PRODUCTION OF LARGE-SIZED MICRODYSTROPHINS IN AN AAV-BASED VECTOR CONFIGURATION
20180346533 ยท 2018-12-06
Assignee
Inventors
Cpc classification
A61P21/00
HUMAN NECESSITIES
A61K48/0058
HUMAN NECESSITIES
C12N2750/14143
CHEMISTRY; METALLURGY
A61K48/0066
HUMAN NECESSITIES
C12N2799/025
CHEMISTRY; METALLURGY
A61K48/00
HUMAN NECESSITIES
International classification
A61K48/00
HUMAN NECESSITIES
A61P21/00
HUMAN NECESSITIES
Abstract
An adeno-associated viral (AAV) vector containing an expression construct, wherein: the expression construct comprises a nucleic acid sequence which encodes a microdystrophin (MD); and the nucleic acid sequence encoding the MD has a size of at least 4.1 kb.
Claims
1. An adeno-associated viral (AAV) vector comprising an expression construct, wherein: the expression construct comprises a nucleic acid sequence which encodes a microdystrophin (MD); and the nucleic acid sequence encoding the MD has a size of at least 4.1 kb.
2. The AAV vector according to claim 1, wherein the expression construct comprises two ITR sequences, and wherein the expression construct and the two ITR sequences together have a size of at least 5.1 kb.
3. The AAV vector according to claim 1, wherein the AVV vector is an AAV vector of serotype 8 (AAV8) or 9 (AAV9).
4. The AAV vector according to claim 1, wherein the expression construct further comprises a muscle-specific promoter which is operably linked to the nucleic acid sequence encoding the MD.
5. The AAV vector according to claim 1, wherein said MD comprises a partial or full-length C terminal domain.
6. The AAV vector according to claim 5, wherein said MD comprises a central rod domain and has a deletion R4-23 in the central rod domain and contains wherein the partial or full-length C terminal domain, is encoded by exons 70 to 75 or exons 70 to 79, respectively.
7. The AAV vector according to claim 5, wherein said MD comprises or consists of the sequence of SEQ ID NO: 13 or SEQ ID NO: 16, or a variant thereof having at least 80% sequence identity thereto.
8. The AAV vector according to claim 5, wherein the expression construct comprises two ITR sequences, and wherein the expression construct and the 2 ITR sequences together comprise or consist of the nucleic acid sequence of SEQ ID NO: 15 or SEQ ID NO: 18.
9. A composition comprising the AAV vector according to claim 1 and a pharmaceutically acceptable carrier.
10-12. (canceled)
13. A method for treating a subject with a dystrophic disease, comprising administering to the subject an effective amount of the composition of claim 9, thereby treating the dystrophic disease.
14. The method of claim 13, wherein the subject is a human.
15. The method of claim 14, wherein the dystrophic disease is Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD).
16. The method of claim 13, wherein herein said MD comprises a central rod domain and a partial or full C-terminal domain, and wherein said MD has a deletion R4-23 in the central rod domain and wherein the partial or full-length C terminal domain is encoded by exons 70 to 75, or exons 70 to 79, respectively.
17. The AAV vector according to claim 16, wherein said MD comprises or consists of the amino acid sequence of SEQ ID NO: 13 or SEQ ID NO: 16 or a variant thereof having at least 80% sequence identity thereto.
18. The AAV vector according to claim 2, wherein the expression construct and the two ITR sequences together have a size of less than 6 kb.
19. The AAV vector according to claim 3, wherein the AAV vector is an AAV 2/8 or an AAV 2/9 vector.
20. The AAV vector according to claim 4, wherein the muscle-specific promoter is a Spc5-12 promoter.
Description
DETAILED DESCRIPTION OF THE INVENTION
[0045] The AAV vector according to the invention is typically made of 2 components: [0046] The encapsidated recombinant nucleic acid sequence which defines the expression cassette (construct) that provides the therapeutic benefit(s) once expressed in the target cell/tissue; and [0047] The viral capsid which allows proper gene transfer and to a certain extent, tissue tropism.
[0048] In one embodiment, the present invention relates to an adeno-associated viral (AAV) vector containing an expression construct, wherein: [0049] the expression construct comprises a nucleic acid sequence which encodes a microdystrophin (MD); and [0050] the nucleic acid sequence encoding the MD has a size of at least 4.1 kb.
[0051] According to one aspect, the adeno-associated viral (AAV) vector of the invention comprises an expression construct, also named expression cassette or insert. In the frame of the present application, said insert is advantageously defined as the nucleic acid sequence located between the 5 and 3 ITR (Inverted Terminal Repeat) sequences of the AAV genome, including said ITR sequences.
[0052] According to common knowledge in the art, the size of the insert should not exceed the wild-type AAV genome length. For example, AAV2 contains 2 ITR sequences of 145 bp each and has a genome of 4682 pb (including the ITR sequences).
[0053] According to one embodiment, the expression construct comprises a nucleic acid sequence which encodes a microdystrophin (MD), advantageously a functional microdystrophin.
[0054] In the frame of the present application, microdystrophin means a peptide or protein which is shorter than the native or wild type dystrophin. In the context of the invention, the terms microdystrophin and minidystrophin have the same meaning. In the rest of the application, the term microdystrophin will be used, as well as the abbreviations MD or Dys.
[0055] The structure of dystrophin is well documented (see
[0056] A functional microdystrophin means that the corresponding peptide or protein is able to perform at least some of the functions of the wild-type dystrophin protein and is able to alleviate, at least partially, one or more of the symptoms associated with the absence of a native dystrophin, especially fiber degeneration, inflammation, necrosis, replacement of muscle with scar and fat tissue, muscle weakness, respiratory and cardiac failure, as well as premature death.
[0057] According to the invention, it is preferred that the microdystrophin displays (to a greater or lesser extent) at least one of the properties disclosed in relation with the microdystrophins of the prior art, especially MD1 (Yue, et al., Mol Ther, 2006. 14(1): 79-87) and MD2 (Koo et al., Hum Gene Ther, 2011. 22: 1379-1388).
[0058] Among others, preferred properties are: [0059] Binding with at least one DAP (dystrophin associated proteins), especially with syntrophin, dystrobrevin, nNOS and/or PAR-1b proteins; [0060] Recruitment of the DAP complex at the sarcolemma; [0061] Rescue of the microtubule network; [0062] Muscle protection from damage; [0063] Restoration of muscle structure and function. Of particular interest are the skeletal muscles, but also the cardiac muscle and the diaphragm; [0064] More generally, amelioration of muscular function, gait, cardiac function, respiratory function, survival, quality and/or expectancy of life.
[0065] As known in the art, said properties can be tested in vitro on human DMD myoblasts, ex vivo on muscle fibres isolated from e.g. mouse model, or in vivo based on animal models or even on patients suffering from DMD or BMD. Animal models are e.g. the mdx mouse (Foster H. et al., Mol Ther, 2008. 16(11): p. 1825-32), the mdx.sup.4cv mouse (Decrouy et al., Gen Ther, 1997. 4(5): 401-8), the CXMDj dog (Koo et al., J Gene Med, 2011. 13(9): 497-506) or the GRMD dog (Le Guiner et al., Mol Ther., 2014. 22(11): 1923-35). The mouse model is commonly used to test new constructs encoding microdystrophins However, this model has drawbacks because the mouse displays a less severe form of the disease, without immune reactions. The other animal model is the dog which is considered more reliable to predict the therapeutic potential of a gene therapy product in humans.
[0066] As mentioned above, the full length dystrophin is characterized by different domains: [0067] A N-terminal domain which binds to actin; [0068] 4 hinge domains (H1 to H4); [0069] 24 spectrin-like repeats or rod domains (R1 to 24); [0070] A cysteine-rich (CR) domain; [0071] A C-terminal (CT) domain.
[0072] According to one embodiment, the microdystrophin has at least one domain lacking, advantageously at least one spectrin-like-repeat.
[0073] According to a particular embodiment, the microdystrophin of the invention is derived from functional microdystrophins of the prior art (
[0076] Advantageously, the microdystrophins according to the invention contains further CT domains.
