LIGAND INDUCIBLE POLYPEPTIDE COUPLER SYSTEM

20180348231 ยท 2018-12-06

Assignee

Inventors

Cpc classification

International classification

Abstract

The invention relates to a novel ligand inducible polypeptide coupling system and methods of modulating cell signal transduction pathways and other intracellular and extracellular protein-protein interactions.

Claims

1. Two polypeptides comprising a first non-naturally occurring polypeptide comprising a fragment or domain of a nuclear receptor protein and a second non-naturally occurring polypeptide comprising a different fragment or domain of a nuclear receptor protein, wherein the first polypeptide is capable of binding an activating ligand, wherein the second polypeptide is capable of associating with the first polypeptide in the presence of the activating ligand, wherein each of the first and second polypeptides further comprise heterologous amino acids or polypeptide sequences such that activating ligand induced association of the first and second polypeptides results in an activated functional, biological or cell signal transduction condition.

2. The first and second polypeptide of claim 1, wherein one or both nuclear receptor protein fragments or domains comprise an arthropod nuclear receptor amino acid sequence.

3. The first and second polypeptide of claim 1 or 2, wherein one or both nuclear receptor protein fragments or domains comprise a Group H nuclear receptor amino acid sequence.

4. The first and second polypeptide of any one of claims 1 to 3, wherein the nuclear receptor amino acid sequence of the first polypeptide comprises an ecdysone receptor (EcR) ligand binding domain, polypeptide fragment, or substitution mutant thereof.

5. The first and second polypeptide of any one of claims 1 to 4, wherein the second polypeptide nuclear receptor protein fragment or domain comprises a mammalian nuclear receptor amino acid sequence.

6. The first and second polypeptide of claim 5, wherein the mammalian nuclear receptor protein fragment or domain comprises a RXR nuclear receptor polypeptide fragment, or substitution mutant thereof.

7. The first and second polypeptide of any one of claims 1 to 6, wherein the second polypeptide nuclear receptor protein fragment or domain comprises a chimera of invertebrate and mammalian nuclear receptor amino acid sequences, or substitution mutants thereof.

8. The first and second polypeptide of claim 7, wherein the second polypeptide nuclear receptor protein fragment or domain comprises a chimera of invertebrate USP (RXR homologue) and mammalian RXR nuclear receptor amino acid sequences, or substitution mutants thereof.

9. A ligand inducible polypeptide coupling (LIPC) system comprising: a) A first non-naturally occurring polypeptide comprising a fragment or domain of an arthropod nuclear receptor protein, and b) A second non-naturally occurring polypeptide comprising a fragment or domain of an arthropod and/or mammalian nuclear receptor protein, wherein the first and second polypeptides comprise additional heterologous sequences capable of producing an activated functional, biological or cell signal transduction condition following contact with an activating ligand.

10. The LIPC system of claim 9, wherein one or both nuclear receptor protein fragments or domains comprise a Group H nuclear receptor amino acid sequence.

11. The LIPC system of claim 9 or 10, wherein the first polypeptide comprises an ecdysone receptor (EcR) ligand binding domain, polypeptide fragment, or substitution mutant thereof.

12. The LIPC system of any one of claims 9 to 11, wherein the second polypeptide comprises a mammalian nuclear receptor amino acid sequence.

13. The LIPC system of claim 12, wherein the second polypeptide comprises a RXR nuclear receptor polypeptide fragment, or substitution mutant thereof.

14. The LIPC system of any one of claims 9 to 13, wherein the second polypeptide comprises a chimera of invertebrate and mammalian nuclear receptor amino acid sequences, or substitution mutants thereof.

15. The LIPC system of claim 14, wherein the second polypeptide comprises a chimera of invertebrate USP (RXR homologue) and mammalian RXR nuclear receptor amino acid sequences, or substitution mutants thereof.

16. The first and second polypeptides in any one of claims 1 to 8, or the LIPC system of any one of claims 9-15, wherein at least one of the nuclear receptor protein fragments are derived from an ecdysone receptor polypeptide selected from the group consisting of a spruce budworm Choristoneura fumiferana EcR (CfEcR) LBD, a beetle Tenebrio molitor EcR (TmEcR) LBD, a Manduca sexta EcR (MsEcR) LBD, a Heliothies virescens EcR (HvEcR) LBD, a midge Chironomus tentans EcR (CfEcR) LBD, a silk moth Bombyx mori EcR (BmEcR) LBD, a fruit fly Drosophila melanogaster EcR (DmEcR) LBD, a mosquito Aedes aegypti EcR (AaEcR) LBD, a blowfly Lucilia capitata EcR (LcEcR) LBD, a blowfly Lucilia cuprina EcR (LucEcR) LBD, a Mediterranean fruit fly Ceratitis capitata EcR (CcEcR) LBD, a locust Locusta migratoria EcR (LmEcR) LBD, an aphid Myzus persicae EcR (MpEcR) LBD, a fiddler crab Celuca pugilator EcR (CpEcR) LBD, a whitefly Bamecia argentifoli EcR (BaEcR) LBD, a leafhopper Nephotetix cincticeps EcR (NcEcR) LBD, and an ixodid tick Amblyomma americanum EcR (AmaEcR) LBD.

17. The first and second polypeptides in any one of claims 1 to 8, or the LIPC system of any one of claims 9-15, wherein at least one of the nuclear receptor protein fragments are derived from an ecdysone receptor polypeptide encoded by a polynucleotide comprising a nucleic acid sequence of SEQ ID NO: 1 (CfEcR-DEF), SEQ ID NO: 2 (CfEcR-CDEF), SEQ ID NO: 3 (DmEcR-DEF), SEQ ID NO: 4 (TmEcR-DEF) SEQ ID NO: 5 (AmaEcR-DEF), or a polynucleotide encoding a functional variant that is substantially identical thereto.

18. The first and second polypeptides or the LIPC system of claims 16-17, wherein at least one of the ecdysone receptor polypeptides comprises a polypeptide sequence of SEQ ID NO: 6 (CfEcR-DEF), SEQ ID NO: 7 (DmEcR-DEF), SEQ ID NO: 8 (CfEcR-CDEF), SEQ ID NO: 9 (TmEcR-DEF), SEQ ID NO: 10 (AmaEcR-DEF), or a polypeptide sequence substantially identical thereto.

19. The first and second polypeptides or the LIPC system of any one of claims 16-18, wherein the ecdysone receptor polypeptide sequence comprises about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or substitution mutations relative to the corresponding wild-type ecdysone receptor polypeptide.

20. The first and second polypeptides or the LIPC system of any one of claims 16-19, wherein the ecdysone receptor polypeptide is encoded by a polynucleotide comprising a codon mutation that results in a substitution of an amino acid residue, wherein the amino acid residue is at a position equivalent to or analogous to a) amino acid residue 20, 21, 48, 51, 52, 55, 58, 59, 61, 62, 92, 93, 95, 96, 107, 109, 110, 120, 123, 125, 175, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 17, b) amino acid residues 95 and 110 of SEQ ID NO: 17, c) amino acid residues 218 and 219 of SEQ ID NO: 17, d) amino acid residues 107 and 175 of SEQ ID NO: 17, e) amino acid residues 127 and 175 of SEQ ID NO: 17, f) amino acid residues 107 and 127 of SEQ ID NO: 17, g) amino acid residues 107, 127 and 175 of SEQ ID NO: 17, h) amino acid residues 52, 107 and 175 of SEQ ID NO: 17, i) amino acid residues 96, 107 and 175 of SEQ ID NO: 17, j) amino acid residues 107, 110 and 175 of SEQ ID NO: 17, k) amino acid residue 107, 121, 213, or 217 of SEQ ID NO: 18, or 1) amino acid residue 91 or 105 of SEQ ID NO: 19.

21. The first and second polypeptides or the LIPC system of any one of claims 16-20, wherein the substitution mutation is selected from the group consisting of a) E20A, Q21A, F48A, I51A, T52A, T52V, T52I, T52L, T55A, T58A, V59A, L61A, I62A, M92A, M93A, R95A, V96A, V96T, V96D, V96M, V1071, F109A, A110P, A110S, A110M, A110L, Y120A, A123F, M125A, R175E, M218A, C219A, L223A, L230A, L234A, W238A, R95A/A110P, M218A/C219A, V107I/R175E, Y127E/R175E, V107I/Y127E, V107I/Y127E/R175E, T52V/V107I/R175E, V96A/V107I/R175E, T52A/V107I/R175E, V96T/V107I/R175E, or V107I/A110P/R175E substitution mutation of SEQ ID NO: 17, b) A107P, G121R, G121L, N213A, C217A, or C217S substitution mutation of SEQ ID NO: 18, and c) G91A or A105P substitution mutation of SEQ ID NO: 19.

22. The first and second polypeptides or the LIPC system of any one of claims 16-21, wherein the retinoid X receptor polypeptide comprises a polypeptide selected from the group consisting of a vertebrate retinoid X receptor polypeptide, an invertebrate retinoid X receptor polypeptide (USP), and a chimeric retinoid X polypeptide comprising polypeptide fragments from a vertebrate and invertebrate RXR.

23. The first and second polypeptides or the LIPC system of claim 22, wherein the chimeric retinoid X receptor polypeptide comprises at least two different retinoid X receptor polypeptide fragments selected from the group consisting of a vertebrate species retinoid X receptor polypeptide fragment, an invertebrate species retinoid X receptor polypeptide fragment, and a non-Dipteran/non-Lepidopteran invertebrate species retinoid X receptor polypeptide fragment.

24. The first and second polypeptides or the LIPC system of claim 23, wherein the chimeric retinoid X receptor polypeptide comprises a retinoid X receptor polypeptide comprising at least one retinoid X receptor polypeptide fragment selected from the group consisting of an EF-domain helix 1, an EF-domain helix 2, an EF-domain helix 3, an EF-domain helix 4, an EF-domain helix 5, an EF-domain helix 6, an EF-domain helix 7, an EF-domain helix 8, an EF-domain helix 9, an EF-domain helix 10, an EF-domain helix 11, an EF-domain helix 12, an F-domain, and an EF-domain -pleated sheet, wherein the retinoid X receptor polypeptide fragment is from a different species retinoid X receptor polypeptide or a different isoform retinoid X receptor polypeptide than the second retinoid X receptor polypeptide fragment.

25. The first and second polypeptides or the LIPC system of claim 22, wherein the chimeric retinoid X receptor polypeptide is encoded by a polynucleotide comprising a nucleic acid sequence of a) SEQ ID NO: 11, b) nucleotides 1-348 of SEQ ID NO: 12 and nucleotides 268-630 of SEQ ID NO: 13, c) nucleotides 1-408 of SEQ ID NO: 12 and nucleotides 337-630 of SEQ ID NO: 13, d) nucleotides 1465 of SEQ ID NO: 12 and nucleotides 403-630 of SEQ ID NO: 13, e) nucleotides 1-555 of SEQ ID NO: 12 and nucleotides 490-630 of SEQ ID NO: 13, f) nucleotides 1-624 of SEQ ID NO: 12 and nucleotides 547-630 of SEQ ID NO: 13, g) nucleotides 1-645 of SEQ ID NO: 12 and nucleotides 601-630 of SEQ ID NO: 13, and h) nucleotides 1-717 of SEQ ID NO: 12, nucleotides 613-630 of SEQ ID NO: 13, or a polynucleotide encoding a functional variant that is substantially identical thereto.

26. The first and second polypeptides or the LIPC system of claim 22, wherein the chimeric retinoid X polypeptide comprises a polypeptide sequence of a) SEQ ID NO: 14, b) amino acids 1-116 of SEQ ID NO: 15 and amino acids 90-210 of SEQ ID NO: 16, c) amino acids 1-136 of SEQ ID NO: 15 and amino acids 113-210 of SEQ ID NO: 16, d) amino acids 1-155 of SEQ ID NO: 15 and amino acids 135-210 of SEQ ID NO: 16, e) amino acids 1-185 of SEQ ID NO: 15 and amino acids 164-210 of SEQ ID NO: 16, f) amino acids 1-208 of SEQ ID NO: 15 and amino acids 183-210 of SEQ ID NO: 16, g) amino acids 1-215 of SEQ ID NO: 15 and amino acids 201-210 of SEQ ID NO: 16, and h) amino acids 1-239 of SEQ ID NO: 15, amino acids 205-210 of SEQ ID NO: 16, or a polypeptide sequence substantially identical thereto.

27. The first and second polypeptides or the LIPC system of any one of claims 1-26, wherein one or both additional heterologous sequences comprise a transmembrane domain.

28. The first and second polypeptides or the LIPC system of claim 27, wherein at least one of the transmembrane domains is a single-pass type I transmembrane domain.

29. An isolated polynucleotide comprising a polynucleotide sequence that encodes the first or second polypeptides in any one of claims 1 to 28.

30. A first polynucleotide comprising a nucleotide sequence encoding the first polypeptide and a second polynucleotide comprising a nucleotide sequence encoding the second polypeptide in any one of claims 1 to 28.

31. A vector comprising one of the polynucleotides of claim 29 or 30.

32. A vector comprising both of the polynucleotides of claim 29 or 30.

33. The vector of claim 31 or 32, wherein said vector is an expression vector.

34. A host cell comprising the vector of any one of claims 31 to 33.

35. The host cell of claim 34, wherein the host cell is a mammalian T-cell.

36. The host cell of claim 34, wherein the host cell is a human T-cell.

37. A method of inducing cell signal transduction comprising introducing the first and second polypeptides or the LIPC system of any one claims 1-28, the polynucleotides of claim 29 or 30, or the vector of any one of claims 31 to 33 into a host cell and contacting the host cell with an activating ligand.

38. The first and second polypeptides or the LIPC system of any one claims 1-28, the polynucleotides of claim 29 or 30, the vector of any one of claims 31 to 33, or the method of any one of claims 34 to 36, wherein the activating ligand is c) a compound of the formula: ##STR00008## wherein: E is a (C.sub.4-C.sub.6)alkyl containing a tertiary carbon or a cyano(C.sub.3-C.sub.5)alkyl containing a tertiary carbon; R.sup.1 is H, Me, Et, i-Pr, F, formyl, CF.sub.3, CHF.sub.2, CHCl.sub.2, CH.sub.2F, CH.sub.2Cl, CH.sub.2OH, CH.sub.2OMe, CH.sub.2CN, CN, CCH, 1-propynyl, 2-propynyl, vinyl, OH, OMe, OEt, cyclopropyl, CF.sub.2CF.sub.3, CHCHCN, allyl, azido, SCN, or SCHF.sub.2; R.sup.2 is H, Me, Et, n-Pr, i-Pr, formyl, CF.sub.3, CHF.sub.2, CHCl.sub.2, CH.sub.2F, CH.sub.2Cl, CH.sub.2OH, CH.sub.2OMe, CH.sub.2CN, CN, CCH, 1-propynyl, 2-propynyl, vinyl, Ac, F, Cl, OH, OMe, OEt, O-n-Pr, OAc, NMe.sub.2, NEt.sub.2, SMe, SEt, SOCF.sub.3, OCF.sub.2CF.sub.2H, COEt, cyclopropyl, CF.sub.2CF.sub.3, CHCHCN, allyl, azido, OCF.sub.3, OCHF.sub.2, O-i-Pr, SCN, SCHF.sub.2, SOMe, NHCN, or joined with R.sup.3 and the phenyl carbons to which R.sup.2 and R.sup.3 are attached to form an ethylenedioxy, a dihydrofuryl ring with the oxygen adjacent to a phenyl carbon, or a dihydropyryl ring with the oxygen adjacent to a phenyl carbon; R.sup.3 is H, Et, or joined with R.sup.2 and the phenyl carbons to which R.sup.2 and R.sup.3 are attached to form an ethylenedioxy, a dihydrofuryl ring with the oxygen adjacent to a phenyl carbon, or a dihydropyryl ring with the oxygen adjacent to a phenyl carbon; R.sup.4, R.sup.5, and R.sup.6 are independently H, Me, Et, F, Cl, Br, formyl, CF.sub.3, CHF.sub.2, CHCl.sub.2, CH.sub.2F, CH.sub.2Cl, CH.sub.2OH, CN, CCH, 1-propynyl, 2-propynyl, vinyl, OMe, OEt, SMe, or Set; or d) an ecdysone, 20-hydroxyecdysone, ponasterone A, muristerone A, an oxysterol, a 22(R) hydroxycholesterol, 24(S) hydroxycholesterol, 25-epoxycholesterol, T0901317, 5-alpha-6-alpha-epoxycholesterol-3-sulfate, 7-ketocholesterol-3-sulfate, farnesol, a bile acid, a 1,1-biphosphonate ester, or a Juvenile hormone III.

39. The first and second polypeptides or the LIPC system of any one claims 1-28, the polynucleotides of claim 29 or 30, the vector of any one of claims 31 to 33, or the method of any one of claims 34 to 36, wherein the activating ligand is a compound of the formula: ##STR00009## wherein R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are: a) H, (C.sub.1-C.sub.6)alkyl; (C.sub.1-C.sub.6)haloalkyl; (C.sub.1-C.sub.6)cyanoalkyl; (C.sub.1-C.sub.6)hydroxyalkyl; (C.sub.1-C.sub.4)alkoxy(C.sub.1-C.sub.6)alkyl; (C.sub.2-C.sub.6)alkenyl optionally substituted with halo, cyano, hydroxyl, or (C.sub.1-C.sub.4)alkyl; (C.sub.2-C.sub.6)alkynyl optionally substituted with halo, cyano, hydroxyl, or (C.sub.1-C.sub.4)alkyl; (C.sub.3-C.sub.5)cycloalkyl optionally substituted with halo, cyano, hydroxyl, or (C.sub.1-C.sub.4)alkyl; or b) unsubstituted or substituted benzyl wherein the substituents are independently 1 to 5 H, halo, nitro, cyano, hydroxyl, (C.sub.1-C.sub.6)alkyl, or (Ci-C.sub.6)alkoxy; and R.sup.5 is H; OH; F; Cl; or (C.sub.1-C.sub.6)alkoxy; provided that: when R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are isopropyl, then R.sup.5 is not hydroxyl; when R.sup.5 is H, hydroxyl, methoxy, or fluoro, then at least one of R.sup.1, R.sup.2, R.sup.3, and R.sup.4 is not H; when only one of R.sup.1, R.sup.2, R.sup.3, and R.sup.4 is methyl, and R.sup.5 is H or hydroxyl, then the remainder of R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are not H; when both R.sup.4 and one of R.sup.1, R.sup.2, and R.sup.3 are methyl, then R.sup.5 is neither H nor hydroxyl; when R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are all methyl, then R.sup.5 is not hydroxyl; when R.sup.1, R.sup.2, and R.sup.3 are all H and R.sup.5 is hydroxyl, then R.sup.4 is not ethyl, n-propyl, n-butyl, allyl, or benzyl.

40. The first and second polypeptides or the LIPC system in any one claims 1-28, the polynucleotides of claim 29 or 30, the vector of any one of claims 31 to 33, or the method of any one of claims 34 to 36, wherein the activating ligand is a compound of the formula: ##STR00010## wherein X and X are independently 0 or S; Y is: (a) substituted or unsubstituted phenyl wherein the substitutents are independently 1-5H, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy, (C.sub.2-C.sub.4)alkenyl, halo (F, Cl, Br, I), (C.sub.1-C.sub.4)haloalkyl, hydroxy, amino, cyano, or nitro; or (b) substituted or unsubstituted 2-pyridyl, 3-pyridyl, or 4-pyridyl, wherein the substitutents are independently 1-4H, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy, (C.sub.2-C.sub.4)alkenyl, halo (F, Cl, Br, I), (C.sub.1-C.sub.4)haloalkyl, hydroxy, amino, cyano, or nitro; R.sup.1 and R.sup.2 are independently: H; cyano; cyano-substituted or unsubstituted (C.sub.1-C.sub.7) branched or straight-chain alkyl; cyano-substituted or unsubstituted (C.sub.2-C.sub.7) branched or straight-chain alkenyl; cyano-substituted or unsubstituted (C.sub.3-C.sub.7) branched or straight-chain alkenylalkyl; or together the valences of R.sup.1 and R.sup.2 form a (C.sub.1-C.sub.7) cyano-substituted or unsubstituted alkylidene group (R.sup.aR.sup.bC) wherein the sum of non-substituent carbons in R.sup.a and R.sup.b is 0-6; R.sup.3 is H, methyl, ethyl, n-propyl, isopropyl, or cyano; R.sup.4, R.sup.7, and R.sup.8 are independently: H, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy, (C.sub.2-C.sub.4)alkenyl, halo (F, Cl, Br, I), (C.sub.1-C.sub.4)haloalkyl, hydroxy, amino, cyano, or nitro; and R.sup.5 and R.sup.6 are independently: H, (C.sub.1-C.sub.4)alkyl, (C.sub.2-C.sub.4)alkenyl, (C.sub.3-C.sub.4)alkenylalkyl, halo (F, Cl, Br, I), C.sub.1-C.sub.4 haloalkyl, (C.sub.1-C.sub.4)alkoxy, hydroxy, amino, cyano, nitro, or together as a linkage of the type (OCHR.sup.9CHR.sup.10O) form a ring with the phenyl carbons to which they are attached; wherein R.sup.9 and R.sup.10 are independently: H, halo, (C.sub.1-C.sub.3)alkyl, (C.sub.2-C.sub.3)alkenyl, (C.sub.1-C.sub.3)alkoxy(C.sub.1-C.sub.3)alkyl, benzoyloxy(C.sub.1-C.sub.3)alkyl, hydroxy(C.sub.1-C.sub.3)alkyl, halo(C.sub.1-C.sub.3)alkyl, formyl, formyl(C.sub.1-C.sub.3)alkyl, cyano, cyano(C.sub.1-C.sub.3)alkyl, carboxy, carboxy(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkoxycarbonyl(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkylcarbonyl(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkanoyloxy(C.sub.1-C.sub.3)alkyl, amino(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkylamino(C.sub.1-C.sub.3)alkyl ((CH.sub.2).sub.nR.sup.cR.sup.e), oximo (CHNOH), oximo(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkoximo (CNOR.sup.d), alkoximo(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)carboxamido (C(O)NR.sup.eR.sup.f), (C.sub.1-C.sub.3)carboxamido(C.sub.1-C.sub.3)alkyl, C.sub.1-C.sub.3)semicarbazido (CNNHC(O)NR.sup.eR.sup.f), semicarbazido(C.sub.1-C.sub.3)alkyl, aminocarbonyloxy (OC(O)NHR.sup.g), aminocarbonyloxy(C.sub.1-C.sub.3)alkyl, pentafluorophenyloxycarbonyl, pentafluorophenyloxycarbonyl(C.sub.1-C.sub.3)alkyl, p-toluenesulfonyl oxy(C.sub.1-C.sub.3)alkyl, arylsulfonyl oxy(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)thio(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkylsulfoxido(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkylsulfonyl(C.sub.1-C.sub.3)alkyl, or (C.sub.1-C.sub.5)trisubstituted-siloxy(C.sub.1-C.sub.3)alkyl ((CH.sub.2),SiOR.sup.dR.sup.eR.sup.g); wherein n=1-3, R.sup.c and R.sup.d represent straight or branched hydrocarbon chains of the indicated length, R.sup.e, R.sup.f represent H or straight or branched hydrocarbon chains of the indicated length, R.sup.g represents (C.sub.1-C.sub.3)alkyl or aryl optionally substituted with halo or (C.sub.1-C.sub.3)alkyl, and R.sup.c, R.sup.d, R.sup.e, R.sup.f, and R.sup.g are independent of one another; provided that i) when R.sup.9 and R.sup.10 are both H, or ii) when either R.sup.9 or R.sup.10 are halo, (C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkoxy(C.sub.1-C.sub.3)alkyl, or benzoyloxy(C.sub.1-C.sub.3)alkyl, or iii) when R.sup.5 and R.sup.6 do not together form a linkage of the type (OCHR.sup.9CHR.sup.10O), then the number of carbon atoms, excluding those of cyano substitution, for either or both of groups R.sup.1 or R.sup.2 is greater than 4, and the number of carbon atoms, excluding those of cyano substitution, for the sum of groups R.sup.1, R.sup.2, and R.sup.3 is 10, 11, or 12.

41. A method of measuring ligand-induced cell signal transduction comprising: a) introducing the first and second polypeptides or the LIPC system of any one claims 1-28, the polynucleotides of claim 29 or 30, or the vector of any one of claims 31 to 33 into a host cell; b) contacting the host cell with an activating ligand; and, c) quantitating the absolute or relative amount of ligand-induced biological activity or polypeptide oligomerization.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0076] A more complete understanding of the present invention may be obtained by reference to the accompanying drawings, when considered in conjunction with the subsequent detailed description. The embodiments illustrated in the drawings are intended only to exemplify the invention and should not be construed as limiting the invention to the illustrated embodiments. Additional embodiments and configurations can provide further useful embodiments.

[0077] FIG. 1: A schematic illustration demonstrating the configuration and mode of operation of an exemplary transcriptional switch using EcR and RXR components

[0078] FIG. 2: A schematic of the concept of the ligand inducible polypeptide coupler (LIPC) components. In the presence of activating ligand, the EcR and RXR components associate, resulting in association of the fused components (e.g., signaling molecules, signaling domains, complementary protein fragments, and protein subunits).

[0079] FIG. 3: A schematic demonstrating a ligand inducible polypeptide coupler (LIPC) system where intracellular EcR and RXR components are fused to extracellular components (e.g., signaling molecules or domains) via a transmembrane domain. In the presence of ligand, the EcR and RXR components associate, resulting in association of the extracellular fused components.

[0080] FIG. 4A and 4B: A schematic demonstrating a ligand inducible polypeptide coupler (LIPC) system where extracellular EcR and RXR components are fused to intracellular components (e.g., signaling molecules or domains) via a transmembrane domain (FIG. 4A). In the presence of ligand, the EcR and RXR components associate, resulting in association of the intracellular fused components. A schematic demonstrating a ligand inducible polypeptide coupler (LIPC) system where intracellular EcR and RXR components are tethered to the membrane and are fused to intracellular components (e.g., signaling molecules or domains) (FIG. 4B). In the presence of ligand, the EcR and RXR components associate, resulting in association of the intracellular fused components.

[0081] FIG. 5: A schematic demonstrating a ligand inducible polypeptide coupler (LIPC) system where the EcR or RXR component is tethered to the membrane while the other complimentary component is free in the cytoplasm. In the presence of ligand, the membrane-tethered EcR or RXR component associates with the cytosolic EcR or RXR component, resulting in association of the fused components (e.g., signaling molecules or domains).

[0082] FIG. 6: A schematic illustration of the split luciferase (fLuc) ligand inducible polypeptide coupler (LIPC) system. Only in the presence of ligand do the EcR and RXR components associate, driving association of the split fLuc and subsequent activity.

[0083] FIG. 7: Data demonstrating that the ligand inducible polypeptide coupler (LIPC) described herein drives split fLuc signal only in the presence of activating ligand.

[0084] FIG. 8: A schematic of exemplary constructs used in the construction of the ligand inducible polypeptide coupler (LIPC) system as described herein.

[0085] FIG. 9: A ligand dose response curve for RR Nluc+Cluc_EcR and EcR_Nluc+Cluc_RR using Veledimex ligand.

[0086] FIG. 10: A ligand dose response curve for RR Nluc+Cluc_EcR and EcR_Nluc+Cluc_RR using Veledimex ligand.

[0087] FIG. 11: EcR dimerization induction via Veledimex ligand.

[0088] FIG. 12: EcR dimerization induction via Veledimex ligand.

DETAILED DESCRIPTION OF THE INVENTION

[0089] The invention provided herein uses components of EcR-RXR transcriptional switch systems (see e.g., PCT Publication Nos. WO 2001/070816, WO 2002/066612, WO 2002/066613, WO 2002/066614, WO 2002/066615, WO 2003/027266, WO 2003/027289, and WO 2005/108617 each of which is hereby incorporated herein by reference its entirety) which can be expressed in, or by, a host cell to control, regulate or modulate association of fused protein components. One role of protein-protein interactions is to initiate cell signal transduction processes, such as by activating cytoplasmic and/or extracellular signaling domains or restoring functionality to a fragmented or split protein via receptor-ligand binding interactions. Thus, this naturally occurring system can be artificially modulated by driving the association of two inactive signaling domains via induced formation of a bridge between an EcR and an RXR component (in the presence of an EcR ligand) wherein the latter components have been incorporated with (i.e., fused to) the signaling domain polypeptides.

[0090] In certains embodiments, described herein are systems and methods relating to selective activation of cellular signaling domains via ligand-induced polypeptide coupling. The systems and methods provide a ligand induced polylpeptide coupling system which allows for induction (e.g., modulation, control, regulation) of protein-protein interactions and (on demand) activation of signaling domains, or inactivation/inhibition of signaling domains.

[0091] Accordingly, disclosed herein are systems and methods that use protein components of a gene transcriptional switch system (expressed in a host cel) for inducing physical association with one another (via an activating ligand) to form a complex (i.e., induce protein-protein interactions) of other associated proteins or domains. Ligand induced protein association can, for example, initiate functions such as activating cytoplasmic and/or extracellular signaling domains in the presence of activating ligand. Thus, in the presence of activating ligand, two signaling domains that are normally inactive can be activated by bringing them together via a bridge between the EcR and USP/RXR components.

[0092] The use of the word a or an when used in conjunction with the term comprising in the claims and/or the specification may mean one, but it is also consistent with the meaning of one or more, at least one, and one or more than one.

[0093] The use of the term for example and its corresponding abbreviation e.g. (whether italicized or not) means that the specific terms cited are representative examples only (that is, specimens, samples, illustrations, models, etc) and embodiments of the invention are not intended to be limited to the specific examples referenced or cited unless explicitly stated otherwise.

[0094] The forward slash character (/), when used herein in reference to gene or polypeptide components (unless indicated otherwise) is an abbreviation for the words and/or. For example, unless specified otherwise, the term USP/RXR indicates a polypeptide that can have a mixture of components of both USP and RXR polypeptides or fragments thereof (e.g., a chimeric polypeptide), or USP polypeptide components or fragements thereof (e.g., domains) only, or RXR components or fragements thereof (e.g., domains) only.

[0095] As used in this specification and claim(s), the words comprising (and any form of comprising, such as comprise and comprises), having (and any form of having, such as have and has), including (and any form of including, such as includes and include) or containing (and any form of containing, such as contains and contain) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method, system, host cell, expression vector, or composition of the invention. Furthermore, systems, host cells, expression vectors, and/or compositions of the invention can be used to achieve methods of the invention.

[0096] Synthetic as used herein refers to compounds formed through a chemical process by human agency, as opposed to those of natural origin.

[0097] By isolated is meant the removal of a nucleic acid, peptide, or polypeptide from its natural environment. By purified is meant that a given nucleic acid, whether one that has been removed from nature (including genomic DNA and mRNA) or synthesized (including cDNA) and/or amplified under laboratory conditions, peptide, or polypeptide has been increased in purity, wherein purity is a relative term, not absolute purity. It is to be understood, however, that nucleic acids, peptides, and polypeptides may be formulated with diluents or adjuvants and still for practical purposes be isolated. For example, nucleic acids typically are mixed with an acceptable carrier or diluent when used for introduction into cells.

[0098] A nucleic acid is a polymeric compound comprised of covalently linked subunits called nucleotides. Nucleic acid includes polyribonucleic acid (RNA) and polydeoxyribonucleic acid (DNA), both of which may be single-stranded or double-stranded. DNA includes but is not limited to cDNA, genomic DNA, plasmids DNA, synthetic DNA, and semi-synthetic DNA. DNA may be linear, circular, or supercoiled.

[0099] A nucleic acid molecule refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; RNA molecules) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; DNA molecules), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in circular or linear DNA molecules (e.g., restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, 5 sequences may be described herein according to the normal convention of indicating only the sequence in the 5 to 3 direction along the non-transcribed strand of DNA, i.e., the strand having a sequence complementary to the mRNA. A recombinant DNA molecule is a DNA molecule that has undergone a molecular biological manipulation.

[0100] The term fragment will be understood to mean, in reference to polynucleotides, a nucleotide sequence of reduced length relative to the reference nucleic acid and comprising, over the common portion, a nucleotide sequence identical to the reference nucleic acid. Such a nucleic acid fragment, according to the invention may be, where appropriate, included in a larger polynucleotide of which it is a constituent. Such fragments comprise, or alternatively consist of, oligonucleotides ranging in length from at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 120, 125, 130, 135, 140, 145, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1250, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000 or 6000 consecutive nucleotides of a nucleic acid according to the invention. In certain embodiments, such fragments may comprise, or alternatively consist of, oligonucleotides of any integer in length ranging, for example, from 6 to 6,000 nucleotides. In certain embodiments such fragments may be any integer in length which is evenly divisible by 3 (e.g., such that the the polynucleotide encodes a full or partial polypeptide open reading frame). In certain embodiments such partial polypeptide fragments may be any integer in length (e.g., such that the polynucleotide may be used as a PCR primer or other hybridizable fragment or for use in generating synthetic or restriction fragment length polynucleotides.)

[0101] As used herein, an isolated nucleic acid fragment is a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. An isolated nucleic acid fragment in the form of a polymer of DNA may be comprised of one or more segments of cDNA, genomic DNA or synthetic DNA.

[0102] A gene refers to an assembly of nucleotides that encode a polypeptide, and includes cDNA and genomic DNA nucleic acids. Gene also refers to a nucleic acid fragment that expresses a specific protein or polypeptide, including regulatory sequences preceding (5 non-coding sequences) and following (3 non-coding sequences) the coding sequence. Native gene refers to a gene as found in nature with its own regulatory sequences. Chimeric gene refers to any gene that is not a native gene, comprising regulatory and/or coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature. A chimeric gene may comprise coding sequences derived from different sources and/or regulatory sequences derived from different sources. Endogenous gene refers to a native gene in its natural location in the genome of an organism. A foreign gene or heterologous gene refers to a gene not normally found in a host organism or cell, but that is introduced into the host organism or cell by gene transfer. Foreign genes can comprise, without limitation, native genes inserted into a non-native organism and chimeric genes. A transgene is a foreign or heterologous gene that has been introduced into the genome of a host organism or cell. Heterologous DNA refers to DNA not naturally located a the cell, or in a chromosomal site of a cell's genome. In some embodiments, heterologous DNA includes a gene foreign to the cell.

[0103] Polynucleotide or oligonucleotide as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, this term includes double and single stranded DNA, triplex DNA, as well as double and single stranded RNA. It also includes modified, for example, by methylation and/or by capping, and unmodified forms of the polynucleotide. The term is also meant to include molecules that include non-naturally occurring or synthetic nucleotides as well as nucleotide analogs. In certain embodiments, an oligonucleotide is hybridizable to a genomic DNA molecule, a cDNA molecule, a plasmid DNA or an mRNA molecule. Oligonucleotides can be labeled (e.g., with .sup.32P-nucleotides or nucleotides to which a label, such as biotin, has been covalently conjugated). In some embodiments, a labeled oligonucleotide can be used as a probe to detect the presence of a nucleic acid. Oligonucleotides (one or both of which may be labeled) can be used as PCR primers, either for cloning full length or a fragment of a nucleic acid, or to detect the presence of a nucleic acid. An oligonucleotide can also be used to form a triple helix with a DNA molecule. In certain embodiments, oligonucleotides are prepared synthetically, for example, on a nucleic acid synthesizer. Accordingly, oligonucleotides can be prepared with non-naturally occurring phosphoester analog bonds, such as thioester bonds, etc.

[0104] Nucleic acids and/or nucleic acid sequences are homologous when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Proteins and/or protein sequences are homologous when their encoding DNAs are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. The homologous molecules can be termed homologs. For example, any naturally occurring proteins, as described herein, can be modified by any available mutagenesis method. When expressed, this mutagenized nucleic acid encodes a polypeptide that is homologous to the protein encoded by the original nucleic acid. Homology is generally inferred from sequence identity between two or more nucleic acids or proteins (or sequences thereof). The precise percentage of identity between sequences that is useful in establishing homology varies with the nucleic acid and protein at issue, but as little as 25% sequence identity is routinely used to establish homology. Higher levels of sequence identity, e.g., 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more can also be used to establish homology. Methods for determining sequence identity percentages (e.g., BLASTP and BLASTN using default parameters) are described herein and are generally available.

[0105] A DNA coding sequence is a double-stranded DNA sequence that is transcribed and translated into a polypeptide in a cell in vitro or in vivo when placed under the control of appropriate regulatory sequences. Suitable regulatory sequences refer to nucleotide sequences located upstream (5 non-coding sequences), within, or downstream (3 non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing site, effector binding site and stem-loop structure. The boundaries of the coding sequence are determined by a start codon at the 5 (amino) terminus and a translation stop codon at the 3 (carboxyl) terminus. A coding sequence can include, but is not limited to, prokaryotic sequences, cDNA from mRNA, genomic DNA sequences, and synthetic DNA sequences. If the coding sequence is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3 to the coding sequence.

[0106] Open reading frame, abbreviated ORF, means a length of nucleic acid sequence, either DNA, cDNA or RNA, that comprises a translation start signal or initiation codon, such as an ATG or AUG, and a termination codon, and can be potentially translated into a polypeptide sequence.

[0107] Homologous recombination refers to the insertion of a foreign DNA sequence into another DNA molecule (e.g., insertion of a vector in a chromosome). In some embodiments, the vector targets a specific chromosomal site for homologous recombination. For specific homologous recombination, the vector will contain sufficiently long regions of homology to sequences of the chromosome to allow complementary binding and incorporation of the vector into the chromosome. Longer regions of homology, and greater degrees of sequence similarity, may increase the efficiency of homologous recombination.

[0108] A vector or expression vector is any modality for the cloning of and/or transfer of a nucleic acid into a host cell. A vector may be a replicon to which another DNA segment may be attached so as to bring about the replication of the attached segment. A replicon is any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of DNA replication in a cell. The term vector includes both viral and nonviral means for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo.

[0109] The term plasmid refers to an extra chromosomal element often carrying a gene that is not part of the central metabolism of the cell, and may be in the form of circular double-stranded DNA molecules. Such elements may be autonomously replicating sequences, genome integrating sequences, phage or nucleotide sequences, linear, circular, or supercoiled, of a single- or double-stranded DNA or RNA, derived from any source, in which a number of nucleotide sequences have been joined or recombined into a unique construction which is capable of introducing a promoter fragment and DNA sequence for a selected gene product along with appropriate 3 untranslated sequence into a cell.

[0110] Vectors may be introduced into the desired host cells by methods known in the art, e.g., transfection, electroporation, microinjection, transduction, cell fusion, DEAE dextran, calcium phosphate precipitation, lipofection (lysosome fusion), use of a gene gun, or a DNA vector transporter (see, e.g., Wu et al., 1992, J. Biol. Chem. 267: 963-967; Wu and Wu, 1988, J. Biol. Chem. 263: 14621-14624; and Hartmut et al., Canadian Patent Application No. 2,012,311, filed Mar. 15, 1990, each of which is incorporated by reference here in its entirety).

[0111] It is also possible to introduce a vector in vivo as a naked DNA plasmid (see, e.g., U.S. Pat. Nos. 5,693,622, 5,589,466 and 5,580,859, each of which is incorporated by reference herein in its entirety). Receptor-mediated DNA delivery approaches can also be used (see, e.g., Curel et al., 1992, Hum. Gene Ther 3: 147-154; and Wu and Wu, 1987, J. Biol. Chem 262: 4429-4432, each of which is incorporated by reference herein in its entirety).

[0112] The term transfection means the uptake of exogenous or heterologous RNA or DNA by a cell. A cell has been transfected by exogenous or heterologous RNA or DNA when such RNA or DNA has been introduced inside the cell. A cell has been transformed by exogenous or heterologous RNA or DNA when the transfected RNA or DNA effects a phenotypic change. The transforming RNA or DNA can be integrated (covalently linked) into chromosomal DNA making up the genome of the cell.

[0113] Transformation refers to the transfer of a nucleic acid fragment into the genome of a host organism, resulting in genetically stable inheritance. Host organisms containing the transformed nucleic acid fragments are referred to as transgenic or recombinant or transformed organisms.

