant according to claim 4, wherein the liquid spawn culture medium contains the following components in gram per liter: 12 g/L of sugar, 2 g/L of NH.sub.4NO.sub.3, 0.8 g/L of K.sub.2HPO.sub.4, 0.5 g/L of MgSO.sub.4, 0.4 g/L of NaCl, and 0.013 g/L of FeSO.sub.4.

8. The method for preparing a microbial flocculant according to claim 4, wherein the fermentation medium contains the following components in gram per liter: 23 g/L of sugar, 2 g/L of NH.sub.4NO.sub.3, 1.2 g/L of K.sub.2HPO.sub.4, 0.5 g/L of MgSO.sub.4, 0.4 g/L of NaCl, 0.015 g/L of FeSO.sub.4, 0.02 g/L of MnSO.sub.4, 0.2 g/L of extract of pine needles, 7 g/L of corn starch, 1.8 g/L of corn steep, and 0.03 g/L of ZnSO.sub.4.

Description

DETAILED DESCRIPTION OF THE PRESENT INVENTION

Example 1: Screening of Strain

(1) (1) Sampling

(2) Moist soil below litters in the almond forest in the southern suburb of Jinan City, Shandong Province, China was selected. The soil surface was scraped off by an aseptic sampling shovel. Soil at a height 3-10 cm below the earth surface was put into an aseptic bag on which the sampling date, time, place and vegetation were marked, and the soil strain sample was put into a refrigerator at 4 C. as soon as possible. Enrichment and screening of spawn were performed on that day or within two days.

(3) (2) Screening

(4) All components (except lysozyme) in the enrichment culture solution prescription were prepared to a liquid culture medium. The liquid culture medium was distributed with 50 mL in each 250 mL flask, subjected to high-pressure steam sterilization at 121 C. for 25 min, cooled to 25-28 C., added with a corresponding amount of lysozyme under aseptic conditions, and evenly mixed. The collected strain sample was inoculated into the prepared enrichment culture solution, well shaken, and cultured while shaking the flask at 120-180 r/min at 20-27 C. for 2-3 days to obtain an enrichment culture bacteria solution.

(5) A selective culture medium was prepared, and a 9 cm plate was used as a selective culture medium plate. The enrichment culture bacteria solution was serially diluted, coated on the selective culture medium plate in a proper degree of dilution, and cultured at 20-27 C. for 2-3 days. Bacterial colonies having fast growth, high viscosity and light colored ring were selected. After purification, typical bacterial colonies were selected and inoculated into the slant culture medium, and stored in a refrigerator at 4 C. after being well cultured.

(6) The culture media will be specifically described as below:

(7) The enrichment culture solution contains the following components in gram per liter (g/L): 2 g/L of beef extract, 9 g/L of peptone, 5 g/L of NaCl, 0.6 g/L of MgSO.sub.4, 0.03 g/L of lysozyme (0.5 million U/g), and 1000 mL of distilled water.

(8) The selective culture medium contains the following components in gram per liter (g/L): 25 g/L of glycerol, 2.5 g/L of NaNO.sub.3, 1.2 g/L of K.sub.2HPO.sub.4, 0.4 g/L of MgSO.sub.4, 0.4 g/L of NaCl, 0.015 g/L of FeSO.sub.4, 2.0 g/L of CuSO.sub.4, 2.0 g/L of sodium propionate, and 15 g/L of purified agar powder.

(9) The slant culture medium contains the following components in gram per liter (g/L): 12 g/L of glycerol, 2.5 g/L of NaNO.sub.3, 0.9 g/L of K.sub.2HPO.sub.4, 0.6 g/L of MgSO.sub.4, 0.6 g/L of NaCl, 0.015 g/L of FeSO.sub.4, and 14 g/L of purified agar powder.

(10) (3) Identification of Strain

(11) The screened strain had the following individual morphological characteristics: long rod: 1.51.8 m2.55.0 m, and short rod: 1.51.8 m1.82.5 m; arrayed in a single one; with rich slime layer; no motion; no spore; and being aerobic.

(12) The screened strain had the following culture characteristics: opaque bacterial colonies which were protruded in the center, tidy in the margin, glossy and high in viscosity were produced on the beef extract and peptone culture medium plate; and bacterial lawns which were thick, glossy, high in viscosity and faint yellow were produced on the slant surface. The screened strain had the following physiological and biochemical characteristics: the catalase test was positive; in the peptone water culture medium, glucose, cane sugar, maltose and arabinose can be highly fermented to produce acid and gas, fructose, xylose, glycerol and lactose can be fermented to produce acid and gas, dextrin and starch can be slowly fermented to produce acid and gas, and xylitol cannot be fermented to produce acid and gas; the methyl red was negative and V-P was positive; it was resistant against 7% NaCl growth; 17 cm bulky bacterial colonies were formed on the starch hydrolysis plate after 2 days; the oil hydrolysis was negative; the gelatin hydrolysis was negative; the litmus milk was reduced; and the urease was positive.

(13) The following is the measurement result of the 16SrDNA sequence of this train (SEQ-1):

(14) TABLE-US-00001 ACGCTGGCGGCAGGCCTAACACATGCAAGTCGAGCGGTAGCACAGAGAGC TTGCTCTCGGGTGACGAGCGGCGGACGGGTGAGTAATGTCTGGGAAACTG CCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACG TCGCAAGACCAAAGTGGGGGACCTTCGGGCCTCATGCCATCAGATGTGCC CAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAGGCGACGATC CCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTC CAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAG CCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGC ACTTTCAGCGGGGAGGAAGGCGTTGAGGTTAATAACCTTGTCGATTGACG TTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAAT ACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAG GCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGC ATTCGAAACTGGCAGGCTA.