[0077] Of particular interest are microdystrophin having a further extended C-terminal domain, i.e. a partial or full-length CT domain. Indeed, the C-terminal region of dystrophin may have an important function in the full assembly of the DAP complex, including members of syntrophin and dystrobrevin protein families, which have been implicated in signalling: [0078] Amino acids 457-497 of dystrobrevin bind to the first set of heptad repeats of dystrophin (amino acids 3,501-3,541); [0079] The 1-syntrophin, and 1-syntrophin binding site is delineated to exon 73-74, and exon 74-75 of dystrophin, respectively. Syntrophin (, 1, and 2) interacts with several proteins including nNOS, voltage-gated sodium channels, stress-activated protein kinase-3, and a microtubule-associated serine/threonine kinase. Interaction between 1-syntrophin, nNOS and plasma membrane Ca.sup.2+/calmodulin-dependent ATPase was also found; [0080] The dystrobrevin family ( and () binds both syntrophin and the coiled coil motifs of the CT domain of dystrophin. Dystrobrevin has a signalling function and contributes to the structural stability of dystrophin containing glycoprotein complex (DGC). Dp71, one of the C-terminal dystrophin isoforms predominantly localises to the nucleus, which implies the potential function of the C-terminal dystrophin in the nucleus.
[0081] Advantageously, such microdystrophins comprise the coiled-coil region helix 1 and 2 (encoded by exons 70 to 75) or the entire CT domain (encoded by exons 70 to 79). According to a specific embodiment, they are derived from MD1 and comprise 4 spectrin-like repeats, i.e. spectrin-like repeats 1, 2, 3 and 24 (R4-R23), and a C-terminal domain as defined above.
[0082] As illustrated in
respectively.
[0085] According to a preferred embodiment, the microdystrophin to be produced with the claimed AAV vector contains at least 1350 amino acids (aa), advantageously at least 1400 aa, 1450 aa, 1500 aa, or 1550 aa. According to another embodiment, the microdystrophin to be produced with the claimed AAV vector contains no more than 1800 amino acids (aa), advantageously no more than 1750 aa, 1700 aa, 1650 aa, or 1600 aa.
[0086] According to one embodiment, the microdystrophin to be produced with the claimed AAV vector is substantially identical, that is, is about 60% identical, more preferably about 70% identical, even more preferably about 80% identical, more preferably about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even more preferably about 99% identical to the microdystrophins disclosed therein, especially those of sequence SEQ ID NO: 1, SEQ ID NO: 7, SEQ ID NO: 13, SEQ ID NO: 4, SEQ ID NO: 10 or SEQ ID NO: 16.
[0087] The present invention also concerns nucleic acid sequences encoding such a microdystrophin.
[0088] In one embodiment, the nucleic acid sequence comprised in the expression construct and encoding the microdystrophin (MD), also named ORF for open reading frame, is a cDNA. However, e.g. single- or double-stranded DNA or RNA can be used.
[0089] In the frame of the invention, nucleic acid sequences encoding microdystrophin (MD) are shorter than the wild-type dystrophin cDNA.
[0090] According to one specific embodiment of the present invention, the size of the nucleic acid sequence encoding the microdystrophin (ORF) exceeds 4 kb (4000 bp). According to one preferred embodiment, the nucleic acid sequence encoding the MD has a size of at least 4050 pb (4.05 kb), preferably 4100 bp (4.1 kb) or even more preferably of at least 4150, 4200, 4250, 4300, 4350, 4400, 4450, 4500, 4550, 4600, 4650, 4700, 4750, 4800, 4850, 4900, 4950, or 5000 bp.
[0091] According to a specific embodiment, the AAV vector according to the invention is not used in combination with a proteasome inhibitor. Alternatively, the AAV vector according to the invention is used in combination with a proteasome inhibitor. In the frame of the application, the wording used in combination is similar to combined or associated and means that both (the AAV vector and the proteasome inhibitor) can be formulated in the same composition, or formulated in two distinct compositions for simultaneous, separate or sequential administration. Proteasome inhibitors are molecules (chemical compounds, peptides, proteins, antibodies, nucleic acids . . . ) able to block the action of proteasomes, protease complexes which are responsible for degrading proteins. Examples include: Lactacystin, Bortezomib, Disulfiram, Epigallocatechin-3-gallate, Carfilzomib, Celastrol, ONX0912, CEP-18770, MLN9708, Marizomib, Epoxomicin, LLnL (N-acetyl-.sub.L-leucinyl-.sub.L-leucinyl-nor-leucinal) and MG132.
[0092] The nucleic acid sequence encoding the microdystrophin is advantageously of human origin but can also be a canine, a rat, a murine or a non-human primate sequence. In one embodiment, the nucleic acid sequence originates from the organism it will be administered to (e.g. a human sequence in humans).
[0093] Basically, the nucleic acid sequence encoding the microdystrophin (MD) is an open reading frame beginning with a start codon and ending with a stop codon. However and according to a specific embodiment, said sequence can be modified in different ways.
[0094] According to one preferred embodiment, the nucleic acid sequence encoding said microdystrophin is optimized for use in a given subject, advantageously in humans. Preferably, the sequence is modified as follows: [0095] The sequence is modified to include a consensus Kozak sequence before AUG start codon within mRNA, to improve initiation of translation. [0096] The sequence is optimized based on transfer RNA frequencies in the subject (preferably human) and GC content is increased to promote RNA stability. As a result and in a specific case, codon optimization for humans advantageously leads to 63% of codons being modified and the GC content increased to over 60%. This of course depends on the original (before optimization) microdystrophin sequence and the target host.
[0097] In relation with the microdystrophins disclosed above, said nucleic acid sequence is advantageously chosen in the group consisting of: SEQ ID NO: 2 (mMD3), SEQ ID NO: 5 (mMD4), SEQ ID NO: 8 (cMD3), SEQ ID NO: 11 (cMD4), SEQ ID NO: 14 (hMD3), SEQ ID NO: 17 (hMD4), or a sequence substantially identical thereto.
[0098] According to one embodiment, the nucleotide sequence of an isolated nucleic acid encoding a peptide of the invention is substantially identical, that is, is about 60% identical, more preferably about 70% identical, even more preferably about 80% identical, more preferably about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even more preferably about 99% identical to said sequences.
[0099] As mentioned above, the expression construct comprises the nucleic acid sequence encoding the transgene of interest, in the present case a microdystrophin (MD), the 2 ITR sequences but also all the sequences required for a proper expression of said MD.
[0100] According to another embodiment, the AAV vector of the invention contains an expression construct (including the 2 ITR sequences) which has a size exceeding 5 kb or even 5.1 kb.
[0101] According to a preferred embodiment, the expression construct has a size of at least 5100 pb (5.1 kb), preferably 5150 bp, or even more preferably of at least 5200, 5250, 5300, 5350, 5400, 5450, 5500, 5550, 5600, 5650, 5700, 5750, 5800, 5850, 5900, 5950, or 6000 bp. According to a specific case, this embodiment is in the absence of any proteasome inhibitor.
[0102] According to another embodiment, the expression construct has a size of less than 7000 bp (7 kb), preferably of less than 6500 pb, or even more preferably of less than 6450, 6400, 6350, 6300, 6250, 6200, 6150, 6100, 6050, or even 6000 bp. According to a specific case, this embodiment is in the absence of any proteasome inhibitor.
[0103] Advantageously, the size of the expression construct is between 5.1 and 6 kb, advantageously between 5.2 and 5.8 kb, more advantageously between 5.15 and 5.75 kb. Without being bound to any theory, a controlled size of the invert prevents the so called fragmentation.
[0104] In one embodiment, the expression construct further comprises regulatory sequences, especially a promoter sequence. Such promoters can be natural or synthetic (artificial) promoters, inducible or constitutive.
[0105] In one embodiment, the promoter is an ubiquitous promoter or having a low tissue-specificity. As an example, the expression vector can harbor the phosphoglycerate kinase 1 (PGK), EF1, -actin, CMV promoter.
[0106] In a preferred embodiment, the promoter sequence is chosen in order to adequately govern the expression of the nucleic acid sequence placed under its control, in terms of expression level, but also of tissue specificity.