[0114] The term selectable marker means an identifying factor, usually an antibiotic or chemical resistance gene, that is able to be selected for based upon the marker gene's effect, i.e., resistance to an antibiotic, resistance to a herbicide, colorimetric markers, enzymes, fluorescent markers, and the like, wherein the effect is used to track the inheritance of a nucleic acid of interest and/or to identify a cell or organism that has inherited the nucleic acid of interest. Examples of selectable marker genes known and used in the art include, but are not limited to: genes providing resistance to ampicillin, streptomycin, gentamycin, kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, for example, anthocyanin regulatory genes, isopentanyl transferase gene, and the like.

[0115] The term reporter gene means a nucleic acid encoding an identifying factor that is able to be identified based upon the reporter gene's effect, wherein the effect is used to track the inheritance of a nucleic acid of interest, to identify a cell or organism that has inherited the nucleic acid of interest, and/or to measure gene expression induction or transcription. Examples of reporter genes known and used in the art include, but are not limited to: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), -galactosidase (LacZ), -glucuronidase (Gus), and the like. Selectable marker genes may also be considered reporter genes.

[0116] Operably linked as used herein refers to refers to the physical and/or functional linkage of a DNA segment to another DNA segment in such a way as to allow the segments to function in their intended manners. A DNA sequence encoding a gene product is operably linked to a regulatory sequence when it is linked to the regulatory sequence, such as, for example, promoters, enhancers and/or silencers, in a manner which allows modulation of transcription of the DNA sequence, directly or indirectly. For example, a DNA sequence is operably linked to a promoter when it is ligated to the promoter downstream with respect to the transcription initiation site of the promoter, in the correct reading frame with respect to the transcription initiation site and allows transcription elongation to proceed through the DNA sequence. An enhancer or silencer is operably linked to a DNA sequence coding for a gene product when it is ligated to the DNA sequence in such a manner as to increase or decrease, respectively, the transcription of the DNA sequence. Enhancers and silencers may be located upstream, downstream or embedded within the coding regions of the DNA sequence. A DNA for a signal sequence is operably linked to DNA coding for a polypeptide if the signal sequence is expressed as a preprotein that participates in the secretion of the polypeptide. The terms cassette, expression cassette, and gene expression cassette refer to a segment of DNA that can be inserted into a nucleic acid or polynucleotide (e.g., specific restriction sites or by homologous recombination). The segment of DNA may comprise a polynucleotide that encodes a polypeptide of interest, and the cassette and restriction sites may be designed to ensure insertion of the cassette in the proper reading frame for transcription and translation. Transformation cassette refers to a vector comprising a polynucleotide that encodes a polypeptide of interest and having elements in addition to the polynucleotide that facilitate transformation of a particular host cell. Cassettes, expression cassettes, gene expression cassettes and transformation cassettes of the invention may also comprise elements that allow for enhanced expression of a polynucleotide encoding a polypeptide of interest in a host cell. These elements may include, but are not limited to: a promoter, a minimal promoter, an enhancer, a response element, a terminator sequence, a polyadenylation sequence, and the like. Regulatory region means a nucleic acid sequence that regulates the expression of a second nucleic acid sequence. A regulatory region may include sequences which are naturally responsible for expressing a particular nucleic acid (a homologous region) or may include sequences of a different origin that are responsible for expressing different proteins or even synthetic proteins (a heterologous region). In particular, the sequences can be sequences of prokaryotic, eukaryotic, or viral genes or derived sequences that stimulate or repress transcription of a gene in a specific or non-specific manner and in an inducible or non-inducible manner. Regulatory regions include origins of replication, RNA splice sites, promoters, enhancers, transcriptional termination sequences, and signal sequences which direct the polypeptide into the secretory pathways of the target cell. A regulatory region from a heterologous source is a regulatory region that is not naturally associated with the expressed nucleic acid. Included among the heterologous regulatory regions are regulatory regions from a different species, regulatory regions from a different gene, hybrid regulatory sequences, and regulatory sequences which do not occur in nature.

[0117] Peptide is used herein to refer to a compound containing two or more amino acid residues linked in a chain. A polypeptide is a polymeric compound comprised of covalently linked amino acid residues. Amino acids have the following general structure:

##STR00004##

[0118] Amino acids are classified into seven groups on the basis of the side chain R: (1) aliphatic side chains, (2) side chains containing a hydroxylic (OH) group, (3) side chains containing sulfur atoms, (4) side chains containing an acidic or amide group, (5) side chains containing a basic group, (6) side chains containing an aromatic ring, and (7) proline, an imino acid in which the side chain is fused to the amino group.

[0119] A protein comprises a polypeptide. An isolated polypeptide or isolated protein is a polypeptide or protein that is substantially free of those compounds that are normally associated therewith in its natural state (e.g., other proteins or polypeptides, nucleic acids, carbohydrates, lipids). Isolated is not meant to exclude artificial or synthetic mixtures with other compounds, or the presence of impurities which do not interfere with biological activity, and which may be present, for example, due to incomplete purification, addition of stabilizers, or compounding into a pharmaceutically acceptable preparation.

[0120] A substitution mutant polypeptide or a substitution mutant as used herein means a polypeptide comprising a substitution or substitutions (or consisting of a substitution or substitutions) of about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more wild-type or naturally occurring amino acid with a different amino acid relative to the wild-type or naturally occurring polypeptide. A substitution mutant polypeptide may comprising only one (1) amino acid substitution compared to the wild-type or naturally occurring polypeptide may be referred to as a point mutant or a single point mutant polypeptide.

[0121] When a substitution mutant polypeptide includes, or consists of, a substitution of one (1) or more wild-type or naturally occurring amino acids, this substitution may comprise, or consist of, either an equivalent number of wild-type or naturally occurring amino acids deleted for the substitution, i.e., two wild-type or naturally occurring amino acids replaced with two non-wild-type or non-naturally occurring amino acids, or a non-equivalent number of wild-type amino acids deleted for the substitution, e.g., two wild-type amino acids replaced with one non-wild-type amino acid (a substitution+deletion mutation), or two wild-type amino acids replaced with three non-wild-type amino acids (a substitution+insertion mutation). Substitution mutants may be described using an abbreviated nomenclature system to indicate the amino acid residue and number replaced within the reference polypeptide sequence and the new substituted amino acid residue. For example, a substitution mutant in which the twentieth (20.sup.th) amino acid residue of a polypeptide is substituted may be abbreviated as x20z, wherein x is the parent, normally occurring or naturally occurring amino acid to be replaced, 20 is the amino acid residue position or number referenced within the polypeptide, and z is the newly substituted amino acid. Therefore, a substitution mutant abbreviated interchangeably as E20A or Glu20Ala indicates that the substitution mutant comprises an alanine residue (typically abbreviated in the art as A or Ala) in place of a glutamic acid (typically abbreviated in the art as E or Glu) at position 20 of the polypeptide.

[0122] Fragment, when used in relation to a polypeptide, as used herein means a polypeptide whose amino acid sequence is shorter than that of a reference polypeptide and which comprises, or consists of, over the entire portion of the reference polypeptide, an identical amino acid sequence (unless explicitly stated otherwise, e.g., a fragment 95% identical to . . . ). Such fragments may, where appropriate, be included in a larger polypeptide of which they are a part. Such fragments of a polypeptide according to the invention may comprise, or alternatively consist of, a polymer ranging in length from at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 120, 125, 130, 135, 140, 145, 150, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1250, 1500, 2000, 2500, 3000, 3500, 4000, 4500, or 5000 amino acid residues. In certain embodiments, such fragments may comprise, or alternatively consist of, amino acid polymers (i.e., peptides, polypeptides) of any integer in length ranging, for example, from 4 to 5,000 residues.

[0123] Truncate or truncated, when used in relation to a polypeptide, is a polypeptide fragment whose amino acid sequence is shorter (at either the N-terminus, C-terminus, or both N- and C- termini) compared to that of a reference polypeptide (e.g., such as may result from a deletion or enzymatic processing of amino acid residues).

[0124] A variant of a polypeptide or protein is any analogue, fragment, truncation, derivative, or mutant which is derived from, or differing from, a similar polypeptide or protein but which retains at least one biological property of the original, or reference, polypeptide or protein. Different variants of the polypeptide or protein may exist in nature. These variants may be naturally occurring allelic variations characterized by differences in the nucleotide sequences of the structural gene coding for the protein, or may involve differential splicing or post-translational modification, or variants may be artificially (e.g., genetically, synthetically, recombinantly) engineered. The skilled artisan can produce variants having single or multiple amino acid substitutions, deletions, additions, or replacements. These variants may include, inter alfa: (a) variants in which one or more amino acid residues are substituted with conservative or non-conservative amino acids, (b) variants in which one or more amino acids are added to the polypeptide or protein, (c) variants in which one or more of the amino acids includes a substituent group, and/or (d) variants in which the polypeptide or protein is fused with another polypeptide. The techniques for obtaining these variants, including genetic (suppressions, deletions, mutations, etc.), chemical, and enzymatic techniques, are known to persons having ordinary skill in the art. A functional variant or functional fragment of a protein disclosed herein retains at least a portion of the function of a reference protein. For example, a functional variant or functional fragment of a protein can retain at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, or about 100% of the biological activity or function of the reference protein to which it is compared. In addition, a functional variant or functional fragment of a protein can, for example, comprise, or consist of, the amino acid sequence of the reference protein with at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 conservative amino acid substitutions per every 100 consecutive amino acid residues. The phrase conservative amino acid substitution or conservative mutation refers to the replacement of one amino acid by another amino acid with a common property (e.g., hydrophobicity, hydrophilicity, ionic charge, basic, acidic, polar, non-polar, etc). A functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz, G. E. and Schirmer, R. H., Principles of Protein Structure, Springer-Verlag, New York (1979), which is incorporated by reference herein in its entirety). According to such analyses, groups of amino acids may be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz, G. E. and Schirmer, R. H., supra). Examples of conservative mutations include amino acid substitutions of amino acids within the sub-groups above, for example, lysine for arginine and vice versa such that a positive charge may be maintained; glutamic acid for aspartic acid and vice versa such that a negative charge may be maintained; serine for threonine such that a free OH can be maintained; and glutamine for asparagine such that a free NH.sub.2 can be maintained. In some instances, it may be preferable for the conservative amino acid substitution to not interfere with, or inhibit the biological activity of, the functional variant. In some instances the conservative amino acid substitution may enhance the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent molecule. In other instances, it may be desirable for the conservative substitution to interfere with, eliminate, or reduce at least one or more biological activities.

[0125] Alternatively or additionally, functional variants can comprise, or consist of, the amino acid sequence of the reference protein with at least one non-conservative amino acid substitution. Non-conservative mutations involve amino acid substitutions between different groups (i.e., wherein the original and substituted AA have a different chemical property, such as differences in properties relating to hydrophobicity, hydrophilicity, ionic charge, polar, non-polar, acidic, basic properties, etc.). A few examples of non-conservative substitutions would be, lysine (basic) for tryptophan (non-polar) or for glutamic acid (acidic), aspartic acid (acidic) for tyrosine (polar) or for histidine (basic), or phenylalanine (non-polar) for arginine (basic) or for serine (polar), etc. In some instances, it may be preferable for the non-conservative amino acid substitution to not interfere with, or inhibit the biological activity of, the functional variant. In some instances the non-conservative amino acid substitution may enhance the biological activity of the functional variant, such that the biological activity of the functional variant is increased as compared to the parent molecule. In other instances, it may be desirable for the non-conservative substitution to interfere with, eliminate, or reduce at least one or more biological activities.

[0126] A heterologous protein refers to a protein not naturally produced in the cell. A mature protein refers to a post-translationally processed polypeptide, i.e., one from which any pre- or propeptides present in the primary translation product have been removed. Precursor protein refers to the primary product of translation of mRNA, i.e., with pre- and propeptides still present. Pre- and propeptides may be but are not limited to signal peptides or intracellular localization signals.

[0127] The term signal peptide refers to an amino terminal polypeptide preceding the secreted mature protein. The signal peptide is cleaved from and is therefore not present in the mature protein. Signal peptides have the function of directing and translocating secreted proteins across cell membranes. Signal peptide is also referred to as signal protein.

[0128] A signal sequence is included at the beginning of the coding sequence of a protein to be expressed on the surface of a cell. This sequence encodes a signal peptide, N-terminal to the mature polypeptide, that directs the host cell to translocate the polypeptide. The term translocation signal sequence may also be used to refer to this type of signal sequence. Translocation signal sequences can be found associated with a variety of proteins native to eukaryotes and prokaryotes, and are often functional in both types of organisms.

[0129] The term homology refers to the percent of identity between two polynucleotide or two polypeptidemolecules. The correspondence between the sequence of one molecule to another can be determined by techniques known to the art. For example, homology can be determined by a direct comparison of the sequence information between two polypeptide molecules by aligning the sequence information and using readily available computer programs. Alternatively, homology can be determined by hybridization of polynucleotides under conditions that form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s) and size determination of the digested fragments.

[0130] Accordingly, the term sequence similarity in all its grammatical forms refers to the degree of identity, homology, or correspondence between nucleic acid or amino acid sequences of proteins that may or may not share a common evolutionary origin (see Reeck et al., 1987, Cell 50:667, which is incorporated by reference herein in its entirety). In certain embodiments, two DNA sequences are substantially homologous or substantially similar when at least about 50%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% at least about 97%, at least about 98%, at least about 99%, of the nucleotides match over the defined length of the DNA or amino acid sequences. Sequences that are substantially homologous can be identified by comparing the sequences using standard software available in sequence data banks, or in a Southern hybridization experiment under, for example, stringent conditions as understood by those of ordinary skill in the art. For example, stringent hybridization conditions may comprise, or alternatively consist of, hybridization of either target, probe, or detection-reagent DNA to filter bound DNA in 6x sodium chloride/sodium citrate (SSC) at about 45 degrees Celsius, followed by one or more washes in 0.2x SSC, 0.1% SDS at about 50-65 degrees Celsius), followed by one or more washes in 0.1x SSC, 0.2% SDS at about 68 degrees Celsius; or, under other stringent hybridization conditions which are known to those of skill in the art (see, for example, Ausubel, F. M. et al., eds., 1989 Current Protocols in Molecular Biology, Green publishing associates, Inc., and John Wiley & Sons Inc., New York, at pages 6.3.1-6.3.6 and 2.10.3). Polynucleotides encoding such polypeptides are also encompassed by the invention.

[0131] The terms identical or sequence identity in the context of two nucleic acid sequences or amino acid sequences of polypeptides refers to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window. A comparison window, as used herein, refers to a segment of at least about 10, at least about 20, at least about 50, at least about 100, at least about 200, at least about 300, at least about 500, or at least about 1000 residues in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are aligned optimally. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman (1981) Adv. Appl. Math. 2:482, incorporated by reference herein in its entirety; by the alignment algorithm of Needleman and Wunsch (1970) J. Mol. Biol. 48:443, incorporated by reference herein in its entirety; by the search for similarity method of Pearson and Lipman (1988) Proc. Nat. Acad. Sci U.S.A. 85:2444, incorporated by reference herein in its entirety; by computerized implementations of these algorithms (including, but not limited to CLUSTAL in the PC/Gene program by Intelligentics, Mountain View Calif., GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group (GCG), 575 Science Dr., Madison, Wis., U.S.A.); the CLUSTAL program is well described by Higgins and Sharp (1988) Gene 73:237-244 and Higgins and Sharp (1989) CABIOS 5:151-153; Corpet et al. (1988) Nucleic Acids Res. 16:10881-10890; Huang et al. (1992) Computer Applications in the Biosciences 8:155-165; and Pearson et al. (1994) Methods in Molecular Biology 24:307-331, each of which is incorporated by reference herein in its entirety. In addition to computer software-based alignments, alignments may also be performed by manual inspection and manual alignment.

[0132] In one class of embodiments, polypeptides are 70%, at least 70%, 75%, at least 75%, 80%, at least 80%, 85%, at least 85%, 90%, at least 90%, 95%, at least 95%, 97%, at least 97%, 98%, at least 98%, 99%, or at least 99% or 100% identical to a reference polypeptide, or a fragment thereof (e.g., as measured by BLASTP or CLUSTAL, or other alignment software) using default parameters. Similarly, nucleic acids can also be described with reference to a starting nucleic acid, e.g., they can be 50%, at least 50%, 60%, at least 60%, 70%, at least 70%, 75%, at least 75%, 80%, at least 80%, 85%, at least 85%, 90%, at least 90%, 95%, at least 95%, 97%, at least 97%, 98%, at least 98%, 99%, at least 99%, or 100% identical to a reference nucleic acid or a fragment thereof (e.g., as measured by BLASTN or CLUSTAL, or other alignment software using default parameters). When one molecule is said to have a certain percentage of sequence identity with a larger molecule, it means that when the two molecules are optimally aligned, said percentage of residues in the smaller molecule finds a match residue in the larger molecule in accordance with the order by which the two molecules are optimally aligned, and the % (percent) identity is calculated in accord with the length of the smaller molecule.

[0133] The term substantially identical as applied to nucleic acid or amino acid sequences means that a nucleic acid or amino acid sequence comprises, or consists of, a sequence that has 70%, at least 70%, 75%, at least 75%, 80%, at least 80%, 85%, at least 85%, 90%, at least 90%, 95%, at least 95%, 97%, at least 97%, 98%, at least 98%, 99%, or at least 99% or 100%, compared to a reference sequence. As indicated above, sequence identity may be calculated, for example, using programs well-known and routinely used by those of ordinary skill in the art. For example, the BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, an expectation (E) of 10, M=5, N=4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a word length (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1992), incorporated by reference herein in its entirety). Percentage of sequence identity is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity. Preferably, the substantial identity exists over a region of the sequences that is at least about 10, at least about 20, at least about 50, at least about 100, at least about 200, at least about 300, at least about 500, or at least about 1000 residues in length. In a most preferred embodiment, the sequences are substantially identical over the entire length of the coding region.

[0134] Proteins disclosed herein (including functional portions and functional variants thereof) may comprise synthetic amino acids in place of one or more naturally-occurring amino acids. Such synthetic amino acids are known in the art, and include, for example but not limited to, aminocyclohexane carboxylic acid, norleucine, -amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, -phenylserine -hydroxyphenylalanine, phenylglycine, -naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N-benzyl-N-methyl-lysine, N,N-dibenzyl-lysine, 6-hydroxylysine, ornithine, -aminocyclopentane carboxylic acid, -aminocyclohexane carboxylic acid, -aminocycloheptane carboxylic acid, -(2-amino-2-norbornane)-carboxylic acid, ,-diaminobutyric acid, , -diaminopropionic acid, homophenylalanine, and -tert-butylglycine.

[0135] The term substantially purified refers to a nucleic acid sequence, polypeptide, protein or other compound which is essentially free, i.e., is more than about 50% free of, more than about 70% free of, more than about 90% free of, the polynucleotides, proteins, polypeptides and other molecules that the nucleic acid, polypeptide, protein or other compound is naturally associated with.

[0136] Synthetic genes can be assembled from oligonucleotide building blocks that are chemically synthesized using procedures known to those or ordinary skill in the art. These building blocks are ligated and annealed to form gene segments that are then enzymatically assembled to construct the entire gene. Chemically synthesized, as related to a sequence of DNA, means that the component nucleotides were assembled in vitro. Manual chemical synthesis of DNA may be accomplished using well-established procedures.The skilled artisan appreciates the likelihood of enhanced gene expression if codon usage is biased towards those codons favored by the host cell or organism in which it is expressed. Determination of preferred codons can be based on a survey of genes derived from the host cell where sequence information is available.

[0137] The term hybrid, when used in reference to a polypeptide, nucleotide, or fragment thereof, as used herein refers to a polypeptide, polynucleotide, or fragment thereof, whose amino acid and/or nucleotide sequence is not found in nature. For example, a fusion protein of two heterologous proteins or polypeptides or a cDNA encoding a fusion polypeptide.

[0138] Ligand Inducible Polypeptide Coupler and Ligand Inducible Polypeptide Couplers is used interchangeably herein with LIPC and LIPCs, irrespectively, that is, LIPC can mean Coupler (singular) or Couplers plural) As such, LIPC refers to a system and polypeptide components of that system for bringing together (coupling; i.e., oligomerizing, dimerizing) polypeptides, in a small molecule ligand-dependent manner via incorporation of nuclear receptor polypeptide components into fusion proteins (e.g., use of Group H nuclear receptor and EcR receptor polypeptide components (e.g. EcR polypeptide fragments or domains); including EcR ligand binding polypeptides and nuclear receptor USP and/or RXR nuclear receptor polypeptide components (e.g. polypeptide fragments or domain thereof) as described herein.

[0139] Administration of an activating ligand and configuration of LIPC components can be used to regulate the timing and location of dimerization and polypeptide coupling activation. LIPC relies upon protein factors encoded by genes which are not native to the host, and which are encoded by heterologous sequences. A LIPC that is used to control the spatial and temporal association of polypeptide components in a host system can be derived from a foreign source such as bacteria, yeast, plants, insects, or viruses. Thus, the LIPC nuclear receptor polypeptide components confer utility in the host by providing a mechanism to control the association (e.g., dimerization, oligomerization) of polypeptides or proteins with which LIPC components are fused (i.e., engineered to be fusion proteins).

[0140] Genetic switches, also referred to as gene switches or transcriptional switches, are used for controlling gene expression and are artificially designed for the deliberate regulation of transgenes. Gene switches typically encode a trans-activator or trans-inhibitor whose activity can be regulated and a trans-activator-responsive or trans-inhibitor-susceptible promoter for controlling a gene of interest. These factors may be ligand-responsive, chimeric proteins containing a DNA-binding domain, a ligand-binding domain and a transcriptional activation domain or inhibition domain, respectively. These include for example, antibiotic responsive switches based on tetracycline-sensory trans-activators and trans-inhibitors, mammalian or insect steroid receptor-derived trans-activators, and rapamycin-induced trans-activators. Other genetic switches make use of endogenous transcription factors that can be deliberately activated by physical cues or signals, and whose transient activation is tolerated by the host cell. Examples of systems of this kind include gene switches that make use of transcription factors which can be activated by heat or ionizing radiation for example. See e.g., Auslander, S. and Fussenegger, M. (2012). Trends in Biotechnology (electronic release) pp. 1-14; Vilaboa N, Boellmann F, Voellmy R (2011) Gene Switches for Deliberate Regulation of Transgene Expression: Recent Advances in System Development and Uses. J Genet Syndr Gene Ther 2:107, each of which is incorporated by reference herein in its entirety.

[0141] In one embodiment, the genetic switch includes the following components: 1) Co-Activation Partner (CAP) and a Ligand-inducible Transcription Factor (LTF) which form unstable and unproductive heterodimers in the absence of Activator Ligand; 2) Activator Ligand: a molecule (e.g., an ecdysone analog or other a non-steroid small molecule); and 3) an Inducible Promoter, (e.g., a customizable promoter which binds the LTF). In one embodiment, the genetic switch allows for the expression of transduced genes only when the small molecule activator ligand combines with the switch components (CAP and LTF) thereby activating gene transcription from an inducible promoter, and ultimately resulting in expression of desired proteins. The timing, location, and concentration of genetic switch can be regulated in a dose dependent manner with the activator ligand. In certain embodiments components of the EcR-based genetic switch developed by Applicant (for example, as referenced under the trademark) RHEOSWITCH)are used as component parts to generate ligand inducible polypeptide couplers (LIPCs) of the present invention (see for example, PCT Publication Nos. WO 2001/070816, WO 2002/066612, WO 2002/066613, WO 2002/066614, WO 2002/066615, WO 2003/027266, WO 2003/027289, and WO 2005/108617 each of which is hereby incorporated by reference herein in its entirety).

[0142] In the present invention, components of EcR-based genetic switches are employed to create ligand inducible polypeptide couplers described, and envisaged by, the disclosure herein. Ecdysone receptor and EcR are used interchangeably herein and refer to members of the Arthropod superfamily of nuclear receptors, classified into subfamily 1, group H (referred to herein as Group H nuclear receptors). The members of each group share 40-60% amino acid identity in the E (ligand binding) domain (Laudet et al., A Unified Nomenclature System for the Nuclear Receptor Subfamily, 1999; Cell 97: 161-163, which is incorporated by reference herein in its entirety). In addition to the ecdysone receptor, other members of this nuclear receptor subfamily 1, group H include: ubiquitous receptor (UR), Orphan receptor 1 (OR-1), steroid hormone nuclear receptor 1 (NER-1), RXR interacting protein-15 (RIP-15), liver x receptor (LXR), steroid hormone receptor like protein (RLD-1), liver x receptor (LXR), liver x receptor (LXR), farnesoid x receptor (FXR), receptor interacting protein 14 (RIP-14), and farnesol receptor (HRR-1). EcR proteins are characterized by signature DNA and ligand binding domains (LBD), and an activation domain (Koelle et al. 1991, Cell, 67:59-77, which is incorporated by reference herein in its entirety). EcR receptors are responsive to a number of steroidal and non-steroidal compounds, i.e., activating ligands.

[0143] Retinoid X receptor and RXR are used interchangeably herein and refer to a member of the nuclear hormone receptor family, in particular the steroid and thyroid hormone receptor superfamily. Vertebrate RXR includes at least three distinct genes (RXR alpha, beta and gamma), which give rise to a large number of protein products through differential promoter usage and alternative splicing. Invertebrate homologs of RXR (e.g., the ultraspiracle (USP) protein) are found in a wide range of species and are envisaged for use in the present invention.

[0144] Activating ligand as used herein refers to a compound that is capable of binding to a member of the nuclear steroid receptor super family (e.g., EcR and RXR) and activating the member by inducing association (e.g., dimerization, oligomerization, or protein-protein interaction) of the nuclear receptor components. Exemplary activating ligands for the present invention are provided below.

[0145] The term inactive or inactivated, when referencing inactive polypeptides, domains, signaling molecules, protein or polypeptide fragments, or protein subunits of polypeptides, as used herein means a protein or polypeptide that is not presently generating all or substantially all of one or more of its inherent biological functions or activities. In some embodiments, an inactive or inactivated protein or polypeptide becomes activated through association with another protein or polypeptide, i.e., protein-protein interaction. Such activation can occur, for example, through oligomerization induced by the binding of a first nuclear receptor ligand binding protein fragment to a second nuclear receptor protein fragment, wherein the first and second nuclear receptor fragments are part of two separate, larger, first and second heterologous polypeptides, wherein the first and second heterologous polypeptides change from a biologically inactive to a biologically active state upon ligand induced oligomerization.

[0146] T cell or T lymphocyte as used herein is a type of lymphocyte that plays a central role in cell-mediated immunity. They may be distinguished from other lymphocytes, such as B cells and natural killer cells (NK cells), by the presence of a T-cell receptor (TCR) on the cell surface.

[0147] Antibody as used herein refers to monoclonal or polyclonal antibodies. The term monoclonal antibodies, as used herein, refers to antibodies that bind to the same epitope (for example, such as antibodies that are produced by a single clone of B-cells). In contrast, polyclonal antibodies refer to a population of antibodies that bind to different epitopes of the same antigen (for example, such as antibodies that are produced by a heterogenous mixture of different B-cells). Ligand Inducible Polypeptide Coupler (LIPC) of the Invention

[0148] Described herein is a ligand inducible polypeptide coupler (LIPC) thatutilizes the ability of a pair of interacting nuclear receptor proteins (by engineering the LIPC (i.e., nuclear receptor) components to generate fusion proteins) to bring together separate proteins or domains and induce their association (e.g., dimerization, oligomerization) of otherwise separate proteins or domains (e.g., separated, biologically inactive polypeptide monomers, such as receptor tyrosine kinase polypeptides (RTKs) which typically require dimerization to form an active signaling complex). In certain embodiments, the switch system of the presnt invention is an ecdysone receptor (EcR)-based system. The ecdysone receptor-based ligand inducible polypeptide couplermay be either heterodimeric or homodimeric with respect to the parent non-nuclear receptor (LIPC) polypeptide components or domains. On the other hand, it is understood that a functional nuclear receptor (e.g., EcR complex) generally refers to a heterodimeric protein complex containing two or more members of the steroid receptor family. For example, an ecdysone receptor protein obtained from various insects, and an ultraspiracle (USP) protein or vertebrate homolog of USP, retinoid X receptor (RXR) protein (see, e.g., Yao, et al. (1993) Nature 366, 476-479 and Yao, et al., (1992) Cell 71, 63-72, each of which is incorporated by reference herein in its entirety).

[0149] The present invention can include two or more expression cassettes; e.g., encoding EcR and USP/RXR components fused to separate polypeptides or domains (e.g., signaling molecules, signaling domains, complementary protein fragments, protein subunits, and natural or engineered partial or truncated proteins). In the presence of activating ligand, the interaction of EcR-containing polypeptides with the USP/RXR-containing polypeptides brings the attached (fusion) proteins or domains in close proximity allowing for their association (protein-protein interaction), see e.g., FIGS. 2-6.

[0150] The ecdysone receptor complex typically includes proteins which are members of the nuclear receptor superfamily wherein all members are generally characterized by the presence of an amino-terminal transactivation domain, a DNA binding domain (DBD), and a ligand binding domain (LBD) separated from the DBD by a hinge region. Members of the nuclear receptor superfamily are also characterized by the presence of four or five domains: A/B, C, D, E, and in some members F (see, e.g., US patent 4,981,784 and Evans, Science 240:889-895(1988), each of which is incorporated by reference herein in its entirety). The A/B domain corresponds to the transactivation domain, C corresponds to the DNA binding domain, D corresponds to the hinge region, and E corresponds to the ligand binding domain. Some members of the family may also have another transactivation domain on the carboxy-terminal side of the LBD corresponding to F.

[0151] These domains may be either native (i.e., naturally-occurring), modified, or chimeras (i.e., heterologous fusion proteins) of domains from different nuclear receptor proteins. Because the domains of EcR, USP, and RXR are modular in nature, the LBD, DBD, and transactivation domains may be interchanged.

[0152] Within certain embodiments, a dipteran (fruit fly Drosophila melanogaster) or a lepidopteran (spruce bud worm Choristoneura fumiferana) ultraspiracle protein (USP) is utilized as part of an LIPC system. In certain embodiments, a vertebrate or mammalian retinoid X receptor (RXR) (see, e.g., International Publ. No. WO/2001/070816, which is incorporated by reference herein in its entirety) is utilized as part of an LIPC system. In certain embodiments, the ultraspiracle protein of Locusta migratoria (LmUSP) and the RXR homolog 1 and RXR homolog 2 of the ixodid tick Amblyomma americanum (AmaRXR1 and AmaRXR2, respectively) and their non-Dipteran, non-Lepidopteran homologs including, but not limited to: fiddler crab Celuca pugilator RXR homolog (CpRXR), beetle Tenebrio molitor RXR homolog (TmRXR), honeybee Apis mellifera RXR homolog (AmRXR), and an aphid Myzus persicae RXR homolog (MpRXR), all of which are referred to herein collectively as invertebrate RXRs (and which can function similar to vertebrate retinoid X receptor (RXR)) are utilized as part of an LIPC system.

[0153] EcR Components

[0154] The present invention provides for ecdysone receptor (EcR) polypeptide components, e.g., EcR ligand binding domains (LBD), to be employed in a ligand inducible polypeptide coupler system described herein. Exemplary EcR components that can be used in the invention are described, for example, in International PCT Publ. Nos. WO 2001/070816, WO 2002/066612, WO 2002/066613, WO 2002/066614, WO 2002/066615, WO 2003/027266, WO 2003/027289, WO 2005/108617, and WO 2009/114201each of which is incorporated by reference herein in its entirety.

[0155] In certain embodiments, the LIPC EcR component is an EcR ligand binding domain (LBD), or a related steroid/thyroid hormone nuclear receptor family member LBD, analog, combination, modification, or fragement thereof. In some embodiments, the LIPC LBD is from a truncated EcR polypeptide or EcR LBD. A truncation or substitution mutation thereof may be made by any method used in the art, including but not limited to restriction endonuclease digestion/deletion, PCR-mediated oligonucleotide-directed deletion, chemical mutagenesis, DNA strand breakage, and the like.

[0156] The LIPC EcR polypeptide component may be an invertebrate EcR, for example, selected from the class Arthropod. In some embodiments, the LIPC EcR polypeptide component (or fragments thereof) is selected from the group consisting of a Lepidopteran EcR, a Dipteran EcR, an Orthopteran EcR, a Homopteran EcR and a Hemipteran EcR. In particular embodiments, the EcR is a from spruce budwonn Choristoneura fumiferana EcR (CfEcR), a beetle Tenebrio molitor EcR (TmEcR), a Manduca sexta EcR (MsEcR), a Heliothies virescens EcR (HvEcR), a midge Chironomus tentans EcR (CfEcR), a silk moth Bombyx mori EcR (BmEcR), a fruit fly Drosophila melanogaster EcR (DmEcR), a mosquito Aedes aegypti EcR (AaEcR), a blowfly Lucilia capitata EcR (LcEcR), a blowfly Lucilia cuprina EcR (LucEcR), a Mediterranean fruit fly Ceratitis capitata EcR (CcEcR), a locust Locusta migratoria EcR (LmEcR), an aphid Myzus persicae EcR (MpEcR), a fiddler crab Celuca pugilator EcR (CpEcR), an ixodid tic Amblyomma americanurn EcR (AmaEcR), a whitefly Bamecia argentifoli EcR (BaEcR, SEQ ID NO: 20) or a leafhopper Nephotetix cincticeps EcR (NcEcR, SEQ ID NO: 21). In one embodiment, the LIPC LBD (or fragment thereof) is from spruce budworm (Choristoneura fumiferana) EcR (CfEcR) or fruit fly Drosophila melanogaster EcR (DmEcR).

[0157] In certain embodiments, the LIPC LBD is from a truncated EcR polypeptide. In some embodiments, the LIPC EcR polypeptide truncation results in a deletion of at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, or 265 amino acids. Preferably, an LIPC EcR polypeptide truncation results in a deletion of at least a partial polypeptide domain. More preferably, the LIPC EcR polypeptide truncation results in a deletion of at least an entire polypeptide domain. In a certain embodiments, the LIPC EcR polypeptide truncation results in a deletion of at least an AB-domain, a C-domain, a D-domain, an F-domain, an A/B/C-domains, an A/B/.sup.1/.sub.2-C-domains, an A/B/C/D-domains, an A/B/C/D/F-domains, an A/B/F-domains, an A/B/C/F-domains, a partial E domain, or a partial F domain. A combination of several complete and/or partial domain deletions may also be performed.

[0158] In some embodiments, an LIPC ecdysone receptor polypeptide component, or fragment thereof, is encoded by a polynucleotide comprising a nucleic acid sequence of SEQ ID NO: 22 (CfEcR-EF), SEQ ID NO: 23 (DmEcR-EF), SEQ ID NO: 24 (CfEcR-DE), or SEQ ID NO: 25 (DmEcR-DE), or a fragment thereof.

[0159] In some embodiments, an LIPC ecdysone receptor polypeptide component, or fragment thereof, is encoded by a polynucleotide comprising a nucleic acid sequence of SEQ ID NO: 1 (CfEcR-DEF), SEQ ID NO: 2 (CfEcR-CDEF), SEQ ID NO: 3 (DmEcR-DEF), SEQ ID NO: 4 (TmEcR-DEF) or SEQ ID NO: 5 (AmaEcR-DEF), or a fragment thereof.

[0160] In certain embodiments, an LIPC ecdysone receptor polypeptide component comprises an amino acid sequence of SEQ ID NO: 26 (CfEcR-EF), SEQ ID NO: 27 (DmEcR-EF), SEQ ID NO: 28 (CfEcR-DE), or SEQ ID NO: 29 (DmEcR-DE), or a fragment thereof. In some embodiments, an LIPC ecdysone receptor polypeptide component comprises an amino acid sequence of SEQ ID NO: 6 (CfEcR-DEF), SEQ ID NO: 8 (CfEcR-CDEF), SEQ ID NO: 7 (DmEcR-DEF), SEQ ID NO: 9 (TmEcR-DEF), or SEQ ID NO: 10 (AmaEcR-DEF), or a fragment thereof.

[0161] In addition, amino acid residues that are involved in ligand binding to Group H nuclear receptor ligand binding domains (e.g., EcR ligand binding domains) that affect the ligand sensitivity and magnitude of gene expression induction in an ecdysone receptor-based inducible gene expression (gene switch) system have been identified (see, e.g., International Publ. No. WO 02/066612, which is incorporated by reference herein in its entirety). These substitution mutant nuclear receptor polypeptides and their use in a LIPC system can provide improved ligand-induced (activated) polypeptide coupling in host cells and organisms in which regulation (modulation, control) of ligand sensitivity and magnitude of ligand induced oligomerization may be selected as desired, depending upon the application. As described further below, Group H nuclear receptors which comprise substitution mutations (referred to herein as substitution mutants) can be employed in ligand inducible polypeptide couplers (LIPC) of the present invention.

[0162] LIPC ecdysone receptor (EcR) polypeptide components (including EcR ligand binding domains (LBD)) used in the present invention may be from an invertebrate EcR, e.g., selected from the class Arthropod EcR. In certain embodiments, the LIPC EcR polypeptide component is selected from the group consisting of a Lepidopteran EcR, a Dipteran EcR, an Orthopteran EcR, a Homopteran EcR and a Hemipteran EcR. In certain embodiments, the EcR ligand binding domain for use in the present invention is from a spruce budworm Choristoneura fumiferana EcR (CfEcR), a beetle Tenebrio molitor EcR (TmEcR), a Manduca sexta EcR (MsEcR), a Heliothies virescens EcR (HvEcR), a midge Chironomus tentans EcR (CtEcR), a silk moth Bombyx mori EcR (BmEcR), a squinting bush brown Bicyclus anynana EcR (BanEcR), a buckeye Junonia coenia EcR (JcEcR), a fruit fly Drosophila melanogaster EcR (DmEcR), a mosquito Aedes aegypti EcR (AaEcR), a blowfly Lucilia capitata (LcEcR), a blowfly Lucilia cuprina EcR (LucEcR), a blowfly Caliphora vicinia EcR (CvEcR), a Mediterranean fruit fly Ceratitis capitata EcR (CcEcR), a locust Locusta migratoria EcR (LmEcR), an aphid Myzus persicae EcR (MpEcR), a fiddler crab Celuca pugilator EcR (CpEcR), an ixodid tick Amblyomma americanum EcR (AmaEcR), a whitefly Bamecia argentifoli EcR or a leafhopper Nephotetix cincticeps EcR. In some embodiments, the LIPC polypeptide component is from a CfEcR, a DmEcR, or an AmaEcR.

[0163] In certain embodiments, the LIPC Group H nuclear receptor polypeptide component is encoded by a polynucleotide comprising, or consisting of, a codon mutation that results in a substitution of a) amino acid residue 20, 21, 48, 51, 52, 55, 58, 59, 61, 62, 92, 93, 95, 96, 107, 109, 110, 120, 123, 125, 175, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 17, b) amino acid residues 95 and 110 of SEQ ID NO: 17, c) amino acid residues 218 and 219 of SEQ ID NO: 17, d) amino acid residues 107 and 175 of SEQ ID NO: 17, e) amino acid residues 127 and 175 of SEQ ID NO: 17, f) amino acid residues 107 and 127 of SEQ ID NO: 17, g) amino acid residues 107, 127 and 175 of SEQ ID NO: 17, h) amino acid residues 52, 107 and 175 of SEQ ID NO: 17, i) amino acid residues 96, 107, and 175 of SEQ ID NO: 17, j) amino acid residues 107, 110, and 175 of SEQ ID NO: 17, k) amino acid residue 107, 121, 213, or 217 of SEQ ID NO: 18, or 1) amino acid residue 91 or 105 of SEQ ID NO: 19. In certain embodiments, the Group H nuclear receptor ligand binding domain is from an ecdysone receptor. In certain embodiments, an LIPC EcR polypeptide component comprising a substitution mutation can comprise, or consist of, a substitution of about or at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or more wild-type or naturally occurring amino acid with a different amino acid relative to the wild-type or naturally occurring EcR receptor ligand binding domain polypeptide.