(15) This strain is named Klebsiella sp. strain LDX1-1 which has been preserved in the China General Microbiological Culture Collection Center (CGMCC, address: Institute of Microbiology of Chinese Academy of Sciences, No. 3, Yard 1, Beichen Road West, Chaoyang District, Beijing, China) on Sep. 7, 2015, and the preservation number is CGMCC No. 11330.

Example 2

(16) The liquid spawn culture medium contains the following components in gram per liter: 12 g/L of sugar, 2 g/L of NH.sub.4NO.sub.3, 0.8 g/L of K.sub.2HPO.sub.4, 0.5 g/L of MgSO.sub.4, 0.4 g/L of NaCl, and 0.013 g/L of FeSO.sub.4.

(17) The fermentation culture medium contains the following components in gram per liter (g/L): 23 g/L of sugar, 2 g/L of NH.sub.4NO.sub.3, 1.2 g/L of K.sub.2HPO.sub.4, 0.5 g/L of MgSO.sub.4, 0.4 g/L of NaCl, 0.015 g/L of FeSO.sub.4, 0.02 g/L of MnSO.sub.4, 0.2 g/L of extract of pine needles (manufactured by Xi'an RunXue Bio-technology Co. Ltd., with an extraction proportion of 10:1), 7 g/L of corn starch, 1.8 g/L of corn steep, and 0.03 g/L of ZnSO.sub.4.

(18) (1) Liquid Spawn Culture

(19) Activated slant spawn was inoculated into a liquid spawn culture medium, and then cultured while shaking at 170 r/min at 26 C. for 13 h to obtain a liquid spawn for later use; and

(20) (2) Fermentation

(21) the liquid spawn was inoculated into a fermentation medium in a volume ratio of 2.5% and then fermented in an activated fermentation way in a fermentation tank for 30 h (the fermentation control conditions were as follows: temperature: 26 C.; air volume/culture volume/min: 0.45 VVM; and stirring speed: 500 r/min) to eventually obtain a fermentation broth at the end of fermentation, and the fermentation broth was filtered to remove impurities to eventually obtain a liquid protein polysaccharide (PPS) microbial flocculant; and by measurement of the fermentation broth, the yield of the microbial flocculant was 61%, the production output thereof was 2.1%, and the flocculation rate was 95%.

(22) The yield of the microbial flocculant was measured by the following method: the pH of the microbial flocculant was adjusted to 7.0; the microbial flocculant was mixed with two and a half-fold amount of absolute ethanol for precipitation and centrifuged at 5000 r/min for 5 min to obtain the primary precipitate; the primary precipitate was washed with six-fold amount of absolute ethanol, and centrifuged at 5000 r/min for 5 min to obtain the secondary precipitate; the secondary precipitate was dried in vacuum at 40 C. for 6 h, and the dry weight thereof was obtained. Yield=(dry weight of the flocculant (Kg)/dry weight of carbon source (Kg))100%.

(23) The flocculation rate was measured by the following method: 0.4% (by weight) of kaolin clay suspension and 5% (by weight) of CaCl.sub.2 solution were prepared; 98% (by volume) of kaolin clay suspension and 2% (by volume) of CaCl.sub.2 solution were added to a reaction cup of a six-motor stirrer, and evenly mixed to form a flocculation system for later use. During the measurement, 20 L of fermentation broth was added to every 100 mL of flocculation system, quickly mixed at a stirring speed of 120 r/min for 40 s and then slowly mixed at a stirring speed of 60 r/min for 120 s, and kept standing for 5 min; the supernatant was collected; and an OD value B at a wavelength of 550 nm was obtained; instead of fermentation broth, distilled water was added and the above operations were operated to obtain an OD value A.
Flocculation rate={(AB)/A}100%.

Example 3: Application of the Microbial Flocculant in Treatment of Sewage

(24) The microbial flocculant prepared in Example 2 was applied to the treatment of domestic sewage. A method for treating domestic sewage includes the following operations: adding a proper amount of microbial flocculant to domestic sewage inside a flocculation device having a stirring function, quickly mixing at a stirring speed of 120 r/min for 40 s and slowly mixing at a stirring speed of 60 r/min for 120 s, keeping the mixture standing for 30 min so that the pollutants were precipitated and separated, and collecting and measuring the supernatant.

(25) The treatment of domestic sewage (the chemical oxygen demand (COD): 859 mg/L; the total amount of phosphorus: 22.9 mg/L; the amount of Mn.sup.2+:0.434 mg/L; and the amount of Fe.sup.3+: 84.6 mg/L) from Qingdao City Investment Daren Water Supply Co., Ltd., with the usage amount (dry weight) of the PPS microbial flocculant of 3-5 g per ton of water, showed the following excellent results: the flocculation rate of suspended solids (SS) was 93%; the COD removal rate was 93%; the total phosphorus removal rate was 86%; the heavy metal Mn.sup.2+ removal rate was 87%; and the Fe.sup.3+ removal rate was 97%.

(26) The examples of the present invention has the following technical effects: a high-activity microbial flocculant producing strain is selected, i.e., Klebsiella sp. strain LDX1-1, and producing a microbial flocculant with this strain in a high yield in an activated fermentation way has the advantages of quick growth of the strain, high metabolic capacity (yield60%), short fermentation cycle (32 h), high production output (2.0%), high flocculation rate (94%) and the like. When the microbial flocculant prepared in the present invention is applied to treatment of domestic sewage, the SS flocculation rate is higher than or equal to 90%, the COD removal rate is higher than or equal to 85%, the heavy metal Mn.sup.2+ removal rate is higher than or equal to 85%. Such a microbial flocculant has board development prospect and good application value.