[0107] In one embodiment, the expression vector comprises a muscle specific promoter. Such a promoter allows a robust expression in the skeletal muscles, and possibly in the cardiac muscle as well as in the diaphragm. Examples of suitable promoters known by the skilled person are e.g. the desmin promoter, the muscle creatine kinase (MCK) promoter, truncated creatine kinase promoters such as e.g. CK6, CK7 or CK8 promoter, and the Syn promoter. Another promoter is the synthetic promoter C5-12 (spC5-12) of 334 bp size as shown for example in sequence SEQ ID NO: 3 (nucleotides 253 to 586), or derivatives thereof, which allow a robust expression in skeletal and cardiac muscles.
[0108] Advantageously, the nucleic acid sequence encoding the MD is placed under the control of a muscle-specific promoter. In other words, the expression construct further comprises a muscle-specific promoter which is operably linked to the nucleic acid sequence encoding the MD.
[0109] A non-exhaustive list of other possible regulatory sequences to be inserted in the expression construct encoding the microdystrophin is: [0110] a polyadenylation signal, e.g. the polyA of the gene of interest, the polyA of SV40 or of beta hemoglobin (HBB2), advantageously in 3 of the sequence encoding the microdystrophin ; The poly A of SV40 is for example disclosed in sequence SEQ ID NO: 3 (nucleotides 4852 to 5091); [0111] sequences for transcript stabilization, e.g. intron 1 of hemoglobin (HBB2); [0112] enhancer sequences ; [0113] miRNA target sequences, which can inhibit the expression of the sequence encoding the microdystrophin in non target tissues, in which said expression is not desired, for example where it can be toxic. Preferably, the corresponding miRNA is not present in the skeletal muscles, and possibly not in the diaphragm nor in the heart. Of particular interest are molecules or sequences which prevent expression in the cells of the hematopoietic (immune) system and the liver.
[0114] As previously mentioned and for recombinant AAV production, the nucleic acid sequence encoding the microdystrophin is inserted between the ITR (Inverted Terminal Repeat) sequences of an AAV vector, advantageously of serotype 2 (http://www.biotechniques.com/multimedia/archive/00232/BTN_A_000114170_O_2326 25a.pdf)). Typical ITR sequences correspond to: [0115] nucleotides 1 to 145 of sequence SEQ ID NO: 3 (5ITR sequence); [0116] nucleotides 5138 to 5283 of sequence SEQ ID NO: 3 (3ITR sequence).
[0117] In relation with the large-sized microdystrophins disclosed therein, the gene therapy product i.e. the AAV vector advantageously comprises or consists of a sequence selected from the group consisting of: SEQ ID NO: 3 (mMD3), SEQ ID NO: 6 (mMD4), SEQ ID NO: 9 (cMD3), SEQ ID NO: 12 (cMD4), SEQ ID NO: 15 (hMD3) and SEQ ID NO: 18 (hMD4).
[0118] As mentioned above, the invention also encompasses substantially identical sequences, that is, displaying about 60% identity, more preferably about 70% identity, even more preferably about 80% identity, more preferably about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even more preferably about 99% identical to said sequences.
[0119] For cloning purposes and production of viral particles, the expression construct can be inserted in a plasmid suitable for selection, replication and production of the cloned MD.
[0120] According to the invention, the viral vector containing the expression construct is an adeno-associated viral (AAV) vector.
[0121] Adeno-associated viral (AAV) vectors have become powerful gene delivery tools for the treatment of various disorders. AAV vectors possess a number of features that render them ideally suited for gene therapy, including a lack of pathogenicity, moderate immunogenicity, and the ability to transduce postmitotic cells and tissues in a stable and efficient manner. Expression of a particular gene contained within an AAV vector can be specifically targeted to one or more types of cells by choosing the appropriate combination of AAV serotype, promoter, and delivery method.
[0122] In one embodiment, the encoding sequence is contained within an AAV vector. More than 100 naturally occurring serotypes of AAV are known. Many natural variants in the AAV capsid exist, allowing identification and use of an AAV with properties specifically suited for dystrophic pathologies. AAV viruses may be engineered using conventional molecular biology techniques, making it possible to optimize these particles for cell specific delivery of nucleic acid sequences, for minimizing immunogenicity, for tuning stability and particle lifetime, for efficient degradation, for accurate delivery to the nucleus.
[0123] As mentioned above, the use of AAVs is a common mode of exogenous delivery of DNA as it is relatively non-toxic, provides efficient gene transfer, and can be easily optimized for specific purposes. Among the serotypes of AAVs isolated from human or non-human primates (NHP) and well characterized, human serotype 2 is the first AAV that was developed as a gene transfer vector. Other currently used AAV serotypes include AAV1, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 and AAV12. In addition, non-natural engineered variants and chimeric AAV can also be useful.
[0124] Desirable AAV fragments for assembly into vectors include the cap proteins, including the vp1, vp2, vp3 and hypervariable regions, the rep proteins, including rep 78, rep 68, rep 52, and rep 40, and the sequences encoding these proteins. These fragments may be readily utilized in a variety of vector systems and host cells.
[0125] Such fragments may be used alone, in combination with other AAV serotype sequences or fragments, or in combination with elements from other AAV or non-AAV viral sequences. As used herein, artificial AAV serotypes include, without limitation, AAV with a non-naturally occurring capsid protein. Such an artificial capsid may be generated by any suitable technique, using a selected AAV sequence (e.g., a fragment of a vp1 capsid protein) in combination with heterologous sequences which may be obtained from a different selected AAV serotype, non-contiguous portions of the same AAV serotype, from a non-AAV viral source, or from a non-viral source. An artificial AAV serotype may be, without limitation, a chimeric AAV capsid, a recombinant AAV capsid, or a humanized AAV capsid. Thus exemplary AAVs, or artificial AAVs, include AAV2/8 (U.S. Pat. No. 7,282,199), AAV2/5 (available from the National Institutes of Health), AAV2/9 (WO2005/033321), AAV2/6 (U.S. Pat. No. 6,156,303), and AAVrh8 (WO2003/042397), among others. In one embodiment, the vectors useful in the compositions and methods described herein contain, at a minimum, sequences encoding a selected AAV serotype capsid, e.g., an AAV8 capsid, or a fragment thereof. In another embodiment, useful vectors contain, at a minimum, sequences encoding a selected AAV serotype rep protein, e.g., AAV8 rep protein, or a fragment thereof. Optionally, such vectors may contain both AAV cap and rep proteins. In vectors in which both AAV rep and cap are provided, the AAV rep and AAV cap sequences can both be of one serotype origin, e.g., all AAV8 origin. Alternatively, vectors may be used in which the rep sequences are from an AAV serotype, which differs from that which is providing the cap sequences. In one embodiment, the rep and cap sequences are expressed from separate sources (e.g., separate vectors, or a host cell and a vector). In another embodiment, these rep sequences are fused in frame to cap sequences of a different AAV serotype to form a chimeric AAV vector, such as AAV2/8 (U.S. Pat. No. 7,282,199).
[0126] According to one embodiment, the composition comprises an AAV of serotype 2, 5, 8 or 9. Advantageously, the claimed vector is an AAV8 or AAV9 vector, especially an AAV2/8 or AAV2/9 vector. More advantageously, the claimed vector is an AAV8 vector or an AAV2/8 vector. In the AAV vectors used in the present invention, the AAV genome may be either a single stranded (ss) nucleic acid or a double stranded (ds), self complementary (sc) nucleic acid.
[0127] As known in the art, recombinant viral particles can be obtained, e.g. by tri-transfection of 293 HEK cells, by the herpes simplex virus system and by the baculovirus system. Advantageously, the viral particles are obtained by tri-transfection of 293 HEK cells.
[0128] The vector titers are usually expressed as viral genomes per ml (vg/ml). In a surprising manner and despite the large size of the MD disclosed in the present invention, viral titers above 1.10.sup.11, preferably above 5.10.sup.11, 1.10.sup.12, 5.10.sup.12 and even more preferably above 1.10.sup.13vg/ml can be obtained.
[0129] According to another aspect, the present invention concerns a composition, advantageously a therapeutic composition or medicament, comprising the AAV vector as disclosed above and possibly other active molecules (other gene therapy products, chemical molecules, peptides, proteins, . . . ), dedicated to the treatment of the same disease or another disease.