[0164] In another embodiment, the LIPC Group H nuclear receptor ligand polypeptide component is encoded by a polynucleotide comprising, or consisting of, a codon mutation that results in a substitution of a) an alanine residue at a position equivalent or analogous to amino acid residue 20, 21, 48, 51, 55, 58, 59, 61, 62, 92, 93, 95, 109, 120, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 17, b) an alanine, valine, isoleucine, or leucine residue at a position equivalent or analogous to amino acid residue 52 of SEQ ID NO: 17, c) an alanine, threonine, aspartic acid, or methionine residue at a position equivalent or analogous to amino acid residue 96 of SEQ ID NO: 17, d) a proline, serine, methionine, or leucine residue at a position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 17, e) a phenylalanine residue at a position equivalent or analogous to amino acid residue 123 of SEQ ID NO: 17, f) an alanine residue at a position equivalent or analogous to amino acid residue 95 of SEQ ID NO: 17 and a proline residue at a position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 17, g) an alanine residue at a position equivalent or analogous to amino acid residues 218 and 219 of SEQ ID NO: 17, h) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17, i) an glutamine residue at a position equivalent or analogous to amino acid residues 175 of SEQ ID NO: 17, j) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 17, k) a glutamine residue at a position equivalent or analogous to amino acid residues 127 and 175 of SEQ ID NO: 17, 1) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residue 127 of SEQ ID NO: 17, m) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residues 127 and 175 of SEQ ID NO: 17, n) a valine residue at a position equivalent or analogous to amino acid residue of SEQ ID NO: 17, an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 17, o) an alanine residue at a position equivalent or analogous to amino acid residue 96 of SEQ ID NO: 17, an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residue of SEQ ID NO: 17, p) an alanine residue at a position equivalent or analogous to amino acid residue 52 of SEQ ID NO: 17, an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17, and a glutamine residue at a position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 17, q) a threonine residue at a position equivalent or analogous to amino acid residue 96 of SEQ ID NO: 17, an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17, and a glutamine residue at a position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 17, r) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17, a proline residue at a position equivalent or analogous to amino acid 110 of SEQ ID NO: 17, and a glutamine residue at a position equivalent or analogous to amino acid 175 of SEQ ID NO: 17, s) a proline at a position equivalent or analogous to amino acid residue 107 of 25 SEQ ID NO: 18, t) an arginine or a leucine at a position equivalent or analogous to amino acid residue 121 of SEQ ID NO: 18, u) an alanine at a position equivalent or analogous to amino acid residue 213 of SEQ ID NO: 18, v) an alanine or a serine at a position equivalent or analogous to amino acid residue 217 of SEQ ID NO: 18, w) an alanine at a position equivalent or analogous to amino acid residue 91 of SEQ ID NO: 19, or x) a proline at a position equivalent or analogous to amino acid residue 105 of SEQ ID NO: 19. In certain embodiments, the LIPC Group H nuclear receptor polypeptide component is from an ecdysone receptor.

[0165] In another embodiment, the LIPC Group H nuclear receptor polypeptide component having a substitution mutation is an ecdysone receptor ligand binding domain comprising, or consisting of, a substitution mutation encoded by a polynucleotide comprising, or consisting of, a codon mutation that results in a substitution mutation selected from the group consisting of a) E20A, Q21A, F48A, I51A, T52A, T52V, T52I, T52L, T55A, T58A, V59A, L61 A, I62A, M92A, M93A, R95A, V96A, V96T, V96D, V96M, V107I, F109A, A110P, A110S, A110M, A110L, Y120A, A123F, M125A, R175E, M218A, C219A, L223A, L230A, L234A, W238A, R95A/A110P, M218A/C219A, V107I/R175E, Y127E/R175E, V107I/Y127E, V107I/Y127E/R175E, T52V/V107I/R175E, V96A/V107I/R175E, T52A/V107I/R175E, V96T/V107I/R175E or V107I/A110P/R175E substitution mutation of SEQ ID NO: 17, b) A107P, G121R, G121L, N213A, C217A, or C217S substitution mutation of SEQ ID NO: 18, and c) G91A or A105P substitution mutation of SEQ ID NO: 19.

[0166] In other embodiments, the LIPC Group H nuclear receptor polypeptide component having a substitution mutation is an ecdysone receptor ligand binding domain polypeptide comprising, or consisting of, a substitution mutation encoded by a polynucleotide that hybridizes to a polynucleotide comprising a codon mutation that results in a substitution mutation selected from the group consisting of a) T58A, A110P, A110L, A110S, or A110M of SEQ ID NO: 17, b) A107P of SEQ ID NO: 18, and c) A105P of SEQ ID NO: 19 under hybridization conditions comprising a hybridization step in less than 500 mM salt and at least 37 degrees Celsius, and a washing step in 2XSSPE at least 63 degrees Celsius. In certain embodiments, the hybridization conditions comprise less than 200 mM salt and at least 37 degrees Celsius for the hybridization step. In another embodiment, the hybridization conditions comprise 2XSSPE and 63 degrees Celsius for both the hybridization and washing steps. In another embodiment, the ecdysone receptor ligand binding domain lacks or exhibits reduced steroid binding activity, such as 20-hydroxyecdysone binding activity, ponasterone A binding activity, or muristerone A binding activity.

[0167] In another embodiment, the LIPC Group H nuclear receptor polypeptide component has a substitution mutation at a position equivalent or analogous to a) amino acid residue 20, 21, 48, 51, 52, 55, 58, 59, 61, 62, 92, 93, 95, 96, 107, 109, 110, 120, 123, 125, 175, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 17, b) amino acid residues 95 and 110 of SEQ ID NO: 17, c) amino acid residues 218 and 219 of SEQ ID NO: 17, d) amino acid residues 107 and 175 of SEQ ID NO: 17, e) amino acid residues 127 and 175 of SEQ ID NO: 17, f) amino acid residues 107 and 127 of SEQ ID NO: 17, g) amino acid residues 107, 127 and 175 of SEQ ID NO: 17, h) amino acid residues 52, 107 and 175 of SEQ ID NO: 17, i) amino acid residues 96, 107 and 175 of SEQ ID NO: 17, j) amino acid residues 107, 110, and 175 of SEQ ID NO: 17, k) amino acid residue 107, 121, 213, or 217 of SEQ ID NO: 18, or 1) amino acid residue 91 or 105 of SEQ ID NO: 19. In certain embodiments, the LIPC Group H nuclear receptor polypeptide component is from an ecdysone receptor.

[0168] In some embodiments, the LIPC Group H nuclear receptor polypeptide component has a substitution of a) an alanine residue at a position equivalent or analogous to amino acid residue 20, 21, 48, 51, 55, 58, 59, 61, 62, 92, 93, 95, 109, 120, 125, 218, 219, 223, 230, 234, or 238 of SEQ ID NO: 17, b) an alanine, valine, isoleucine, or leucine residue at a position equivalent or analogous to amino acid residue 52 of SEQ ID NO: 17, c) an alanine, threonine, aspartic acid, or methionine residue at a position equivalent or analogous to amino acid residue 96 of SEQ ID NO: 17, d) a proline, serine, methionine, or leucine residue at a position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 17, e) a phenylalanine residue at a position equivalent or analogous to amino acid residue 123 of SEQ ID NO: 17, f) an alanine residue at a position equivalent or analogous to amino acid residue 95 of SEQ ID NO: 17 and a proline residue at a position equivalent or analogous to amino acid residue 110 of SEQ ID NO: 17, g) an alanine residue at a position equivalent or analogous to amino acid residues 218 and 219 of SEQ ID NO: 17, h) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17, 1) a glutamine residue at a position equivalent or analogous to amino acid residues 175 of SEQ ID NO: 17, j) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 17, k) a glutamine residue at a position equivalent or analogous to amino acid residues 127 and 175 of SEQ ID NO: 17, 1) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residue 127 of SEQ ID NO: 17, m) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residues 127 and 175 of SEQ ID NO: 17, n) a valine residue at a position equivalent or analogous to amino acid residue 52 of SEQ ID NO: 17, an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 17, o) an alanine residue at a position equivalent or analogous to amino acid residue 96 of SEQ ID NO: 17, an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17 and a glutamine residue at a position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 17, p) an alanine residue at a position equivalent or analogous to amino acid residue 52 of SEQ ID NO: 17, an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17, and a glutamine residue at a position equivalent or analogous to amino acid residue 175 of SEQ ID NO: 17, q) a threonine residue at a position equivalent or analogous to amino acid residue 96 of SEQ ID NO: 17, an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17, and a glutamine residue at a position equivalent or analogous to amino acid residue 175 of SEQ ID NO. 17, r) an isoleucine residue at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 17, a proline residue at a position equivalent or analogous to amino acid 110 of SEQ ID NO: 17, and a glutamine residue at a position equivalent or analogous to amino acid 175 of SEQ ID NO: 17, s) a proline at a position equivalent or analogous to amino acid residue 107 of SEQ ID NO: 18, t) an arginine or a leucine at a position equivalent or analogous to amino acid residue 121 of SEQ ID NO: 18, u) an alanine at a position equivalent or analogous to amino acid residue 213 of SEQ ID NO: 18, v) an alanine or a serine at a position equivalent or analogous to amino acid residue 217 of SEQ ID NO: 18, w) an alanine at a position equivalent or analogous to amino acid residue 91 of SEQ ID NO: 19, or x) a proline at a position equivalent or analogous to amino acid residue 105 of SEQ ID NO: 19. In certain embodiments, the LIPC Group H nuclear receptor polypeptide component is from an ecdysone receptor.

[0169] In another embodiment, an LIPC Group H nuclear receptor polypeptide component having a substitution mutation is an ecdysone receptor ligand binding domain polypeptide composing a substitution mutation, wherein the substitution mutation is selected from the group consisting of a) E20A, Q21A, F48A, I51A, T52A, T52V, T52I, T52L, T55A, T58A, V59A, L61A, I62A, M92A, M93A, R95A, V96A, V96T, V96D, V96M, V107L F109A, A110P, A110S, A110M, A110L, Y120A, A123F, M125A, R175E, M218A, C219A, L223A, L230A, L234A, W238A, R95A/A110P, M218A C219A, V107I/R175E, Y127E/R175E, V107I/Y127E, V107I/Y127E/R175E, T52V/V107I/R175E, V96A/V107I/R175E, T52A/V107I/R175E, V96T/V107I/R175E, or V107I/A110P/R175E substitution mutation of SEQ ID NO: 17, b) A107P, G121R, G121L, N213A, C217A, or C217S substitution mutation of SEQ ID NO: 18, and c) G91A or A105P substitution mutation of SEQ ID NO: 19. In certain embodiments an EcR polypeptide component (amino acid sequence) used in an LIPC protein of the invention comprises, or alternatively consists of, one or more substitution mutations selected from the group consisting of substitutions indicated in Table 1.

TABLE-US-00001 TABLE 1 EcR polypeptide substitution mutations that can be used in the LIPC system. Reference PCT EcR Domain Single Amino Acid EcR Domain Combination Publication Substitutions Substitution Mutations WO 2002/066612 In SEQ ID NO: 1 of WO 2002/066612 In SEQ ID NO: 1 of WO 2002/066612 (PCT/US2002/005090) (provided herein as SEQ ID NO: 17): (provided herein as SEQ ID NO: 17): NOVEL E20X or A T52X + V107X + R175X SUBSTITUTION Q21X or A T52A + V107I + R175E MUTANT F48X or A, L, W, Y, K, R, N T52V + V107I + R175E RECEPTORS AND I51X or A, M, N, L T52V + A110P THEIR USE IN A T52X or A, V, I, L, M, E, R95X + A110X NUCLEAR P, R, W, G, Q R95A + A110P RECEPTOR-BASED M54W or T V96X + V107X + R175X INDUCIBLE GENE T55X or A V96A + V107I + R175E EXPRESSION T58X or A V96T + V107I + R175E SYSTEM, V59X or A V96T + 119F which is hereby L61X or A V107X + A110X + R175X incorporated by I62X or A V107X + Y127X reference herein in its M92X or A, L, E V107X + Y127X + R175X entirety. M93X or A V107X + R175X R95X or A, H, M, W V107I + A110P + Y127E V96X or A, T, D, M, S, E V107I + A110P + Y127E V107X or I V107I + A110P + R175E F109X or A, W, P, N, M V107I + Y127E A110X or P, S, M, L, E, N, W V107I + Y127E + L152V N119F V107I + Y127E + R175E Y120X or A, W, M V107I + R175E A123X or F A110P + V128F M125X or A, P, R, E, L, Y127X + R175X C, W, G, I, N, S, V Y127E + R175E V128F N218X + M219X L132M or N, V, E R175X or E N218X M219X L223X or A, K, R, Y L230X or A L234X or A, M, I, R, W W238X or A, P, E, Y, M, L INX00068-WO In SEQ ID NO: 1 of WO 2005/108617 In SEQ ID NO: 1 of WO 2005/108617 WO 2005/108617 (provided herein as SEQ ID NO: 86): (provided herein as SEQ ID NO: 86): (PCT/US2005/015089) F48X or N, R, Y, W, L, K T52X + A110X MUTANT I51X or M, N, L T52X + V107X + Y127X RECEPTORS AND T52X or L, P, M, R, W, G, T52V + A110P THEIR USE IN A Q, E, V T52V + V107I + Y127E NUCLEAR M54X or W, T V96X + N119X RECEPTOR-BASED M92X or L, E V96T + N119F INDUCIBLE GENE R95X or H, M, W V107X + A110X + Y127X EXPRESSION V96X or L, S, E, W, T V107I + A110P + Y127E SYSTEM V107I V107X + Y127X + 259X* Which is hereby F109X or W, P, L, M, N V107I + Y127E + 259G* incorporated by A110X or E, W, N, P A110X + V128X reference herein in its N119X or F A110P + V128F entirety. Y120X or W, M M125X or E, P, L, C, W, G, I, N, S, V, R V128X or F L132X or M, N, E, V M219X or A, K, W, Y L223X or K, R, Y L234X or M, R, W, I W238X or P, E, L, M, Y

[0170] RXR Components

[0171] The present invention provides for particular RXR components, including RXR ligand binding domains (LBD), to be employed in ligand inducible polypeptide couplers (LIPCs) described herein. Exemplary RXR components that can be used in the present invention include, for example, those described in International PCT Publ. Nos.: WO 2001/070816; WO 2002/066612; WO 2002/066613; WO 2002/066614; WO 2002/066615; WO 2003/027266; WO 2003/027289; WO 2005/108617 and, WO 2009/114201, each of which is incorporated by reference herein in its entirety.

[0172] In certain embodiments, the LIPC RXR component is a mouse Mus musculus RXR (MmRXR) or a human Homo sapiens RXR (HsRXR). The LIPC RXR component may be an RXR.sub., RXR.sub., or RXR.sub.isoform, or fragment thereof.

[0173] In some embodiments, the RXR LIPC component is a truncated RXR. The LIPC RXR polypeptide truncation can comprise, or consist of, a deletion of at least 1, 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, 260, or 265 amino acids. In certain embodiments, the LIPC RXR polypeptide truncation comprises, or consists of, a deletion of at least a partial polypeptide domain. In some embodiments, the LIPC RXR polypeptide truncation comprises, or consists of, a deletion of at least an entire polypeptide domain. In a specific embodiment, the LIPC RXR polypeptide truncation comprises, or consists of, a deletion of at least an AB-domain deletion, a C-domain deletion, a D-domain deletion, an E-domain deletion, an F-domain deletion, an A/B/C-domains deletion, an A/B/1/2-C-domains deletion, an A B/C/D-domains deletion, an A/B/C D/F-domains deletion, an A/B/F-domains, and an A/B/C/F-domains deletion. A combination of several complete and/or partial domain deletions may also be performed.

[0174] In certain embodiments, the LIPC RXR polypeptide component is encoded by a polynucleotide comprising, or consisting of, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, and SEQ ID NO: 39, or a fragment thereof.

[0175] In another embodiment, the LIPC RXR component comprises or consists of a polypeptide sequence selected from the group consisting of SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, and SEQ ID NO: 49, or a fragment thereof.

[0176] In certain embodiments, LIPC of the invention include a chimeric RXR polypeptide comprising at least two polypeptide fragments selected from the group consisting of: 1) a vertebrate species RXR polypeptide fragment; 2) an invertebrate species RXR polypeptide fragment; and, 3) a non-Dipteran/non-Lepidopteran invertebrate species RXR polypeptide fragment. An LIPC chimeric RXR polypeptide component of the invention may comprise or consist of two different animal species RXR polypeptide fragments, or when the animal species is the same, the two or more polypeptide fragments may be from two or more different isoforms of the animal species RXR polypeptide fragment.

[0177] In some embodiments, the vertebrate species LIPC RXR polypeptide fragment comprises or consists of a mouse Mus musculus RXR (MmRXR) or a human Homo sapiens RXR (HsRXR), or fragment thereof. The LIPC RXR polypeptide component may comprise or consist of an RXR.sub., RXR.sub., or RXR.sub.isoform, or fragment thereof.

[0178] In some embodiments, the vertebrate species LIPC RXR polypeptide fragment is from a vertebrate species RXR encoded by a polynucleotide comprising, or consisting of, a nucleic acid sequence selected from the group consisting of SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, and SEQ ID NO: 67, or fragment thereof. In another embodiment, the vertebrate species LIPC RXR polypeptide fragment is from a vertebrate species RXR comprising, or consisting of, an amino acid sequence selected from the group consisting of SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO: 70, SEQ ID NO: 71, SEQ ID NO: 72, and SEQ ID NO: 73, or fragment thereof.

[0179] In another embodiment, a LIPC invertebrate species RXR polypeptide fragment is from a locust Locusta migratoria ultraspiracle polypeptide (LmUSP), an ixodid tick Amblyomma americanum RXR homolog 1 (AmaRXR1), a ixodid tick Amblyomma americanum RXR homolog 2 (AmaRXR2), a fiddler crab Celuca pugilator RXR homolog (CpRXR), a beetle Tenebrio molitor RXR homolog (TmRXR), a honeybee Apis mellifera RXR homolog (AmRXR), and an aphid Myzus persicae RXR homolog (MpRXR).

[0180] In certain embodiments, a LIPC invertebrate species RXR polypeptide fragment is from a invertebrate species RXR polypeptide encoded by a polynucleotide comprising or consisting of a nucleic acid sequence of SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, or SEQ ID NO: 55, or fragment thereof. In another embodiment, a LIPC invertebrate species RXR polypeptide fragment is from a invertebrate species RXR polypeptide comprising or consisting of an amino acid sequence of SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, or SEQ ID NO: 61, or fragment thereof.

[0181] In certain embodiments, a LIPC invertebrate species RXR polypeptide fragment is from a non-Dipteran/non-Lepidopteran invertebrate species RXR homolog.

[0182] In some embodiments, a LIPC chimeric RXR component comprises or consists of at least one vertebrate species RXR polypeptide fragment and one invertebrate species RXR polypeptide fragment.

[0183] In another embodiment, a LIPC chimeric RXR component comprises or consists of at least one vertebrate species RXR polypeptide fragment and one non-Dipteran/non-Lepidopteran invertebrate species RXR homolog polypeptide fragment.

[0184] In another embodiment, a LIPC chimeric RXR component comprises or consists of at least one invertebrate species RXR polypeptide fragment and one non-Dipteran/non-Lepidopteran invertebrate species RXR homolog polypeptide fragment.

[0185] In another embodiment, a LIPC chimeric RXR component comprises or consists of at least one vertebrate species RXR polypeptide fragment and one different vertebrate species RXR polypeptide fragment.

[0186] In another embodiment, a LIPC chimeric RXR component comprises or consists of at least one invertebrate species RXR polypeptide fragment and one different invertebrate species RXR polypeptide fragment.

[0187] In another embodiment, a LIPC chimeric RXR component comprises or consists of at least one non-Dipteran/non-Lepidopteran invertebrate species RXR polypeptide fragment and one different non-Dipteran non-Lepidopteran invertebrate species RXR polypeptide fragment.

[0188] In certain embodiments, a LIPC chimeric RXR component has an RXR region comprising at least one polypeptide fragment selected from the group consisting of an EF-domain helix 1, an EF-domain helix 2, an EF-domain helix 3, an EF-domain helix 4, an EF-domain helix 5, an EF-domain helix 6, an EF-domain helix 7, an EF-domain helix 8, and EF-domain helix 9, an EF-domain helix 10, an EF-domain helix 11, an EF-domain helix 12, an F-domain, and/or an EF-domain -pleated sheet, wherein at least one of two or more domains are from different species RXR (e.g., a human RXR polypeptide fragment and a murine RXR polypeptide fragment).

[0189] In another embodiment, a first polypeptide fragment of a LIPC chimeric RXR component component comprises or consists of helices 1-6, helices 1-7, helices 1-8, helices 1-9, helices 1-10, helices 1-11, or helices 1-12 of a first species RXR, and a second polypeptide fragment of the chimeric LIPC RXR component comprises or consists of helices 7-12, helices 8-12, helices 9-12, helices 10-12, helices 11-12, helix 12, or F domain of a second species RXR, respectively.

[0190] In another embodiment, a first polypeptide fragment of a LIPC chimeric RXR component comprises or consists of helices 1-6 of a first species RXR, and a second polypeptide fragment of the LIPC chimeric RXR component comprises helices 7-12 of a second species RXR.

[0191] In another embodiment, a first polypeptide fragment of a LIPC chimeric RXR component comprises or consists of helices 1-7 of a first species RXR, and a second polypeptide fragment of the LIPC chimeric RXR component comprises or consists of helices 8-12 of a second species RXR.

[0192] In another embodiment, a first polypeptide fragment of a LIPC chimeric RXR component comprises or consists of helices 1-8 of a first species RXR, and a second polypeptide fragment of the LIPC chimeric RXR component comprises or consists of helices 9-12 of a second species RXR.

[0193] In another embodiment, a first polypeptide fragment of a LIPC chimeric RXR component comprises or consists of helices 1-9 of a first species RXR, and a second polypeptide fragment of the LIPC chimeric RXR component comprises or consists of helices 10-12 of a second species RXR.

[0194] In another embodiment, a first polypeptide fragment of a LIPC chimeric RXR component comprises or consists of helices 1-10 of a first species RXR, and a second polypeptide fragment of the LIPC chimeric RXR component comprises or consists of helices 11-12 of a second species RXR.

[0195] In another embodiment, a first polypeptide fragment of a LIPC chimeric RXR component comprises or consists of helices 1-11 of a first species RXR, and a second polypeptide fragment of the LIPC chimeric RXR component comprises or consists of helix 12 of a second species RXR.

[0196] In another embodiment, a first polypeptide fragment of a LIPC chimeric RXR component comprises or consists of helices 1-12 of a first species RXR, and a second polypeptide fragment of the LIPC chimeric RXR component comprises or consists of an F domain of a second species RXR.

[0197] In another embodiment, a LIPC RXR component comprises or consists of a truncated chimeric RXR. A chimeric RXR truncation can comprise a deletion of at least 1, 2, 3, 4, 5, 6, 8, 10, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 25, 26, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, or 240 amino acids. In certain embodiments, a chimeric RXR truncation results in a deletion of at least a partial polypeptide domain. In other embodiments, a chimeric RXR truncation results in a deletion of at least an entire polypeptide domain. In another embodiment, a chimeric RXR truncation results in a deletion of at least a partial E-domain, a complete E-domain, a partial F-domain, a complete F-domain, an EF-domain helix 1, an EF-domain helix 2, an EF-domain helix 3, an EF-domain helix 4, an EF-domain helix 5, an EF-domain helix 6, an EF-domain helix 7, an EF-domain helix 8, and EF-domain helix 9, an EF-domain helix 10, an EF-domain helix 11, an EF-domain helix 12, and/or an EF-domain f3-pleated sheet. A combination of several partial and or complete domain deletions may also be performed.

[0198] In certain embodiments, a LIPC truncated chimeric RXRcomponent is encoded by a polynucleotide comprising or consisting of a nucleic acid sequence of SEQ ID NO: 74, SEQ ID NO: 75, SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, or SEQ ID NO: 79, or fragments thereof. In another embodiment, a LIPC truncated chimeric RXR component comprises or consists of a nucleic acid sequence of SEQ ID NO: 80, SEQ ID NO: 81, SEQ ID NO: 82, SEQ ID NO: 83, SEQ ID NO: 84, or SEQ ID NO: 85, or fragment thereof.

[0199] In another embodiment, a LIPC chimeric RXR component is encoded by a polynucleotide comprising or consisting of a nucleic acid sequence of a) SEQ ID NO: 11, b) nucleotides 1-348 of SEQ BD NO: 12 and nucleotides 268-630 of SEQ ID NO: 13, c) nucleotides 1-408 of SEQ ID NO: 12 and nucleotides 337-630 of SEQ ID NO: 13, d) nucleotides 1-465 of SEQ ID NO: 12 and nucleotides 403-630 of SEQ ID NO: 13, e) nucleotides 1-555 of SEQ ID NO: 12 and nucleotides 490-630 of SEQ ID NO: 13, f) nucleotides 1-624 of SEQ ID NO: 12 and nucleotides 547-630 of SEQ ID NO: 13, g) nucleotides 1-645 of SEQ ID NO: 12 and nucleotides 601-630 of SEQ ID NO: 13, and h) nucleotides 1-717 of SEQ ID NO: 12 and/or nucleotides 613-630 of SEQ ID NO: 13, or a fragment thereof.

[0200] In another preferred embodiment, a LIPC chimeric RXR component comprises of consists of an amino acid sequence of a) SEQ ID NO: 14, b) amino acids 1-116 of SEQ ID NO: 15 and amino acids 90-210 of SEQ ID NO: 16, c) amino acids 1-136 of SEQ ID NO: 15 and amino acids 113-210 of SEQ ID NO: 16, d) amino acids 1-155 of SEQ ID NO: 15 and amino acids 135-210 of SEQ ID NO: 16, e) amino acids 1-185 of SEQ ID NO: 15 and amino acids 164-210 of SEQ ID NO: 16, f) amino acids 1-208 of SEQ ID NO: 15 and amino acids 183-210 of SEQ ID NO: 16, g) amino acids 1-215 of SEQ ID NO: 15 and amino acids 201-210 of SEQ ID NO: 16, and/or h) amino acids 1-239 of SEQ ID NO: 15 or amino acids 205-210 of SEQ ID NO: 16, or a fragment thereof.

[0201] EcR and/or RXR Polypeptide Components

In certain embodiments, EcR and/or USP/RXR polypeptides used in a LIPC of the invention comprise, or consist of, at least one or more EcR and/or RXR substitution mutants selected from the group consisting of substitution mutants described in any one or more of International PCT Publ. Nos. WO 2001/070816, WO 2002/066612, WO 2002/066613, WO 2002/066614, WO 2002/066615, WO 2003/027266, WO 2003/027289, and WO 2005/108617, each of which is incorporated by reference herein in its entirety.

[0202] Gene Expression Cassettes of the Present Invention

[0203] One embodiment of the invention includes a ligand inducible polypeptide coupler (LIPC) system comprising: a) a first expression cassette that is capable of being expressed in a host cell comprising a polynucleotide that encodes a first fusion protein (polypeptide) comprising i) a nuclear receptor polypeptide or fragment thereof and ii) a first inactive signaling domain; and b) a second expression cassette that is capable of being expressed in the host cell comprising a polynucleotide sequence that encodes a second, separate, fusion protein (polypeptide) comprising i) a second nuclear receptor polypeptide or fragment thereof and ii) a second inactive signaling domain; wherein the first and second inactive signaling domains are activated upon association of the two fusion proteins with one another.

[0204] Another embodiment of the invention includes a ligand inducible polypeptide coupler (LIPC) system comprising: a) a first expression cassette that is capable of being expressed in a host cell comprising a polynucleotide that encodes a first fusion protein (polypeptide) comprising i) an arthropod nuclear receptor polypeptide or fragment thereof; and ii) a first inactive signaling domain; and b) a second expression cassette that is capable of being expressed in the host cell comprising a polynucleotide sequence that encodes a second, separate, fusion protein (polypeptide) comprising i) a second, non-arthropod nuclear receptor polypeptide or fragment thereof; and ii) a second inactive signaling domain; wherein the first and second inactive signaling domains are activated upon association of the two fusion proteins with one another. In another embodiment the non-arthropod nuclear receptor comprises a non-dipteran/non-lepidopteran nuclear receptor polypeptide or fragment thereof. In another embodiment the non-arthropod nuclear receptor comprises a mammalian nuclear receptor polypeptide or fragment thereof. In another embodiment the non-arthropod nuclear receptor comprises a human nuclear receptor polypeptide or fragment thereof. In another embodiment the non-arthropod nuclear receptor comprises a murine nuclear receptor polypeptide or fragment thereof. In another embodiment the non-arthropod nuclear receptor comprises a chimeric nuclear receptor polypeptide or fragments thereof, wherin the chimera comprises polypeptide components from two or more different species.

[0205] One embodiment of the invention includes a ligand inducible polypeptide coupler (LIPC) system comprising: a) a first expression cassette that is capable of being expressed in a host cell comprising a polynucleotide that encodes a first fusion protein (polypeptide) comprising i) an ecdysone receptor (EcR) polypeptide or fragment thereof and ii) a first inactive signaling domain; and b) a second expression cassette that is capable of being expressed in the host cell comprising a polynucleotide sequence that encodes a second, separate, fusion protein (polypeptide) comprising i) a retinoid X receptor polypeptide or fragment thereof and ii) a second inactive signaling domain; wherein the first and second inactive signaling domains are activated upon association of the two fusion proteins with one another.

[0206] Ligands, optionally, for use in invention as described below, when combined with an EcR ligand binding domain and a RXR ligand binding domain, as described herein, provide the means for external temporal regulation (activation or withdrawal of activation; i.e., via cessation of administration, or contact with, ligand) of the signaling domain(s). Binding of ligand to the LIPC EcR and RXR polypeptide components enables protein-protein interaction of LIPC-fusion proteins, and in certain embodiments activation, of the signaling domains. In some embodiments, one or more of the LIPC domains is varied producing a hybrid LIPC. In certain embodiments, hybrid genes and the resulting hybrid proteins are optimized in the chosen host cell or organism for desired activity and complementary binding of the ligand.

Inactive Signaling Domains

[0207] Embodiments of the invention include ligand inducible polypeptide coupler systems that allow for tailored (e.g., dose-regulated, inducible) activation of inactive domains (e.g., signaling molecules, signaling domains, complementary protein fragments, protein subunits, and natural or engineered partial or truncated proteins) through protein-protein interactin or association.

[0208] In certain embodiments, a signaling protein and/or polypeptide domain whose activity is to be modulated is a homologous protein or fragment thereof with respect to the host cell. In other embodiments, the signaling protein and/or polypeptide domain whose activity is to be modulated is a heterologous protein or fragment thereof with respect to the host cell.

[0209] Embodiments of the invention include compostions and uses of signaling proteins and polypeptide domains encoding polypeptides or signaling domains involved in a disease, a disorder, a dysfunction, a genetic defect, targets for drug discovery, and proteomics analyses and applications, etc.

[0210] Numerous cell signaling polypeptides and domains (e.g., signaling proteins) that require association (e.g., dimerization or oligomerization) or protein-protein interaction for activation have been identified in a wide-range of organisms and can be used in the present invention. Many of these signaling molecules participate in signaling pathways that are conserved throughout a large number of organisms.

[0211] For example, many cell surface receptors anchored in the membrane with a single transmembrane domain are primarily activated by endogenous (i.e., naturally occurring) ligand-induced dimerization or oligomerization. Generally, these molecules do not associate on their own, but are brought together (or in close proximity to their binding partner) through interactions with an endogenous extracellular ligand. In contrast to endogenous naturally occurring cell signal protein activation, the present invention provides for a small-molecule, ligand inducible polypeptide coupler system to modulate (i.e., turn on, turn off, increase or decrease) activity, i.e., dimerization or oligomerization, of cell signaling proteins and domains via on demand administration (or withdrawal of administration) of a small molecule nuclear receptor activating ligand. For a review of various molecules and pathways that utilize protein dimerization or oligomerization for activation, see, e.g., Klemm, et al. Annu. Rev. Immunol. 16:569-92 (1998), which is incorporated by reference herein in its entirety.

[0212] In certain embodiments the following signaling molecules and/or domains from cell surface receptors, intracellular signaling proteins, and their associated pathway members are envisaged for use with the invention as the first and/or second inactive signaling domain, signaling molecule, complementary protein fragment, protein subunit, or natural or engineered partial or truncated protein of the invention:

[0213] Receptor tyrosine kinase (RTK) receptors and their associated pathway members, including RTK class I (EGF receptor family) (ErbB family), RTK class II (Insulin receptor family), RTK class III (PDGF receptor family), RTK class IV (FGF receptor family), RTK class V (VEGF receptors family), RTK class VI (HGF receptor family), RTK class VII (Trk receptor family), RTK class VIII (Eph receptor family), RTK class IX (AXL receptor family), RTK class X (LTK receptor family), RTK class XI (TIE receptor family), RTK class XII (ROR receptor family), RTK class XIII (DDR receptor family), RTK class XIV (RET receptor family), RTK class XV (KLG receptor family), RTK class XVI (RYK receptor family), and RTK class XVII (MuSK receptor family).

[0214] Cytokine receptors and their associated pathway members, including type I cytokine receptor (e.g., Type I interleukin receptors, Erythropoietin receptor, GM-CSF receptor, G-CSF receptor, growth hormone receptor, prolactin receptor, Oncostatin M receptor, and Leukemia inhibitory factor receptor), type II cytokine receptor (e.g., Type II interleukin receptors, interferon-alpha/beta receptor, and interferon-gamma receptor), members of the immunoglobulin superfamily (e.g., Interleukin-1 receptor, CSF1, C-kit receptor, and Interleukin-18 receptor). Tumor necrosis factor receptor family (e.g., CD27, CD30, CD40, CD120, and Lymphotoxin beta receptor). Chemokine receptors (e.g., Interleukin-8 receptor, CCR1, CXCR4, MCAF receptor, and NAP-2 receptor). TGF beta receptors (e.g., TGF beta receptor 1 and TGF beta receptor 2). Antigen receptor signaling receptors (e.g., B cell and T cell antigen receptors).

[0215] Additional signaling proteins and/or domains that are envisaged to be used with the present invention include, but are not limited to, firefly luciferase (fLuc), Signal Transducer and Activator of Transcription (STAT) proteins, NF-B proteins, antibodies (including antibody fragments), transcription factors, nuclear receptors, including nuclear hormone receptors, 14-3-3 proteins, G-protein coupled receptors, G proteins, kinesin, triosephosphateisomerase (TIM), alcohol dehydrogenase, Factor XI, Factor XIII, Toll-like receptors, fibrinogen, Bcl-2 family members, Smad family members, and the like.

[0216] In certain embodiments, the inactive signaling domain of the invention have a transmembrane domain. In some embodiments the transmembrane domain is a single-pass transmembrane domain. In certain embodiments, the single-pass transmembrane domain is a single-pass type I transmembrane domain. In other embodiments, the transmembrane domain is a multi-pass transmembrane domain. In certain embodiments, the transmembrane domain(s) have a hydrophilic alpha helix motif.

Activating Ligands

[0217] Acceptable activating ligands that can be used with the invention are any that modulate protein-protein interaction of the signaling domains of the switch system wherein the presence of the ligand results in activation of the inactive signaling domains. Such ligands include those disclosed in International PCT Publ. Nos. WO 2002/066612, WO 2002/066614, WO 2003/105849, WO 2004/072254, WO 2004/005478, WO 2004/078924, WO 2005/017126, WO 2008/153801, WO 2009/114201, WO 2013/036758, WO 2014/144380 and in U.S. Pat. Nos. 6,258,603 and 8,748,125, each of which is incorporated by reference herein in its entirety.

[0218] Exemplary ligands include, but are not limited to, ponasterone, muristerone A, 9-cis-retinoic acid, synthetic analogs of retinoic acid, N,N-diacylhydrazines such as those disclosed in U.S. Pat. Nos. 6,013,836, 5,117,057, 5,530,028 and 537,872, each of which is incorporated by reference herein in its entirety; dibenzoylalkyl cyanohydrazines such as those disclosed in European Application No. 461809, which is incorporated by reference herein in its entirety; N-alkyl-N,N-diaroylhydrazines such as those disclosed in U.S. Pat. No. 5,225,443 which is incorporated by reference herein in its entirety; N-acyl-N-alkylcarbonylhydrazines such as those disclosed in European Application No. 234994 which is incorporated by reference herein in its entirety; N-aroyl-N-alkyl-N-aroylhydrazines such as those described in U. S. Pat. No. 4,985,461, which is incorporated by reference herein in its entirety, and other similar materials including 3,5-di-tert-butyl-4-hydroxy-N-isobutyl-benzamide, 8-0-acetylharpagide, and the like.

[0219] In certain embodiments, the ligand for use in the methods of the present invention is a compound of the formula:

##STR00005##

[0220] wherein E is a (C.sub.4-C.sub.6)alkyl containing a tertiary carbon or a cyano(C.sub.3-C5)alkyl containing a tertiary carbon; R.sup.1 is H, Me, Et, i-Pr, F, formyl, CF.sub.3, CHF.sub.2, CHCl.sub.2, CH.sub.2F, CH.sub.2Cl, CH.sub.2OH, CH.sub.2OMe, CH.sub.2CN, CN, CCH, 1-propynyl, 2-propynyl, vinyl, OH, OMe, OEt, cyclopropyl, CF.sub.2CF.sub.3, CHCHCN, allyl, azido, SCN, or SCHF.sub.2;

[0221] R.sup.2 is H, Me, Et, n-Pr, i-Pr, formyl, CF.sub.3, CHF.sub.2, CHCl.sub.2, CH.sub.2F, CH.sub.2Cl, CH.sub.2OH, CH.sub.2OMe, CH.sub.2CN, CN, CCH, 1-propynyl, 2-propynyl, vinyl, Ac, F, Cl, OH, OMe, OEt, O-n-Pr, OAc, NMe.sub.2, NEt.sub.2, SMe, SEt, SOCF.sub.3, OCF.sub.2CF.sub.2H, COEt, cyclopropyl, CF.sub.2CF.sub.3, CHCHCN, allyl, azido, OCF.sub.3, OCHF.sub.2, O-i-Pr, SCN, SCHF.sub.2, SOMe, NHCN, or joined with R.sup.3 and the phenyl carbons to which R.sup.2 and R.sup.3 are attached to form an ethylenedioxy, a dihydrofuryl ring with the oxygen adjacent to a phenyl carbon, or a dihydropyryl ring with the oxygen adjacent to a phenyl carbon;

[0222] R.sup.3 is H, Et, or joined with R.sup.2 and the phenyl carbons to which R.sup.2 and R.sup.3 are attached to form an ethylenedioxy, a dihydrofuryl ring with the oxygen adjacent to a phenyl carbon, or a dihydropyryl ring with the oxygen adjacent to a phenyl carbon; R.sup.4, R.sup.5, and R.sup.6 are independently H, Me, Et, F, Cl, Br, formyl, CF.sub.3, CHF.sub.2, CHCl.sub.2, CH.sub.2F, CH.sub.2Cl, CH.sub.2OH, CN, CCH, 1-propynyl, 2-propynyl, vinyl, OMe, OEt, SMe, or Set

[0223] In some embodiments, the ligand for use with the methods of the present invention is a compound of the formula:

##STR00006##

[0224] wherein R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are:

[0225] a) H, (C.sub.1-C.sub.6)alkyl; (C.sub.1-C.sub.6)haloalkyl; (C.sub.1-C.sub.6)cyanoalkyl; (C.sub.1-C.sub.6)hydroxyalkyl; (C.sub.1-C.sub.4)alkoxy(C.sub.1-C.sub.6)alkyl; (C.sub.2-C.sub.6)alkenyl optionally substituted with halo, cyano, hydroxyl, or (C.sub.1-C.sub.4)alkyl; (C.sub.2-C.sub.6)alkynyl optionally substituted with halo, cyano, hydroxyl, or (C.sub.1-C.sub.4)alkyl; (C.sub.3-C.sub.5)cycloalkyl optionally substituted with halo, cyano, hydroxyl, or (C.sub.1-C.sub.4)alkyl; oxiranyl optionally substituted with halo, cyano, or (C.sub.1-C.sub.4)alkyl; or

[0226] b) unsubstituted or substituted benzyl wherein the substituents are independently 1 to 5 H, halo, nitro, cyano, hydroxyl, (C.sub.1-C.sub.6)alkyl, or (C.sub.1-C.sub.6)alkoxy; and R.sup.5 is H; OH; F; Cl; or (C.sub.1-C.sub.6)alkoxy.