[0130] According to a specific embodiment, the composition does not comprise any proteasome inhibitor. Alternatively, said composition further comprises a proteasome inhibitor.
[0131] The present invention then provides pharmaceutical compositions comprising a nucleic acid of the invention, or the vector of the invention. Such compositions comprise a therapeutically effective amount of the therapeutic (the nucleic acid or vector of the invention), and a pharmaceutically acceptable carrier. In a specific embodiment, the term pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. or European Pharmacopeia or other generally recognized pharmacopeia for use in animals, and humans. The term carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like.
[0132] The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsions, sustained-release formulations and the like. Examples of suitable pharmaceutical carriers are described in Remington's Pharmaceutical Sciences by E. W. Martin. Such compositions will contain a therapeutically effective amount of the therapeutic, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the subject.
[0133] In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lidocaine to release pain at the site of the injection.
[0134] In one embodiment, the composition according to the invention is suitable for administration in humans. The composition is preferably in a liquid form, advantageously a saline composition, more advantageously a phosphate buffered saline (PBS) composition or a Ringer-Lactate solution.
[0135] The amount of the therapeutic (i.e. a nucleic acid or a vector) of the invention which will be effective in the treatment of dystrophic diseases can be determined by standard clinical techniques. In addition, in vivo and/or in vitro assays may optionally be employed to help predict optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, the weight and the seriousness of the disease, and should be decided according to the judgment of the practitioner and each patient's circumstances.
[0136] The above-disclosed AAV vector or composition can be used as a medicament, especially as a gene therapy product, to be administered to a subject in need thereof. According to another aspect, the present invention concerns the use of the above-disclosed AAV vector or composition for the preparation of a medicament.
[0137] Suitable administration should allow the delivery of a therapeutically effective amount of the gene therapy product to the target tissues, especially skeletal muscles and possibly diaphragm and heart. In the context of the invention, when the gene therapy product is a viral vector comprising a nucleic acid sequence encoding a microdystrophin, the therapeutic dose is defined as the quantity of viral particles (vg for viral genomes) containing the microdystrophin sequence, administered per kilogram (kg) of the subject.
[0138] Available routes of administration are topical (local), enteral (system-wide effect, but delivered through the gastrointestinal (GI) tract), or parenteral (systemic action, but delivered by routes other than the GI tract). Preferred route of administration of the compositions disclosed herein is parenteral and includes intramuscular administration (i.e. into the muscle) and systemic administration (i.e. into the circulating system). In this context, the term injection (or perfusion or infusion) encompasses intravascular, in particular intravenous (IV), and intramuscular (IM) administration. Injections are usually performed using syringes or catheters.
[0139] In one embodiment, systemic delivery of the composition comprises administering the composition near a local treatment site, i.e. in a vein or artery nearby a weakened muscle. In certain embodiments, the invention comprises the local delivery of the composition, which produces systemic effects. This route of administration, usually called regional (loco-regional) infusion, administration by isolated limb perfusion or high-pressure transvenous limb perfusion has been successfully used as a gene delivery method in muscular dystrophy (Zheng Fan et al. (2012, Molecular Therapy 20(2), 456-461).
[0140] According to one aspect, the composition is administered to an isolated limb (loco-regional) by infusion or perfusion. In other words, the invention comprises the regional delivery of the composition in a leg and/or arm by an intravascular route of administration, i.e. a vein (transveneous) or an artery, under pressure. This is usually achieved by using a tourniquet to temporarily arrest blood circulation while allowing a regional diffusion of the infused product, as e.g. disclosed by Toromanoff et al. (2008, Molecular Therapy 16(7):1291-99), Arruda et al. (2010, Blood 115(23):4678-88) and Zheng Fan et al. (2012, Molecular Therapy 20(2), 456-461).
[0141] In one embodiment, the composition is injected in a limb of the subject. In one embodiment, the subject is a mammal, preferably a human, a dog or a nonhuman primate. When the subject is a human, the limb can be the arm or the leg. According to one embodiment, the composition is administered in the lower part of the body of the subject, e.g. below the knee, or in the upper part of the body of the subject, e.g., below the elbow.
[0142] In one embodiment, the composition is administered to a peripheral vein, e.g. the cephalic vein. The volume of the composition to be infused can be in a range that varies between about 5 and 40% of the limb volume. The typical dose can vary between 5 and 30 ml/kg of body weight. In one embodiment, the pressure to be applied (tourniquet pressure or maximum line pressure) is below 100 000 Pa, advantageously below 50 000 Pa. In a preferred embodiment, the pressure applied is around 300 torr (40 000 Pa).
[0143] In one embodiment, the blood circulation of the limb is stopped using a tourniquet that is tightened for several minutes to more than one hour, typically between about 1 and 80 minutes, for example about 30 minutes. In a preferred embodiment, the tourniquet was applied before, during and after the administration, for example about 10 minutes prior to, about 20 minutes during and about 15 min after the infusion. More generally, the pressure is applied for several minutes, typically between about 1 and 80 minutes, for example about 30 minutes. In a preferred embodiment, the pressure is applied before, during and after the administration, for example about 10 minutes prior to, about 20 minutes during and about 15 minutes after the infusion.
[0144] In one embodiment, the average flow rate is comprised between 5 and 150 ml/min, advantageously between 5 and 80 ml/min, for example 10 ml/min. Of course, the flow rate also determines the time period during which the blood circulation is stopped and the pressure applied.
[0145] A preferred method of administration according to the invention is systemic administration. Systemic injection opens the way to an injection of the whole body, in order to reach the entire muscles of the body of the subject including the heart and the diaphragm and then a real treatment of these systemic and still incurable diseases. In certain embodiments, systemic delivery comprises delivery of the composition to the subject such that composition is accessible throughout the body of the subject.
[0146] According to a preferred embodiment, systemic administration occurs via injection of the composition in a blood vessel, i.e. intravascular (intravenous or intra-arterial) administration. According to one embodiment, the composition is administered by intravenous injection, through a peripheral vein. Alternatively, systemic administration occurs via intramuscular injection.
[0147] According to one embodiment, the composition is administered by intravenous injection, through a peripheral vein.
[0148] The systemic administration is typically performed in the following conditions: [0149] a flow rate of between 1 to 10 ml/min, advantageously between 1 to 5 ml/min, e.g. 3 ml/min; [0150] the total injected volume can vary between 1 and 10 ml, preferably 5 ml of vector preparation per kg of the subject. The injected volume should not represent more than 10% of total blood volume, preferably around 6%.
[0151] When systemically delivered, the composition is preferably administered with a dose less than or equal to 10.sup.15 vg/kg or even 10.sup.14 vg/kg, advantageously between 10.sup.12 vg/kg and 10.sup.14 vg/kg, more advantageously between 5.10.sup.12 vg/kg and 10.sup.14 vg/kg, e.g. 1, 2, 3, 4, 5, 6, 7, 8 or 9.10.sup.13 vg/kg. A lower dose of e.g. 1, 2, 3, 4, 5, 6, 7, 8 or 9.10.sup.12 vg/kg can also be contemplated in order to avoid potential toxicity and /or immune reactions. As known by the skilled person, a dose as low as possible given a satisfying result in term of efficiency is preferred.
[0152] In a specific embodiment, the treatment comprises a single administration of the composition.
[0153] In one embodiment, the presence of the AAV vector and/or the expression of the microdystrophin, as well as the associated therapeutic benefits, are observed for up to 1 month, or 3 months or 6 months or even 1 year, 2 years, 5 years, 10 years, or even more the whole life of the subject.
[0154] According to the invention, the subject is preferably a human, but can also be a mouse, a rat, a nonhuman primate or a dog.
[0155] Dystrophic disease means a disease linked to a defect in the dystrophin gene. This defect can be deletions or mutations leading to low level of expression or absence of expression, introduction of a premature stop codon in the open reading frame, or the production of an inactive protein. Preferred dystrophic diseases are Duchenne and Becker muscular dystrophy (DMD/BMD) caused by mutations of the dystrophin gene. Said mutations can result in the absence or a low level of dystrophin expression, or in the production of a partially or fully inactive, possibly truncated, protein.