[0227] In some embodiments, when R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are H, then R.sup.5 is not H or hydroxy.

[0228] In certain embodiments, at least one of R.sup.1, R.sup.2, R.sup.3, and R.sup.4 is not H. In another embodiment, at least two of R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are not H. In another embodiment, at least three R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are not H. In another embodiment, each of R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are not H.

[0229] In some embodiments, when R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are H, then R.sup.5 is not methoxy, when R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are isopropyl, then R.sup.5 is not hydroxy, and when R.sup.1, R.sup.2, and R.sup.3 are H and R.sup.5 is hydroxy, then R.sup.4 is not methyl or ethyl.

[0230] In specific embodiments, R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are: a) H, (C.sub.1-C.sub.6)alkyl; (C.sub.1-C.sub.6)haloalkyl; (C.sub.1-C.sub.6)cyanoalkyl; (C.sub.1-C.sub.6)hydroxyalkyl; (C.sub.1-C.sub.4)alkoxy(C.sub.1-C.sub.6)alkyl; (C.sub.2-C.sub.6)alkenyl; (C.sub.2-C.sub.6)alkynyl; oxiranyl optionally substituted with halo, cyano, or (C.sub.1-C.sub.4)alkyl; or b) unsubstituted or substituted benzyl wherein the substituents are independently 1 to 5 H, halo, cyano, or (C.sub.1-C.sub.6)alkyl; and R.sup.5 is H, OH, F, Cl, or (C.sub.1-C.sub.6)alkoxy.

[0231] In other specific embodiments, R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are H, (C.sub.1-C.sub.6)alkyl; (C.sub.2-C.sub.6)alkenyl; (C.sub.2-C.sub.6)alkynyl; 2-ethyloxiranyl, or benzyl; and R.sup.5 is H; OH; or F.

[0232] In specific embodiments, when R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are isopropyl, then R.sup.5 is not hydroxyl; when R.sup.5 is H, hydroxyl, methoxy, or fluoro, then at least one of R.sup.1, R.sup.2, R.sup.3, and R.sup.4 is not H; when only one of R.sup.1, R.sup.2, R.sup.3, and R.sup.4 is methyl, and R.sup.5 is H or hydroxyl, then the remainder of R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are not H; when both R.sup.4 and one of R.sup.1, R.sup.2, and R.sup.3 are methyl, then R.sup.5 is neither H nor hydroxyl; when R.sup.1, R.sup.2, R.sup.3, and R.sup.4 are all methyl, then R.sup.5 is not hydroxyl; and when R.sup.1, R.sup.2, and R.sup.3 are all H and R.sup.5 is hydroxyl, then R.sup.4 is not ethyl, n-propyl, n-butyl, allyl, or benzyl.

[0233] Certain embodiments of the invention include the use of the following steroidal ligands: 20-hydroxyecdysone, 2-methyl ether; 20-hydroxyecdysone, 3-methyl ether; 20-hydroxyecdysone, 14-methyl ether; 20-hydroxyecdysone, 2,22-dimethyl ether; 20-hydroxyecdysone, 3,22-dimethyl ether; 20-hydroxyecdysone, 14,22-dimethyl ether; 20-hydroxyecdysone, 22,25-dimethyl ether; 20-hydroxyecdysone, 2,3,14,22-tetramethyl ether; 20-hydroxyecdysone, 22-H-propyl ether; 20-hydroxyecdysone, 22-n-butyl ether; 20-hydroxyecdysone, 22-allyl ether; 20-hydroxyecdysone, 22-benzyl ether; 20-hydroxyecdysone, 22-(28R,S)-2-ethyloxiranyl ether; ponasterone A, 2-methyl ether; ponasterone A, 14-methyl ether; ponasterone A, 22-methyl ether; ponasterone A, 2,22-dimethyl ether; ponasterone A, 3,22-dimethyl ether; ponasterone A, 14,22-dimethyl ether; dacryhainansterone, 22-methyl ether.

[0234] Additional embodiments of the invention include the use of the following steroidal ligands: 25,26-didehydroponasterone A, (iso-stachysterone C (25(26))), shidasterone (stachysterone D), stachysterone C, 22-deoxy-20-hydroxyecdysone (taxisterone), ponasterone A, polyporusterone B, 22-dehydro-20-hydroxyecdysone, ponasterone A 22-methyl ether, 20-hydroxyecdysone, pterosterone, (25R)-inokosterone, (25S)-inokosterone, pinnatasterone, 25-fluoroponasterone A, 24(28)-dehydromakisterone A, 24-epi-makisterone A, makisterone A, 20-hydroxyecdysone-22-methyl ether, 20-hydroxyecdysone-25-methyl ether, abutasterone, 22,23-di-epi-geradiasterone, 20,26-dihydroxyecdysone (podecdysone C), 24-epi-abutasterone, geradiasterone, 29-norcyasterone, ajugasterone B, 24(28)[Z]-dehydroamarasterone B, amarasterone A, makisterone C, rapisterone C, 20-hydroxyecdysone-22,25-dimethyl ether, 20-hydroxyecdysone-22-ethyl ether, carthamosterone, 24(25)-dehydroprecyasterone, leuzeasterone, cyasterone, 20-hydroxyecdysone-22-allyl ether, 24(28)[Z]-dehydro-29-hydroxymakisterone C, 20-hydroxyecdysone-22-acetate, viticosterone E (20-hydroxyecdysone 25-acetate), 20-hydroxyecdysone-22-n-propyl ether, 24-hydroxycyasterone, 20-hydroxyecdysone-22-n-butyl ether, ponasterone A 22-hemi succinate, 22-acetoacetyl-20-hydroxyecdysone, 20-hydroxyecdysone-22-benzyl ether, canescensterone, 20-hydroxyecdysone-22-hemisuccinate, inokosterone-26-hemisuccinate, 20-hydroxyecdysone-22-benzoate, 20-hydroxyecdysone-22--D-glucopyranoside, 20-hydroxyecdysone-25--D-glucopyranoside, sileneoside A (20-hydroxyecdysone-22-galactoside), 3-deoxy-1,20-dihydroxyecdysone (3-deoxyintegri sterone A), 2-deoxyintegristerone A, 1-epi-integristerone A, integristerone A, sileneoside C (integristerone A 22-galactoside), 2,22-dideoxy-20-hydroxyecdysone, 2-deoxy-20-hydroxyecdysone, 2-deoxy-20-hydroxyecdysone-3-acetate, 2-deoxy-20,26-dihydroxyecdysone, 2-deoxy-20-hydroxyecdysone-22-acetate, 2-deoxy-20-hydroxyecdysone-3,22-diacetate, 2-deoxy-20-hydroxyecdysone-22-benzoate, ponasterone A 2-hemi succinate, 20-hydroxyecdysone-2-methyl ether, 20-hydroxyecdysone-2-acetate, 20-hydroxyecdysone-2-hemisuccinate, 20-hydroxyecdysone-2--D-glucopyranoside, 2-dansyl-20-hydroxyecdysone, 20-hydroxyecdysone-2,22-dimethyl ether, ponasterone A 3B-D-xylopyranoside (limnantheoside B), 20-hydroxyecdysone-3-methyl ether, 20-hydroxyecdysone-3-acetate, 20-hydroxyecdysone-3-D-xylopyranoside (limnantheoside A), 20-hydToxyecdysone-3--D-glucopyranoside, sileneoside D (20-hydroxyecdysone-3-galactoside), 20-hydroxyecdysone 3-D-glucopyranosyl-[1-3]--D-xylopyranoside (limnantheoside C), 20-hydroxyecdysone-3,22-dimethyl ether, cyasterone-3-acetate, 2-dehydro-3-epi-20-hydroxyecdysone, 3-epi-20-hydroxecdysone (coronatasterone), rapisterone D, 3-dehydro-20-hydroxyecdysone, 5-hydroxy-25,26-didehydroponasterone A, 5-hydroxystachysterone C, 25-deoxypolypodine B, polypodine B, 25-fluoropolypodine B, 5-hydroxyabutasterone, 26-hydroxypolypodine B, 29-norsengosterone, sengosterone, 6-hydroxy-20-hydroxyecdysone, 6-hydroxy-20-hydroxyecdysone, 20-hydroxyecdysone-6-oxime, ponasterone A 6-carboxymethyloxime, 20-hydroxyecdysone-6-carboxymethyloxime, ajugasterone C, rapisterone B, muristerone A, atrotosterone B, atrotosterone A, turkesterone-2-acetate, punisterone (rhapontisterone), turkesterone, atrotosterone C, 25-hydroxyatrotosterone B, 25-hydroxyatrotosterone A, paxillosterone, rurkesterone-2,22-diacetate, turkesterone-22-acetate, turkesterone-11-acetate, turkesterone-2, 11-diacetate, turkesterone-11-propionate, turkesterone-11-butanoate, turkesterone-11-hexanoate, turkesterone-11-decanoate, turkesterone-11-laurate, turkesterone-11-myristate, turkesterone-11-arachidate, 22-dehydro-12-hydroxynorsengosterone, 22-dehydro-12-hydroxycyasterone, 22-dehydro-12-hydroxysengosterone, 14-deoxy(14-H)-20-hydroxyecdysone, 20-hydroxyecdysone-14-methyl ether, 14-perhydroxy-20-hydroxyecdysone, 20-hydroxyecdysone 14,22-dimethyl ether, 20-hydroxyecdysone-2,3,14,22-tetramethyl ether, (20S)-22-deoxy-20,21-dihydroxyecdysone, 22,25-dideoxyecdysone, (22S)-20-(2,2-dimethylfuranyl)ecdysone, (22R)-20-(2,2-dimethylfuranyl)ecdysone, 22-deoxyecdysone, 25-deoxyecdysone, 22-dehydroecdysone, ecdysone, 22-epi-ecdysone, 24-methylecdysone (20-deoxymakisterone A), ecdysone-22-hemisuccinate, 25-deoxyecdysone-22--D-glucopyranoside, ecdysone-22-myristate, 22-dehydro-20-iso-ecdysone, 20-iso-ecdysone, 20-iso-22-epi-ecdysone, 2-deoxyecdysone, sileneoside E (2-deoxyecdysone 3-glucoside; blechnoside A), 2-deoxyecdysone-22-acetate, 2-deoxyecdysone-3,22-diacetate, 2-deoxyecdysone-22-3-D-glucopyranoside, 2-deoxyecdysone glucopyranoside, 2-deoxy-21-hydroxyecdysone, 3-epi-22-iso-ecdysone, 3-dehydro-2-deoxyecdysone (silenosterone), 3-dehydroecdysone, 3-dehydro-2-deoxyecdysone-22-acetate, ecdysone-6-carboxymethyloxime, ecdysone-2,3-acetonide, 14-epi-20-hydroxyecdysone-2,3-acetonide, 20-hydroxyecdysone-2,3-acetonide, 20-hydroxyecdysone-20,22-acetonide, 14-epi-20-hydroxyecdysone-2,3,20,22-diacetonide, paxillosterone-20,22-p-hydroxybenzylidene acetal, poststerone, (20S)-dihydropoststerone, (20S)dihydropoststerone, poststerone-20-dansylhydrazine, (20S)-dihydropoststerone-2,3,20-tribenzoate, (20R)-dihydropoststerone-2,3,20-tribenzoate, (20R)dihydropoststerone-2,3-acetonide, (20S)dihydropoststerone-2,3-acetonide, (5-H)-dihydrorubrosterone, 2,14,22,25-tetradeoxy-5 -ecdysone, 5 -ketodiol, bombycosterol, 2, 3 ,22S,25-tetrahydroxy-5-cholestan-6-one, (5-H)-2-deoxy-21-hydroxyecdysone, castasterone, 24-epi-castasterone, (5-H)-2-deoxyintegri sterone A, (5-H)-22-deoxyintegristerone A, (5-H)-20-hydroxyecdysone, 24,25-didehydrodacryhaninansterone, 25,26-didehydrodacryhainansterone, 5-deoxykaladasterone (dacryhainansterone), (14-H)-14-deoxy-25-hydroxydacryhainansterone, 25-hydroxydacryhainansterone, rubrosterone, (5-H)-dihydrorubrosterone, dihydrorubrosterone-17-acetate, sidisterone, 20-hydroxyecdysone-2,3,22-triacetate, 14-deoxy(14-H)-20-hydroxyecdysone, 14-epi-20-hydroxyecdysone, 9,20-dihydroxyecdysone, malacosterone, 2-deoxypolypodine B-3--D-glucopyranoside, ajugalactone, cheilanthone B, 23,6-trihydroxy-5-cholestane, 2,3,6-trihydroxy-5-cholestane, 14-dehydroshidasterone, stachysterone B, 2,3,9,20R,22R,25-hexahydroxy-5(3-cholest-7, 14-dien-6-one, kaladasterone, (14-H)-14-deoxy-25-hydroxydacryhainansterone, 4-dehydro-20-hydroxyecdysone, 14-methyl-12-en-shidasterone, 14-methyl-12-en-15,20-dihydroxyecdysone, podecdysone B, 2,3 ,20R,22R-tetrahydroxy-25-fluoro-5-cholest-8,14-dien-6-one (25-fluoropodecdysone B), calonysterone, 14-deoxy-14,18-cyclo-20-hydroxyecdysone, 9,14-epoxy-20-hydroxyecdysone, 9, 14 -epoxy-20-hydroxyecdysone, 9,14-epoxy-20-hydroxyecdysone 2,3,20,22-diacetonide, 28-homobrassinolide, iso-homobrassinolide.

[0235] In some embodiments, the ligand for use with the methods of the present invention is a compound of the general formula:

##STR00007##

[0236] wherein X and X are independently O or S;

[0237] Y is:

[0238] (a) substituted or unsubstituted phenyl wherein the substitutents are independently 1-5H, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy, (C.sub.2-C.sub.4)alkenyl, halo (F, Cl, Br, I), (C.sub.1-C.sub.4)haloalkyl, hydroxy, amino, cyano, or nitro; or

[0239] (b) substituted or unsubstituted 2-pyridyl, 3-pyridyl, or 4-pyridyl, wherein the substitutents are independently 1-4H, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy, (C.sub.2-C.sub.4)alkenyl, halo (F, Cl, Br, I), (C.sub.1-C.sub.4)haloalkyl, hydroxy, amino, cyano, or nitro;

[0240] R.sup.1 and R.sup.2 are independently: H; cyano; cyano-substituted or unsubstituted (C.sub.1-C.sub.7) branched or straight-chain alkyl; cyano-substituted or unsubstituted (C.sub.2-C.sub.7) branched or straight-chain alkenyl; cyano-substituted or unsubstituted (C.sub.3-C.sub.7) branched or straight-chain alkenylalkyl; or together the valences of R.sup.1 and R.sup.2 form a (C.sub.1-C.sub.7)cyano-substituted or unsubstituted alkylidene group (R.sup.aR.sup.bC) wherein the sum of non-substituent carbons in R.sup.a and R.sup.b is 0-6;

[0241] R.sup.3 is H, methyl, ethyl, n-propyl, isopropyl, or cyano;

[0242] R.sup.4, R.sup.7, and R.sup.8 are independently: H, (C.sub.1-C.sub.4)alkyl, (C.sub.1-C.sub.4)alkoxy, (C.sub.2-C.sub.4)alkenyl, halo (F, Cl, Br, I), (C.sub.1-C.sub.4)haloalkyl, hydroxy, amino, cyano, or nitro; and

[0243] R.sup.5 and R.sup.6 are independently: H, (C.sub.1-C.sub.4)alkyl, (C.sub.2-C.sub.4)alkenyl, (C.sub.3-C.sub.4)alkenylalkyl, halo (F, Cl, Br, I), C.sub.1-C.sub.4 haloalkyl, (C.sub.1-C.sub.4)alkoxy, hydroxy, amino, cyano, nitro, or together as a linkage of the type (OCHR.sup.9CHR.sup.10O) form a ring with the phenyl carbons to which they are attached; wherein R.sup.9 and R.sup.10 are independently: H, halo, (C.sub.1-C.sub.3)alkyl, (C.sub.2-C.sub.3)alkenyl, (C.sub.1-C.sub.3)alkoxy(C.sub.1-C.sub.3)alkyl, benzoyloxy(C.sub.1-C.sub.3)alkyl, hydroxy(C.sub.1-C.sub.3)alkyl, halo(C.sub.1-C.sub.3)alkyl, formyl, formyl(C.sub.1-C.sub.3)alkyl, cyano, cyano(C.sub.1-C.sub.3)alkyl, carboxy, carboxy(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkoxycarbonyl(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkylcarbonyl(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkanoyloxy(C.sub.1-C.sub.3)alkyl, amino(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkylamino(C.sub.1-C.sub.3)alkyl ((CH.sub.2).sub.nR.sup.cR.sup.c), oximo (CHNOH), oximo(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkoximo (CNOR.sup.d), alkoximo(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)carboxamido (C(O)NR.sup.eR.sup.f), (C.sub.1-C.sub.3)carboxamido(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)semicarbazido (CNNHC(O)NR.sup.eR.sup.f), semicarbazido(C.sub.1-C.sub.3)alkyl, aminocarbonyloxy (OC(O)NHR.sup.g), aminocarbonyloxy(C.sub.1-C.sub.3)alkyl, pentafluorophenyloxycarbonyl, pentafluorophenyloxycarbonyl(C.sub.1-C.sub.3)alkyl, p-toluenesulfonyloxy(C.sub.1-C.sub.3)alkyl, arylsulfonyloxy(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)thio(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkylsulfoxido(C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkylsulfonyl(C.sub.1-C.sub.3)alkyl, or (C.sub.1-C.sub.5)trisubstituted-siloxy(C.sub.1-C.sub.3)alkyl ((CH.sub.2).sub.nSiOR.sup.dR.sup.eR.sup.g); wherein n=1-3, R.sup.c and R.sup.d represent straight or branched hydrocarbon chains of the indicated length, R.sup.e, R.sup.f represent H or straight or branched hydrocarbon chains of the indicated length, R.sup.g represents (C.sub.1-C.sub.3)alkyl or aryl optionally substituted with halo or (C.sub.1-C.sub.3)alkyl, and R.sup.c, R.sup.d, R.sup.e, R.sup.f, and R.sup.g are independent of one another;

[0244] provided that

[0245] i) when R.sup.9 and R.sup.10 are both H, or

[0246] ii) when either R.sup.9 or R.sup.10 are halo, (C.sub.1-C.sub.3)alkyl, (C.sub.1-C.sub.3)alkoxy(C.sub.1-C.sub.3)alkyl, or benzoyloxy(C.sub.1-C.sub.3)alkyl, or

[0247] iii) when R.sup.5 and R.sup.6 do not together form a linkage of the type (OCHR.sup.9CHR.sup.10O),

[0248] then the number of carbon atoms, excluding those of cyano substitution, for either or both of groups R.sup.1 or R.sup.2 is greater than 4, and the number of carbon atoms, excluding those of cyano substitution, for the sum of groups R.sup.1, R.sup.2, and R.sup.3 is 10, 11, or 12.

Polynucleotides of the Invention

[0249] A novel ecdysone receptor/retinoid X receptor-based ligand inducible polypeptide coupler system of the invention may comprise an expression cassette having a polynucleotide sequence that encodes a hybrid polypeptide comprising an EcR nuclear receptor polypeptide component and an inactive signaling domain or a RXR nuclear receptor polypeptide component and an inactive signaling domain. These expression cassettes, the polynucleotides they comprise, and the hybrid polypeptides they encode are useful as components of an EcR/RXR-based ligand inducible polypeptide coupler system to modulate the activity of signaling domains within a host cell.

[0250] Thus, the present invention provides an isolated polynucleotide that encodes a hybrid polypeptide having an EcR nuclear receptor polypeptide component and an inactive signaling domain and/or a RXR nuclear receptor polypeptide component and an inactive signaling domain. The isolated polynucleotides that encode the EcR and/or RXR nuclear receptor polypeptide components of the invention comprise, but are not limited to, the polynucleotide sequences described above, including wild-type, truncated, and substitution mutation-containing EcR polypeptides described herein and/or wild-type, truncated, and chimeric RXR polypeptides described herein, including combinations thereof.

[0251] In addition, the isolated polynucleotides of the present invention can have polynucleotide sequences that encode signaling domains, including those described herein. The polynucleotide sequences of such signaling domains are readily accessible via publically available databases that are known to those of ordinary skill in the art. Such databases include, but are not limited to, GenBank (ncbi.nlm.nih.gov/genbank), UniProt (uniprot.org), and the like.

Polypeptides of the Invention

[0252] The novel ecdysone receptor/retinoid X receptor-based ligand inducible polypeptide coupler system of the invention can comprise an expression cassette having a polynucleotide that encodes a hybrid polypeptide comprising an EcR polypeptide and/or an inactive signaling domain or a RXRpolypeptide and an inactive signaling domain. These expression cassettes, the polynucleotides they comprise, and the hybrid polypeptides they encode are useful as components of an EcR/RXR-based ligand inducible polypeptide coupler system to modulate the activity of signaling domains within a host cell.

[0253] Thus, the present invention also relates to an isolated hybrid polypeptide having an EcR polypeptide and an inactive signaling domain (e.g., signaling molecules, signaling domains, complementary protein fragments, protein subunits, and natural or engineered partial or truncated proteins) and/or a RXR polypeptide and an inactive signaling domain (e.g., signaling molecules, signaling domains, complementary protein fragments, protein subunits, and natural or engineered partial or truncated proteins) according to the invention. The EcR and/or RXR domains of the isolated polypeptides of the invention can comprise, but are not limited to, polypeptide sequences described herein, including wild-type, truncated, functional fragments, and substitution mutation-containing EcR ligand binding domains described herein and/or wild-type, truncated, functional fragments, and chimeric RXR polypeptides described herein, including combinations thereof.

[0254] In addition, the isolated hybrid polypeptides of the invention can have signaling domains (e.g., signaling molecules, signaling domains, complementary protein fragments, protein subunits, and natural or engineered partial or truncated proteins), including those described herein. The amino acid sequences of such signaling domains are readily accessible via publically available databases that are known to those of ordinary skill in the art. Such databases include, but are not limited to, GenBank (ncbi.nlm.nih.gov/genbank), UniProt (uniprot.org), and the like.

Expression Vectors of the Invention

[0255] The novel ecdysone receptor/retinoid X receptor-based ligand inducible polypeptide coupler system of the invention comprises an expression cassette comprising a polynucleotide that encodes a hybrid polypeptide comprising an EcR ligand binding domain and an inactive signaling domain (e.g., signaling molecules, signaling domains, complementary protein fragments, protein subunits, and natural or engineered partial or truncated proteins) and/or a RXR polypeptide and an inactive signaling domain (e.g., signaling molecules, signaling domains, complementary protein fragments, protein subunits, and natural or engineered partial or truncated proteins). These expression cassettes, the polynucleotides they comprise, and the hybrid polypeptides they encode can be expressed in a host cell using any suitable expression vector. Suitable expression vectors are well known to those of ordinary skill in the art and the choice of expression vector and optimal expression conditions in view of the desired host cell can be readily determined by one of ordinary skill in the art. Exemplary expression vectors that can be employed with the invention include, but are not limited to, the expression vectors described above.

Host Cells

[0256] As described above, the ligand inducible polypeptide coupler system of the present invention may be used to modulate protein-protein interaction, i.e., association, within a host cell. Modulation in transgenic host cells may be useful for the modulation of various proteins of interest. Thus, the invention provides an isolated host cell comprising a ligand inducible polypeptide coupler system according to the invention. The present invention also provides an isolated host cell comprising a ligand inducible polypeptide coupler system comprising one or more expression cassettes according to the invention. The invention also provides an isolated host cell comprising a polynucleotide or a polypeptide. The isolated host cell may be either a prokaryotic or a eukaryotic host cell.

[0257] In certain embodiments, the isolated host cell is a prokaryotic host cell or a eukaryotic host cell. In another specific embodiment, the isolated host cell is an invertebrate host cell or a vertebrate host cell. Such host cells may be selected from a bacterial cell, a fungal cell, a yeast cell, a nematode cell, an insect cell, a fish cell, a plant cell, an avian cell, an animal cell, and a mammalian cell. More specifically, the host cell is a yeast cell, a nematode cell, an insect cell, a plant cell, a zebrafish cell, a chicken cell, a hamster cell, a mouse cell, a rat cell, a rabbit cell, a cat cell, a dog cell, a bovine cell, a goat cell, a cow cell, a pig cell, a horse cell, a sheep cell, a simian cell, a monkey cell, a chimpanzee cell, or a human cell. Examples of host cells include, but are not limited to, fungal or yeast species such as Aspergillus, Trichoderma, Saccharomyces, Pichia, Candida, Hansenula, or bacterial species such as those in the genera Synechocystis, Synechococcus, Salmonella, Bacillus, Acinetobacter, Rhodococcus, Streptomyces, Escherichia, Pseudomonas, Methylomonas, Methylobacter, Alcaligenes, Synechocystis, Anabaena, Thiobacillus, Methanobacterium and Klebsiella, animal, and mammalian host cells.

[0258] In certain embodiments, the host cell is a yeast cell selected from the group consisting of a Saccharomyces, a Pichia, and a Candida host cell. In a specific embodiment, the host cell is a Caenorhabditis elegans nematode cell. In another specific embodiment, the host cell is a hamster cell. In another embodiment, the host cell is a murine cell. In another embodiment, the host cell is a monkey cell. In another specific embodiment, the host cell is a human cell.

[0259] In another embodiment, the host cell is a mammalian cell selected from the group consisting of a hamster cell, a mouse cell, a rat cell, a rabbit cell, a cat cell, a dog cell, a bovine cell, a goat cell, a cow cell, a pig cell, a horse cell, a sheep cell, a monkey cell, a chimpanzee cell, and a human cell. In certain embodiments the host cell is an immortalized cell, an immune cell, or a T-cell.

[0260] Host cell transformation is well known in the art and may be achieved by a variety of methods including but not limited to electroporation, viral infection, plasmid/vector transfection, non-viral vector mediated transfection, particle bombardment, and the like. Expression of desired gene products involves culturing the transformed host cells under suitable conditions and inducing expression of the transformed gene. Culture conditions and gene expression protocols in prokaryotic and eukaryotic cells are well known in the art. Cells may be harvested and the gene products isolated according to protocols specific for the gene product.

[0261] In addition, a host cell may be chosen that modulates the expression of the inserted polynucleotide, or modifies and processes the polypeptide product in the specific fashion desired.

[0262] The invention also relates to a non-human organism comprising an isolated host cell according to the invention. In certain embodiments, the non-human organism is selected from the group consisting of a bacterium, a fungus, a yeast, an animal, and a mammal. In some embodiments, the non-human organism is a yeast, a mouse, a rat, a rabbit, a cat, a dog, a bovine, a goat, a pig, a horse, a sheep, a monkey, or a chimpanzee.

[0263] In a certain embodiments, the non-human organism is a yeast selected from the group consisting of Saccharomyces, Pichia, and Candida. In another embodiment, the non-human organism is a Mus musculus mouse.

Methods for Modulating Post-Translational Activity

[0264] Applicant's invention encompasses methods of incorporating LIPCs into polypeptides (generating heterologous polypeptides) to modulate activity of signaling domains in host cells. Specifically, Applicant's invention provides a method of inducing or inhibiting activation of signaling proteins and pathways via incorporation of LIPC components into signal activating or inhibiting polypeptides expressed in a host cell, and contacting the host cell with a ligand, to bring about the signal transduction activation or inhibition.

[0265] In one embodiment, cell signal transduction is activated by LIPC-induced dimerization of oligomerization of signaling domains (e.g., signaling molecules, signaling domains, complementary protein fragments, protein subunits, and natural or engineered partial or truncated proteins).

[0266] In another embodiment, cell signal transduction is inhibited by LIPC-induced dimerization of an inhibitory polypeptide to a cell signal transduction (activation) pathway polypeptide. In one embodiment, a component of the LIPC alone (e.g., an EcR or RxR/USP polypeptide) is the inhibitory polypeptide.

[0267] In one embodiment, LIPC polypeptides are used to modulate (i.e., activate or inhibit) intracellular protein-protein interactions. In another embodiment, LIPC polypeptides are used to modulate (i.e., activate or inhibit) extracellular protein-protein interactions. In another embodiment, LIPC polypeptides are used to modulate (i.e., activate or inhibit) transmembrane protein-protein interactions.

[0268] Genes and proteins of interest for expression and modulation of activity via LIPC in a host cell may be endogenous genes or heterologous genes. Nucleic acid or amino acid sequence information for a desired gene or protein can be located in one of many public access databases, for example, GenBank, EMBL, Swiss-Prot, and PIR, or in numerous biology-related journal publications. Thus, those of ordinary skill in the art have access to nucleic acid sequence and/or amino acid sequence information for virtually all known genes and proteins. Such information can then be used to construct the desired constructs for expression of the protein of interest (e.g., signaling domain) within the expression cassettes used in Applicant's methods described herein.

[0269] Examples of genes and proteins of interest for expression in a host cell using Applicant's methods include, but are not limited to, enzymes, reporter genes, structural proteins, transmembrane receptors, nuclear receptor, genes encoding polypeptides or signaling domains involved in a disease, a disorder, a dysfunction, a genetic defect, antibodies, targets for drug discovery, and proteomics analyses and applications, and the like.

[0270] Among the many and varied manners in which a Ligand Inducible Polypeptide Coupler (LIPC) of the present invention may be utilized and incorporated into control of or effect upon a biological cell signal transduction system, one general example is substitution of any other ligand inducible dimerization or multimerization system (such as those utilizing FK506 or rapamycin) with LIPC components of the present invention.

[0271] A specific example in which a Ligand Inducible Polypeptide Coupler (LIPC) of the present invention may be utilized and incorporated into control of a biological cell signal transduction system, is for use in generating an inducible cell kill switch or suicide switch; such as has been proposed for use in destroying genetically modified T cells (e.g., chimeric antigen receptor (CAR) T cells).

[0272] Some examples of the above-referenced sytems are reviewed and described in: [0273] Publication number WO2015157252 (PCT/US2015/024671) Treatment of Cancer Using Anti-CD19 Chimeric Antigen Receptor; [0274] Publication number WO2011146862 (PCT/US2011/037381) Methods For Inducing Selective Apoptosis; [0275] Publication number WO2014164348 (PCT/US2014/022004) Modified Caspase Polypeptides And Uses Thereof; [0276] Publication number WO2014151960 (PCT/US2014/026734) Methods For Controlling T cell Proliferation; [0277] Publication number WO2014127261 (PCT/US2014/016527) Chimeric Antigen Receptor And Methods of Use Therefore; [0278] Auslander et al., From gene switches to mammalian designer cells: Present and future prospects, Trends in Biotechnology, vol. 31, no. 3 pp. 155-168 (2013); [0279] Chakravarti, et al., Synthetic biology in cell-based cancer immunotherapy, Trends in Biotechnology, vol. 33, issue 8, pp. 449-461 (2015); [0280] Ciceri, et al., Infusion of suicide-gene-engineered donor lymphocytes after family haploidentical haemopoietic stem-cell transplantation for leukaemia (the TK007 trial): A non-randomised phase I-II study, Lancet Oncol. 10, 489-500 (2009); Medline doi:10.1016/S1470-2045(09)70074-9; [0281] Wu, et al. Remote control of therapeutic T cells through a small molecule-gated chimeric receptor, 10.1126/science.aab40 77 (2015); [0282] Vilaboa, et al.,Gene switches for deliberate regulation of transgene rxpression: Recent advances in system development and uses, J Genet Syndr Gene Ther 2:107. doi:10.4172/2157-7412.1000107; [0283] Stieger, et al., In vivo regulation using tetracycline-regulatable systems, Adv Drug Deliv Rev 61: 527-541 (2009);
each of the above-cited references are hereby incorporated by reference herein.

EXAMPLE 1

LIPC Activated Luciferase

[0284] Applicant's RheoSwitch genetic switch technology drives transcription in the presence of an activating ligand. The ligand binds the EcR ligand-binding domain portion of a GAL4-EcR fusion protein, which recruits an RXR-VP16 component (see, e.g., FIG. 1). The inventors have determined that EcR and RXR domains, such as those used in the RheoSwitch system, can act as a ligand inducible polypeptide coupler, driving association of other proteins fused to the EcR and RXR domains.

[0285] The ligand inducible polypeptide coupler operates differently than a transcriptional gene switch. Using the LIPC system, protein-protein interaction is controlled, not gene expression. Levels of activation may be regulated in a dose-dependent fashion as controlled via concentration and quantity of small molecule ligand administration.

[0286] As described herein, a split firefly luciferase system has been used to demonstate ligand-inducible EcR-RXR fusion protein association. This system represents a new method for employing protein switch components. Such a switch is fundamentally different from gene transcriptional activation switches, which are directed to controlling protein expression. Controlling protein-protein interaction, i.e., association, requires careful and specific engineering, as the molecules to be associated (e.g., dimerized or oligomerized) must have some differential function when associated and have limited, or no natural affinity for each other under the non-ligand conditions.

Methods and Analytical Approach

[0287] A series of EcR and RXR fusions (some with a split firefly luciferase (fLuc)) proteins have been conceived and designed (see FIGS. 2-6). Split luciferase systems have been used to investigate protein-protein interactions in other cell systems (see, e.g., Luker, et al., Proc. Natl. Acad. Sci. U.S.A. 101(33): 12288-93 (2004), Paulmurugan and Gambhir, Anal. Chem. 75(5):1295-302 (2005), Fujikawa and Kato, Plant J. 52(1):185-95 (2007), and Leng, et al., PLos One 8(4):e62230 (2013), each of which is incorporated by reference herein in its entirety). The split luciferase system has an advantage over split GFP systems in that the components do not covalently bind when associated, allowing for off-rate analysis.

[0288] The fLuc protein was divided into two pieces having no intrinsic affinity for each other (such that it is inactive until brought into close association by fused protein elements) for use as a system of testing protein-protein association. HEK293 cells were transfected with the split fLuc fused to EcR and RXR domains as follows:

Transfection

[0289] A day before transfection, 10,000 cells (293T cells) were plated into each well of a 96 well plate containing 100 l of growth medium (Dulbecco's Modified Eagle's Medium with 10% Fetal Bovine Serum) without antibiotics. Plasmids in pairs, RxR Nluc with Cluc EcR and EcR_ Nluc with Cluc_ RxR (see FIG. 8; amino acid sequences for the constructs depicted in FIG. 8 are provided as SEQ ID NOs: 87-92, respectively. SEQ ID NOs: 91 and 92 correspond to the EcR and RXR amino sequences, respectively, employed in the constructs of FIG. 8), were transfected with Lipofectamine 2000, according to manufacturer's specifications. Briefly, individual plasmid DNA (0.2 g) and 0.5 l of Lipofectamine 2000 was diluted in 25.0 l of OptiMEM I Reduced Serum Medium and incubated for 5 minutes at room temperature, volumes were doubled for co-transfections. Diluted plasmid DNA was combined with diluted Lipofectamine 2000 and incubated for 20 minutes at room temperature. 50 l of the DNA/Lipofectamine 2000 complex was added to each well of the 96 well plate. Cells were incubated at 37 C. in a 5% CO.sub.2 incubator for 24 hours, prior to addition of the activating ligand Veledimex.

Bioluminescence Assay

[0290] Twenty four hours (24hrs) post-transfection, cell culture media from each well of the 96-well plate was replaced with 100 nM Veledimex activating ligand and Dimethyl sulfoxide-DMSO (negative control). Each component was diluted thousand fold in Dulbecco's Modified Eagle's Medium with 10% Fetal Bovine Serum and incubated for 6 hrs at 37 C. in a 5% CO.sub.2 incubator. ONE-Glo Luciferase Assay Buffer was combined with ONE-Glo Luciferase Assay Substrate, which contains 5-Fluoroluciferin (a luciferin analog). This reagent was frozen after reconstitution and stored at 20 C. until use. Luciferase ONE-Glo Luciferase substrate was thawed to room temperature in a water bath. The 96-well plate was removed from the incubator and equilibrated for 1 hr., at room temperature, plate bottom covered with Corning 96 well microplate aluminum sealing tape, before addition of the substrate. 100 l of the ONE-Glo Luciferase reagent buffer was added to each well of the 96-well plate. After 3 minutes of incubation at room temperature to ensure complete cell lysis, the 96-well plate was placed in GloMax 96 Microplate Luminometer to measure bioluminescence from each well.

[0291] In the absence of activating ligand, only background signal was observed. fLuc signal was detected following addition of activating ligand (FIG. 7; RXR-EcR Ligand and +, far right). The fLuc assay was performed 6 hours after addition of activating ligand. A construct using STAT1, a protein shown to homodimerize using the identical split fLuc system (see, e.g., Luker, et al., (2004)), was included for a positive control (see Table 2). Signal of the positive control appears to be unaffected by activating ligand (FIG. 7; Positive control, STAT1. Ligand and +). As negative controls, eGFP and activating ligand alone (vehicle only) samples gave only background readings (FIG. 7; eGFP, Ligand -, and Ligand +). It should be noted that in this run the Ligand + well had a cell count slightly lower than the other wells (FIG. 7; Ligand +*). Data was normalized against mean background and reported in relative light units. Standard fLuc was run as an additional control.

[0292] Upon addition of activating ligand, a clear fLuc signal is generated using the EcR and RXR LIPC system. Only background is observed in the absence of ligand (see FIG. 7).

TABLE-US-00002 TABLE 2 Experimental Setup for Split Luciferase System fLuc Group Vector 1 Vector 2 Treatment Activity control eGFP control mock control mock Ligand split fLuc +control STAT1-fLuc fLuc-STAT1 + System +control STAT1-fLuc fLuc-STAT1 + Exp RXR-fLuc fLuc-EcR Exp RXR-fLuc fLuc-EcR Ligand + +control Full fLuc +++

[0293] Positive signal should only be observed in complementing pairs of vectors that have been exposed to activating ligand, driving association of EcR and RXR components and restoring fLuc activity. Ligand dose response curves are shown in FIG. 9 and FIG. 10. This work serves to demonstrate EcR and RXR' s ability to drive ligand inducible polypeptide couping, i.e., ligand-mediated association or oligomerization, that can control protein-protein interactions and associations at a post-translational level.

[0294] EcR dimerization induction via Veledimex ligand results are shown in FIGS. 11 and FIG. 12.

[0295] Data generated by the present system can be used to inform molecular designs for additional systems going forward. Additional uses of such a system include, but are not limited to, screening for signaling domains (e.g., signaling molecules, signaling domains, complementary protein fragments, protein subunits, and natural or engineered partial or truncated proteins) that are activated through protein-protein interaction.

[0296] Based on the experiments and results with the intracellular split fLuc reporter, new designs for LIPC systems will be undertaken. Additional configurations of EcR, RXR, and split fLuc elements will be assayed to demonstrate additional pairings. All of this information can be used to inform the generation of comparative models of the proteins that can in turn provide guidance for future designs. The current split fLuc vectors will also be tested in other important cell types for consistent activity. As the proteins are constitutively expressed in the present example, the dimerization event should be rapid when activating ligand is administered. Conversely, given that the fLuc halves have no affinity for each other and do not covalently interact, this system could also be used to examine off-rate kinetics following removal of activating ligand. Both signal onset and decay experiments are envisaged and being undertaken.