[0156] Subjects that could benefit from the compositions of the invention include all patients diagnosed with a muscular dystrophy or at risk of developing such a muscular dystrophy. A subject to be treated can then be selected based on the identification of mutations or deletions in the dystrophin gene by any method known to the one skilled in the art, including for example sequencing of the dystrophin gene, and/or through the evaluation of the dystrophin level of expression or activity by any method known to the one skilled in the art. Therefore, said subjects include both subjects already exhibiting symptoms of a dystrophic disease and subjects at risk of developing said disease. In one embodiment, said subjects include subjects already exhibiting symptoms of a dystrophic disease. In another embodiment, said subjects are ambulatory patients and early non-ambulant patients.
[0157] According to one embodiment, the invention concerns an AAV vector as disclosed above or a composition comprising said AAV vector for use in the treatment of a dystrophic disease. According to another embodiment, the invention concerns the use of an AAV vector as disclosed above or a composition comprising said AAV vector for the preparation of a medicament for the treatment of a dystrophic disease.
[0158] In other words, the present invention provides a method for treating a dystrophic disease in a subject, comprising administrating to the subject an AAV vector as disclosed above or a composition comprising said AAV vector.
[0159] According to a specific embodiment, the claimed treatment is not combined with a treatment with a proteasome inhibitor. Alternatively, the subject is treated with a proteasome inhibitor in a simultaneous, separate or sequential manner.
[0160] Such AAV vectors and compositions comprising said vectors are notably intended for gene therapy, particularly for the treatment of subjects suffering from Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy (BMD). A first target of is to provide a safe (not toxic) treatment. A further aim is to provide an efficient treatment which allows to postpone, slow down or prevent the development of the disease, and possibly to ameliorate the phenotype of the patient which can be easily monitored at the clinical level. In a subject, AAV vectors and compositions according to the invention can be used: [0161] for ameliorating muscular function. Of particular interest are the skeletal muscles, but also the cardiac muscle and the diaphragm; [0162] for ameliorating gait; [0163] for ameliorating cardiac function; [0164] for ameliorating respiratory function; [0165] for prolonging survival, more generally to ameliorate the quality and the expectancy of life.
[0166] In conclusion, the present invention reports the possibility to use AAV vectors, especially of serotype 8 and 9, for packaging nucleic acid sequences encoding large-sized microdystrophins As a result, it is possible to design new microdystrophins having further domains potentially relevant for improved activity.
[0167] As illustrated in the examples below and in an unexpected manner, it is possible to obtain: [0168] an acceptable level of viral particles compatible with in vivo applications; [0169] an acceptable level of intact (not deleted) and active microdystrophins
[0170] Therefore, AAV vectors encoding large-sized microdystrophins are potential gene therapy products with the following characteristics: [0171] A product which can be systemically (e.g. by intramuscular injection, intravascular injection, especially intravenous injection, or by loco-regional administration) administered, at a reasonable dose (i.e. a proper gene transfer in the target tissues) and possibly by a unique injection; [0172] A product which has acceptable toxicity at that dose, and especially does not induce an adverse immune response against the dystrophin protein; [0173] A product having a satisfying tropism, i.e. a wide spread gene transfer on large territories of skeletal muscles, but also diaphragm and myocardium; [0174] A product able to ameliorate the dystrophic disease in humans.
[0175] The practice of the present invention employs, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are well within the purview of the skilled artisan. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, fourth edition (Sambrook, 2012); Oligonucleotide Synthesis (Gait, 1984); Culture of Animal Cells (Freshney, 2010); Methods in Enzymology Handbook of Experimental Immunology (Weir, 1997); Gene Transfer Vectors for Mammalian Cells (Miller and Calos, 1987); Short Protocols in Molecular Biology (Ausubel, 2002); Polymerase Chain Reaction: Principles, Applications and Troubleshooting, (Babar, 2011); Current Protocols in Immunology (Coligan, 2002). These techniques are applicable to the production of the polynucleotides and polypeptides of the invention, and, as such, may be considered in making and practicing the invention. Particularly useful techniques for particular embodiments will be discussed in the sections that follow.
[0176] The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety.
[0177] Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods.
EXPERIMENTAL EXAMPLES
[0178] The invention is further described in detail by reference to the following experimental examples and the attached figures. These examples are provided for purposes of illustration only, and are not intended to be limiting.
BRIEF DESCRIPTION OF THE FIGURES
[0179]
[0180]
[0181]
[0182] C2C12 myoblast cultures were transfected with pAAV-mMD1, -mMD2, -mMD3, and -mMD4 plasmids (tracks 1-4) or with no DNA (track 5 and 6). After 2days, RNA was isolated and analysed by RT-PCR using primers (panel A), while RNA was analysed by PCR using same primers (panel B). Lane 7 in panel B shows a positive control samples amplifying from pAAVmMD1 plasmids. PCR products were analysed by 1% agarose gel electrophoresis and visualised by ethidium bromide staining.
[0183]
[0184] Plasmid vectors were introduced into TA muscles of mdx mice by eletrotranfer. After 8 days, muscles were recovered and subjected to immunohistology for the dystrophin staining. Low magnification bright-field micrographs are shown for pAAV mMD1 (A), pAAVmMD2 (B), pAAV mMD3 (C) and pAAV mMD4 (D). The number of microdystrophin-positive fibres were counted as described in the histogram (E); mean SE (n=4). There was no significant difference between the constructs by statistical analysis.
[0185]
[0186] Samples of AAV vector preparations were lysed by treatment with proteinase K, and viral DNA was purified and spotted onto a membrane filter, along with a series of plasmid standards. Filters were then hybridised to a digoxin-labelled probe, and developed with anti-digoxin antibody, the ECL system, and exposure of filters to X-ray film. A montage of developed X-ray film is shown. A. pAAV-mMD1 plasmid standards: 1. 160 ng, 2. 80 ng, 3. 40 ng, 4. 20 ng, 5. 10 ng, 6. 5 ng, 7. 2.5 ng, 8. 1.25 ng, 9. 0.625 ng. B. Extracts of AAV preparations (1 ml): 1. AAV2/9-mMD1, 2. AAV2/9-mMD2, 3. AAV2/9-mMD3, 4. AAV2/9-mMD4. C. Extracts of AAV preparations (2ml): 1. AAV2/9-mMD1, 2. AAV2/9-mMD2, 3. AAV2/9-mMD3, 4. AAV2/9-mMD4.
[0187]
[0188] The TA muscles of eight week old mdx mice were injected with 210.sup.10 vg of AAV 2/9-mMD1, mMD2, mMD3, and mMD4. TA muscles were recovered eight weeks after injection and processed for cryosectioning. The sections were subjected to immunohistochemical labelling with an antibody (Manex 1011C) against dystrophin. Panels A-F shows AAV2/9-mMD1, mMD2, mMD3, mMD4, C57BL10 and mdx, respectively. Control muscle from age-matched mdx and C57BL/10 were injected with saline only.
[0189]
[0190] The TA muscles of eight week old mdx mice were injected with 2 10.sup.10 vg of rAAV 2/9-mMD1, mMD2, mMD3, and mMD4. TA muscles were recovered at eight weeks after injection and processed for cryosectioning. The sections were subjected to immune-peroxidase labeling with an antibody (Manex 1011C) against dystrophin. Low magnification bright-field micrographs are shown for AAV2/9-mMD1 (a), AAV2/9-mMD2 (b), AAV2/9-mMD3 (c), and AAV2/9-mMD4 (d). Control muscle from age-matched B57BL/10 (e) and mdx (f) were injected with saline only.
[0191]
[0192]
[0193]
[0194] a) Dystrophin N-terminal domain (Manex1011B antibody), dystrophin C-terminus domain (Dys2 antibody), -sarcoglycan, -syntrophin and -dystrobrevin immunostaining of mdx4cv TA muscles injected with saline, AAV2/9-Dys-CTL (mMD4) b) TA muscle weight of C57BL/6 control mice (C57,n=8) compared to TA muscles of mdx4cv mice (n=8) injected with saline (mdx4cv) or AAV2/9-Dys-CTL (mMD4) c) Specific maximal force (sP0) of TA muscles of C57BL/6 control mice (C57, n=8) compared to TA muscles of mdx4cv mice (n=8) injected with saline (mdx4cv) or AAV2/9-Dys-CTL (mMD4) d) Resistance to eccentric contractions. Absolute maximal force (P0) following lengthening contractions of TA muscles of C57BL/6 control mice (C57, n=8) compared to TA muscles of mdx4cv mice (n=8) injected with saline (mdx4cv) or AAV2/9-Dys-CTL (mMD4) (Bars indicate s.c.m, * indicates p<0.05; ** indicates p<0.01 compared to mdx4cv condition. Scale bar indicates 50 m.)
[0195]
[0196]
[0197]
[0198]
[0199] Design of Novel Micro-Dystrophin (MD) Constructs with C Terminal Extensions
[0200] 1 Construction of CT Domains Containing Microdystrophins:
[0201] In order to construct CT domain containing microdystrophin variants, human (h), murine (m) and canine (c) specific and codon-optimised microdystrophin (MD) 1 cDNA format was used as the original template. This MD1 cDNA format was based on a widely used design which incorporates deletions of the coding sequence of rod domains 4-23 and the CT domain of the dystrophin. The MD1 encoded microdystrophin thus retains the N-terminal (NT) domain, hinge regions 1, 2 and 4 of spectrin repeats in rod domain, 1, 2, 3 and 24 of cystein-rich (CR) domain and three amino acids of exon 79 of dystrophin (see
[0202] Three CT domain containing microdystrophin cDNAs were designed and generated incorporating either part of, or the full CT domain sequence of dystrophin, and based on the originally synthesised MD1 codon optimised-microdystrophin (
[0203] Of particular interest are the MD3 and MD4 proteins which size is predicted to be above the packaging capacity of the AAV vectors.
[0204] The corresponding amino acid sequences are as follows: [0205] mMD3: SEQ ID NO: 1 of 1394 aa [0206] mMD4: SEQ ID NO: 4 of 1473 aa [0207] cMD3: SEQ ID NO: 7 of 1393 aa [0208] cMD4: SEQ ID NO: 10 of 1472 aa [0209] hMD3: SEQ ID NO: 13 of 1392 aa [0210] hMD4: SEQ ID NO: 16 of 1471 aa
[0211] 2 Optimization of the Corresponding mRNA Sequences:
[0212] Codon usage of each microdystrophin cDNA was codon-optimised by increasing GC content in the sequence to promote RNA stability based on transfer RNA frequencies in human. Although murine or canine cDNA of microdystrophins were optimised based on human sequences, codon usage and transfer RNA frequencies shows similarity among the vertebrates (Hastings, Emerson 1983). Optimal consensus Kozak sequence (GCCACCATGC) including ATG start codon was incorporated to improve the initiation of the translation. Additionally 5- and 3-untranslated regions of the dystrophin cDNA were removed to decrease the size of the microdystrophin cassette flanked by ITR.
[0213] The corresponding optimized cDNA sequences are as follows: [0214] mMD3: SEQ ID NO: 2 of 4191 bp [0215] mMD4: SEQ ID NO: 5 of 4428 bp [0216] cMD3: SEQ ID NO: 8 of 4188 bp [0217] cMD4: SEQ ID NO: 11 of 4425 bp [0218] hMD3: SEQ ID NO: 14 of 4185 bp [0219] hMD4: SEQ ID NO: 17 of 4422 bp
[0220] 3 Construction of the New AAV-MD Plasmids:
[0221] In order to be able to produce AAV vectors in due course, the various MDs were incorporated into an AAV vector plasmid under control of the muscle specific Spc5-12 promoter and incorporating the SV40 poly-adenylation site (
[0222] Construction of MD3 and MD4 microdystrophin plasmids was accomplished by AvrII/NotI mediated subcloning, using the pAAVSpc512-MD1 plasmid (disclosed e.g. in Koo et al., J Gene Med, 2011. 13(9): 497-506) as the original template (
[0223] Human (h), murine (m), and canine (c) species-specific MD1, MD2, MD3 and mMD4 cDNA was inserted between Spc5-12 muscle specific promoter and SV40 polyadenylation signal. All microdystrophin codon was optimised and this cassette was flanked by two inverted terminal repeats (ITRs) of AAV serotype 2 at the 5 and 3 end of the microdystrophin. To validate species homologues (m; murine, h; human, c; canine), extension of the C-terminal domain of dystrophin (MD1, MD2, MD3, and MD4) and 5 or 3 ITR presence and restriction endonuclease mapping analysis of cloned microdystrophin variants were performed with several enzymes.
[0224] As shown on
[0230] The Inverted Terminal Repeat (ITR) sequences of 145 bases each have the following sequences:
TABLE-US-00001 5aggaacccctagtgatggagttggccactccctctctgcg cgctcgctcgctcactgaggccgcccgggcaaagcccggg cgtcgggcgacctttggtcgcccggcctcagtgagcgagc gagcgcgcagagagggagtggccaa-3
[0231] The Spc512 muscle synthetic promoter of 334 bp has the following sequence:
TABLE-US-00002 ggccgtccgccctcggcaccatcctcacgacacccaaata tggcgacgggtgaggaatggtggggagttatttttagagc ggtgaggaaggtgggcaggcagcaggtgttggcgctctaa aaataactcccgggagttatttttagagcggaggaatggt ggacacccaaatatggcgacggttcctcacccgtcgccat atttgggtgtccgccctcggccggggccgcattcctgggg gccgggcggtgctcccgcccgcctcgataaaaggctccgg ggccggcggcggcccacgagctacccggaggagcgggagg cgccaagctctaga
[0232] The 240 bp SV40polyA signal sequence has the following sequences :
TABLE-US-00003 agacatgataagatacattgatgagtttggacaaaccaca actagaatgcagtgaaaaaaatgctttatttgtgaaattt gtgatgctattgctttatttgtaaccattataagctgcaa taaacaagttaacaacaacaattgcattcattttatgttt caggttcagggggagatgtgggaggttttttaaagcaagt aaaacctctacaaatgtggtaaaatccgataaggactaga
[0233] Other possible sequences are:
TABLE-US-00004 cagacatgataagatacattgatgagtttggacaaaccac aactagaatgcagtgaaaaaaatgctttatttgtgaaatt tgtgatgctattgctttatttgtaaccattataagctgca ataaacaagttaacaacaacaattgcattcattttatgtt tcaggttcagggggagatgtgggaggttttttaaagcaag taaaacctctacaaatgtggta Or atctagataactgatcataatcagccataccacatttgta gaggttttacttgctttaaaaaacctcccacacctccccc tgaacctgaaacataaaatgaatgcaattgttgttgttaa cttgtttattgcagcttataatggttacaaataaagcaat agcatcacaaatttcacaaataaagcatttttttcactgc attctagttgtggtttgtccaaactcatcaatgtatctta Or agacatgataagatacattgatgagtttggacaaaccaca actagaatgcagtgaaaaaaatgctttatttgtgaaattt gtgatgctattgctttatttgtaaccattataagctgcaa taaacaagttaacaacaacaattgcattcattttatgttt caggttcagggggaggtggggaggttttttaaagcaagta aaacctctacaaatgtggtatggctgattatgatccggct gcctcgcgcgtttcggtgatgacggtgaaaacctctgaca catgcagctcccggagacggtcacagcttgtctgtaagcg gatgccgggagcagacaagcccgtcagggcgcgtcagcgg gtgttggcgggtgtcggggcgcagccatgaccggtcgac
[0234] The sequences corresponding to said inserts (5ITR to 3-ITR) are as follows: [0235] sequence SEQ ID NO: 3 (mMD3): 5283 bp [0236] sequence SEQ ID NO: 6 (mMD4): 5520 bp [0237] sequence SEQ ID NO: 9 (cMD3): 5280 bp [0238] sequence SEQ ID NO: 12 (cMD4): 5517 bp [0239] sequence SEQ ID NO: 15 (hMD3): 5277 bp [0240] sequence SEQ ID NO: 18 (hMD4): 5514 bp
4 Validation of the New AAV-MD Plasmids:
[0241] Transcriptional activity of the MD plasmid vectors by transfection into mouse C2C12 myoblast cultures:
[0242] To assess the functional activity, plasmids expressing CT-extended microdystrophin variants were transfected into primary C2C12 myoblast cells. C2C12 myoblasts were originally isolated from the skeletal muscle of C57BL/10 mouse. Approximately 7.510.sup.5 C2C12 myoblast cells were cultured in 40 mm dishes and transfected 3 days later with pAAV-mMD1, -mMD2, -mMD3, and -mMD4 microdystrophin plasmids using Lipofectamine 2000. Transfection was carried out in serum free conditions. 4 hrs after transfection, transfection mixture was replaced with DMEM medium containing 10% FCS and incubated at 37 C., 8% CO.sub.2.