[0297] Further, additional LIPC designs are being pursued. Some of the designs are similar to those of the fLuc system above, with differences being, for example, that the molecules involved in the interaction can be single-pass type I transmembrane proteins. Initial designs and experiments will be with EcR and RXR localized intracellularly with at least portions of the fused proteins located extracellularly (see FIG. 3). Several additional configurations, however, can also be designed and tested depending on the actual assay readout. Additional designs include, but are not limited to, molecules with a transmembrane domain fused to EcR and RXR with EcR and RXR localized extracellularly and the fused proteins located intracellularly (see FIG. 4). Another configuration is where EcR and RXR components are fused to transmembrane domains yet the EcR, RXR, and fused signaling domains are all located intracellularly (see FIG. 5). Note that additional signaling domains, apart from fLuc, can be employed in the various configurations outlined above.

[0298] Further research will include experiments to understand on- and off-rates, optimal expression levels required to drive desired activation effects, and reduce (if needed) potential background (e.g., biological effects of the unpartnered proteins in the absence of ligand).

EXAMPLE 2

Ligand-Induced Dimerization of Nuclear Receptor Components

[0299] Experiments were performed to test if nuclear receptor domains (i.e., EcR and RxR polypeptides) could be induced to homodimerize upon addition of ligand (FIGS. 11 and 12). STAT1 was used as control polypeptide since it is reported to self dimerize independent of ligand addition. Abbreviations in the figures are:

[0300] EcR is Ecdysone receptor;

[0301] EcR-EcR means EcR_Nluc+Cluc_EcR which is a luciferase polypeptide split into two halves, such that an EcR polypeptide is fused to the N-terminus of a luciferase polypeptide fragment (EcR_Nluc) and another fragment of luciferase has an EcR polypeptide fused to its C-terminal end (Cluc_EcR); thereby activating luciferase (generation of bioluminescence) upon EcR homodimerization;

[0302] RxR is Retinoid X receptor;

[0303] Mock means no vector added;

[0304] eGFP is enhanced GFP (used as a negative control);

[0305] RxR_EcR means EcR_Nluc+Cluc_RXR which is a luciferase polypeptide split into two halves, such that an EcR polypeptide is fused to the N-terminus of a luciferase polypeptide fragment (EcR.sub.13 Nluc) and another fragment of luciferase has an RxR polypeptide fused to its C-terminal end (Cluc RxR); thereby activating luciferase (generation of bioluminescence) upon EcR homodimerization;

[0306] The results (FIGS. 11 and 12) indicate that EcR domain can be induced to homo dimerize upon ligand addition. However, the difference in bioluminescence signal was relatively low, which may be due to low affinity between the EcR domains by themselves. Based on the bioluminescence output, there was a statistically significant homodimerization of EcR domains upon ligand addition. In contrast, RxR domains were, surprisingly, observed to homodimerize independent of ligand. Moreover, the strongest signal (bioluminescence) was observed via heterodimerization of RxR and EcR domains induced by the ligand. Accordingly, these results indicate a relatively strong interaction between RxR and EcR domains via heterodimerization induced by ligand. Indeed, although homodimerization of each domain was of more limited affinity, it was surprising to observe and discover the ligand-independent homodimerization of RxR domains.

[0307] Unless defined otherwise, all technical and scientific terms and any acronyms used herein have the same meanings as commonly understood by one of ordinary skill in the art in the field of this invention.

[0308] All references cited herein are incorporated by reference herein to the full extent allowed by law. The discussion of those references is intended merely to summarize the assertions made by their authors. No admission is made that any reference (or a portion of any reference) is relevant art. Applicants reserve the right to challenge the accuracy and pertinence of any cited reference.

TABLE-US-00003 APPENDIXI SEQUENCES <210> SEQIDNO:1 <211> LENGTH:1054 <212> TYPE:DNA <213> ORGANISM:Choristoneurafumiferana <400> SEQUENCE:1 cctgagtgcgtagtacccgagactcagtgcgccatgaagcggaaagagaagaaagcacag 60 aaggagaaggacaaactgcctgtcagcacgacgacggtggacgaccacatgccgcccatt 120 atgcagtgtgaacctccacctcctgaagcagcaaggattcacgaagtggtcccaaggttt 180 ctctccgacaagctgttggagacaaaccggcagaaaaacatcccccagttgacagccaac 240 cagcagttccttatcgccaggctcatctggtaccaggacgggtacgagcagccttctgat 300 gaagatttgaagaggattacgcagacgtggcagcaagcggacgatgaaaacgaagagtct 360 gacactcccttccgccagatcacagagatgactatcctcacggtccaacttatcgtggag 420 ttcgcgaagggattgccagggttcgccaagatctcgcagcctgatcaaattacgctgctt 480 aaggcttgctcaagtgaggtaatgatgctccgagtcgcgcgacgatacgatgcggcctca 540 gacagtgttctgttcgcgaacaaccaagcgtacactcgcgacaactaccgcaaggctggc 600 atggcctacgtcatcgaggatctactgcacttctgccggtgcatgtactctatggcgttg 660 gacaacatccattacgcgctgctcacggctgtcgtcatcttttctgaccggccagggttg 720 gagcagccgcaactggtggaagaaatccagcggtactacctgaatacgctccgcatctat 780 atcctgaaccagctgagcgggtcggcgcgttcgtccgtcatatacggcaagatcctctca 840 atcctctctgagctacgcacgctcggcatgcaaaactccaacatgtgcatctccctcaag 900 ctcaagaacagaaagctgccgcctttcctcgaggagatctgggatgtggcggacatgtcg 960 cacacccaaccgccgcctatcctcgagtcccccacgaatctctagcccctgcgcgcacgc 1020 atcgccgatgccgcgtccggccgcgctgctctga 1054 <210> SEQIDNO:2 <211> LENGTH:1288 <212> TYPE:DNA <213> ORGANISM:Choristoneurafumiferana <400> SEQUENCE:2 aagggccctgcgccccgtcagcaagaggaactgtgtctggtatgcggggacagagcctcc 60 ggataccactacaatgcgctcacgtgtgaagggtgtaaagggttcttcagacggagtgtt 120 accaaaaatgcggtttatatttgtaaattcggtcacgcttgcgaaatggacatgtacatg 180 cgacggaaatgccaggagtgccgcctgaagaagtgcttagctgtaggcatgaggcctgag 240 tgcgtagtacccgagactcagtgcgccatgaagcggaaagagaagaaagcacagaaggag 300 aaggacaaactgcctgtcagcacgacgacggtggacgaccacatgccgcccattatgcag 360 tgtgaacctccacctcctgaagcagcaaggattcacgaagtggtcccaaggtttctctcc 420 gacaagctgttggagacaaaccggcagaaaaacatcccccagttgacagccaaccagcag 480 ttccttatcgccaggctcatctggtaccaggacgggtacgagcagccttctgatgaagat 540 ttgaagaggattacgcagacgtggcagcaagcggacgatgaaaacgaagagtctgacact 600 cccttccgccagatcacagagatgactatcctcacggtccaacttatcgtggagttcgcg 660 aagggattgccagggttcgccaagatctcgcagcctgatcaaattacgctgcttaaggct 720 tgctcaagtgaggtaatgatgctccgagtcgcgcgacgatacgatgcggcctcagacagt 780 gttctgttcgcgaacaaccaagcgtacactcgcgacaactaccgcaaggctggcatggcc 840 tacgtcatcgaggatctactgcacttctgccggtgcatgtactctatggcgttggacaac 900 atccattacgcgctgctcacggctgtcgtcatcttttctgaccggccagggttggagcag 960 ccgcaactggtggaagaaatccagcggtactacctgaatacgctccgcatctatatcctg 1020 aaccagctgagcgggtcggcgcgttcgtccgtcatatacggcaagatcctctcaatcctc 1080 tctgagctacgcacgctcggcatgcaaaactccaacatgtgcatctccctcaagctcaag 1140 aacagaaagctgccgcctttcctcgaggagatctgggatgtggcggacatgtcgcacacc 1200 caaccgccgcctatcctcgagtcccccacgaatctctagcccctgcgcgcacgcatcgcc 1260 gatgccgcgtccggccgcgctgctctga 1288 <210> SEQIDNO:3 <211> LENGTH:1650 <212> TYPE:DNA <213> ORGANISM:Drosophilamelanogaster <400> SEQUENCE:3 cggccggaatgcgtcgtcccggagaaccaatgtgcgatgaagcggcgcgaaaagaaggcc 60 cagaaggagaaggacaaaatgaccacttcgccgagctctcagcatggcggcaatggcagc 120 ttggcctctggtggcggccaagactttgttaagaaggagattcttgaccttatgacatgc 180 gagccgccccagcatgccactattccgctactacctgatgaaatattggccaagtgtcaa 240 gcgcgcaatataccttccttaacgtacaatcagttggccgttatatacaagttaatttgg 300 taccaggatggctatgagcagccatctgaagaggatctcaggcgtataatgagtcaaccc 360 gatgagaacgagagccaaacggacgtcagctttcggcatataaccgagataaccatactc 420 acggtccagttgattgttgagtttgctaaaggtctaccagcgtttacaaagataccccag 480 gaggaccagatcacgttactaaaggcctgctcgtcggaggtgatgatgctgcgtatggca 540 cgacgctatgaccacagctcggactcaatattcttcgcgaataatagatcatatacgcgg 600 gattcttacaaaatggccggaatggctgataacattgaagacctgctgcatttctgccgc 660 caaatgttctcgatgaaggtggacaacgtcgaatacgcgcttctcactgccattgtgatc 720 ttctcggaccggccgggcctggagaaggcccaactagtcgaagcgatccagagctactac 780 atcgacacgctacgcatttatatactcaaccgccactgcggcgactcaatgagcctcgtc 840 ttctacgcaaagctgctctcgatcctcaccgagctgcgtacgctgggcaaccagaacgcc 900 gagatgtgtttctcactaaagctcaaaaaccgcaaactgcccaagttcctcgaggagatc 960 tgggacgttcatgccatcccgccatcggtccagtcgcaccttcagattacccaggaggag 1020 aacgagcgtctcgagcgggctgagcgtatgcgggcatcggttgggggcgccattaccgcc 1080 ggcattgattgcgactctgcctccacttcggcggcggcagccgcggcccagcatcagcct 1140 cagcctcagccccagccccaaccctcctccctgacccagaacgattcccagcaccagaca 1200 cagccgcagctacaacctcagctaccacctcagctgcaaggtcaactgcaaccccagctc 1260 caaccacagcttcagacgcaactccagccacagattcaaccacagccacagctccttccc 1320 gtctccgctcccgtgcccgcctccgtaaccgcacctggttccttgtccgcggtcagtacg 1380 agcagcgaatacatgggcggaagtgcggccataggacccatcacgccggcaaccaccagc 1440 agtatcacggctgccgttaccgctagctccaccacatcagcggtaccgatgggcaacgga 1500 gttggagtcggtgttggggtgggcggcaacgtcagcatgtatgcgaacgcccagacggcg 1560 atggccttgatgggtgtagccctgcattcgcaccaagagcagcttatcgggggagtggcg 1620 gttaagtcggagcactcgacgactgcatag 1650 <210> SEQIDNO:4 <211> LENGTH:894 <212> TYPE:DNA <213> ORGANISM:Tenebriomolitor <400> SEQUENCE:4 aggccggaatgtgtggtaccggaagtacagtgtgctgttaagagaaaagagaagaaagcc 60 caaaaggaaaaagataaaccaaacagcactactaacggctcaccagacgtcatcaaaatt 120 gaaccagaattgtcagattcagaaaaaacattgactaacggacgcaataggatatcacca 180 gagcaagaggagctcatactcatacatcgattggtttatttccaaaacgaatatgaacat 240 ccgtctgaagaagacgttaaacggattatcaatcagccgatagatggtgaagatcagtgt 300 gagatacggtttaggcataccacggaaattacgatcctgactgtgcagctgatcgtggag 360 tttgccaagcggttaccaggcttcgataagctcctgcaggaagatcaaattgctctcttg 420 aaggcatgttcaagcgaagtgatgatgttcaggatggcccgacgttacgacgtccagtcg 480 gattccatcctcttcgtaaacaaccagccttatccgagggacagttacaatttggccggt 540 atgggggaaaccatcgaagatctcttgcatttttgcagaactatgtactccatgaaggtg 600 gataatgccgaatatgctttactaacagccatcgttattttctcagagcgaccgtcgttg 660 atagaaggctggaaggtggagaagatccaagaaatctatttagaggcattgcgggcgtac 720 gtcgacaaccgaagaagcccaagccggggcacaatattcgcgaaactcctgtcagtacta 780 actgaattgcggacgttaggcaaccaaaattcagagatgtgcatctcgttgaaattgaaa 840 aacaaaaagttaccgccgttcctggacgaaatctgggacgtcgacttaaaagca 894 210> SEQIDNO:5 <211> LENGTH:948 <212> TYPE:DNA <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:5 cggccggaatgtgtggtgccggagtaccagtgtgccatcaagcgggagtctaagaagcac 60 cagaaggaccggccaaacagcacaacgcgggaaagtccctcggcgctgatggcgccatct 120 tctgtgggtggcgtgagccccaccagccagcccatgggtggcggaggcagctccctgggc 180 agcagcaatcacgaggaggataagaagccagtggtgctcagcccaggagtcaagcccctc 240 tcttcatctcaggaggacctcatcaacaagctagtctactaccagcaggagtttgagtcg 300 ccttctgaggaagacatgaagaaaaccacgcccttccccctgggagacagtgaggaagac 360 aaccagcggcgattccagcacattactgagatcaccatcctgacagtgcagctcattgtg 420 gagttctccaagcgggtccctggctttgacacgctggcacgagaagaccagattactttg 480 ctgaaggcctgctccagtgaagtgatgatgctgagaggtgcccggaaatatgatgtgaag 540 acagattctatagtgtttgccaataaccagccgtacacgagggacaactaccgcagtgcc 600 agtgtgggggactctgcagatgccctgttccgcttctgccgcaagatgtgtcagctgaga 660 gtagacaacgctgaatacgcactcctgacggccattgtaattttctctgaacggccatca 720 ctggtggacccgcacaaggtggagcgcatccaggagtactacattgagaccctgcgcatg 780 tactccgagaaccaccggcccccaggcaagaactactttgcccggctgctgtccatcttg 840 acagagctgcgcaccttgggcaacatgaacgccgaaatgtgcttctcgctcaaggtgcag 900 aacaagaagctgccaccgttcctggctgagatttgggacatccaagag 948 <210> SEQIDNO:6 <211> LENGTH:334 <212> TYPE:PRT <213> ORGANISM:Choristoneurafumiferana <400> SEQUENCE:6 ProGluCysValValProGluThrGlnCysAlaMetLysArgLysGlu LysLysAlaGlnLysGluLysAspLysLeuProValSerThrThrThr ValAspAspHisMetProProIleMetGlnCysGluProProProPro GluAlaAlaArgIleHisGluValValProArgPheLeuSerAspLys LeuLeuGluThrAsnArgGlnLysAsnIleProGlnLeuThrAlaAsn GlnGlnPheLeuIleAlaArgLeuIleTrpTyrGlnAspGlyTyrGlu GlnProSerAspGluAspLeuLysArgIleThrGlnThrTrpGlnGln AlaAspAspGluAsnGluGluSerAspThrProPheArgGlnIleThr GluMetThrIleLeuThrValGlnLeuIleValGluPheAlaLysGly LeuProGlyPheAlaLysIleSerGlnProAspGlnIleThrLeuLeu LysAlaCysSerSerGluValMetMetLeuArgValAlaArgArgTyr AspAlaAlaSerAspSerValLeuPheAlaAsnAsnGlnAlaTyrThr ArgAspAsnTyrArgLysAlaGlyMetAlaTyrValIleGluAspLeu LeuHisPheCysArgCysMetTyrSerMetAlaLeuAspAsnIleHis TyrAlaLeuLeuThrAlaValValIlePheSerAspArgProGlyLeu GluGlnProGlnLeuValGluGluIleGlnArgTyrTyrLeuAsnThr LeuArgIleTyrIleLeuAsnGlnLeuSerGlySerAlaArgSerSer ValIleTyrGlyLysIleLeuSerIleLeuSerGluLeuArgThrLeu GlyMetGlnAsnSerAsnMetCysIleSerLeuLysLeuLysAsnArg LysLeuProProPheLeuGluGluIleTrpAspValAlaAspMetSer HisThrGlnProProProIleLeuGluSerProThrAsnLeu <210> SEQIDNO:7 <211> LENGTH:549 <212> TYPE:PRT <213> ORGANISM:Drosophilamelanogaster <400> SEQUENCE:7 ArgProGluCysValValProGluAsnGlnCysAlaMetLysArgArg GluLysLysAlaGlnLysGluLysAspLysMetThrThrSerProSer SerGlnHisGlyGlyAsnGlySerLeuAlaSerGlyGlyGlyGlnAsp PheValLysLysGluIleLeuAspLeuMetThrCysGluProProGln HisAlaThrIleProLeuLeuProAspGluIleLeuAlaLysCysGln AlaArgAsnIleProSerLeuThrTyrAsnGlnLeuAlaValIleTyr LysLeuIleTrpTyrGlnAspGlyTyrGluGlnProSerGluGluAsp LeuArgArgIleMetSerGlnProAspGluAsnGluSerGlnThrAsp ValSerPheArgHisIleThrGluIleThrIleLeuThrValGlnLeu IleValGluPheAlaLysGlyLeuProAlaPheThrLysIleProGln GluAspGlnIleThrLeuLeuLysAlaCysSerSerGluValMetMet LeuArgMetAlaArgArgTyrAspHisSerSerAspSerIlePhePhe AlaAsnAsnArgSerTyrThrArgAspSerTyrLysMetAlaGlyMet AlaAspAsnIleGluAspLeuLeuHisPheCysArgGlnMetPheSer MetLysValAspAsnValGluTyrAlaLeuLeuThrAlaIleValIle PheSerAspArgProGlyLeuGluLysAlaGlnLeuValGluAlaIle GlnSerTyrTyrIleAspThrLeuArgIleTyrIleLeuAsnArgHis CysGlyAspSerMetSerLeuValPheTyrAlaLysLeuLeuSerIle LeuThrGluLeuArgThrLeuGlyAsnGlnAsnAlaGluMetCysPhe SerLeuLysLeuLysAsnArgLysLeuProLysPheLeuGluGluIle TrpAspValHisAlaIleProProSerValGlnSerHisLeuGlnIle ThrGlnGluGluAsnGluArgLeuGluArgAlaGluArgMetArgAla SerValGlyGlyAlaIleThrAlaGlyIleAspCysAspSerAlaSer ThrSerAlaAlaAlaAlaAlaAlaGlnHisGlnProGlnProGlnPro GlnProGlnProSerSerLeuThrGlnAsnAspSerGlnHisGlnThr GlnProGlnLeuGlnProGlnLeuProProGlnLeuGlnGlyGlnLeu GlnProGlnLeuGlnProGlnLeuGlnThrGlnLeuGlnProGlnIle GlnProGlnProGlnLeuLeuProValSerAlaProValProAlaSer ValThrAlaProGlySerLeuSerAlaValSerThrSerSerGluTyr MetGlyGlySerAlaAlaIleGlyProIleThrProAlaThrThrSer SerIleThrAlaAlaValThrAlaSerSerThrThrSerAlaValPro MetGlyAsnGlyValGlyValGlyValGlyValGlyGlyAsnValSer MetTyrAlaAsnAlaGlnThrAlaMetAlaLeuMetGlyValAlaLeu HisSerHisGlnGluGlnLeuIleGlyGlyValAlaValLysSerGlu HisSerThrThrAla <210> SEQIDNO:8 <211> LENGTH:401 <212> TYPE:PRT <213> ORGANISM:Choristoneurafumiferana <400> SEQUENCE:8 CysLeuValCysGlyAspArgAlaSerGlyTyrHisTyrAsnAlaLeu ThrCysGluGlyCysLysGlyPhePheArgArgSerValThrLysAsn AlaValTyrIleCysLysPheGlyHisAlaCysGluMetAspMetTyr MetArgArgLysCysGlnGluCysArgLeuLysLysCysLeuAlaVal GlyMetArgProGluCysValValProGluThrGlnCysAlaMetLys ArgLysGluLysLysAlaGlnLysGluLysAspLysLeuProValSer ThrThrThrValAspAspHisMetProProIleMetGlnCysGluPro ProProProGluAlaAlaArgIleHisGluValValProArgPheLeu SerAspLysLeuLeuGluThrAsnArgGlnLysAsnIleProGlnLeu ThrAlaAsnGlnGlnPheLeuIleAlaArgLeuIleTrpTyrGlnAsp GlyTyrGluGlnProSerAspGluAspLeuLysArgIleThrGlnThr TrpGlnGlnAlaAspAspGluAsnGluGluSerAspThrProPheArg GlnIleThrGluMetThrIleLeuThrValGlnLeuIleValGluPhe AlaLysGlyLeuProGlyPheAlaLysIleSerGlnProAspGlnIle ThrLeuLeuLysAlaCysSerSerGluValMetMetLeuArgValAla ArgArgTyrAspAlaAlaSerAspSerValLeuPheAlaAsnAsnGln AlaTyrThrArgAspAsnTyrArgLysAlaGlyMetAlaTyrValIle GluAspLeuLeuHisPheCysArgCysMetTyrSerMetAlaLeuAsp AsnIleHisTyrAlaLeuLeuThrAlaValValIlePheSerAspArg ProGlyLeuGluGlnProGlnLeuValGluGluIleGlnArgTyrTyr LeuAsnThrLeuArgIleTyrIleLeuAsnGlnLeuSerGlySerAla ArgSerSerValIleTyrGlyLysIleLeuSerIleLeuSerGluLeu ArgThrLeuGlyMetGlnAsnSerAsnMetCysIleSerLeuLysLeu LysAsnArgLysLeuProProPheLeuGluGluIleTrpAspValAla AspMetSerHisThrGlnProProProIleLeuGluSerProThrAsn Leu <210> SEQIDNO:9 <211> LENGTH:298 <212> TYPE:PRT <213> ORGANISM:Tenebriomolitor <400> SEQUENCE:9 ArgProGluCysValValProGluValGlnCysAlaValLysArgLys GluLysLysAlaGlnLysGluLysAspLysProAsnSerThrThrAsn GlySerProAspValIleLysIleGluProGluLeuSerAspSerGlu LysThrLeuThrAsnGlyArgAsnArgIleSerProGluGlnGluGlu LeuIleLeuIleHisArgLeuValTyrPheGlnAsnGluTyrGluHis ProSerGluGluAspValLysArgIleIleAsnGlnProIleAspGly GluAspGlnCysGluIleArgPheArgHisThrThrGluIleThrIle LeuThrValGlnLeuIleValGluPheAlaLysArgLeuProGlyPhe AspLysLeuLeuGlnGluAspGlnIleAlaLeuLeuLysAlaCysSer SerGluValMetMetPheArgMetAlaArgArgTyrAspValGlnSer AspSerIleLeuPheValAsnAsnGlnProTyrProArgAspSerTyr AsnLeuAlaGlyMetGlyGluThrIleGluAspLeuLeuHisPheCys ArgThrMetTyrSerMetLysValAspAsnAlaGluTyrAlaLeuLeu ThrAlaIleValIlePheSerGluArgProSerLeuIleGluGlyTrp LysValGluLysIleGlnGluIleTyrLeuGluAlaLeuArgAlaTyr ValAspAsnArgArgSerProSerArgGlyThrIlePheAlaLysLeu LeuSerValLeuThrGluLeuArgThrLeuGlyAsnGlnAsnSerGlu MetCysIleSerLeuLysLeuLysAsnLysLysLeuProProPheLeu AspGluIleTrpAspValAspLeuLysAla <210> SEQIDNO:10 <211> LENGTH:316 <212> TYPE:PRT <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:10 ArgProGluCysValValProGluTyrGlnCysAlaIleLysArgGlu SerLysLysHisGlnLysAspArgProAsnSerThrThrArgGluSer ProSerAlaLeuMetAlaProSerSerValGlyGlyValSerProThr SerGlnProMetGlyGlyGlyGlySerSerLeuGlySerSerAsnHis GluGluAspLysLysProValValLeuSerProGlyValLysProLeu SerSerSerGlnGluAspLeuIleAsnLysLeuValTyrTyrGlnGln GluPheGluSerProSerGluGluAspMetLysLysThrThrProPhe ProLeuGlyAspSerGluGluAspAsnGlnArgArgPheGlnHisIle ThrGluIleThrIleLeuThrValGlnLeuIleValGluPheSerLys ArgValProGlyPheAspThrLeuAlaArgGluAspGlnIleThrLeu LeuLysAlaCysSerSerGluValMetMetLeuArgGlyAlaArgLys TyrAspValLysThrAspSerIleValPheAlaAsnAsnGlnProTyr ThrArgAspAsnTyrArgSerAlaSerValGlyAspSerAlaAspAla LeuPheArgPheCysArgLysMetCysGlnLeuArgValAspAsnAla GluTyrAlaLeuLeuThrAlaIleValIlePheSerGluArgProSer LeuValAspProHisLysValGluArgIleGlnGluTyrTyrIleGlu ThrLeuArgMetTyrSerGluAsnHisArgProProGlyLysAsnTyr PheAlaArgLeuLeuSerIleLeuThrGluLeuArgThrLeuGlyAsn MetAsnAlaGluMetCysPheSerLeuLysValGlnAsnLysLysLeu ProProPheLeuAlaGluIleTrpAspIleGlnGlu SEQIDNO:11 <211> LENGTH:711 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <220> FEATURE: <223> OTHERINFORMATION:ChimericRXRligandbindingdomain <400> SEQUENCE:11 gccaacgaggacatgcctgtagagaagattctggaagccgagcttgctgtcgagcccaag 60 actgagacatacgtggaggcaaacatggggctgaaccccagctcaccaaatgaccctgtt 120 accaacatctgtcaagcagcagacaagcagctcttcactcttgtggagtgggccaagagg 180 atcccacacttttctgagctgcccctagacgaccaggtcatcctgctacgggcaggctgg 240 aacgagctgctgatcgcctccttctcccaccgctccatagctgtgaaagatgggattctc 300 ctggccaccggcctgcacgtacaccggaacagcgctcacagtgctggggtgggcgccatc 360 tttgacagggtgctaacagagctggtgtctaagatgcgtgacatgcagatggacaagact 420 gaacttggctgcttgcgatctgttattcttttcaatccagaggtgaggggtttgaaatcc 480 gcccaggaagttgaacttctacgtgaaaaagtatatgccgctttggaagaatatactaga 540 acaacacatcccgatgaaccaggaagatttgcaaaacttttgcttcgtctgccttcttta 600 cgttccataggccttaagtgtttggagcatttgtttttctttcgccttattggagatgtt 660 ccaattgatacgttcctgatggagatgcttgaatcaccttctgattcataa 711 <210> SEQIDNO:12 <211> LENGTH:720 <212> TYPE:DNA <213> ORGANISM:Homosapiens <400> SEQUENCE:12 gcccccgaggagatgcctgtggacaggatcctggaggcagagcttgctgtggaacagaag 60 agtgaccagggcgttgagggtcctgggggaaccgggggtagcggcagcagcccaaatgac 120 cctgtgactaacatctgtcaggcagctgacaaacagctattcacgcttgttgagtgggcg 180 aagaggatcccacacttttcctccttgcctctggatgatcaggtcatattgctgcgggca 240 ggctggaatgaactcctcattgcctccttttcacaccgatccattgatgttcgagatggc 300 atcctccttgccacaggtcttcacgtgcaccgcaactcagcccattcagcaggagtagga 360 gccatctttgatcgggtgctgacagagctagtgtccaaaatgcgtgacatgaggatggac 420 aagacagagcttggctgcctgagggcaatcattctgtttaatccagatgccaagggcctc 480 tccaaccctagtgaggtggaggtcctgcgggagaaagtgtatgcatcactggagacctac 540 tgcaaacagaagtaccctgagcagcagggacggtttgccaagctgctgctacgtcttcct 600 gccctccggtccattggccttaagtgtctagagcatctgtttttcttcaagctcattggt 660 gacacccccatcgacaccttcctcatggagatgcttgaggctccccatcaactggcctga 720 SEQIDNO:13 <211> LENGTH:635 <212> TYPE:DNA <213> ORGANISM:Locustamigratoria <400> SEQUENCE:13 tgcatacagacatgcctgttgaacgcatacttgaagctgaaaaacgagtggagtgcaaag 60 cagaaaaccaagtggaatatgagctggtggagtgggctaaacacatcccgcacttcacat 120 ccctacctctggaggaccaggttctcctcctcagagcaggttggaatgaactgctaattg 180 cagcattttcacatcgatctgtagatgttaaagatggcatagtacttgccactggtctca 240 cagtgcatcgaaattctgcccatcaagctggagtcggcacaatatttgacagagttttga 300 cagaactggtagcaaagatgagagaaatgaaaatggataaaactgaacttggctgcttgc 360 gatctgttattcttttcaatccagaggtgaggggtttgaaatccgcccaggaagttgaac 420 ttctacgtgaaaaagtatatgccgctttggaagaatatactagaacaacacatcccgatg 480 aaccaggaagatttgcaaaacttttgcttcgtctgccttctttacgttccataggcctta 540 agtgtttggagcatttgtttttctttcgccttattggagatgttccaattgatacgttcc 600 tgatggagatgcttgaatcaccttctgattcataa 635 <210> SEQIDNO:14 <211> LENGTH:236 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <220> FEATURE: <223> OTHERINFORMATION:ChimericRXRligandbindingdomain <400> SEQUENCE:14 AlaAsnGluAspMetProValGluLysIleLeuGluAlaGluLeuAla ValGluProLysThrGluThrTyrValGluAlaAsnMetGlyLeuAsn ProSerSerProAsnAspProValThrAsnIleCysGlnAlaAlaAsp LysGlnLeuPheThrLeuValGluTrpAlaLysArgIleProHisPhe SerGluLeuProLeuAspAspGlnValIleLeuLeuArgAlaGlyTrp AsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAlaValLys AspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsnSerAla HisSerAlaGlyValGlyAlaIlePheAspArgValLeuThrGluLeu ValSerLysMetArgAspMetGlnMetAspLysThrGluLeuGlyCys LeuArgSerValIleLeuPheAsnProGluValArgGlyLeuLysSer AlaGlnGluValGluLeuLeuArgGluLysValTyrAlaAlaLeuGlu GluTyrThrArgThrThrHisProAspGluProGlyArgPheAlaLys LeuLeuLeuArgLeuProSerLeuArgSerIleGlyLeuLysCysLeu GluHisLeuPhePhePheArgLeuIleGlyAspValProIleAspThr PheLeuMetGluMetLeuGluSerProSerAspSer <210> SEQIDNO:15 <211> LENGTH:239 <212> TYPE:PRT <213> ORGANISM:Homosapiens <400> SEQUENCE:15 AlaProGluGluMetProValAspArgIleLeuGluAlaGluLeuAla ValGluGlnLysSerAspGlnGlyValGluGlyProGlyGlyThrGly GlySerGlySerSerProAsnAspProValThrAsnIleCysGlnAla AlaAspLysGlnLeuPheThrLeuValGluTrpAlaLysArgIlePro HisPheSerSerLeuProLeuAspAspGlnValIleLeuLeuArgAla GlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAsp ValArgAspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsn SerAlaHisSerAlaGlyValGlyAlaIlePheAspArgValLeuThr GluLeuValSerLysMetArgAspMetArgMetAspLysThrGluLeu GlyCysLeuArgAlaIleIleLeuPheAsnProAspAlaLysGlyLeu SerAsnProSerGluValGluValLeuArgGluLysValTyrAlaSer LeuGluThrTyrCysLysGlnLysTyrProGluGlnGlnGlyArgPhe AlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLys CysLeuGluHisLeuPhePhePheLysLeuIleGlyAspThrProIle AspThrPheLeuMetGluMetLeuGluAlaProHisGlnLeuAla <210> SEQIDNO:16 <211> LENGTH:210 <212> TYPE:PRT <213> ORGANISM:Locustamigratoria <400> SEQUENCE:16 HisThrAspMetProValGluArgIleLeuGluAlaGluLysArgVal GluCysLysAlaGluAsnGlnValGluTyrGluLeuValGluTrpAla LysHisIleProHisPheThrSerLeuProLeuGluAspGlnValLeu LeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaAlaPheSerHis ArgSerValAspValLysAspGlyIleValLeuAlaThrGlyLeuThr ValHisArgAsnSerAlaHisGlnAlaGlyValGlyThrIlePheAsp ArgValLeuThrGluLeuValAlaLysMetArgGluMetLysMetAsp LysThrGluLeuGlyCysLeuArgSerValIleLeuPheAsnProGlu ValArgGlyLeuLysSerAlaGlnGluValGluLeuLeuArgGluLys ValTyrAlaAlaLeuGluGluTyrThrArgThrThrHisProAspGlu ProGlyArgPheAlaLysLeuLeuLeuArgLeuProSerLeuArgSer IleGlyLeuLysCysLeuGluHisLeuPhePhePheArgLeuIleGly AspValProIleAspThrPheLeuMetGluMetLeuGluSerProSer AspSer <210> SEQIDNO:17 <211> 240 <212> PRT <213> Choristoneurafumiferana <400> SEQUENCE:17 LeuThrAlaAsnGlnGlnPheLeuIleAlaArgLeuIleTrpTyrGln AspGlyTyrGluGlnProSerAspGluAspLeuLysArgIleThrGln ThrTrpGlnGlnAlaAspAspGluAsnGluGluSerAspThrProPhe ArgGlnIleThrGluMetThrIleLeuThrValGlnLeuIleValGlu PheAlaLysGlyLeuProGlyPheAlaLysIleSerGlnProAspGln IleThrLeuLeuLysAlaCysSerSerGluValMetMetLeuArgVal AlaArgArgTyrAspAlaAlaSerAspSerValLeuPheAlaAsnAsn GlnAlaTyrThrArgAspAsnTyrArgLysAlaGlyMetAlaTyrVal IleGluAspLeuLeuHisPheCysArgCysMetTyrSerMetAlaLeu AspAsnIleHisTyrAlaLeuLeuThrAlaValValIlePheSerAsp ArgProGlyLeuGluGlnProGlnLeuValGluGluIleGlnArgTyr TyrLeuAsnThrLeuArgIleTyrIleLeuAsnGlnLeuSerGlySer AlaArgSerSerValIleTyrGlyLysIleLeuSerIleLeuSerGlu LeuArgThrLeuGlyMetGlnAsnSerAsnMetCysIleSerLeuLys LeuLysAsnArgLysLeuProProPheLeuGluGluIleTrpAspVal <210> SEQIDNO:18 <211> 237 <212> PRT <213> Drosophilamelanogaster <400> SEQUENCE:18 LeuThrTyrAsnGlnLeuAlaValIleTyrLysLeuIleTrpTyrGln AspGlyTyrGluGlnProSerGluGluAspLeuArgArgIleMetSer GlnProAspGluAsnGluSerGlnThrAspValSerPheArgHisIle ThrGluIleThrIleLeuThrValGlnLeuIleValGluPheAlaLys GlyLeuProAlaPheThrLysIleProGlnGluAspGlnIleThrLeu LeuLysAlaCysSerSerGluValMetMetLeuArgMetAlaArgArg TyrAspHisSerSerAspSerIlePhePheAlaAsnAsnArgSerTyr ThrArgAspSerTyrLysMetAlaGlyMetAlaAspAsnIleGluAsp LeuLeuHisPheCysArgGlnMetPheSerMetLysValAspAsnVal GluTyrAlaLeuLeuThrAlaIleValIlePheSerAspArgProGly LeuGluLysAlaGlnLeuValGluAlaIleGlnSerTyrTyrIleAsp ThrLeuArgIleTyrIleLeuAsnArgHisCysGlyAspSerMetSer LeuValPheTyrAlaLysLeuLeuSerIleLeuThrGluLeuArgThr LeuGlyAsnGlnAsnAlaGluMetCysPheSerLeuLysLeuLysAsn ArgLysLeuProLysPheLeuGluGluIleTrpAspVal <210> SEQIDNO:19 <211> 240 <212> PRT <213> Amblyommaamericanum <400> SEQUENCE:19 ProGlyValLysProLeuSerSerSerGlnGluAspLeuIleAsnLys LeuValTyrTyrGlnGlnGluPheGluSerProSerGluGluAspMet LysLysThrThrProPheProLeuGlyAspSerGluGluAspAsnGln ArgArgPheGlnHisIleThrGluIleThrIleLeuThrValGlnLeu IleValGluPheSerLysArgValProGlyPheAspThrLeuAlaArg GluAspGlnIleThrLeuLeuLysAlaCysSerSerGluValMetMet LeuArgGlyAlaArgLysTyrAspValLysThrAspSerIleValPhe AlaAsnAsnGlnProTyrThrArgAspAsnTyrArgSerAlaSerVal GlyAspSerAlaAspAlaLeuPheArgPheCysArgLysMetCysGln LeuArgValAspAsnAlaGluTyrAlaLeuLeuThrAlaIleValIle PheSerGluArgProSerLeuValAspProHisLysValGluArgIle GlnGluTyrTyrIleGluThrLeuArgMetTyrSerGluAsnHisArg ProProGlyLysAsnTyrPheAlaArgLeuLeuSerIleLeuThrGlu LeuArgThrLeuGlyAsnMetAsnAlaGluMetCysPheSerLeuLys ValGlnAsnLysLysLeuProProPheLeuAlaGluIleTrpAspIle <210> SEQIDNO:20 <211> LENGTH:1586 <212> TYPE:DNA <213> ORGANISM:Bameciaargentifoli <400> SEQUENCE:20 gaattcgcggccgctcgcaaacttccgtacctctcaccccctcgccaggaccccccgcca 60 accagttcaccgtcatctcctccaatggatactcatcccccatgtcttcgggcagctacg 120 acccttatagtcccaccaatggaagaatagggaaagaagagctttcgccggcgaatagtc 180 tgaacgggtacaacgtggatagctgcgatgcgtcgcggaagaagaagggaggaacgggtc 240 ggcagcaggaggagctgtgtctcgtctgcggggaccgcgcctccggctaccactacaacg 300 ccctcacctgcgaaggctgcaagggcttcttccgtcggagcatcaccaagaatgccgtct 360 accagtgtaaatatggaaataattgtgaaattgacatgtacatgaggcgaaaatgccaag 420 agtgtcgtctcaagaagtgtctcagcgttggcatgaggccagaatgtgtagttcccgaat 480 tccagtgtgctgtgaagcgaaaagagaaaaaagcgcaaaaggacaaagataaacctaact 540 caacgacgagttgttctccagatggaatcaaacaagagatagatcctcaaaggctggata 600 cagattcgcagctattgtctgtaaatggagttaaacccattactccagagcaagaagagc 660 tcatccataggctagtttattttcaaaatgaatatgaacatccatccccagaggatatca 720 aaaggatagttaatgctgcaccagaagaagaaaatgtagctgaagaaaggtttaggcata 780 ttacagaaattacaattctcactgtacagttaattgtggaattttctaagcgattacctg 840 gttttgacaaactaattcgtgaagatcaaatagctttattaaaggcatgtagtagtgaag 900 taatgatgtttagaatggcaaggaggtatgatgctgaaacagattcgatattgtttgcaa 960 ctaaccagccgtatacgagagaatcatacactgtagctggcatgggtgatactgtggagg 1020 atctgctccgattttgtcgacatatgtgtgccatgaaagtcgataacgcagaatatgctc 1080 ttctcactgccattgtaattttttcagaacgaccatctctaagtgaaggctggaaggttg 1140 agaagattcaagaaatttacatagaagcattaaaagcatatgttgaaaatcgaaggaaac 1200 catatgcaacaaccatttttgctaagttactatctgttttaactgaactacgaacattag 1260 ggaatatgaattcagaaacatgcttctcattgaagctgaagaatagaaaggtgccatcct 1320 tcctcgaggagatttgggatgttgtttcataaacagtcttacctcaattccatgttactt 1380 ttcatatttgatttatctcagcaggtggctcagtacttatcctcacattactgagctcac 1440 ggtatgctcatacaattataacttgtaatatcatatcggtgatgacaaatttgttacaat 1500 attctttgttaccttaacacaatgttgatctcataatgatgtatgaatttttctgttttt 1560 gcaaaaaaaaaagcggccgcgaattc 1586 <210> SEQIDNO:21 <211> LENGTH:1109 <212> TYPE:DNA <213> ORGANISM:Nephotetixcincticeps <400> SEQUENCE:21 caggaggagctctgcctgttgtgcggagaccgagcgtcgggataccactacaacgctctc 60 acctgcgaaggatgcaagggcttctttcggaggagtatcaccaaaaacgcagtgtaccag 120 tccaaatacggcaccaattgtgaaatagacatgtatatgcggcgcaagtgccaggagtgc 180 cgactcaagaagtgcctcagtgtagggatgaggccagaatgtgtagtacctgagtatcaa 240 tgtgccgtaaaaaggaaagagaaaaaagctcaaaaggacaaagataaacctgtctcttca 300 accaatggctcgcctgaaatgagaatagaccaggacaaccgttgtgtggtgttgcagagt 360 gaagacaacaggtacaactcgagtacgcccagtttcggagtcaaacccctcagtccagaa 420 caagaggagctcatccacaggctcgtctacttccagaacgagtacgaacaccctgccgag 480 gaggatctcaagcggatcgagaacctcccctgtgacgacgatgacccgtgtgatgttcgc 540 tacaaacacattacggagatcacaatactcacagtccagctcatcgtggagtttgcgaaa 600 aaactgcctggtttcgacaaactactgagagaggaccagatcgtgttgctcaaggcgtgt 660 tcgagcgaggtgatgatgctgcggatggcgcggaggtacgacgtccagacagactcgatc 720 ctgttcgccaacaaccagccgtacacgcgagagtcgtacacgatggcaggcgtgggggaa 780 gtcatcgaagatctgctgcggttcggccgactcatgtgctccatgaaggtggacaatgcc 840 gagtatgctctgctcacggccatcgtcatcttctccgagcggccgaacctggcggaagga 900 tggaaggttgagaagatccaggagatctacctggaggcgctcaagtcctacgtggacaac 960 cgagtgaaacctcgcagtccgaccatcttcgccaaactgctctccgttctcaccgagctg 1020 cgaacactcggcaaccagaactccgagatgtgcttctcgttaaactacgcaaccgcaaac 1080 atgccaccgttcctcgaagaaatctggga 1109 <210> SEQIDNO:22 <211> LENGTH:735 <212> TYPE:DNA <213> ORGANISM:Choristoneurafumiferana <400> SEQUENCE:22 taccaggacgggtacgagcagccttctgatgaagatttgaagaggattacgcagacgtgg 60 cagcaagcggacgatgaaaacgaagagtctgacactcccttccgccagatcacagagatg 120 actatcctcacggtccaacttatcgtggagttcgcgaagggattgccagggttcgccaag 180 atctcgcagcctgatcaaattacgctgcttaaggcttgctcaagtgaggtaatgatgctc 240 cgagtcgcgcgacgatacgatgcggcctcagacagtgttctgttcgcgaacaaccaagcg 300 tacactcgcgacaactaccgcaaggctggcatggcctacgtcatcgaggatctactgcac 360 ttctgccggtgcatgtactctatggcgttggacaacatccattacgcgctgctcacggct 420 gtcgtcatcttttctgaccggccagggttggagcagccgcaactggtggaagaaatccag 480 cggtactacctgaatacgctccgcatctatatcctgaaccagctgagcgggtcggcgcgt 540 tcgtccgtcatatacggcaagatcctctcaatcctctctgagctacgcacgctcggcatg 600 caaaactccaacatgtgcatctccctcaagctcaagaacagaaagctgccgcctttcctc 660 gaggagatctgggatgtggcggacatgtcgcacacccaaccgccgcctatcctcgagtcc 720 cccacgaatctctag 735 <210> SEQIDNO:23 <211> LENGTH:1338 <212> TYPE:DNA <213> ORGANISM:Drosophilamelanogaster <400> SEQUENCE:23 tatgagcagccatctgaagaggatctcaggcgtataatgagtcaacccgatgagaacgag 60 agccaaacggacgtcagctttcggcatataaccgagataaccatactcacggtccagttg 120 attgttgagtttgctaaaggtctaccagcgtttacaaagataccccaggaggaccagatc 180 acgttactaaaggcctgctcgtcggaggtgatgatgctgcgtatggcacgacgctatgac 240 cacagctcggactcaatattcttcgcgaataatagatcatatacgcgggattcttacaaa 300 atggccggaatggctgataacattgaagacctgctgcatttctgccgccaaatgttctcg 360 atgaaggtggacaacgtcgaatacgcgcttctcactgccattgtgatcttctcggaccgg 420 ccgggcctggagaaggcccaactagtcgaagcgatccagagctactacatcgacacgcta 480 cgcatttatatactcaaccgccactgcggcgactcaatgagcctcgtcttctacgcaaag 540 ctgctctcgatcctcaccgagctgcgtacgctgggcaaccagaacgccgagatgtgtttc 600 tcactaaagctcaaaaaccgcaaactgcccaagttcctcgaggagatctgggacgttcat 660 gccatcccgccatcggtccagtcgcaccttcagattacccaggaggagaacgagcgtctc 720 gagcgggctgagcgtatgcgggcatcggttgggggcgccattaccgccggcattgattgc 780 gactctgcctccacttcggcggcggcagccgcggcccagcatcagcctcagcctcagccc 840 cagccccaaccctcctccctgacccagaacgattcccagcaccagacacagccgcagcta 900 caacctcagctaccacctcagctgcaaggtcaactgcaaccccagctccaaccacagctt 960 cagacgcaactccagccacagattcaaccacagccacagctccttcccgtctccgctccc 1020 gtgcccgcctccgtaaccgcacctggttccttgtccgcggtcagtacgagcagcgaatac 1080 atgggcggaagtgcggccataggacccatcacgccggcaaccaccagcagtatcacggct 1140 gccgttaccgctagctccaccacatcagcggtaccgatgggcaacggagttggagtcggt 1200 gttggggtgggcggcaacgtcagcatgtatgcgaacgcccagacggcgatggccttgatg 1260 ggtgtagccctgcattcgcaccaagagcagcttatcgggggagtggcggttaagtcggag 1320 cactcgacgactgcatag 1338 <210> SEQIDNO:24 <211> LENGTH:960 <212> TYPE:DNA <213> ORGANISM:Choristoneurafumiferana <400> SEQUENCE:24 cctgagtgcgtagtacccgagactcagtgcgccatgaagcggaaagagaagaaagcacag 60 aaggagaaggacaaactgcctgtcagcacgacgacggtggacgaccacatgccgcccatt 120 atgcagtgtgaacctccacctcctgaagcagcaaggattcacgaagtggtcccaaggttt 180 ctctccgacaagctgttggagacaaaccggcagaaaaacatcccccagttgacagccaac 240 cagcagttccttatcgccaggctcatctggtaccaggacgggtacgagcagccttctgat 300 gaagatttgaagaggattacgcagacgtggcagcaagcggacgatgaaaacgaagagtct 360 gacactcccttccgccagatcacagagatgactatcctcacggtccaacttatcgtggag 420 ttcgcgaagggattgccagggttcgccaagatctcgcagcctgatcaaattacgctgctt 480 aaggcttgctcaagtgaggtaatgatgctccgagtcgcgcgacgatacgatgcggcctca 540 gacagtgttctgttcgcgaacaaccaagcgtacactcgcgacaactaccgcaaggctggc 600 atggcctacgtcatcgaggatctactgcacttctgccggtgcatgtactctatggcgttg 660 gacaacatccattacgcgctgctcacggctgtcgtcatcttttctgaccggccagggttg 720 gagcagccgcaactggtggaagaaatccagcggtactacctgaatacgctccgcatctat 780 atcctgaaccagctgagcgggtcggcgcgttcgtccgtcatatacggcaagatcctctca 840 atcctctctgagctacgcacgctcggcatgcaaaactccaacatgtgcatctccctcaag 900 ctcaagaacagaaagctgccgcctttcctcgaggagatctgggatgtggcggacatgtcg 960 <210> SEQIDNO:25 <211> LENGTH:969 <212> TYPE:DNA <213> ORGANISM:Drosophilamelanogaster <400> SEQUENCE:25 cggccggaatgcgtcgtcccggagaaccaatgtgcgatgaagcggcgcgaaaagaaggcc 60 cagaaggagaaggacaaaatgaccacttcgccgagctctcagcatggcggcaatggcagc 120 ttggcctctggtggcggccaagactttgttaagaaggagattcttgaccttatgacatgc 180 gagccgccccagcatgccactattccgctactacctgatgaaatattggccaagtgtcaa 240 gcgcgcaatataccttccttaacgtacaatcagttggccgttatatacaagttaatttgg 300 taccaggatggctatgagcagccatctgaagaggatctcaggcgtataatgagtcaaccc 360 gatgagaacgagagccaaacggacgtcagctttcggcatataaccgagataaccatactc 420 acggtccagttgattgttgagtttgctaaaggtctaccagcgtttacaaagataccccag 480 gaggaccagatcacgttactaaaggcctgctcgtcggaggtgatgatgctgcgtatggca 540 cgacgctatgaccacagctcggactcaatattcttcgcgaataatagatcatatacgcgg 600 gattcttacaaaatggccggaatggctgataacattgaagacctgctgcatttctgccgc 660 caaatgttctcgatgaaggtggacaacgtcgaatacgcgcttctcactgccattgtgatc 720 ttctcggaccggccgggcctggagaaggcccaactagtcgaagcgatccagagctactac 780 atcgacacgctacgcatttatatactcaaccgccactgcggcgactcaatgagcctcgtc 840 ttctacgcaaagctgctctcgatcctcaccgagctgcgtacgctgggcaaccagaacgcc 900 gagatgtgtttctcactaaagctcaaaaaccgcaaactgcccaagttcctcgaggagatc 960 tgggacgtt 969 <210> SEQIDNO:26 <211> LENGTH:244 <212> TYPE:PRT <213> ORGANISM:Choristoneurafumiferana <400> SEQUENCE:26 TyrGlnAspGlyTyrGluGlnProSerAspGluAspLeuLysArgIle ThrGlnThrTrpGlnGlnAlaAspAspGluAsnGluGluSerAspThr ProPheArgGlnIleThrGluMetThrIleLeuThrValGlnLeuIle ValGluPheAlaLysGlyLeuProGlyPheAlaLysIleSerGlnPro AspGlnIleThrLeuLeuLysAlaCysSerSerGluValMetMetLeu ArgValAlaArgArgTyrAspAlaAlaSerAspSerValLeuPheAla AsnAsnGlnAlaTyrThrArgAspAsnTyrArgLysAlaGlyMetAla TyrValIleGluAspLeuLeuHisPheCysArgCysMetTyrSerMet AlaLeuAspAsnIleHisTyrAlaLeuLeuThrAlaValValIlePhe SerAspArgProGlyLeuGluGlnProGlnLeuValGluGluIleGln ArgTyrTyrLeuAsnThrLeuArgIleTyrIleLeuAsnGlnLeuSer GlySerAlaArgSerSerValIleTyrGlyLysIleLeuSerIleLeu SerGluLeuArgThrLeuGlyMetGlnAsnSerAsnMetCysIleSer LeuLysLeuLysAsnArgLysLeuProProPheLeuGluGluIleTrp AspValAlaAspMetSerHisThrGlnProProProIleLeuGluSer ProThrAsnLeu <210> SEQIDNO:27 <211> LENGTH:445 <212> TYPE:PRT <213> ORGANISM:Drosophilamelanogaster <400> SEQUENCE:27 TyrGluGlnProSerGluGluAspLeuArgArgIleMetSerGlnPro AspGluAsnGluSerGlnThrAspValSerPheArgHisIleThrGlu IleThrIleLeuThrValGlnLeuIleValGluPheAlaLysGlyLeu ProAlaPheThrLysIleProGlnGluAspGlnIleThrLeuLeuLys AlaCysSerSerGluValMetMetLeuArgMetAlaArgArgTyrAsp HisSerSerAspSerIlePhePheAlaAsnAsnArgSerTyrThrArg AspSerTyrLysMetAlaGlyMetAlaAspAsnIleGluAspLeuLeu HisPheCysArgGlnMetPheSerMetLysValAspAsnValGluTyr AlaLeuLeuThrAlaIleValIlePheSerAspArgProGlyLeuGlu LysAlaGlnLeuValGluAlaIleGlnSerTyrTyrIleAspThrLeu ArgIleTyrIleLeuAsnArgHisCysGlyAspSerMetSerLeuVal PheTyrAlaLysLeuLeuSerIleLeuThrGluLeuArgThrLeuGly AsnGlnAsnAlaGluMetCysPheSerLeuLysLeuLysAsnArgLys LeuProLysPheLeuGluGluIleTrpAspValHisAlaIleProPro SerValGlnSerHisLeuGlnIleThrGlnGluGluAsnGluArgLeu GluArgAlaGluArgMetArgAlaSerValGlyGlyAlaIleThrAla GlyIleAspCysAspSerAlaSerThrSerAlaAlaAlaAlaAlaAla GlnHisGlnProGlnProGlnProGlnProGlnProSerSerLeuThr GlnAsnAspSerGlnHisGlnThrGlnProGlnLeuGlnProGlnLeu ProProGlnLeuGlnGlyGlnLeuGlnProGlnLeuGlnProGlnLeu GlnThrGlnLeuGlnProGlnIleGlnProGlnProGlnLeuLeuPro ValSerAlaProValProAlaSerValThrAlaProGlySerLeuSer AlaValSerThrSerSerGluTyrMetGlyGlySerAlaAlaIleGly ProIleThrProAlaThrThrSerSerIleThrAlaAlaValThrAla SerSerThrThrSerAlaValProMetGlyAsnGlyValGlyValGly ValGlyValGlyGlyAsnValSerMetTyrAlaAsnAlaGlnThrAla MetAlaLeuMetGlyValAlaLeuHisSerHisGlnGluGlnLeuIle GlyGlyValAlaValLysSerGluHisSerThrThrAla <210> SEQIDNO:28 <211> LENGTH:320 <212> TYPE:PRT <213> ORGANISM:Choristoneurafumiferana <400> SEQUENCE:28 ProGluCysValValProGluThrGlnCysAlaMetLysArgLysGlu LysLysAlaGlnLysGluLysAspLysLeuProValSerThrThrThr ValAspAspHisMetProProIleMetGlnCysGluProProProPro GluAlaAlaArgIleHisGluValValProArgPheLeuSerAspLys LeuLeuGluThrAsnArgGlnLysAsnIleProGlnLeuThrAlaAsn GlnGlnPheLeuIleAlaArgLeuIleTrpTyrGlnAspGlyTyrGlu GlnProSerAspGluAspLeuLysArgIleThrGlnThrTrpGlnGln AlaAspAspGluAsnGluGluSerAspThrProPheArgGlnIleThr GluMetThrIleLeuThrValGlnLeuIleValGluPheAlaLysGly LeuProGlyPheAlaLysIleSerGlnProAspGlnIleThrLeuLeu LysAlaCysSerSerGluValMetMetLeuArgValAlaArgArgTyr AspAlaAlaSerAspSerValLeuPheAlaAsnAsnGlnAlaTyrThr ArgAspAsnTyrArgLysAlaGlyMetAlaTyrValIleGluAspLeu LeuHisPheCysArgCysMetTyrSerMetAlaLeuAspAsnIleHis TyrAlaLeuLeuThrAlaValValIlePheSerAspArgProGlyLeu GluGlnProGlnLeuValGluGluIleGlnArgTyrTyrLeuAsnThr LeuArgIleTyrIleLeuAsnGlnLeuSerGlySerAlaArgSerSer ValIleTyrGlyLysIleLeuSerIleLeuSerGluLeuArgThrLeu GlyMetGlnAsnSerAsnMetCysIleSerLeuLysLeuLysAsnArg LysLeuProProPheLeuGluGluIleTrpAspValAlaAspMetSer <210> SEQIDNO:29 <211> LENGTH:323 <212> TYPE:PRT <213> ORGANISM:Drosophilamelanogaster <400> SEQUENCE:29 ArgProGluCysValValProGluAsnGlnCysAlaMetLysArgArg GluLysLysAlaGlnLysGluLysAspLysMetThrThrSerProSer SerGlnHisGlyGlyAsnGlySerLeuAlaSerGlyGlyGlyGlnAsp