[0243] After 48 h, when the cells were fully differentiated and fused each other to form myotubes, RNA was extracted from the cultures. The presence of dystrophin mRNA transcripts of pAAV- mMD3, and -mMD4 was evaluated by RT-PCR. Codon-optimised cDNA specific primer sets were as follows (5.fwdarw.3): TGGAGCAGGAGCACAACAA (forward), ATCTCGGGCTTGTTGTTGG (Reverse). Approximately 346bp RT-PCR products were amplified in all microdystrophin variants, but not in negative control cultures (
[0244] CONCLUSION: This in vitro data demonstrates that all microdystrophin cDNA genes were able to be functionally transcribed in the muscle cells under the control of SPc5-12 promoter. No cDNA from RNA (Reverse transcriptase oblated reactions) was observed by PCR, indicating that amplified cDNA was derived only by cellular RNA in microdystrophin transfected cells. [0245] Expression of MD variants following electroporation of plasmid vectors into TA muscles of mdx mice:
[0246] To analyse the efficiency of microdystrophin protein expression in muscle, these plasmids were tested in vivo by electrotransfer into tibialis anterior (TA) muscles of mdx mice. 5 month old male mdx were injected with 10 units of bovine hyaluronidase (25 ml at 0.4 units/ ml). Two hours later, TA muscles were injected with each 25 mg of pAAV-mMD3, and -mMD4 microdystrophin plasmids in 25 ml of sterile injectable saline solution. Control C57BL/10 and mdx mice were injected with 25 ml of saline solution only. Electrode jelly was placed on the electrode plates to increase the contact area with the skin of mouse. Electrical field was then applied to the injected TA muscle using external electrodes at 175 V/cm in 20 ms square wave pulses at 1 Hz. During injection and electrotransfer procedure, all mice were anaesthetised with 2-4% isoflurane.
[0247] At 8 days postinjection, TA muscles were recovered and subjected to immunohistology for the dystrophin staining. Electrotransfer of microdystrophins achieved positive staining of microdystrophin at the sarcolemmal membrane of mdx mice, successfully. Positive dystrophin fibres were counted in microdystrophin electroporated muscle of mdx mice (
[0248] CONCLUSION: This in vivo result demonstrated that all microdystrophin plasmid could achieve successful dystrophin expression at the sarcolemmal membrane with similar functionality of transduction efficiency in skeletal muscle.
[0249] 5 Evaluation of AAV 2/9 vectors expressing the new MD variants in mdx mouse: [0250] Production and characterization of the AAV 2/9 vectors:
[0251] To produce AAV vectors, dual or triple-plasmid transfection into 293T cells is required, followed by virus harvesting and purification. In order to optimise the yield of AAV vectors, various transfection protocols were evaluated based upon exposure of cells to CaPO.sub.4 precipitates of plasmid DNA formed at different pH values. Substantial transfection efficiencies in 293T cells were observed with an eGFP plasmids vector and using CaPO.sub.4 precipitation to optimise the trranfection efficiencies in pH 7.0, pH 7.05 and pH 7.1 HEPES buffer. After 2 days, eGFP expression in live cells was observed under the epifluorescence microscope. In pH7.05 HEPES buffer mediated-eGFP plasmid transfected cells, it showed highest transfection efficiencies (data not shown).
[0252] For AAV vector production, 293T cells in 1 roller bottle (1700cm.sup.2) were transfected with vector plasmids, pAAVITR-mMD1, mMD2, mMD3, and mMD4 along with pAdDF6 and pAAVhelpercap9 plasmids using CaPO.sub.4 precipitation in optimised pH 7.05 HEPES buffer. After transfection of DNA, AAV was harvested and purified, and AAV yields were determined by dot-blot hybridisation (
[0254] To examine the level of the dystrophin expression at the sarcolemma of the young adult mdx mouse, the TA muscle of 2 month old mdx mice were injected with 210.sup.10 vg of AAV 2/9-mMD1, mMD2, mMD3 and mMD4 in 25 ml of sterile injectable saline solution. After 8 weeks, TA muscles were recovered, cryosectioned and subjected to immunohistochemical labelling with an Manex 1011C antibody against dystrophin. Microdystrophin proteins were stained at the sarcolemmal membrane of AAV2/9-mMD1, -mMD2, -mMD3 and -mMD4 injected mdx mice, successfully (
[0255] To verify the level of dytrophin expression at the sarcolemma, positive fibres in AAV2/9-mMD1, mMD2, mMD3, and mMD4 injected TA muscle were counted in immunohistochemically labelled whole TA muscle areas. Approximately 560, 660, 390 and 240 of mMD1, mMD2, mMD3 and mMD4 microdystrophin positive fibres were counted in AAV2/9 injected whole TA muscles, respectively. The percentage of dystrophin expression was calculated by dividing the number of dystrophin positive fibres by total number of fibres in TA muscles. Approximately 28%, 41%, 24% and 20% of mMD1, mMD2, mMD3 and mMD4 microdystrophin positive fibres were observed in AAV2/9 injected whole TA muscles, respectively (
[0256] CONCLUSION: These in vivo data show that: [0257] Viral particles are produced at acceptable levels; [0258] The corresponding microdystrophins are produced at acceptable levels.
[0259] 6 Evaluation of AAV 2/9 vectors expressing the new MD variants in mdx4cv mouse: [0260] Methods:
[0261] In vivo gene transfer. All mouse procedures were done according to protocol approved by the Committee on Animal Resources at the Centre d Experimentation Fonctionnelle of Piti-Salpetrire animal facility and under appropriate biological containment. Adeno-associated virus (AAV2/9) vectors were produced using three-plasmid constructs protocol. For microdystrophin (Dys) expression, 2-month-old mdx.sup.4cv mice were injected into the Tibialis anterior (TA) with 50 l of AAV2/9-Dys (mMD4) vectors containing 2.510.sup.9 viral genomes (vg). For each mouse, the left TA muscle was injected with AAV and the contralateral muscle was injected with vehicle alone (PBS). Animals were sacrificed 2 months after AAV-tDys injection and muscles were collected, snap-frozen in liquid nitrogen-cooled isopentane and stored at 80 C.
[0262] RNA extraction and RT-PCR analysis. RNAs were isolated using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. 1 g of RNA was reverse transcribed using M-MLV first strand synthesis system according to the manufacturer's instructions (Invitrogen) in a total of 20 l. One l of cDNA preparation was subsequently used in a semi-quantitative PCR analysis according to standard protocol (ReddyMix, Thermo Scientific). PCR amplification was carried out for 20-35 cycles within the linear range of amplification for each gene. PCR products were resolved on 1% agarose or 5% non-denaturing polyacrylamide (for splicing) gels, BET stained and quantified with ImageJ software. To quantify mRNA expression, Real-time PCR was performed using a Lightcycler 480 (Roche). Reactions were performed with SYBR Green kit (Roche) according to the manufacturer's instructions. PCR cycles were a 15 min denaturation step followed by 50 cycles with a 94 C. denaturation for 15 sec, 58 C. annealing for 20 sec, and 72 C. extension for 20 sec. Mouse Rrlp0 mRNA or zebrafish elongation factor alpha (elfa) mRNA were used as standard. Data were analysed with the Lightcycler 480 analysis software.
[0263] Immunohistochemistry and histology. Hematoxylin and eosin (HE) staining was used to examine the overall muscle morphology of 10 tm TA muscle sections. For immunohistochemistry, muscle cryo-sections were stained using Mouse on Mouse (M.O.M) kit (Vector Labs). Primary antibodies were incubated overnight at 4 C. followed by 3 washes with PBS-0.1% tween, and incubated with goat anti-mouse or goat anti-rabbit secondary antibodies Alexa 488, Alexa 555 or Alexa 647 (Life Technologies). Antibodies against dystrophin (Manex1011B, 1:100, mouse monoclonal, gift from Dr. Glenn Morris; Dys1 and Dys2, 1:100, mouse monoclonal, Novocastra; MANDRA1, 1:1000, Mouse monoclonal, Sigma-Aldrich), a-syntrophin (rabbit polyclonal, 1:200, Abcam), -dystrobrevin (mouse monoclonal, 1:200, BD Biosciences); anti-MHCIIa (SC71, 1:3, mouse monoclonal IgG1; Hybridoma DSHB), anti-MHCIIX (6H1-mouse monoclonal 1 gM; Hybridoma DHSB), laminin (1:300, rabbit polyclonal, Chemicon) were used.
[0264] Electron microscopy. TA muscles were dissected, cut into small pieces and immediately fixed in 2% glutaraldehyde, 2% PFA, 0.1M phosphate buffer. After abundant washes and 2% OsO4 post fixation, samples were dehydrated at 4 in graded acetone including a 1% uranyl acetate in 70 acetone step, and were finally embedded in Epon resin. Thin (70 nm) sections were stained with uranyl acetate and lead citrate, observed using a Philips CM120 electron microscope (Philips Electronics NV) and photographed with a digital SIS Morada camera.
[0265] In situ force measurement. The isometric contractile properties of TA muscle were studied in situ as previously described (Mouisel, E. et al. Neurosci. Res., 2006. 55: 389-396). Mice were anesthetized with pentobarbital (60 mg/kg intraperitoneally). The knee and foot were fixed with clamps and pins. The distal tendon of the TA muscle was attached to a lever arm of a servomoteur system (305B, Dual-Mode Lever). Data were recorded and analysed on a microcomputer using PowerLab system (4SP, ADInstruments) and software (Chart 4, ADInstruments). The sciatic nerve (proximally crushed) was stimulated by a bipolar silver electrode using a supramaximal (10-V) square wave pulse of 0.1 ms duration. All contractions were made at an initial length L0 (length at which maximal tension was first obtained during tetanic contractions). Absolute maximal isometric tetanic force was measured during isometric contractions in response to electrical stimulation (frequency of 25 to 150 Hz, train of stimulation of 500ms). Maximal specific isometric force was calculated by dividing absolute maximal isometric force by muscle weight.
[0266] Resistance to eccentric (lengthening) contractions of TA muscles was then evaluated by measuring the force drop following eccentric contractions (Koo et al., 2011). A maximal isomeric contraction of the TA muscle was initiated during the first 500 msec. Then, muscle lengthening (1.1 mm, 10% L0) at a velocity of 0.5 mm/sec (about 0.5 L0/sec) was imposed during the last 200 msec. Nine lengthening contractions of the TA muscles were performed, each separated by a 60-sec rest period. Maximal isometric force was measured after each eccentric contraction and expressed as a percentage of the initial maximal isometric force. [0267] Results:
[0268] The test whether the C-ter domain modulates dystrophin activity, the ability of the micro-dystrophin construct Dys-CTL encoding the murine MD4 (mMD4) in restoring muscle function of dystrophin deficient (mdx.sup.4cv, Charles River Laboratories; Decrouy et al., Gen Ther, 1997. 4(5): 401-8) mice has been tested. Adeno-associated virus (AAV2/9) vectors expressing Dys-CTL (also noted mMD4) were injected locally in Tibialis Anterior (TA) muscles of mdx.sup.4cv mice. Muscles transduced with said construct expressed satisfying levels of Dys transcripts (
[0269] They also showed expected localization of Dys at the sarcolemma (
[0270] CONCLUSION: These in vivo data show that the microdystrophins are functional since they are able to ameliorate dystrophin-deficient mice muscle phenotype.
[0271] 1-7 Evaluation of AAV 2/8 vectors expressing the new MD variants in the cxmd canine model:
[0272] Similar experiments have been performed in the Beagle-based CXMD model with AAV 2/8 vectors expressing the new MD variants. [0273] Production and characterization of the AAV 2/8 vectors:
[0274] AAV2/8-cMD1, cMD2, cMD3 and cMD4 vectors were produced by CaPO4 transfection of vector plasmids with pAAVITR-cMD1, cMD2, cMD3, and cMD4 along with pAdDF6 and pAAVhelpercap8 plasmids into 392T cells. AAV vectors were harvested and purified by CsC1 gradient centrifugation. The viral titres were determined by quantitative PCR using the codon-optimised microdystrophin specific primer; ccaacaaagtgccctactacatc (forward) and ggttgtgctggtccagggcgt (reverse). The viral concentration of the rAAV2/8-cMD1, cMD2, cMD3 and cMD4 were 4.010.sup.13 vg/ml, 1.410.sup.13 vg/ml, 1.8 10.sup.13 vg/ml and 1.5 10.sup.13 vg/ml, respectively. [0275] Transduction of the TA muscle of CXMD dog by AAV2/8-vectors at 2 month after injection:
[0276] The transduction efficacy of the cDM1 was still efficient at 2 month after injection. Approximately 83.6% dystrophin fibres were positive in TA muscles at eight weeks after injection of AAV2/8-mMD1. In AAV2/8-cMD3 and cMD4 injected TA muscle, approximately 36.5% and 26.5% of the expression of dystrophin was observed at eight weeks after injection (
[0277] To verify the microdystrophin variants, microdystrophin was detected using NCL-Dys 2 antibody which detects the extreme C-terminal domain (amino acids 3669-3685) of the dystrophin. As expected, only cMD4 microdystrophin was detected (
[0279] It was also investigated whether microdystrophin expression can restore membrane integrity. Lack of the dystrophin in muscle invariably leads to failure of muscle integrity as assessed by the presence of leaky fibres. Damaged muscle membrane can be indicated by staining with extracellulary applied labelled endogenous extracellular proteins such as albumin, immunoglobulin G (IgG) and IgM (Blake, Weir et al. 2002). Membrane integrity of cMD1, cMD3 and cMD4 positive fibres was examined using an anti-canine IgG immunostaining. Membrane damaged fibres shows cytoplasmic IgG staining due to more permeable muscle membrane. In cMD1, cMD3 and cMD4 transduced TA muscle of CXMD dogs, microdystrophin positive fibres did not render any cytoplasmic IgG staining which indicates that integrity of sarcolemmal membrane was improved by microdystrophin expression (
[0281] It was examined whether microdystrophin expression in muscle can prevent or halt the muscle damage in CXMD dogs. Central nucleation is one of the markers of myofibre regeneration in dystrophin muscles. At eight weeks after intramuscular injection of 110.sup.13 vg of AAV2/8-cMD1, cMD3 and cMD4 into the muscle of CXMD dogs, TA muscles were recovered and subjected to immunohistology for the H&E staining which can stain nuclei and cytoplasm. Central nucleation in muscle fibres was not evident in dystrophin positive muscle areas of cMD1, cDM3 and cDM4 injected TA muscle (
[0283] Dystrophin expression at the sarcolemma in normal muscle allows interactions with DAP complex to form a transmembrane link which acts as a mediator of signalling between extracellular matrix and cytoskeleton in muscle fibres. The ability of codon-optimised microdystrophins to restore the association of the dystrophin-associated protein (DAP) complex at the sarcolemma was investigated.
[0284] At eight week after intramuscular injection of 110.sup.13 vg of AAV2/8-cMD1, cMD3 and cMD4 vectors into the muscle of CXMD, TA muscles were recovered and subjected to immunohistology for the dystrophin staining. Co-localisation of DAP complex such as -dystrobrevin (Dtn) and 1-syntrophin (Syn) was observed at the cMD1, cMD3 and cMD4 positive fibres (
[0285] CONCLUSION: These in vivo data show that the microdystrophins are functional in mice (produced with AAV 2/9 vectors) but also in dogs (produced with AAV 2/8 vectors).