PheValLysLysGluIleLeuAspLeuMetThrCysGluProProGln HisAlaThrIleProLeuLeuProAspGluIleLeuAlaLysCysGln AlaArgAsnIleProSerLeuThrTyrAsnGlnLeuAlaValIleTyr LysLeuIleTrpTyrGlnAspGlyTyrGluGlnProSerGluGluAsp LeuArgArgIleMetSerGlnProAspGluAsnGluSerGlnThrAsp ValSerPheArgHisIleThrGluIleThrIleLeuThrValGlnLeu IleValGluPheAlaLysGlyLeuProAlaPheThrLysIleProGln GluAspGlnIleThrLeuLeuLysAlaCysSerSerGluValMetMet LeuArgMetAlaArgArgTyrAspHisSerSerAspSerIlePhePhe AlaAsnAsnArgSerTyrThrArgAspSerTyrLysMetAlaGlyMet AlaAspAsnIleGluAspLeuLeuHisPheCysArgGlnMetPheSer MetLysValAspAsnValGluTyrAlaLeuLeuThrAlaIleValIle PheSerAspArgProGlyLeuGluLysAlaGlnLeuValGluAlaIle GlnSerTyrTyrIleAspThrLeuArgIleTyrIleLeuAsnArgHis CysGlyAspSerMetSerLeuValPheTyrAlaLysLeuLeuSerIle LeuThrGluLeuArgThrLeuGlyAsnGlnAsnAlaGluMetCysPhe SerLeuLysLeuLysAsnArgLysLeuProLysPheLeuGluGluIle TrpAspVal <210> SEQIDNO:30 <211> LENGTH:987 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:30 tgtgctatctgtggggaccgctcctcaggcaaacactatggggtatacagttgtgagggc 60 tgcaagggcttcttcaagaggacagtacgcaaagacctgacctacacctgccgagacaac 120 aaggactgcctgatcgacaagagacagcggaaccggtgtcagtactgccgctaccagaag 180 tgcctggccatgggcatgaagcgggaagctgtgcaggaggagcggcagcggggcaaggac 240 cggaatgagaacgaggtggagtccaccagcagtgccaacgaggacatgcctgtagagaag 300 attctggaagccgagcttgctgtcgagcccaagactgagacatacgtggaggcaaacatg 360 gggctgaaccccagctcaccaaatgaccctgttaccaacatctgtcaagcagcagacaag 420 cagctcttcactcttgtggagtgggccaagaggatcccacacttttctgagctgccccta 480 gacgaccaggtcatcctgctacgggcaggctggaacgagctgctgatcgcctccttctcc 540 caccgctccatagctgtgaaagatgggattctcctggccaccggcctgcacgtacaccgg 600 aacagcgctcacagtgctggggtgggcgccatctttgacagggtgctaacagagctggtg 660 tctaagatgcgtgacatgcagatggacaagacggagctgggctgcctgcgagccattgtc 720 ctgttcaaccctgactctaaggggctctcaaaccctgctgaggtggaggcgttgagggag 780 aaggtgtatgcgtcactagaagcgtactgcaaacacaagtaccctgagcagccgggcagg 840 tttgccaagctgctgctccgcctgcctgcactgcgttccatcgggctcaagtgcctggag 900 cacctgttcttcttcaagctcatcggggacacgcccatcgacaccttcctcatggagatg 960 ctggaggcaccacatcaagccacctag 987 <210> SEQIDNO:31 <211> LENGTH:789 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:31 aagcgggaagctgtgcaggaggagcggcagcggggcaaggaccggaatgagaacgaggtg 60 gagtccaccagcagtgccaacgaggacatgcctgtagagaagattctggaagccgagctt 120 gctgtcgagcccaagactgagacatacgtggaggcaaacatggggctgaaccccagctca 180 ccaaatgaccctgttaccaacatctgtcaagcagcagacaagcagctcttcactcttgtg 240 gagtgggccaagaggatcccacacttttctgagctgcccctagacgaccaggtcatcctg 300 ctacgggcaggctggaacgagctgctgatcgcctccttctcccaccgctccatagctgtg 360 aaagatgggattctcctggccaccggcctgcacgtacaccggaacagcgctcacagtgct 420 ggggtgggcgccatctttgacagggtgctaacagagctggtgtctaagatgcgtgacatg 480 cagatggacaagacggagctgggctgcctgcgagccattgtcctgttcaaccctgactct 540 aaggggctctcaaaccctgctgaggtggaggcgttgagggagaaggtgtatgcgtcacta 600 gaagcgtactgcaaacacaagtaccctgagcagccgggcaggtttgccaagctgctgctc 660 cgcctgcctgcactgcgttccatcgggctcaagtgcctggagcacctgttcttcttcaag 720 ctcatcggggacacgcccatcgacaccttcctcatggagatgctggaggcaccacatcaa 780 gccacctag 789 <210> SEQIDNO:32 <211> LENGTH:714 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:32 gccaacgaggacatgcctgtagagaagattctggaagccgagcttgctgtcgagcccaag 60 actgagacatacgtggaggcaaacatggggctgaaccccagctcaccaaatgaccctgtt 120 accaacatctgtcaagcagcagacaagcagctcttcactcttgtggagtgggccaagagg 180 atcccacacttttctgagctgcccctagacgaccaggtcatcctgctacgggcaggctgg 240 aacgagctgctgatcgcctccttctcccaccgctccatagctgtgaaagatgggattctc 300 ctggccaccggcctgcacgtacaccggaacagcgctcacagtgctggggtgggcgccatc 360 tttgacagggtgctaacagagctggtgtctaagatgcgtgacatgcagatggacaagacg 420 gagctgggctgcctgcgagccattgtcctgttcaaccctgactctaaggggctctcaaac 480 cctgctgaggtggaggcgttgagggagaaggtgtatgcgtcactagaagcgtactgcaaa 540 cacaagtaccctgagcagccgggcaggtttgccaagctgctgctccgcctgcctgcactg 600 cgttccatcgggctcaagtgcctggagcacctgttcttcttcaagctcatcggggacacg 660 cccatcgacaccttcctcatggagatgctggaggcaccacatcaagccacctag 714 <210> SEQIDNO:33 <211> LENGTH:536 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:33 ggatcccacacttttctgagctgcccctagacgaccaggtcatcctgctacgggcaggct 60 ggaacgagctgctgatcgcctccttctcccaccgctccatagctgtgaaagatgggattc 120 tcctggccaccggcctgcacgtacaccggaacagcgctcacagtgctggggtgggcgcca 180 tctttgacagggtgctaacagagctggtgtctaagatgcgtgacatgcagatggacaaga 240 cggagctgggctgcctgcgagccattgtcctgttcaaccctgactctaaggggctctcaa 300 accctgctgaggtggaggcgttgagggagaaggtgtatgcgtcactagaagcgtactgca 360 aacacaagtaccctgagcagccgggcaggtttgccaagctgctgctccgcctgcctgcac 420 tgcgttccatcgggctcaagtgcctggagcacctgttcttcttcaagctcatcggggaca 480 cgcccatcgacaccttcctcatggagatgctggaggcaccacatcaagccacctag 536 <210> SEQIDNO:34 <211> LENGTH:672 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:34 gccaacgaggacatgcctgtagagaagattctggaagccgagcttgctgtcgagcccaag 60 actgagacatacgtggaggcaaacatggggctgaaccccagctcaccaaatgaccctgtt 120 accaacatctgtcaagcagcagacaagcagctcttcactcttgtggagtgggccaagagg 180 atcccacacttttctgagctgcccctagacgaccaggtcatcctgctacgggcaggctgg 240 aacgagctgctgatcgcctccttctcccaccgctccatagctgtgaaagatgggattctc 300 ctggccaccggcctgcacgtacaccggaacagcgctcacagtgctggggtgggcgccatc 360 tttgacagggtgctaacagagctggtgtctaagatgcgtgacatgcagatggacaagacg 420 gagctgggctgcctgcgagccattgtcctgttcaaccctgactctaaggggctctcaaac 480 cctgctgaggtggaggcgttgagggagaaggtgtatgcgtcactagaagcgtactgcaaa 540 cacaagtaccctgagcagccgggcaggtttgccaagctgctgctccgcctgcctgcactg 600 cgttccatcgggctcaagtgcctggagcacctgttcttcttcaagctcatcggggacacg 660 cccatcgacacc 672 <210> SEQIDNO:35 <211> LENGTH:1123 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <220> FEATURE: <221> NAME/KEY:misc_feature <223> OTHERINFORMATION:NovelSequence <400> SEQUENCE:35 tgcgccatctgcggggaccgctcctcaggcaagcactatggagtgtacagctgcgagggg 60 tgcaagggcttcttcaagcggacggtgcgcaaggacctgacctacacctgccgcgacaac 120 aaggactgcctgattgacaagcggcagcggaaccggtgccagtactgccgctaccagaag 180 tgcctggccatgggcatgaagcgggaagccgtgcaggaggagcggcagcgtggcaaggac 240 cggaacgagaatgaggtggagtcgaccagcagcgccaacgaggacatgccggtggagagg 300 atcctggaggctgagctggccgtggagcccaagaccgagacctacgtggaggcaaacatg 360 gggctgaaccccagctcgccgaacgaccctgtcaccaacatttgccaagcagccgacaaa 420 cagcttttcaccctggtggagtgggccaagcggatcccacacttctcagagctgcccctg 480 gacgaccaggtcatcctgctgcgggcaggctggaatgagctgctcatcgcctccttctcc 540 caccgctccatcgccgtgaaggacgggatcctcctggccaccgggctgcacgtccaccgg 600 aacagcgcccacagcgcaggggtgggcgccatctttgacagggtgctgacggagcttgtg 660 tccaagatgcgggacatgcagatggacaagacggagctgggctgcctgcgcgccatcgtc 720 ctctttaaccctgactccaaggggctctcgaacccggccgaggtggaggcgctgagggag 780 aaggtctatgcgtccttggaggcctactgcaagcacaagtacccagagcagccgggaagg 840 ttcgctaagctcttgctccgcctgccggctctgcgctccatcgggctcaaatgcctggaa 900 catctcttcttcttcaagctcatcggggacacacccattgacaccttccttatggagatg 960 ctggaggcgccgcaccaaatgacttaggcctgcgggcccatcctttgtgcccacccgttc 1020 tggccaccctgcctggacgccagctgttcttctcagcctgagccctgtccctgcccttct 1080 ctgcctggcctgtttggactttggggcacagcctgtcactgct 1123 <210> SEQIDNO:36 <211> LENGTH:925 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <220> FEATURE: <221> NAME/KEY:misc_feature <223> OTHERINFORMATION:NovelSequence <400> SEQUENCE:36 aagcgggaagccgtgcaggaggagcggcagcgtggcaaggaccggaacgagaatgaggtg 60 gagtcgaccagcagcgccaacgaggacatgccggtggagaggatcctggaggctgagctg 120 gccgtggagcccaagaccgagacctacgtggaggcaaacatggggctgaaccccagctcg 180 ccgaacgaccctgtcaccaacatttgccaagcagccgacaaacagcttttcaccctggtg 240 gagtgggccaagcggatcccacacttctcagagctgcccctggacgaccaggtcatcctg 300 ctgcgggcaggctggaatgagctgctcatcgcctccttctcccaccgctccatcgccgtg 360 aaggacgggatcctcctggccaccgggctgcacgtccaccggaacagcgcccacagcgca 420 ggggtgggcgccatctttgacagggtgctgacggagcttgtgtccaagatgcgggacatg 480 cagatggacaagacggagctgggctgcctgcgcgccatcgtcctctttaaccctgactcc 540 aaggggctctcgaacccggccgaggtggaggcgctgagggagaaggtctatgcgtccttg 600 gaggcctactgcaagcacaagtacccagagcagccgggaaggttcgctaagctcttgctc 660 cgcctgccggctctgcgctccatcgggctcaaatgcctggaacatctcttcttcttcaag 720 ctcatcggggacacacccattgacaccttccttatggagatgctggaggcgccgcaccaa 780 atgacttaggcctgcgggcccatcctttgtgcccacccgttctggccaccctgcctggac 840 gccagctgttcttctcagcctgagccctgtccctgcccttctctgcctggcctgtttgga 900 ctttggggcacagcctgtcactgct 925 <210> SEQIDNO:37 <211> LENGTH:850 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <220> FEATURE: <221> NAME/KEY:misc_feature <223> OTHERINFORMATION:NovelSequence <400> SEQUENCE:37 gccaacgaggacatgccggtggagaggatcctggaggctgagctggccgtggagcccaag 60 accgagacctacgtggaggcaaacatggggctgaaccccagctcgccgaacgaccctgtc 120 accaacatttgccaagcagccgacaaacagcttttcaccctggtggagtgggccaagcgg 180 atcccacacttctcagagctgcccctggacgaccaggtcatcctgctgcgggcaggctgg 240 aatgagctgctcatcgcctccttctcccaccgctccatcgccgtgaaggacgggatcctc 300 ctggccaccgggctgcacgtccaccggaacagcgcccacagcgcaggggtgggcgccatc 360 tttgacagggtgctgacggagcttgtgtccaagatgcgggacatgcagatggacaagacg 420 gagctgggctgcctgcgcgccatcgtcctctttaaccctgactccaaggggctctcgaac 480 ccggccgaggtggaggcgctgagggagaaggtctatgcgtccttggaggcctactgcaag 540 cacaagtacccagagcagccgggaaggttcgctaagctcttgctccgcctgccggctctg 600 cgctccatcgggctcaaatgcctggaacatctcttcttcttcaagctcatcggggacaca 660 cccattgacaccttccttatggagatgctggaggcgccgcaccaaatgacttaggcctgc 720 gggcccatcctttgtgcccacccgttctggccaccctgcctggacgccagctgttcttct 780 cagcctgagccctgtccctgcccttctctgcctggcctgtttggactttggggcacagcc 840 tgtcactgct 850 <210> SEQIDNO:38 <211> LENGTH:670 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:38 atcccacacttctcagagctgcccctggacgaccaggtcatcctgctgcgggcaggctgg 60 aatgagctgctcatcgcctccttctcccaccgctccatcgccgtgaaggacgggatcctc 120 ctggccaccgggctgcacgtccaccggaacagcgcccacagcgcaggggtgggcgccatc 180 tttgacagggtgctgacggagcttgtgtccaagatgcgggacatgcagatggacaagacg 240 gagctgggctgcctgcgcgccatcgtcctctttaaccctgactccaaggggctctcgaac 300 ccggccgaggtggaggcgctgagggagaaggtctatgcgtccttggaggcctactgcaag 360 cacaagtacccagagcagccgggaaggttcgctaagctcttgctccgcctgccggctctg 420 cgctccatcgggctcaaatgcctggaacatctcttcttcttcaagctcatcggggacaca 480 cccattgacaccttccttatggagatgctggaggcgccgcaccaaatgacttaggcctgc 540 gggcccatcctttgtgcccacccgttctggccaccctgcctggacgccagctgttcttct 600 cagcctgagccctgtccctgcccttctctgcctggcctgtttggactttggggcacagcc 660 tgtcactgct 670 <210> SEQIDNO:39 <211> LENGTH:672 <212> TYPE:DNA <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:39 gccaacgaggacatgccggtggagaggatcctggaggctgagctggccgtggagcccaag 60 accgagacctacgtggaggcaaacatggggctgaaccccagctcgccgaacgaccctgtc 120 accaacatttgccaagcagccgacaaacagcttttcaccctggtggagtgggccaagcgg 180 atcccacacttctcagagctgcccctggacgaccaggtcatcctgctgcgggcaggctgg 240 aatgagctgctcatcgcctccttctcccaccgctccatcgccgtgaaggacgggatcctc 300 ctggccaccgggctgcacgtccaccggaacagcgcccacagcgcaggggtgggcgccatc 360 tttgacagggtgctgacggagcttgtgtccaagatgcgggacatgcagatggacaagacg 420 gagctgggctgcctgcgcgccatcgtcctctttaaccctgactccaaggggctctcgaac 480 ccggccgaggtggaggcgctgagggagaaggtctatgcgtccttggaggcctactgcaag 540 cacaagtacccagagcagccgggaaggttcgctaagctcttgctccgcctgccggctctg 600 cgctccatcgggctcaaatgcctggaacatctcttcttcttcaagctcatcggggacaca 660 cccattgacacc 672 <210> SEQIDNO:40 <211> LENGTH:328 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:40 CysAlaIleCysGlyAspArgSerSerGlyLysHisTyrGlyValTyr SerCysGluGlyCysLysGlyPhePheLysArgThrValArgLysAsp LeuThrTyrThrCysArgAspAsnLysAspCysLeuIleAspLysArg GlnArgAsnArgCysGlnTyrCysArgTyrGlnLysCysLeuAlaMet GlyMetLysArgGluAlaValGlnGluGluArgGlnArgGlyLysAsp ArgAsnGluAsnGluValGluSerThrSerSerAlaAsnGluAspMet ProValGluLysIleLeuGluAlaGluLeuAlaValGluProLysThr GluThrTyrValGluAlaAsnMetGlyLeuAsnProSerSerProAsn AspProValThrAsnIleCysGlnAlaAlaAspLysGlnLeuPheThr LeuValGluTrpAlaLysArgIleProHisPheSerGluLeuProLeu AspAspGlnValIleLeuLeuArgAlaGlyTrpAsnGluLeuLeuIle AlaSerPheSerHisArgSerIleAlaValLysAspGlyIleLeuLeu AlaThrGlyLeuHisValHisArgAsnSerAlaHisSerAlaGlyVal GlyAlaIlePheAspArgValLeuThrGluLeuValSerLysMetArg AspMetGlnMetAspLysThrGluLeuGlyCysLeuArgAlaIleVal LeuPheAsnProAspSerLysGlyLeuSerAsnProAlaGluValGlu AlaLeuArgGluLysValTyrAlaSerLeuGluAlaTyrCysLysHis LysTyrProGluGlnProGlyArgPheAlaLysLeuLeuLeuArgLeu ProAlaLeuArgSerIleGlyLeuLysCysLeuGluHisLeuPhePhe PheLysLeuIleGlyAspThrProIleAspThrPheLeuMetGluMet LeuGluAlaProHisGlnAlaThr 325 <210> SEQIDNO:41 <211> LENGTH:262 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:41 LysArgGluAlaValGlnGluGluArgGlnArgGlyLysAspArgAsn GluAsnGluValGluSerThrSerSerAlaAsnGluAspMetProVal GluLysIleLeuGluAlaGluLeuAlaValGluProLysThrGluThr TyrValGluAlaAsnMetGlyLeuAsnProSerSerProAsnAspPro ValThrAsnIleCysGlnAlaAlaAspLysGlnLeuPheThrLeuVal GluTrpAlaLysArgIleProHisPheSerGluLeuProLeuAspAsp GlnValIleLeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaSer PheSerHisArgSerIleAlaValLysAspGlyIleLeuLeuAlaThr GlyLeuHisValHisArgAsnSerAlaHisSerAlaGlyValGlyAla IlePheAspArgValLeuThrGluLeuValSerLysMetArgAspMet GlnMetAspLysThrGluLeuGlyCysLeuArgAlaIleValLeuPhe AsnProAspSerLysGlyLeuSerAsnProAlaGluValGluAlaLeu ArgGluLysValTyrAlaSerLeuGluAlaTyrCysLysHisLysTyr ProGluGlnProGlyArgPheAlaLysLeuLeuLeuArgLeuProAla LeuArgSerIleGlyLeuLysCysLeuGluHisLeuPhePhePheLys LeuIleGlyAspThrProIleAspThrPheLeuMetGluMetLeuGlu AlaProHisGlnAlaThr 260 <210> SEQIDNO:42 <211> LENGTH:237 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:42 AlaAsnGluAspMetProValGluLysIleLeuGluAlaGluLeuAla ValGluProLysThrGluThrTyrValGluAlaAsnMetGlyLeuAsn ProSerSerProAsnAspProValThrAsnIleCysGlnAlaAlaAsp LysGlnLeuPheThrLeuValGluTrpAlaLysArgIleProHisPhe SerGluLeuProLeuAspAspGlnValIleLeuLeuArgAlaGlyTrp AsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAlaValLys AspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsnSerAla HisSerAlaGlyValGlyAlaIlePheAspArgValLeuThrGluLeu ValSerLysMetArgAspMetGlnMetAspLysThrGluLeuGlyCys LeuArgAlaIleValLeuPheAsnProAspSerLysGlyLeuSerAsn ProAlaGluValGluAlaLeuArgGluLysValTyrAlaSerLeuGlu AlaTyrCysLysHisLysTyrProGluGlnProGlyArgPheAlaLys LeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLysCysLeu GluHisLeuPhePhePheLysLeuIleGlyAspThrProIleAspThr PheLeuMetGluMetLeuGluAlaProHisGlnAlaThr <210> SEQIDNO:43 <211> LENGTH:177 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:43 IleProHisPheSerGluLeuProLeuAspAspGlnValIleLeuLeu ArgAlaGlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArgSer IleAlaValLysAspGlyIleLeuLeuAlaThrGlyLeuHisValHis ArgAsnSerAlaHisSerAlaGlyValGlyAlaIlePheAspArgVal LeuThrGluLeuValSerLysMetArgAspMetGlnMetAspLysThr GluLeuGlyCysLeuArgAlaIleValLeuPheAsnProAspSerLys GlyLeuSerAsnProAlaGluValGluAlaLeuArgGluLysValTyr AlaSerLeuGluAlaTyrCysLysHisLysTyrProGluGlnProGly ArgPheAlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGly LeuLysCysLeuGluHisLeuPhePhePheLysLeuIleGlyAspThr ProIleAspThrPheLeuMetGluMetLeuGluAlaProHisGlnAla Thr <210> SEQIDNO:44 <211> LENGTH:224 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:44 AlaAsnGluAspMetProValGluLysIleLeuGluAlaGluLeuAla ValGluProLysThrGluThrTyrValGluAlaAsnMetGlyLeuAsn ProSerSerProAsnAspProValThrAsnIleCysGlnAlaAlaAsp LysGlnLeuPheThrLeuValGluTrpAlaLysArgIleProHisPhe SerGluLeuProLeuAspAspGlnValIleLeuLeuArgAlaGlyTrp AsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAlaValLys AspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsnSerAla HisSerAlaGlyValGlyAlaIlePheAspArgValLeuThrGluLeu ValSerLysMetArgAspMetGlnMetAspLysThrGluLeuGlyCys LeuArgAlaIleValLeuPheAsnProAspSerLysGlyLeuSerAsn ProAlaGluValGluAlaLeuArgGluLysValTyrAlaSerLeuGlu AlaTyrCysLysHisLysTyrProGluGlnProGlyArgPheAlaLys LeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLysCysLeu GluHisLeuPhePhePheLysLeuIleGlyAspThrProIleAspThr <210> SEQIDNO:45 <211> LENGTH:328 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:45 CysAlaIleCysGlyAspArgSerSerGlyLysHisTyrGlyValTyr SerCysGluGlyCysLysGlyPhePheLysArgThrValArgLysAsp LeuThrTyrThrCysArgAspAsnLysAspCysLeuIleAspLysArg GlnArgAsnArgCysGlnTyrCysArgTyrGlnLysCysLeuAlaMet GlyMetLysArgGluAlaValGlnGluGluArgGlnArgGlyLysAsp ArgAsnGluAsnGluValGluSerThrSerSerAlaAsnGluAspMet ProValGluArgIleLeuGluAlaGluLeuAlaValGluProLysThr GluThrTyrValGluAlaAsnMetGlyLeuAsnProSerSerProAsn AspProValThrAsnIleCysGlnAlaAlaAspLysGlnLeuPheThr LeuValGluTrpAlaLysArgIleProHisPheSerGluLeuProLeu AspAspGlnValIleLeuLeuArgAlaGlyTrpAsnGluLeuLeuIle AlaSerPheSerHisArgSerIleAlaValLysAspGlyIleLeuLeu AlaThrGlyLeuHisValHisArgAsnSerAlaHisSerAlaGlyVal GlyAlaIlePheAspArgValLeuThrGluLeuValSerLysMetArg AspMetGlnMetAspLysThrGluLeuGlyCysLeuArgAlaIleVal LeuPheAsnProAspSerLysGlyLeuSerAsnProAlaGluValGlu AlaLeuArgGluLysValTyrAlaSerLeuGluAlaTyrCysLysHis LysTyrProGluGlnProGlyArgPheAlaLysLeuLeuLeuArgLeu ProAlaLeuArgSerIleGlyLeuLysCysLeuGluHisLeuPhePhe PheLysLeuIleGlyAspThrProIleAspThrPheLeuMetGluMet LeuGluAlaProHisGlnMetThr <210> SEQIDNO:46 <211> LENGTH:262 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:46 LysArgGluAlaValGlnGluGluArgGlnArgGlyLysAspArgAsn GluAsnGluValGluSerThrSerSerAlaAsnGluAspMetProVal GluArgIleLeuGluAlaGluLeuAlaValGluProLysThrGluThr TyrValGluAlaAsnMetGlyLeuAsnProSerSerProAsnAspPro ValThrAsnIleCysGlnAlaAlaAspLysGlnLeuPheThrLeuVal GluTrpAlaLysArgIleProHisPheSerGluLeuProLeuAspAsp GlnValIleLeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaSer PheSerHisArgSerIleAlaValLysAspGlyIleLeuLeuAlaThr GlyLeuHisValHisArgAsnSerAlaHisSerAlaGlyValGlyAla IlePheAspArgValLeuThrGluLeuValSerLysMetArgAspMet GlnMetAspLysThrGluLeuGlyCysLeuArgAlaIleValLeuPhe AsnProAspSerLysGlyLeuSerAsnProAlaGluValGluAlaLeu ArgGluLysValTyrAlaSerLeuGluAlaTyrCysLysHisLysTyr ProGluGlnProGlyArgPheAlaLysLeuLeuLeuArgLeuProAla LeuArgSerIleGlyLeuLysCysLeuGluHisLeuPhePhePheLys LeuIleGlyAspThrProIleAspThrPheLeuMetGluMetLeuGlu AlaProHisGlnMetThr <210> SEQIDNO:47 <211> LENGTH:237 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:47 AlaAsnGluAspMetProValGluArgIleLeuGluAlaGluLeuAla ValGluProLysThrGluThrTyrValGluAlaAsnMetGlyLeuAsn ProSerSerProAsnAspProValThrAsnIleCysGlnAlaAlaAsp LysGlnLeuPheThrLeuValGluTrpAlaLysArgIleProHisPhe SerGluLeuProLeuAspAspGlnValIleLeuLeuArgAlaGlyTrp AsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAlaValLys AspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsnSerAla HisSerAlaGlyValGlyAlaIlePheAspArgValLeuThrGluLeu ValSerLysMetArgAspMetGlnMetAspLysThrGluLeuGlyCys LeuArgAlaIleValLeuPheAsnProAspSerLysGlyLeuSerAsn ProAlaGluValGluAlaLeuArgGluLysValTyrAlaSerLeuGlu AlaTyrCysLysHisLysTyrProGluGlnProGlyArgPheAlaLys LeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLysCysLeu GluHisLeuPhePhePheLysLeuIleGlyAspThrProIleAspThr PheLeuMetGluMetLeuGluAlaProHisGlnMetThr <210> SEQIDNO:48 <211> LENGTH:177 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <<221> NAME/KEY:misc_feature <400> SEQUENCE:48 IleProHisPheSerGluLeuProLeuAspAspGlnValIleLeuLeu ArgAlaGlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArgSer IleAlaValLysAspGlyIleLeuLeuAlaThrGlyLeuHisValHis ArgAsnSerAlaHisSerAlaGlyValGlyAlaIlePheAspArgVal LeuThrGluLeuValSerLysMetArgAspMetGlnMetAspLysThr GluLeuGlyCysLeuArgAlaIleValLeuPheAsnProAspSerLys GlyLeuSerAsnProAlaGluValGluAlaLeuArgGluLysValTyr AlaSerLeuGluAlaTyrCysLysHisLysTyrProGluGlnProGly ArgPheAlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGly LeuLysCysLeuGluHisLeuPhePhePheLysLeuIleGlyAspThr ProIleAspThrPheLeuMetGluMetLeuGluAlaProHisGlnMet Thr <210> SEQIDNO:49 <211> LENGTH:224 <212> TYPE:PRT <213> ORGANISM:ArtificialSequence <221> NAME/KEY:misc_feature <400> SEQUENCE:49 AlaAsnGluAspMetProValGluArgIleLeuGluAlaGluLeuAla ValGluProLysThrGluThrTyrValGluAlaAsnMetGlyLeuAsn ProSerSerProAsnAspProValThrAsnIleCysGlnAlaAlaAsp LysGlnLeuPheThrLeuValGluTrpAlaLysArgIleProHisPhe SerGluLeuProLeuAspAspGlnValIleLeuLeuArgAlaGlyTrp AsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAlaValLys AspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsnSerAla HisSerAlaGlyValGlyAlaIlePheAspArgValLeuThrGluLeu ValSerLysMetArgAspMetGlnMetAspLysThrGluLeuGlyCys LeuArgAlaIleValLeuPheAsnProAspSerLysGlyLeuSerAsn ProAlaGluValGluAlaLeuArgGluLysValTyrAlaSerLeuGlu AlaTyrCysLysHisLysTyrProGluGlnProGlyArgPheAlaLys LeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLysCysLeu GluHisLeuPhePhePheLysLeuIleGlyAspThrProIleAspThr <210> SEQIDNO:50 <211> LENGTH:635 <212> TYPE:DNA <213> ORGANISM:Locustamigratoria <400> SEQUENCE:50 tgcatacagacatgcctgttgaacgcatacttgaagctgaaaaacgagtggagtgcaaag 60 cagaaaaccaagtggaatatgagctggtggagtgggctaaacacatcccgcacttcacat 120 ccctacctctggaggaccaggttctcctcctcagagcaggttggaatgaactgctaattg 180 cagcattttcacatcgatctgtagatgttaaagatggcatagtacttgccactggtctca 240 cagtgcatcgaaattctgcccatcaagctggagtcggcacaatatttgacagagttttga 300 cagaactggtagcaaagatgagagaaatgaaaatggataaaactgaacttggctgcttgc 360 gatctgttattcttttcaatccagaggtgaggggtttgaaatccgcccaggaagttgaac 420 ttctacgtgaaaaagtatatgccgctttggaagaatatactagaacaacacatcccgatg 480 aaccaggaagatttgcaaaacttttgcttcgtctgccttctttacgttccataggcctta 540 agtgtttggagcatttgtttttctttcgccttattggagatgttccaattgatacgttcc 600 tgatggagatgcttgaatcaccttctgattcataa 635 <210> SEQIDNO:51 <211> LENGTH:687 <212> TYPE:DNA <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:51 cctcctgagatgcctctggagcgcatactggaggcagagctgcgggttgagtcacagacg 60 gggaccctctcggaaagcgcacagcagcaggatccagtgagcagcatctgccaagctgca 120 gaccgacagctgcaccagctagttcaatgggccaagcacattccacattttgaagagctt 180 ccccttgaggaccgcatggtgttgctcaaggctggctggaacgagctgctcattgctgct 240 ttctcccaccgttctgttgacgtgcgtgatggcattgtgctcgctacaggtcttgtggtg 300 cagcggcatagtgctcatggggctggcgttggggccatatttgatagggttctcactgaa 360 ctggtagcaaagatgcgtgagatgaagatggaccgcactgagcttggatgcctgcttgct 420 gtggtactttttaatcctgaggccaaggggctgcggacctgcccaagtggaggccctgag 480 ggagaaagtgtatctgccttggaagagcactgccggcagcagtacccagaccagcctggg 540 cgctttgccaagctgctgctgcggttgccagctctgcgcagtattggcctcaagtgcctc 600 gaacatctctttttcttcaagctcatcggggacacgcccatcgacaactttcttctttcc 660 atgctggaggccccctctgacccctaa 687 <210> SEQIDNO:52 <211> LENGTH:693 <212> TYPE:DNA <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:52 tctccggacatgccactcgaacgcattctcgaagccgagatgcgcgtcgagcagccggca 60 ccgtccgttttggcgcagacggccgcatcgggccgcgaccccgtcaacagcatgtgccag 120 gctgccccgccacttcacgagctcgtacagtgggcccggcgaattccgcacttcgaagag 180 cttcccatcgaggatcgcaccgcgctgctcaaagccggctggaacgaactgcttattgcc 240 gccttttcgcaccgttctgtggcggtgcgcgacggcatcgttctggccaccgggctggtg 300 gtgcagcggcacagcgcacacggcgcaggcgttggcgacatcttcgaccgcgtactagcc 360 gagctggtggccaagatgcgcgacatgaagatggacaaaacggagctcggctgcctgcgc 420 gccgtggtgctcttcaatccagacgccaagggtctccgaaacgccaccagagtagaggcg 480 ctccgcgagaaggtgtatgcggcgctggaggagcactgccgtcggcaccacccggaccaa 540 ccgggtcgcttcggcaagctgctgctgcggctgcctgccttgcgcagcatcgggctcaaa 600 tgcctcgagcatctgttcttcttcaagctcatcggagacactcccatagacagcttcctg 660 ctcaacatgctggaggcaccggcagacccctag 693 <210> SEQIDNO:53 <211> LENGTH:801 <212> TYPE:DNA <213> ORGANISM:Celucapugilator <400> SEQUENCE:53 tcagacatgccaattgccagcatacgggaggcagagctcagcgtggatcccatagatgag 60 cagccgctggaccaaggggtgaggcttcaggttccactcgcacctcctgatagtgaaaag 120 tgtagctttactttaccttttcatcccgtcagtgaagtatcctgtgctaaccctctgcag 180 gatgtggtgagcaacatatgccaggcagctgacagacatctggtgcagctggtggagtgg 240 gccaagcacatcccacacttcacagaccttcccatagaggaccaagtggtattactcaaa 300 gccgggtggaacgagttgcttattgcctcattctcacaccgtagcatgggcgtggaggat 360 ggcatcgtgctggccacagggctcgtgatccacagaagtagtgctcaccaggctggagtg 420 ggtgccatatttgatcgtgtcctctctgagctggtggccaagatgaaggagatgaagatt 480 gacaagacagagctgggctgccttcgctccatcgtcctgttcaacccagatgccaaagga 540 ctaaactgcgtcaatgatgtggagatcttgcgtgagaaggtgtatgctgccctggaggag 600 tacacacgaaccacttaccctgatgaacctggacgctttgccaagttgcttctgcgactt 660 cctgcactcaggtctataggcctgaagtgtcttgagtacctcttcctgtttaagctgatt 720 ggagacactcccctggacagctacttgatgaagatgctcgtagacaacccaaatacaagc 780 gtcactccccccaccagctag 801 <210> SEQIDNO:54 <211> LENGTH:690 <212> TYPE:DNA <213> ORGANISM:Tenebriomolitor <400> SEQUENCE:54 gccgagatgcccctcgacaggataatcgaggcggagaaacggatagaatgcacacccgct 60 ggtggctctggtggtgtcggagagcaacacgacggggtgaacaacatctgtcaagccact 120 aacaagcagctgttccaactggtgcaatgggctaagctcatacctcactttacctcgttg 180 ccgatgtcggaccaggtgcttttattgagggcaggatggaatgaattgctcatcgccgca 240 ttctcgcacagatctatacaggcgcaggatgccatcgttctagccacggggttgacagtt 300 aacaaaacgtcggcgcacgccgtgggcgtgggcaacatctacgaccgcgtcctctccgag 360 ctggtgaacaagatgaaagagatgaagatggacaagacggagctgggctgcttgagagcc 420 atcatcctctacaaccccacgtgtcgcggcatcaagtccgtgcaggaagtggagatgctg 480 cgtgagaaaatttacggcgtgctggaagagtacaccaggaccacccacccgaacgagccc 540 ggcaggttcgccaaactgcttctgcgcctcccggccctcaggtccatcgggttgaaatgt 600 tccgaacacctctttttcttcaagctgatcggtgatgttccaatagacacgttcctgatg 660 gagatgctggagtctccggcggacgcttag 690 <210> SEQIDNO:55 <211> LENGTH:681 <212> TYPE:DNA <213> ORGANISM:Apismellifera <400> SEQUENCE:55 cattcggacatgccgatcgagcgtatcctggaggccgagaagagagtcgaatgtaagatg 60 gagcaacagggaaattacgagaatgcagtgtcgcacatttgcaacgccacgaacaaacag 120 ctgttccagctggtagcatgggcgaaacacatcccgcattttacctcgttgccactggag 180 gatcaggtacttctgctcagggccggttggaacgagttgctgatagcctccttttcccac 240 cgttccatcgacgtgaaggacggtatcgtgctggcgacggggatcaccgtgcatcggaac 300 tcggcgcagcaggccggcgtgggcacgatattcgaccgtgtcctctcggagcttgtctcg 360 aaaatgcgtgaaatgaagatggacaggacagagcttggctgtctcagatctataatactc 420 ttcaatcccgaggttcgaggactgaaatccatccaggaagtgaccctgctccgtgagaag 480 atctacggcgccctggagggttattgccgcgtagcttggcccgacgacgctggaagattc 540 gcgaaattacttctacgcctgcccgccatccgctcgatcggattaaagtgcctcgagtac 600 ctgttcttcttcaaaatgatcggtgacgtaccgatcgacgattttctcgtggagatgtta 660 gaatcgcgatcagatccttag 681 <210> SEQIDNO:56 <211> LENGTH:210 <212> TYPE:PRT <213> ORGANISM:Locustamigratoria <400> SEQUENCE:56 HisThrAspMetProValGluArgIleLeuGluAlaGluLysArgVal GluCysLysAlaGluAsnGlnValGluTyrGluLeuValGluTrpAla LysHisIleProHisPheThrSerLeuProLeuGluAspGlnValLeu LeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaAlaPheSerHis ArgSerValAspValLysAspGlyIleValLeuAlaThrGlyLeuThr ValHisArgAsnSerAlaHisGlnAlaGlyValGlyThrIlePheAsp ArgValLeuThrGluLeuValAlaLysMetArgGluMetLysMetAsp LysThrGluLeuGlyCysLeuArgSerValIleLeuPheAsnProGlu ValArgGlyLeuLysSerAlaGlnGluValGluLeuLeuArgGluLys ValTyrAlaAlaLeuGluGluTyrThrArgThrThrHisProAspGlu ProGlyArgPheAlaLysLeuLeuLeuArgLeuProSerLeuArgSer IleGlyLeuLysCysLeuGluHisLeuPhePhePheArgLeuIleGly AspValProIleAspThrPheLeuMetGluMetLeuGluSerProSer AspSer <210> SEQIDNO:57 <211> LENGTH:228 <212> TYPE:PRT <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:57 ProProGluMetProLeuGluArgIleLeuGluAlaGluLeuArgVal GluSerGlnThrGlyThrLeuSerGluSerAlaGlnGlnGlnAspPro ValSerSerIleCysGlnAlaAlaAspArgGlnLeuHisGlnLeuVal GlnTrpAlaLysHisIleProHisPheGluGluLeuProLeuGluAsp ArgMetValLeuLeuLysAlaGlyTrpAsnGluLeuLeuIleAlaAla PheSerHisArgSerValAspValArgAspGlyIleValLeuAlaThr GlyLeuValValGlnArgHisSerAlaHisGlyAlaGlyValGlyAla IlePheAspArgValLeuThrGluLeuValAlaLysMetArgGluMet LysMetAspArgThrGluLeuGlyCysLeuLeuAlaValValLeuPhe AsnProGluAlaLysGlyLeuArgThrCysProSerGlyGlyProGlu GlyGluSerValSerAlaLeuGluGluHisCysArgGlnGlnTyrPro AspGlnProGlyArgPheAlaLysLeuLeuLeuArgLeuProAlaLeu ArgSerIleGlyLeuLysCysLeuGluHisLeuPhePhePheLysLeu IleGlyAspThrProIleAspAsnPheLeuLeuSerMetLeuGluAla ProSerAspPro <210> SEQIDNO:58 <211> LENGTH:230 <212> TYPE:PRT <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:58 SerProAspMetProLeuGluArgIleLeuGluAlaGluMetArgVal GluGlnProAlaProSerValLeuAlaGlnThrAlaAlaSerGlyArg AspProValAsnSerMetCysGlnAlaAlaProProLeuHisGluLeu ValGlnTrpAlaArgArgIleProHisPheGluGluLeuProIleGlu AspArgThrAlaLeuLeuLysAlaGlyTrpAsnGluLeuLeuIleAla AlaPheSerHisArgSerValAlaValArgAspGlyIleValLeuAla ThrGlyLeuValValGlnArgHisSerAlaHisGlyAlaGlyValGly AspIlePheAspArgValLeuAlaGluLeuValAlaLysMetArgAsp MetLysMetAspLysThrGluLeuGlyCysLeuArgAlaValValLeu PheAsnProAspAlaLysGlyLeuArgAsnAlaThrArgValGluAla LeuArgGluLysValTyrAlaAlaLeuGluGluHisCysArgArgHis HisProAspGlnProGlyArgPheGlyLysLeuLeuLeuArgLeuPro AlaLeuArgSerIleGlyLeuLysCysLeuGluHisLeuPhePhePhe LysLeuIleGlyAspThrProIleAspSerPheLeuLeuAsnMetLeu GluAlaProAlaAspPro <210> SEQIDNO:59 <211> LENGTH:266 <212> TYPE:PRT <213> ORGANISM:Celucapugilator <400> SEQUENCE:59 SerAspMetProIleAlaSerIleArgGluAlaGluLeuSerValAsp ProIleAspGluGlnProLeuAspGlnGlyValArgLeuGlnValPro LeuAlaProProAspSerGluLysCysSerPheThrLeuProPheHis ProValSerGluValSerCysAlaAsnProLeuGlnAspValValSer AsnIleCysGlnAlaAlaAspArgHisLeuValGlnLeuValGluTrp AlaLysHisIleProHisPheThrAspLeuProIleGluAspGlnVal ValLeuLeuLysAlaGlyTrpAsnGluLeuLeuIleAlaSerPheSer HisArgSerMetGlyValGluAspGlyIleValLeuAlaThrGlyLeu ValIleHisArgSerSerAlaHisGlnAlaGlyValGlyAlaIlePhe AspArgValLeuSerGluLeuValAlaLysMetLysGluMetLysIle AspLysThrGluLeuGlyCysLeuArgSerIleValLeuPheAsnPro AspAlaLysGlyLeuAsnCysValAsnAspValGluIleLeuArgGlu LysValTyrAlaAlaLeuGluGluTyrThrArgThrThrTyrProAsp GluProGlyArgPheAlaLysLeuLeuLeuArgLeuProAlaLeuArg SerIleGlyLeuLysCysLeuGluTyrLeuPheLeuPheLysLeuIle GlyAspThrProLeuAspSerTyrLeuMetLysMetLeuValAspAsn ProAsnThrSerValThrProProThrSer <210> SEQIDNO:60 <211> LENGTH:229 <212> TYPE:PRT <213> ORGANISM:Tenebriomolitor <400> SEQUENCE:60 AlaGluMetProLeuAspArgIleIleGluAlaGluLysArgIleGlu CysThrProAlaGlyGlySerGlyGlyValGlyGluGlnHisAspGly ValAsnAsnIleCysGlnAlaThrAsnLysGlnLeuPheGlnLeuVal GlnTrpAlaLysLeuIleProHisPheThrSerLeuProMetSerAsp GlnValLeuLeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaAla PheSerHisArgSerIleGlnAlaGlnAspAlaIleValLeuAlaThr GlyLeuThrValAsnLysThrSerAlaHisAlaValGlyValGlyAsn IleTyrAspArgValLeuSerGluLeuValAsnLysMetLysGluMet LysMetAspLysThrGluLeuGlyCysLeuArgAlaIleIleLeuTyr AsnProThrCysArgGlyIleLysSerValGlnGluValGluMetLeu ArgGluLysIleTyrGlyValLeuGluGluTyrThrArgThrThrHis ProAsnGluProGlyArgPheAlaLysLeuLeuLeuArgLeuProAla LeuArgSerIleGlyLeuLysCysSerGluHisLeuPhePhePheLys LeuIleGlyAspValProIleAspThrPheLeuMetGluMetLeuGlu SerProAlaAspAla <210> SEQIDNO:61 <211> LENGTH:226 <212> TYPE:PRT <213> ORGANISM:Apismellifera <400> SEQUENCE:61 HisSerAspMetProIleGluArgIleLeuGluAlaGluLysArgVal GluCysLysMetGluGlnGlnGlyAsnTyrGluAsnAlaValSerHis IleCysAsnAlaThrAsnLysGlnLeuPheGlnLeuValAlaTrpAla LysHisIleProHisPheThrSerLeuProLeuGluAspGlnValLeu LeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaSerPheSerHis ArgSerIleAspValLysAspGlyIleValLeuAlaThrGlyIleThr ValHisArgAsnSerAlaGlnGlnAlaGlyValGlyThrIlePheAsp ArgValLeuSerGluLeuValSerLysMetArgGluMetLysMetAsp ArgThrGluLeuGlyCysLeuArgSerIleIleLeuPheAsnProGlu ValArgGlyLeuLysSerIleGlnGluValThrLeuLeuArgGluLys IleTyrGlyAlaLeuGluGlyTyrCysArgValAlaTrpProAspAsp AlaGlyArgPheAlaLysLeuLeuLeuArgLeuProAlaIleArgSer IleGlyLeuLysCysLeuGluTyrLeuPhePhePheLysMetIleGly AspValProIleAspAspPheLeuValGluMetLeuGluSerArgSer AspPro <210> SEQIDNO:62 <211> LENGTH:714 <212> TYPE:DNA <213> ORGANISM:Musmusculus <400> SEQUENCE:62 gccaacgaggacatgcctgtagagaagattctggaagccgagcttgctgtcgagcccaag 60 actgagacatacgtggaggcaaacatggggctgaaccccagctcaccaaatgaccctgtt 120 accaacatctgtcaagcagcagacaagcagctcttcactcttgtggagtgggccaagagg 180 atcccacacttttctgagctgcccctagacgaccaggtcatcctgctacgggcaggctgg 240 aacgagctgctgatcgcctccttctcccaccgctccatagctgtgaaagatgggattctc 300 ctggccaccggcctgcacgtacaccggaacagcgctcacagtgctggggtgggcgccatc 360 tttgacagggtgctaacagagctggtgtctaagatgcgtgacatgcagatggacaagacg 420 gagctgggctgcctgcgagccattgtcctgttcaaccctgactctaaggggctctcaaac 480 cctgctgaggtggaggcgttgagggagaaggtgtatgcgtcactagaagcgtactgcaaa 540 cacaagtaccctgagcagccgggcaggtttgccaagctgctgctccgcctgcctgcactg 600 cgttccatcgggctcaagtgcctggagcacctgttcttcttcaagctcatcggggacacg 660 cccatcgacaccttcctcatggagatgctggaggcaccacatcaagccacctag 714 <210> SEQIDNO:63 <211> LENGTH:720 <212> TYPE:DNA <213> ORGANISM:Musmusculus <400> SEQUENCE:63 gcccctgaggagatgcctgtggacaggatcctggaggcagagcttgctgtggagcagaag 60 agtgaccaaggcgttgagggtcctggggccaccgggggtggtggcagcagcccaaatgac 120 ccagtgactaacatctgccaggcagctgacaaacagctgttcacactcgttgagtgggca 180 aagaggatcccgcacttctcctccctacctctggacgatcaggtcatactgctgcgggca 240 ggctggaacgagctcctcattgcgtccttctcccatcggtccattgatgtccgagatggc 300 atcctcctggccacgggtcttcatgtgcacagaaactcagcccattccgcaggcgtggga 360 gccatctttgatcgggtgctgacagagctagtgtccaaaatgcgtgacatgaggatggac 420 aagacagagcttggctgcctgcgggcaatcatcatgtttaatccagacgccaagggcctc 480 tccaaccctggagaggtggagatccttcgggagaaggtgtacgcctcactggagacctat 540 tgcaagcagaagtaccctgagcagcagggccggtttgccaagctgctgttacgtcttcct 600 gccctccgctccatcggcctcaagtgtctggagcacctgttcttcttcaagctcattggc 660 gacacccccattgacaccttcctcatggagatgcttgaggctccccaccagctagcctga 720 <210> SEQIDNO:64 <211> LENGTH:705 <212> TYPE:DNA <213> ORGANISM:Musmusculus <400> SEQUENCE:64 agccacgaagacatgcccgtggagaggattctagaagccgaacttgctgtggaaccaaag 60 acagaatcctacggtgacatgaacgtggagaactcaacaaatgaccctgttaccaacata 120 tgccatgctgcagataagcaacttttcaccctcgttgagtgggccaaacgcatcccccac 180 ttctcagatctcaccttggaggaccaggtcattctactccgggcagggtggaatgaactg 240 ctcattgcctccttctcccaccgctcggtttccgtccaggatggcatcctgctggccacg 300 ggcctccacgtgcacaggagcagcgctcacagccggggagtcggctccatcttcgacaga 360 gtccttacagagttggtgtccaagatgaaagacatgcagatggataagtcagagctgggg 420 tgcctacgggccatcgtgctgtttaacccagatgccaagggtttatccaacccctctgag 480 gtggagactcttcgagagaaggtttatgccaccctggaggcctataccaagcagaagtat 540 ccggaacagccaggcaggtttgccaagcttctgctgcgtctccctgctctgcgctccatc 600 ggcttgaaatgcctggaacacctcttcttcttcaagctcattggagacactcccatcgac 660 agcttcctcatggagatgttggagaccccactgcagatcacctga 705 <210> SEQIDNO:65 <211> LENGTH:850 <212> TYPE:DNA <213> ORGANISM:Homosapiens <400> SEQUENCE:65 gccaacgaggacatgccggtggagaggatcctggaggctgagctggccgtggagcccaag 60 accgagacctacgtggaggcaaacatggggctgaaccccagctcgccgaacgaccctgtc 120 accaacatttgccaagcagccgacaaacagcttttcaccctggtggagtgggccaagcgg 180 atcccacacttctcagagctgcccctggacgaccaggtcatcctgctgcgggcaggctgg 240 aatgagctgctcatcgcctccttctcccaccgctccatcgccgtgaaggacgggatcctc 300 ctggccaccgggctgcacgtccaccggaacagcgcccacagcgcaggggtgggcgccatc 360 tttgacagggtgctgacggagcttgtgtccaagatgcgggacatgcagatggacaagacg 420 gagctgggctgcctgcgcgccatcgtcctctttaaccctgactccaaggggctctcgaac 480 ccggccgaggtggaggcgctgagggagaaggtctatgcgtccttggaggcctactgcaag 540 cacaagtacccagagcagccgggaaggttcgctaagctcttgctccgcctgccggctctg 600 cgctccatcgggctcaaatgcctggaacatctcttcttcttcaagctcatcggggacaca 660 cccattgacaccttccttatggagatgctggaggcgccgcaccaaatgacttaggcctgc 720 gggcccatcctttgtgcccacccgttctggccaccctgcctggacgccagctgttcttct 780 cagcctgagccctgtccctgcccttctctgcctggcctgtttggactttggggcacagcc 840 tgtcactgct 850 <210> SEQIDNO:66 <211> LENGTH:720 <212> TYPE:DNA <213> ORGANISM:Homosapiens <400> SEQUENCE:66 gcccccgaggagatgcctgtggacaggatcctggaggcagagcttgctgtggaacagaag 60 agtgaccagggcgttgagggtcctgggggaaccgggggtagcggcagcagcccaaatgac 120 cctgtgactaacatctgtcaggcagctgacaaacagctattcacgcttgttgagtgggcg 180 aagaggatcccacacttttcctccttgcctctggatgatcaggtcatattgctgcgggca 240 ggctggaatgaactcctcattgcctccttttcacaccgatccattgatgttcgagatggc 300 atcctccttgccacaggtcttcacgtgcaccgcaactcagcccattcagcaggagtagga 360 gccatctttgatcgggtgctgacagagctagtgtccaaaatgcgtgacatgaggatggac 420 aagacagagcttggctgcctgagggcaatcattctgtttaatccagatgccaagggcctc 480 tccaaccctagtgaggtggaggtcctgcgggagaaagtgtatgcatcactggagacctac 540 tgcaaacagaagtaccctgagcagcagggacggtttgccaagctgctgctacgtcttcct 600 gccctccggtccattggccttaagtgtctagagcatctgtttttcttcaagctcattggt 660 gacacccccatcgacaccttcctcatggagatgcttgaggctccccatcaactggcctga 720 <210> SEQIDNO:67 <211> LENGTH:705 <212> TYPE:DNA <213> ORGANISM:Homosapiens <400> SEQUENCE:67 ggtcatgaagacatgcctgtggagaggattctagaagctgaacttgctgttgaaccaaag 60 acagaatcctatggtgacatgaatatggagaactcgacaaatgaccctgttaccaacata 120 tgtcatgctgctgacaagcagcttttcaccctcgttgaatgggccaagcgtattccccac 180 ttctctgacctcaccttggaggaccaggtcattttgcttcgggcagggtggaatgaattg 240 ctgattgcctctttctcccaccgctcagtttccgtgcaggatggcatccttctggccacg 300 ggtttacatgtccaccggagcagtgcccacagtgctggggtcggctccatctttgacaga 360 gttctaactgagctggtttccaaaatgaaagacatgcagatggacaagtcggaactggga 420 tgcctgcgagccattgtactctttaacccagatgccaagggcctgtccaacccctctgag 480 gtggagactctgcgagagaaggtttatgccacccttgaggcctacaccaagcagaagtat 540 ccggaacagccaggcaggtttgccaagctgctgctgcgcctcccagctctgcgttccatt 600 ggcttgaaatgcctggagcacctcttcttcttcaagctcatcggggacacccccattgac 660 accttcctcatggagatgttggagaccccgctgcagatcacctga 705 <210> SEQIDNO:68 <211> LENGTH:237 <212> TYPE:PRT <213> ORGANISM:Musmusculus <400> SEQUENCE:68 AlaAsnGluAspMetProValGluLysIleLeuGluAlaGluLeuAla ValGluProLysThrGluThrTyrValGluAlaAsnMetGlyLeuAsn ProSerSerProAsnAspProValThrAsnIleCysGlnAlaAlaAsp LysGlnLeuPheThrLeuValGluTrpAlaLysArgIleProHisPhe SerGluLeuProLeuAspAspGlnValIleLeuLeuArgAlaGlyTrp AsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAlaValLys AspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsnSerAla HisSerAlaGlyValGlyAlaIlePheAspArgValLeuThrGluLeu ValSerLysMetArgAspMetGlnMetAspLysThrGluLeuGlyCys LeuArgAlaIleValLeuPheAsnProAspSerLysGlyLeuSerAsn ProAlaGluValGluAlaLeuArgGluLysValTyrAlaSerLeuGlu AlaTyrCysLysHisLysTyrProGluGlnProGlyArgPheAlaLys LeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLysCysLeu GluHisLeuPhePhePheLysLeuIleGlyAspThrProIleAspThr PheLeuMetGluMetLeuGluAlaProHisGlnAlaThr <210> SEQIDNO:69 <211> LENGTH:239 <212> TYPE:PRT <213> ORGANISM:Musmusculus <400> SEQUENCE:69 AlaProGluGluMetProValAspArgIleLeuGluAlaGluLeuAla ValGluGlnLysSerAspGlnGlyValGluGlyProGlyAlaThrGly GlyGlyGlySerSerProAsnAspProValThrAsnIleCysGlnAla AlaAspLysGlnLeuPheThrLeuValGluTrpAlaLysArgIlePro HisPheSerSerLeuProLeuAspAspGlnValIleLeuLeuArgAla GlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAsp ValArgAspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsn SerAlaHisSerAlaGlyValGlyAlaIlePheAspArgValLeuThr GluLeuValSerLysMetArgAspMetArgMetAspLysThrGluLeu GlyCysLeuArgAlaIleIleMetPheAsnProAspAlaLysGlyLeu SerAsnProGlyGluValGluIleLeuArgGluLysValTyrAlaSer LeuGluThrTyrCysLysGlnLysTyrProGluGlnGlnGlyArgPhe AlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLys CysLeuGluHisLeuPhePhePheLysLeuIleGlyAspThrProIle AspThrPheLeuMetGluMetLeuGluAlaProHisGlnLeuAla <210> SEQIDNO:70 <211> LENGTH:234 <212> TYPE:PRT <213> ORGANISM:Musmusculus <400> SEQUENCE:70 SerHisGluAspMetProValGluArgIleLeuGluAlaGluLeuAla ValGluProLysThrGluSerTyrGlyAspMetAsnValGluAsnSer ThrAsnAspProValThrAsnIleCysHisAlaAlaAspLysGlnLeu PheThrLeuValGluTrpAlaLysArgIleProHisPheSerAspLeu ThrLeuGluAspGlnValIleLeuLeuArgAlaGlyTrpAsnGluLeu LeuIleAlaSerPheSerHisArgSerValSerValGlnAspGlyIle LeuLeuAlaThrGlyLeuHisValHisArgSerSerAlaHisSerArg GlyValGlySerIlePheAspArgValLeuThrGluLeuValSerLys MetLysAspMetGlnMetAspLysSerGluLeuGlyCysLeuArgAla IleValLeuPheAsnProAspAlaLysGlyLeuSerAsnProSerGlu ValGluThrLeuArgGluLysValTyrAlaThrLeuGluAlaTyrThr LysGlnLysTyrProGluGlnProGlyArgPheAlaLysLeuLeuLeu ArgLeuProAlaLeuArgSerIleGlyLeuLysCysLeuGluHisLeu PhePhePheLysLeuIleGlyAspThrProIleAspSerPheLeuMet GluMetLeuGluThrProLeuGlnIleThr <210> SEQIDNO:71 <211> LENGTH:237 <212> TYPE:PRT <213> ORGANISM:Homosapiens <400> SEQUENCE:71 AlaAsnGluAspMetProValGluArgIleLeuGluAlaGluLeuAla ValGluProLysThrGluThrTyrValGluAlaAsnMetGlyLeuAsn ProSerSerProAsnAspProValThrAsnIleCysGlnAlaAlaAsp LysGlnLeuPheThrLeuValGluTrpAlaLysArgIleProHisPhe SerGluLeuProLeuAspAspGlnValIleLeuLeuArgAlaGlyTrp AsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAlaValLys AspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsnSerAla HisSerAlaGlyValGlyAlaIlePheAspArgValLeuThrGluLeu ValSerLysMetArgAspMetGlnMetAspLysThrGluLeuGlyCys LeuArgAlaIleValLeuPheAsnProAspSerLysGlyLeuSerAsn ProAlaGluValGluAlaLeuArgGluLysValTyrAlaSerLeuGlu AlaTyrCysLysHisLysTyrProGluGlnProGlyArgPheAlaLys LeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLysCysLeu GluHisLeuPhePhePheLysLeuIleGlyAspThrProIleAspThr PheLeuMetGluMetLeuGluAlaProHisGlnMetThr <210> SEQIDNO:72 <211> LENGTH:239 <212> TYPE:PRT <213> ORGANISM:Homosapiens <400> SEQUENCE:72 AlaProGluGluMetProValAspArgIleLeuGluAlaGluLeuAla ValGluGlnLysSerAspGlnGlyValGluGlyProGlyGlyThrGly GlySerGlySerSerProAsnAspProValThrAsnIleCysGlnAla AlaAspLysGlnLeuPheThrLeuValGluTrpAlaLysArgIlePro HisPheSerSerLeuProLeuAspAspGlnValIleLeuLeuArgAla GlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArgSerIleAsp ValArgAspGlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsn SerAlaHisSerAlaGlyValGlyAlaIlePheAspArgValLeuThr GluLeuValSerLysMetArgAspMetArgMetAspLysThrGluLeu GlyCysLeuArgAlaIleIleLeuPheAsnProAspAlaLysGlyLeu SerAsnProSerGluValGluValLeuArgGluLysValTyrAlaSer LeuGluThrTyrCysLysGlnLysTyrProGluGlnGlnGlyArgPhe AlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeuLys CysLeuGluHisLeuPhePhePheLysLeuIleGlyAspThrProIle AspThrPheLeuMetGluMetLeuGluAlaProHisGlnLeuAla <210> SEQIDNO:73 <211> LENGTH:234 <212> TYPE:PRT <213> ORGANISM:Homosapiens <400> SEQUENCE:73 GlyHisGluAspMetProValGluArgIleLeuGluAlaGluLeuAla ValGluProLysThrGluSerTyrGlyAspMetAsnMetGluAsnSer ThrAsnAspProValThrAsnIleCysHisAlaAlaAspLysGlnLeu PheThrLeuValGluTrpAlaLysArgIleProHisPheSerAspLeu ThrLeuGluAspGlnValIleLeuLeuArgAlaGlyTrpAsnGluLeu LeuIleAlaSerPheSerHisArgSerValSerValGlnAspGlyIle LeuLeuAlaThrGlyLeuHisValHisArgSerSerAlaHisSerAla GlyValGlySerIlePheAspArgValLeuThrGluLeuValSerLys MetLysAspMetGlnMetAspLysSerGluLeuGlyCysLeuArgAla IleValLeuPheAsnProAspAlaLysGlyLeuSerAsnProSerGlu ValGluThrLeuArgGluLysValTyrAlaThrLeuGluAlaTyrThr LysGlnLysTyrProGluGlnProGlyArgPheAlaLysLeuLeuLeu ArgLeuProAlaLeuArgSerIleGlyLeuLysCysLeuGluHisLeu PhePhePheLysLeuIleGlyAspThrProIleAspThrPheLeuMet GluMetLeuGluThrProLeuGlnIleThr <210> SEQIDNO:74 <211> LENGTH:516 <212> TYPE:DNA <213> ORGANISM:Locustamigratoria <400> SEQUENCE:74 atccctacctctggaggaccaggttctcctcctcagagcaggttggaatgaactgctaat 60 tgcagcattttcacatcgatctgtagatgttaaagatggcatagtacttgccactggtct 120 cacagtgcatcgaaattctgcccatcaagctggagtcggcacaatatttgacagagtttt 180 gacagaactggtagcaaagatgagagaaatgaaaatggataaaactgaacttggctgctt 240 gcgatctgttattcttttcaatccagaggtgaggggtttgaaatccgcccaggaagttga 300 acttctacgtgaaaaagtatatgccgctttggaagaatatactagaacaacacatcccga 360 tgaaccaggaagatttgcaaaacttttgcttcgtctgccttctttacgttccataggcct 420 taagtgtttggagcatttgttttctttcgccttattggagatgttccaattgatacgttc 480 ctgatggagatgcttgaatcaccttctgattcataa 516 <210> SEQIDNO:75 <211> LENGTH:528 <212> TYPE:DNA <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:75 attccacattttgaagagcttccccttgaggaccgcatggtgttgctcaaggctggctgg 60 aacgagctgctcattgctgctttctcccaccgttctgttgacgtgcgtgatggcattgtg 120 ctcgctacaggtcttgtggtgcagcggcatagtgctcatggggctggcgttggggccata 180 tttgatagggttctcactgaactggtagcaaagatgcgtgagatgaagatggaccgcact 240 gagcttggatgcctgcttgctgtggtactttttaatcctgaggccaaggggctgcggacc 300 tgcccaagtggaggccctgagggagaaagtgtatctgccttggaagagcactgccggcag 360 cagtacccagaccagcctgggcgctttgccaagctgctgctgcggttgccagctctgcgc 420 agtattggcctcaagtgcctcgaacatctctttttcttcaagctcatcggggacacgccc 480 atcgacaactttcttctttccatgctggaggccccctctgacccctaa 528 <210> SEQIDNO:76 <211> LENGTH:531 <212> TYPE:DNA <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:76 attccgcacttcgaagagcttcccatcgaggatcgcaccgcgctgctcaaagccggctgg 60 aacgaactgcttattgccgccttttcgcaccgttctgtggcggtgcgcgacggcatcgtt 120 ctggccaccgggctggtggtgcagcggcacagcgcacacggcgcaggcgttggcgacatc 180 ttcgaccgcgtactagccgagctggtggccaagatgcgcgacatgaagatggacaaaacg 240 gagctcggctgcctgcgcgccgtggtgctcttcaatccagacgccaagggtctccgaaac 300 gccaccagagtagaggcgctccgcgagaaggtgtatgcggcgctggaggagcactgccgt 360 cggcaccacccggaccaaccgggtcgcttcggcaagctgctgctgcggctgcctgccttg 420 cgcagcatcgggctcaaatgcctcgagcatctgttcttcttcaagctcatcggagacact 480 cccatagacagcttcctgctcaacatgctggaggcaccggcagacccctag 531 <210> SEQIDNO:77 <211> LENGTH:552 <212> TYPE:DNA <213> ORGANISM:Celucapugilator <400> SEQUENCE:77 atcccacacttcacagaccttcccatagaggaccaagtggtattactcaaagccgggtgg 60 aacgagttgcttattgcctcattctcacaccgtagcatgggcgtggaggatggcatcgtg 120 ctggccacagggctcgtgatccacagaagtagtgctcaccaggctggagtgggtgccata 180 tttgatcgtgtcctctctgagctggtggccaagatgaaggagatgaagattgacaagaca 240 gagctgggctgccttcgctccatcgtcctgttcaacccagatgccaaaggactaaactgc 300 gtcaatgatgtggagatcttgcgtgagaaggtgtatgctgccctggaggagtacacacga 360 accacttaccctgatgaacctggacgctttgccaagttgcttctgcgacttcctgcactc 420 aggtctataggcctgaagtgtcttgagtacctcttcctgtttaagctgattggagacact 480 cccctggacagctacttgatgaagatgctcgtagacaacccaaatacaagcgtcactccc 540 cccaccagctag 552 <210> SEQIDNO:78 <211> LENGTH:531 <212> TYPE:DNA <213> ORGANISM:Tenebriomolitor <400> SEQUENCE:78 atacctcactttacctcgttgccgatgtcggaccaggtgcttttattgagggcaggatgg 60 aatgaattgctcatcgccgcattctcgcacagatctatacaggcgcaggatgccatcgtt 120 ctagccacggggttgacagttaacaaaacgtcggcgcacgccgtgggcgtgggcaacatc 180 tacgaccgcgtcctctccgagctggtgaacaagatgaaagagatgaagatggacaagacg 240 gagctgggctgcttgagagccatcatcctctacaaccccacgtgtcgcggcatcaagtcc 300 gtgcaggaagtggagatgctgcgtgagaaaatttacggcgtgctggaagagtacaccagg 360 accacccacccgaacgagcccggcaggttcgccaaactgcttctgcgcctcccggccctc 420 aggtccatcgggttgaaatgttccgaacacctctttttcttcaagctgatcggtgatgtt 480 ccaatagacacgttcctgatggagatgctggagtctccggcggacgcttag 531 <210> SEQIDNO:79 <211> LENGTH:531 <212> TYPE:DNA <213> ORGANISM:Apismellifera <400> SEQUENCE:79 atcccgcattttacctcgttgccactggaggatcaggtacttctgctcagggccggttgg 60 aacgagttgctgatagcctccttttcccaccgttccatcgacgtgaaggacggtatcgtg 120 ctggcgacggggatcaccgtgcatcggaactcggcgcagcaggccggcgtgggcacgata 180 ttcgaccgtgtcctctcggagcttgtctcgaaaatgcgtgaaatgaagatggacaggaca 240 gagcttggctgtctcagatctataatactcttcaatcccgaggttcgaggactgaaatcc 300 atccaggaagtgaccctgctccgtgagaagatctacggcgccctggagggttattgccgc 360 gtagcttggcccgacgacgctggaagattcgcgaaattacttctacgcctgcccgccatc 420 cgctcgatcggattaaagtgcctcgagtacctgttcttcttcaaaatgatcggtgacgta 480 ccgatcgacgattttctcgtggagatgttagaatcgcgatcagatccttag 531 <210> SEQIDNO:80 <211> LENGTH:176 <212> TYPE:PRT <213> ORGANISM:Locustamigratoria <400> SEQUENCE:80 IleProHisPheThrSerLeuProLeuGluAspGlnValLeuLeuLeu ArgAlaGlyTrpAsnGluLeuLeuIleAlaAlaPheSerHisArgSer ValAspValLysAspGlyIleValLeuAlaThrGlyLeuThrValHis ArgAsnSerAlaHisGlnAlaGlyValGlyThrIlePheAspArgVal LeuThrGluLeuValAlaLysMetArgGluMetLysMetAspLysThr GluLeuGlyCysLeuArgSerValIleLeuPheAsnProGluValArg GlyLeuLysSerAlaGlnGluValGluLeuLeuArgGluLysValTyr AlaAlaLeuGluGluTyrThrArgThrThrHisProAspGluProGly ArgPheAlaLysLeuLeuLeuArgLeuProSerLeuArgSerIleGly LeuLysCysLeuGluHisLeuPhePhePheArgLeuIleGlyAspVal ProIleAspThrPheLeuMetGluMetLeuGluSerProSerAspSer <210> SEQIDNO:81 <211> LENGTH:175 <212> TYPE:PRT <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:81 IleProHisPheGluGluLeuProLeuGluAspArgMetValLeuLeu LysAlaGlyTrpAsnGluLeuLeuIleAlaAlaPheSerHisArgSer ValAspValArgAspGlyIleValLeuAlaThrGlyLeuValValGln ArgHisSerAlaHisGlyAlaGlyValGlyAlaIlePheAspArgVal LeuThrGluLeuValAlaLysMetArgGluMetLysMetAspArgThr GluLeuGlyCysLeuLeuAlaValValLeuPheAsnProGluAlaLys GlyLeuArgThrCysProSerGlyGlyProGluGlyGluSerValSer AlaLeuGluGluHisCysArgGlnGlnTyrProAspGlnProGlyArg PheAlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGlyLeu LysCysLeuGluHisLeuPhePhePheLysLeuIleGlyAspThrPro IleAspAsnPheLeuLeuSerMetLeuGluAlaProSerAspPro <210> SEQIDNO:82 <211> LENGTH:176 <212> TYPE:PRT <213> ORGANISM:Amblyommaamericanum <400> SEQUENCE:82 IleProHisPheGluGluLeuProIleGluAspArgThrAlaLeuLeu LysAlaGlyTrpAsnGluLeuLeuIleAlaAlaPheSerHisArgSer ValAlaValArgAspGlyIleValLeuAlaThrGlyLeuValValGln ArgHisSerAlaHisGlyAlaGlyValGlyAspIlePheAspArgVal LeuAlaGluLeuValAlaLysMetArgAspMetLysMetAspLysThr GluLeuGlyCysLeuArgAlaValValLeuPheAsnProAspAlaLys GlyLeuArgAsnAlaThrArgValGluAlaLeuArgGluLysValTyr AlaAlaLeuGluGluHisCysArgArgHisHisProAspGlnProGly ArgPheGlyLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGly LeuLysCysLeuGluHisLeuPhePhePheLysLeuIleGlyAspThr ProIleAspSerPheLeuLeuAsnMetLeuGluAlaProAlaAspPro <210> SEQIDNO:83 <211> LENGTH:183 <212> TYPE:PRT <213> ORGANISM:Celucapugilator <400> SEQUENCE:83 IleProHisPheThrAspLeuProIleGluAspGlnValValLeuLeu LysAlaGlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArgSer MetGlyValGluAspGlyIleValLeuAlaThrGlyLeuValIleHis ArgSerSerAlaHisGlnAlaGlyValGlyAlaIlePheAspArgVal LeuSerGluLeuValAlaLysMetLysGluMetLysIleAspLysThr GluLeuGlyCysLeuArgSerIleValLeuPheAsnProAspAlaLys GlyLeuAsnCysValAsnAspValGluIleLeuArgGluLysValTyr AlaAlaLeuGluGluTyrThrArgThrThrTyrProAspGluProGly ArgPheAlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGly LeuLysCysLeuGluTyrLeuPheLeuPheLysLeuIleGlyAspThr ProLeuAspSerTyrLeuMetLysMetLeuValAspAsnProAsnThr SerValThrProProThrSer <210> SEQIDNO:84 <211> LENGTH:176 <212> TYPE:PRT <213> ORGANISM:Tenebriomolitor <400> SEQUENCE:84 IleProHisPheThrSerLeuProMetSerAspGlnValLeuLeuLeu ArgAlaGlyTrpAsnGluLeuLeuIleAlaAlaPheSerHisArgSer IleGlnAlaGlnAspAlaIleValLeuAlaThrGlyLeuThrValAsn LysThrSerAlaHisAlaValGlyValGlyAsnIleTyrAspArgVal LeuSerGluLeuValAsnLysMetLysGluMetLysMetAspLysThr GluLeuGlyCysLeuArgAlaIleIleLeuTyrAsnProThrCysArg GlyIleLysSerValGlnGluValGluMetLeuArgGluLysIleTyr GlyValLeuGluGluTyrThrArgThrThrHisProAsnGluProGly ArgPheAlaLysLeuLeuLeuArgLeuProAlaLeuArgSerIleGly LeuLysCysSerGluHisLeuPhePhePheLysLeuIleGlyAspVal ProIleAspThrPheLeuMetGluMetLeuGluSerProAlaAspAla <210> SEQIDNO:85 <211> LENGTH:176 <212> TYPE:PRT <213> ORGANISM:Apismellifera <400> SEQUENCE:85 IleProHisPheThrSerLeuProLeuGluAspGlnValLeuLeuLeu ArgAlaGlyTrpAsnGluLeuLeuIleAlaSerPheSerHisArgSer IleAspValLysAspGlyIleValLeuAlaThrGlyIleThrValHis ArgAsnSerAlaGlnGlnAlaGlyValGlyThrIlePheAspArgVal LeuSerGluLeuValSerLysMetArgGluMetLysMetAspArgThr GluLeuGlyCysLeuArgSerIleIleLeuPheAsnProGluValArg GlyLeuLysSerIleGlnGluValThrLeuLeuArgGluLysIleTyr GlyAlaLeuGluGlyTyrCysArgValAlaTrpProAspAspAlaGly ArgPheAlaLysLeuLeuLeuArgLeuProAlaIleArgSerIleGly LeuLysCysLeuGluTyrLeuPhePhePheLysMetIleGlyAspVal ProIleAspAspPheLeuValGluMetLeuGluSerArgSerAspPro <210> SEQIDNO:86 <211> LENGTH:259 <212> TYPE:PRT <213> ORGANISM:Choristoneurafumiferana <400> SEQUENCE:86 LeuThrAlaAsnGlnGlnPheLeuIleAlaArgLeuIleTrpTyrGln AspGlyTyrGluGlnProserAspGluAspLeuLysArgIleThrGln ThrTrpGlnGlnAlaAspAspGluAsnGluGluserAspThrProPhe ArgGlnIleThrGluMetThrIleLeuThrValGlnLeuIleValGlu PheAlaLysGlyLeuProGlyPheAlaLysIleserGlnProAspGln IleThrLeuLeuLysAlacysserserGluValMetMetLeuArgVal AlaArgArgTyrAspAlaAlaserAspserValLeuPheAlaAsnAsn GlnAlaTyrThrArgAspAsnTyrArgLysAlaGlyMetAlaTyrVal IleGluAspLeuLeuHisPhecysArgcysMetTyrserMetAlaLeu AspAsnIleHisTyrAlaLeuLeuThrAlavalvalIlePheserAsp ArgProGlyLeuGluGlnProGlnLeuvalGluGluIleGlnArgTyr TyrLeuAsnThrLeuArgIleTyrIleLeuAsnGlnLeuserGlyser AlaArgserserValIleTyrGlyLysIleLeuserIleLeuserGlu LeuArgThrLeuGlyMetGlnAsnserAsnMetcysIleSerLeuLys LeuLysAsnArgLysLeuProProPheLeuGluGluIleTrpAspval AlaAspMetserHisThrGlnProProProIleLeuGluserProThr AsnLeuGly <210> SEQIDNO:87 <211> LENGTH:674 <212> TYPE:PRT <213> ORGANISM:Artificial <400> SEQUENCE:87 MetAspTyrLysAspAspAspAspLysGluMetProValAspArgIle LeuGluAlaGluLeuAlaValGluGlnLysSerAspGlnGlyValGlu GlyProGlyGlyThrGlyGlySerGlySerSerProAsnAspProVal ThrAsnIleCysGlnAlaAlaAspLysGlnLeuPheThrLeuValGlu TrpAlaLysArgIleProHisPheSerSerLeuProLeuAspAspGln ValIleLeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaSerPhe SerHisArgSerIleAspValArgAspGlyIleLeuLeuAlaThrGly LeuHisValHisArgAsnSerAlaHisSerAlaGlyValGlyAlaIle PheAspArgValLeuThrGluLeuValSerLysMetArgAspMetArg MetAspLysThrGluLeuGlyCysLeuArgAlaIleIleLeuPheAsn ProGluValArgGlyLeuLysSerAlaGlnGluValGluLeuLeuArg GluLysValTyrAlaAlaLeuGluGluTyrThrArgThrThrHisPro AspGluProGlyArgPheAlaLysLeuLeuLeuArgLeuProSerLeu ArgSerIleGlyLeuLysCysLeuGluHisLeuPhePhePheArgLeu IleGlyAspValProIleAspThrPheLeuMetGluMetLeuGluSer ProSerAspSerGlnIleSerTyrAlaSerArgGlyGlyGlySerSer GlyGlyGlyGluAspAlaLysAsnIleLysLysGlyProAlaProPhe TyrProLeuGluAspGlyThrAlaGlyGluGlnLeuHisLysAlaMet LysArgTyrAlaLeuValProGlyThrIleAlaPheThrAspAlaHis IleGluValAsnIleThrTyrAlaGluTyrPheGluMetSerValArg LeuAlaGluAlaMetLysArgTyrGlyLeuAsnThrAsnHisArgIle ValValCysSerGluAsnSerLeuGlnPhePheMetProValLeuGly AlaLeuPheIleGlyValAlaValAlaProAlaAsnAspIleTyrAsn GluArgGluLeuLeuAsnSerMetAsnIleSerGlnProThrValVal PheValSerLysLysGlyLeuGlnLysIleLeuAsnValGlnLysLys LeuProIleIleGlnLysIleIleIleMetAspSerLysThrAspTyr GlnGlyPheGlnSerMetTyrThrPheValThrSerHisLeuProPro GlyPheAsnGluTyrAspPheValProGluSerPheAspArgAspLys ThrIleAlaLeuIleMetAsnSerSerGlySerThrGlyLeuProLys GlyValAlaLeuProHisArgThrAlaCysValArgPheSerHisAla ArgAspProIlePheGlyAsnGlnIleIleProAspThrAlaIleLeu SerValValProPheHisHisGlyPheGlyMetPheThrThrLeuGly TyrLeuIleCysGlyPheArgValValLeuMetTyrArgPheGluGlu GluLeuPheLeuArgSerLeuGlnAspTyrLysIleGlnSerAlaLeu LeuValProThrLeuPheSerPhePheAlaLysSerThrLeuIleAsp LysTyrAspLeuSerAsnLeuHisGluIleAlaSerGlyGlyAlaPro LeuSerLysGluValGlyGluAlaValAlaLysArgPheHisLeuPro GlyIleArgGlnGlyTyrGlyLeuThrGluThrThrSerAlaIleLeu IleThrProGluGlyAspAspLysProGlyAlaValGlyLysValVal ProPhePheGluAlaLysValValAspLeuAspThrGlyLysThrLeu GlyValAsnGlnArgGlyGluLeuCysValArgGlyProMetIleMet SerGlyTyrValAsnAsnProGluAlaThrAsnAlaLeuIleAspLys AspGly <210> SEQIDNO:88 <211> LENGTH:463 <212> TYPE:PRT <213> ORGANISM:Artificial <400> SEQUENCE:88 GlnValAlaProAlaGluLeuGluSerIleLeuLeuGlnHisProAsn IlePheAspAlaGlyValAlaGlyLeuProAspAspAspAlaGlyGlu LeuProAlaAlaValValValLeuGluHisGlyLysThrMetThrGlu LysGluIleValAspTyrValAlaSerGlnValThrThrAlaLysLys LeuArgGlyGlyValValPheValAspGluValProLysGlyLeuThr GlyLysLeuAspAlaArgLysIleArgGluIleLeuIleLysAlaLys LysGlyGlyLysSerLysLeuGlyGlyGlySerSerGlyGlyGlyGln IleSerTyrAlaSerArgGlyArgProGluCysValValProGluThr GlnCysAlaMetLysArgLysGluLysLysAlaGlnLysGluLysAsp LysLeuProValSerThrThrThrValAspAspHisMetProProIle MetGlnCysGluProProProProGluAlaAlaArgIleHisGluVal ValProArgPheLeuSerAspLysLeuLeuValThrAsnArgGlnLys AsnIleProGlnLeuThrAlaAsnGlnGlnPheLeuIleAlaArgLeu IleTrpTyrGlnAspGlyTyrGluGlnProSerAspGluAspLeuLys ArgIleThrGlnThrTrpGlnGlnAlaAspAspGluAsnGluGluSer AspThrProPheArgGlnIleThrGluMetThrIleLeuThrValGln LeuIleValGluPheAlaLysGlyLeuProGlyPheAlaLysIleSer GlnProAspGlnIleThrLeuLeuLysAlaCysSerSerGluValMet MetLeuArgValAlaArgArgTyrAspAlaAlaSerAspSerIleLeu PheAlaAsnAsnGlnAlaTyrThrArgAspAsnTyrArgLysAlaGly MetAlaGluValIleGluAspLeuLeuHisPheCysArgCysMetTyr SerMetAlaLeuAspAsnIleHisTyrAlaLeuLeuThrAlaValVal IlePheSerAspArgProGlyLeuGluGlnProGlnLeuValGluGlu IleGlnArgTyrTyrLeuAsnThrLeuArgIleTyrIleLeuAsnGln LeuSerGlySerAlaArgSerSerValIleTyrGlyLysIleLeuSer IleLeuSerGluLeuArgThrLeuGlyMetGlnAsnSerAsnMetCys IleSerLeuLysLeuLysAsnArgLysLeuProProPheLeuGluGlu IleTrpAspValAlaAspMetSerHisThrGlnProProProIleLeu GluSerProThrAsnLeuTyrProTyrAspValProAspTyrAla <210> SEQIDNO:89 <211> LENGTH:675 <212> TYPE:PRT <213> ORGANISM:Artificial <400> SEQUENCE:89 TrpTyrGlnAspGlyTyrGluGlnProSerAspGluAspLeuLysArg IleThrGlnThrTrpGlnGlnAlaAspAspGluAsnGluGluSerAsp ThrProPheArgGlnIleThrGluMetThrIleLeuThrValGlnLeu IleValGluPheAlaLysGlyLeuProGlyPheAlaLysIleSerGln ProAspGlnIleThrLeuLeuLysAlaCysSerSerGluValMetMet LeuArgValAlaArgArgTyrAspAlaAlaSerAspSerIleLeuPhe AlaAsnAsnGlnAlaTyrThrArgAspAsnTyrArgLysAlaGlyMet AlaGluValIleGluAspLeuLeuHisPheCysArgCysMetTyrSer MetAlaLeuAspAsnIleHisTyrAlaLeuLeuThrAlaValValIle PheSerAspArgProGlyLeuGluGlnProGlnLeuValGluGluIle GlnArgTyrTyrLeuAsnThrLeuArgIleTyrIleLeuAsnGlnLeu SerGlySerAlaArgSerSerValIleTyrGlyLysIleLeuSerIle LeuSerGluLeuArgThrLeuGlyMetGlnAsnSerAsnMetCysIle SerLeuLysLeuLysAsnArgLysLeuProProPheLeuGluGluIle TrpAspValAlaAspMetSerHisThrGlnProProProIleLeuGlu SerProThrAsnLeuGlnIleSerTyrAlaSerArgGlyGlyGlySer SerGlyGlyGlyGluAspAlaLysAsnIleLysLysGlyProAlaPro PheTyrProLeuGluAspGlyThrAlaGlyGluGlnLeuHisLysAla MetLysArgTyrAlaLeuValProGlyThrIleAlaPheThrAspAla HisIleGluValAsnIleThrTyrAlaGluTyrPheGluMetSerVal ArgLeuAlaGluAlaMetLysArgTyrGlyLeuAsnThrAsnHisArg IleValValCysSerGluAsnSerLeuGlnPhePheMetProValLeu GlyAlaLeuPheIleGlyValAlaValAlaProAlaAsnAspIleTyr AsnGluArgGluLeuLeuAsnSerMetAsnIleSerGlnProThrVal ValPheValSerLysLysGlyLeuGlnLysIleLeuAsnValGlnLys LysLeuProIleIleGlnLysIleIleIleMetAspSerLysThrAsp TyrGlnGlyPheGlnSerMetTyrThrPheValThrSerHisLeuPro ProGlyPheAsnGluTyrAspPheValProGluSerPheAspArgAsp LysThrIleAlaLeuIleMetAsnSerSerGlySerThrGlyLeuPro LysGlyValAlaLeuProHisArgThrAlaCysValArgPheSerHis AlaArgAspProIlePheGlyAsnGlnIleIleProAspThrAlaIle LeuSerValValProPheHisHisGlyPheGlyMetPheThrThrLeu GlyTyrLeuIleCysGlyPheArgValValLeuMetTyrArgPheGlu GluGluLeuPheLeuArgSerLeuGlnAspTyrLysIleGlnSerAla LeuLeuValProThrLeuPheSerPhePheAlaLysSerThrLeuIle AspLysTyrAspLeuSerAsnLeuHisGluIleAlaSerGlyGlyAla ProLeuSerLysGluValGlyGluAlaValAlaLysArgPheHisLeu ProGlyIleArgGlnGlyTyrGlyLeuThrGluThrThrSerAlaIle LeuIleThrProGluGlyAspAspLysProGlyAlaValGlyLysVal ValProPhePheGluAlaLysValValAspLeuAspThrGlyLysThr LeuGlyValAsnGlnArgGlyGluLeuCysValArgGlyProMetIle MetSerGlyTyrValAsnAsnProGluAlaThrAsnAlaLeuIleAsp LysAspGly <210> SEQIDNO:90 <211> LENGTH:412 <212> TYPE:PRT <213> ORGANISM:Artificial <400> SEQUENCE:90 MetSerGlyTyrValAsnAsnProGluAlaThrAsnAlaLeuIleAsp LysAspGlyTrpLeuHisSerGlyAspIleAlaTyrTrpAspGluAsp GluHisPhePheIleValAspArgLeuLysSerLeuIleLysTyrLys GlyTyrGlnValAlaProAlaGluLeuGluSerIleLeuLeuGlnHis ProAsnIlePheAspAlaGlyValAlaGlyLeuProAspAspAspAla GlyGluLeuProAlaAlaValValValLeuGluHisGlyLysThrMet ThrGluLysGluIleValAspTyrValAlaSerGlnValThrThrAla LysLysLeuArgGlyGlyValValPheValAspGluValProLysGly LeuThrGlyLysLeuAspAlaArgLysIleArgGluIleLeuIleLys AlaLysLysGlyGlyLysSerLysLeuGlyGlyGlySerSerGlyGly GlyGlnIleSerTyrAlaSerArgGlyGluMetProValAspArgIle LeuGluAlaGluLeuAlaValGluGlnLysSerAspGlnGlyValGlu GlyProGlyGlyThrGlyGlySerGlySerSerProAsnAspProVal ThrAsnIleCysGlnAlaAlaAspLysGlnLeuPheThrLeuValGlu TrpAlaLysArgIleProHisPheSerSerLeuProLeuAspAspGln ValIleLeuLeuArgAlaGlyTrpAsnGluLeuLeuIleAlaSerPhe SerHisArgSerIleAspValArgAspGlyIleLeuLeuAlaThrGly LeuHisValHisArgAsnSerAlaHisSerAlaGlyValGlyAlaIle PheAspArgValLeuThrGluLeuValSerLysMetArgAspMetArg MetAspLysThrGluLeuGlyCysLeuArgAlaIleIleLeuPheAsn ProGluValArgGlyLeuLysSerAlaGlnGluValGluLeuLeuArg GluLysValTyrAlaAlaLeuGluGluTyrThrArgThrThrHisPro AspGluProGlyArgPheAlaLysLeuLeuLeuArgLeuProSerLeu ArgSerIleGlyLeuLysCysLeuGluHisLeuPhePhePheArgLeu IleGlyAspValProIleAspThrPheLeuMetGluMetLeuGluSer ProSerAspSerAspTyrLysAspAspAspAspLys <210> SEQIDNO:91 <211> LENGTH:1189 <212> TYPE:PRT <213> ORGANISM:Artificial <400> SEQUENCE:91 MetTyrProTyrAspValProAspTyrAlaSerGlnTrpTyrGluLeu GlnGlnLeuAspSerLysPheLeuGluGlnValHisGlnLeuTyrAsp AspSerPheProMetGluIleArgGlnTyrLeuAlaGlnTrpLeuGlu LysGlnAspTrpGluHisAlaAlaAsnAspValSerPheAlaThrIle ArgPheHisAspLeuLeuSerGlnLeuAspAspGlnTyrSerArgPhe SerLeuGluAsnAsnPheLeuLeuGlnHisAsnIleArgLysSerLys ArgAsnLeuGlnAspAsnPheGlnGluAspProIleGlnMetSerMet IleIleTyrSerCysLeuLysGluGluArgLysIleLeuGluAsnAla GlnArgPheAsnGlnAlaGlnSerGlyAsnIleGlnSerThrValMet LeuAspLysGlnLysGluLeuAspSerLysValArgAsnValLysAsp LysValMetCysIleGluHisGluIleLysSerLeuGluAspLeuGln AspGluTyrAspPheLysCysLysThrLeuGlnAsnArgGluHisGlu ThrAsnGlyValAlaLysSerAspGlnLysGlnGluGlnLeuLeuLeu LysLysMetTyrLeuMetLeuAspAsnLysArgLysGluValValHis LysIleIleGluLeuLeuAsnValThrGluLeuThrGlnAsnAlaLeu IleAsnAspGluLeuValGluTrpLysArgArgGlnGlnSerAlaCys IleGlyGlyProProAsnAlaCysLeuAspGlnLeuGlnAsnTrpPhe ThrIleValAlaGluSerLeuGlnGlnValArgGlnGlnLeuLysLys LeuGluGluLeuGluGlnLysTyrThrTyrGluHisAspProIleThr LysAsnLysGlnValLeuTrpAspArgThrPheSerLeuPheGlnGln LeuIleGlnSerSerPheValValGluArgGlnProCysMetProThr HisProGlnArgProLeuValLeuLysThrGlyValGlnPheThrVal LysLeuArgLeuLeuValLysLeuGlnGluLeuAsnTyrAsnLeuLys ValLysValLeuPheAspLysAspValAsnGluArgAsnThrValLys GlyPheArgLysPheAsnIleLeuGlyThrHisThrLysValMetAsn MetGluGluSerThrAsnGlySerLeuAlaAlaGluPheArgHisLeu GlnLeuLysGluGlnLysAsnAlaGlyThrArgThrAsnGluGlyPro LeuIleValThrGluGluLeuHisSerLeuSerPheGluThrGlnLeu CysGlnProGlyLeuValIleAspLeuGluThrThrSerLeuProVal ValValIleSerAsnValSerGlnLeuProSerGlyTrpAlaSerIle LeuTrpTyrAsnMetLeuValAlaGluProArgAsnLeuSerPhePhe LeuThrProProCysAlaArgTrpAlaGlnLeuSerGluValLeuSer TrpGlnPheSerSerValThrLysArgGlyLeuAsnValAspGlnLeu AsnMetLeuGlyGluLysLeuLeuGlyProAsnAlaSerProAspGly LeuIleProTrpThrArgPheCysLysGluAsnIleAsnAspLysAsn PheProPheTrpLeuTrpIleGluSerIleLeuGluLeuIleLysLys HisLeuLeuProLeuTrpAsnAspGlyCysIleMetGlyPheIleSer LysGluArgGluArgAlaLeuLeuLysAspGlnGlnProGlyThrPhe LeuLeuArgPheSerGluSerSerArgGluGlyAlaIleThrPheThr TrpValGluArgSerGlnAsnGlyGlyGluProAspPheHisAlaVal GluProTyrThrLysLysGluLeuSerAlaValThrPheProAspIle IleArgAsnTyrLysValMetAlaAlaGluAsnIleProGluAsnPro LeuLysTyrLeuTyrProAsnIleAspLysAspHisAlaPheGlyLys TyrTyrSerArgProLysGluAlaProGluProMetGluLeuAspGly ProLysGlyThrGlyTyrIleLysThrGluLeuIleSerValSerGlu ValHisProSerArgLeuGlnThrThrAspAsnLeuLeuProMetSer ProGluGluPheAspGluValSerArgIleValGlySerValGluPhe AspSerMetMetAsnThrValGlnIleSerTyrAlaSerArgGlyGly GlySerSerGlyGlyGlyGluAspAlaLysAsnIleLysLysGlyPro AlaProPheTyrProLeuGluAspGlyThrAlaGlyGluGlnLeuHis LysAlaMetLysArgTyrAlaLeuValProGlyThrIleAlaPheThr AspAlaHisIleGluValAsnIleThrTyrAlaGluTyrPheGluMet SerValArgLeuAlaGluAlaMetLysArgTyrGlyLeuAsnThrAsn HisArgIleValValCysSerGluAsnSerLeuGlnPhePheMetPro ValLeuGlyAlaLeuPheIleGlyValAlaValAlaProAlaAsnAsp IleTyrAsnGluArgGluLeuLeuAsnSerMetAsnIleSerGlnPro ThrValValPheValSerLysLysGlyLeuGlnLysIleLeuAsnVal GlnLysLysLeuProIleIleGlnLysIleIleIleMetAspSerLys ThrAspTyrGlnGlyPheGlnSerMetTyrThrPheValThrSerHis LeuProProGlyPheAsnGluTyrAspPheValProGluSerPheAsp ArgAspLysThrIleAlaLeuIleMetAsnSerSerGlySerThrGly LeuProLysGlyValAlaLeuProHisArgThrAlaCysValArgPhe SerHisAlaArgAspProIlePheGlyAsnGlnIleIleProAspThr AlaIleLeuSerValValProPheHisHisGlyPheGlyMetPhe ThrThrLeuGlyTyrLeuIleCysGlyPheArgValValLeuMet TyrArgPheGluGluGluLeuPheLeuArgSerLeuGlnAspTyr LysIleGlnSerAlaLeuLeuValProThrLeuPheSerPhePhe AlaLysSerThrLeuIleAspLysTyrAspLeuSerAsnLeuHis GluIleAlaSerGlyGlyAlaProLeuSerLysGluValGlyGlu AlaValAlaLysArgPheHisLeuProGlyIleArgGlnGlyTyr GlyLeuThrGluThrThrSerAlaIleLeuIleThrProGluGly AspAspLysProGlyAlaValGlyLysValValProPhePheGlu AlaLysValValAspLeuAspThrGlyLysThrLeuGlyValAsn GlnArgGlyGluLeuCysValArgGlyProMetIleMetSerGly TyrValAsnAsnProGluAlaThrAsnAlaLeuIleAspLysAsp Gly <210> SEQIDNO:92 <211> LENGTH:926 <212> TYPE:PRT <213> ORGANISM:Artificial <400> SEQUENCE:92 MetSerGlyTyrValAsnAsnProGluAlaThrAsnAlaLeuIleAsp LysAspGlyTrpLeuHisSerGlyAspIleAlaTyrTrpAspGluAsp GluHisPhePheIleValAspArgLeuLysSerLeuIleLysTyrLys GlyTyrGlnValAlaProAlaGluLeuGluSerIleLeuLeuGlnHis ProAsnIlePheAspAlaGlyValAlaGlyLeuProAspAspAspAla GlyGluLeuProAlaAlaValValValLeuGluHisGlyLysThrMet ThrGluLysGluIleValAspTyrValAlaSerGlnValThrThrAla LysLysLeuArgGlyGlyValValPheValAspGluValProLysGly LeuThrGlyLysLeuAspAlaArgLysIleArgGluIleLeuIleLys AlaLysLysGlyGlyLysSerLysLeuGlyGlyGlySerSerGlyGly GlyGlnIleSerTyrAlaSerArgGlySerGlnTrpTyrGluLeuGln GlnLeuAspSerLysPheLeuGluGlnValHisGlnLeuTyrAspAsp SerPheProMetGluIleArgGlnTyrLeuAlaGlnTrpLeuGluLys GlnAspTrpGluHisAlaAlaAsnAspValSerPheAlaThrIleArg PheHisAspLeuLeuSerGlnLeuAspAspGlnTyrSerArgPheSer LeuGluAsnAsnPheLeuLeuGlnHisAsnIleArgLysSerLysArg AsnLeuGlnAspAsnPheGlnGluAspProIleGlnMetSerMetIle IleTyrSerCysLeuLysGluGluArgLysIleLeuGluAsnAlaGln ArgPheAsnGlnAlaGlnSerGlyAsnIleGlnSerThrValMetLeu AspLysGlnLysGluLeuAspSerLysValArgAsnValLysAspLys ValMetCysIleGluHisGluIleLysSerLeuGluAspLeuGlnAsp GluTyrAspPheLysCysLysThrLeuGlnAsnArgGluHisGluThr AsnGlyValAlaLysSerAspGlnLysGlnGluGlnLeuLeuLeuLys LysMetTyrLeuMetLeuAspAsnLysArgLysGluValValHisLys IleIleGluLeuLeuAsnValThrGluLeuThrGlnAsnAlaLeuIle AsnAspGluLeuValGluTrpLysArgArgGlnGlnSerAlaCysIle GlyGlyProProAsnAlaCysLeuAspGlnLeuGlnAsnTrpPheThr IleValAlaGluSerLeuGlnGlnValArgGlnGlnLeuLysLysLeu GluGluLeuGluGlnLysTyrThrTyrGluHisAspProIleThrLys AsnLysGlnValLeuTrpAspArgThrPheSerLeuPheGlnGlnLeu IleGlnSerSerPheValValGluArgGlnProCysMetProThrHis ProGlnArgProLeuValLeuLysThrGlyValGlnPheThrValLys LeuArgLeuLeuValLysLeuGlnGluLeuAsnTyrAsnLeuLysVal LysValLeuPheAspLysAspValAsnGluArgAsnThrValLysGly PheArgLysPheAsnIleLeuGlyThrHisThrLysValMetAsnMet GluGluSerThrAsnGlySerLeuAlaAlaGluPheArgHisLeuGln LeuLysGluGlnLysAsnAlaGlyThrArgThrAsnGluGlyProLeu IleValThrGluGluLeuHisSerLeuSerPheGluThrGlnLeuCys GlnProGlyLeuValIleAspLeuGluThrThrSerLeuProValVal ValIleSerAsnValSerGlnLeuProSerGlyTrpAlaSerIleLeu TrpTyrAsnMetLeuValAlaGluProArgAsnLeuSerPhePheLeu ThrProProCysAlaArgTrpAlaGlnLeuSerGluValLeuSerTrp GlnPheSerSerValThrLysArgGlyLeuAsnValAspGlnLeuAsn MetLeuGlyGluLysLeuLeuGlyProAsnAlaSerProAspGlyLeu IleProTrpThrArgPheCysLysGluAsnIleAsnAspLysAsnPhe ProPheTrpLeuTrpIleGluSerIleLeuGluLeuIleLysLysHis LeuLeuProLeuTrpAsnAspGlyCysIleMetGlyPheIleSerLys GluArgGluArgAlaLeuLeuLysAspGlnGlnProGlyThrPheLeu LeuArgPheSerGluSerSerArgGluGlyAlaIleThrPheThrTrp ValGluArgSerGlnAsnGlyGlyGluProAspPheHisAlaValGlu ProTyrThrLysLysGluLeuSerAlaValThrPheProAspIleIle ArgAsnTyrLysValMetAlaAlaGluAsnIleProGluAsnProLeu LysTyrLeuTyrProAsnIleAspLysAspHisAlaPheGlyLysTyr TyrSerArgProLysGluAlaProGluProMetGluLeuAspGlyPro LysGlyThrGlyTyrIleLysThrGluLeuIleSerValSerGluVal HisProSerArgLeuGlnThrThrAspAsnLeuLeuProMetSerPro GluGluPheAspGluValSerArgIleValGlySerValGluPheAsp SerMetMetAsnThrValAspTyrLysAspAspAspAspLys <210> SEQIDNO:93 <211> LENGTH:335 <212> TYPE:PRT <213> ORGANISM:Artificial <400> SEQUENCE:93 <223> artificial ArgProGluCysValValProGluThrGlnCysAlaMetLysArgLys GluLysLysAlaGlnLysGluLysAspLysLeuProValSerThrThr ThrValAspAspHisMetProProIleMetGlnCysGluProProPro ProGluAlaAlaArgIleHisGluValValProArgPheLeuSerAsp LysLeuLeuValThrAsnArgGlnLysAsnIleProGlnLeuThrAla AsnGlnGlnPheLeuIleAlaArgLeuIleTrpTyrGlnAspGlyTyr GluGlnProSerAspGluAspLeuLysArgIleThrGlnThrTrpGln GlnAlaAspAspGluAsnGluGluSerAspThrProPheArgGlnIle ThrGluMetThrIleLeuThrValGlnLeuIleValGluPheAlaLys GlyLeuProGlyPheAlaLysIleSerGlnProAspGlnIleThrLeu LeuLysAlaCysSerSerGluValMetMetLeuArgValAlaArgArg TyrAspAlaAlaSerAspSerIleLeuPheAlaAsnAsnGlnAlaTyr ThrArgAspAsnTyrArgLysAlaGlyMetAlaGluValIleGluAsp LeuLeuHisPheCysArgCysMetTyrSerMetAlaLeuAspAsnIle HisTyrAlaLeuLeuThrAlaValValIlePheSerAspArgProGly LeuGluGlnProGlnLeuValGluGluIleGlnArgTyrTyrLeuAsn ThrLeuArgIleTyrIleLeuAsnGlnLeuSerGlySerAlaArgSer SerValIleTyrGlyLysIleLeuSerIleLeuSerGluLeuArgThr LeuGlyMetGlnAsnSerAsnMetCysIleSerLeuLysLeuLysAsn ArgLysLeuProProPheLeuGluGluIleTrpAspValAlaAspMet SerHisThrGlnProProProIleLeuGluSerProThrAsnLeu <210> SEQIDNO:94 <211> LENGTH:235 <212> TYPE:PRT <213> ORGANISM:Artificial <400> SEQUENCE:94 GluMetProValAspArgIleLeuGluAlaGluLeuAlaValGluGln LysSerAspGlnGlyValGluGlyProGlyGlyThrGlyGlySerGly SerSerProAsnAspProValThrAsnIleCysGlnAlaAlaAspLys GlnLeuPheThrLeuValGluTrpAlaLysArgIleProHisPheSer SerLeuProLeuAspAspGlnValIleLeuLeuArgAlaGlyTrpAsn GluLeuLeuIleAlaSerPheSerHisArgSerIleAspValArgAsp GlyIleLeuLeuAlaThrGlyLeuHisValHisArgAsnSerAlaHis SerAlaGlyValGlyAlaIlePheAspArgValLeuThrGluLeuVal SerLysMetArgAspMetArgMetAspLysThrGluLeuGlyCysLeu ArgAlaIleIleLeuPheAsnProGluValArgGlyLeuLysSerAla GlnGluValGluLeuLeuArgGluLysValTyrAlaAlaLeuGluGlu TyrThrArgThrThrHisProAspGluProGlyArgPheAlaLysLeu LeuLeuArgLeuProSerLeuArgSerIleGlyLeuLysCysLeuGlu HisLeuPhePhePheArgLeuIleGlyAspValProIleAspThrPhe LeuMetGluMetLeuGluSerProSerAspSer