COMPOSITIONS AND METHODS FOR OBTAINING 3-DIMENSIONAL LUNG-LIKE EPITHELIUM AND RELATED USES THEREOF
20180344901 ยท 2018-12-06
Inventors
Cpc classification
C12N5/0688
CHEMISTRY; METALLURGY
C12N2501/385
CHEMISTRY; METALLURGY
C12N5/0606
CHEMISTRY; METALLURGY
C12N2501/119
CHEMISTRY; METALLURGY
C12N2501/113
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
A61L2430/22
HUMAN NECESSITIES
C12N2506/27
CHEMISTRY; METALLURGY
A61L27/3895
HUMAN NECESSITIES
A61K35/42
HUMAN NECESSITIES
C12N5/0607
CHEMISTRY; METALLURGY
A61L27/3834
HUMAN NECESSITIES
C12N2501/117
CHEMISTRY; METALLURGY
C12N2501/999
CHEMISTRY; METALLURGY
C12N5/0062
CHEMISTRY; METALLURGY
A61L27/3813
HUMAN NECESSITIES
A61L27/3804
HUMAN NECESSITIES
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
International classification
C12N5/00
CHEMISTRY; METALLURGY
Abstract
The invention disclosed herein generally relates to methods and systems for growing, expanding and/or obtaining 3-dimensional lung-like epithelium comprising cells having SOX9 protein activity and SOX2+ protein activity. In particular, the invention disclosed herein relates to methods and systems for growing human cells having SOX9 protein activity and SOX2+ protein activity in vitro, and for promoting pluripotent stem cell derived ventral-anterior foregut spheroid tissue into 3-dimensional lung-like epithelium comprising cells having SOX9 protein activity and SOX2+ protein activity.
Claims
1. A method, comprising: culturing cells isolated from a human lung in vitro or cells from ventral-anterior foregut spheroid derived from pluripotent stem cells tissue in vitro, wherein the culturing results in differentiation of the cells isolated from a human lung or the cells from the ventral-anterior foregut spheroid tissue derived from pluripotent stem cells into tissue comprising 3-dimensional lung-like epithelium, wherein the culturing comprises activating one or more signaling pathways selected from the FGF signaling pathway, the retinoic acid signaling pathway, and the Wnt signaling pathway; and obtaining 3-dimensional lung tissue from the cultured tissue comprising 3-dimensional lung-like epithelium.
2. The method of claim 1, wherein the obtained tissue comprising 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity.
3. The method of claim 1, wherein activating the Wnt signaling pathway comprises culturing the cells isolated from a human lung or the cells from the ventral-anterior foregut spheroid tissue derived from pluripotent stem cells with a small molecule or agonist that activates the Wnt signaling pathway, wherein activating the FGF signaling pathway comprises culturing the cells isolated from a human lung or the cells from the ventral-anterior foregut spheroid tissue derived from pluripotent stem cells with a small molecule or agonist that activates the FGF signaling pathway, wherein activating the RA signaling pathway comprises culturing the cells isolated from a human lung or the cells from the ventral-anterior foregut spheroid tissue derived from pluripotent stem cells with a small molecule or agonist that activates the RA signaling pathway.
4. The method of claim 3, wherein the small molecule or agonist that activates the Wnt signaling pathway is CHIR99021 or other small molecules that function in a similar capacity, wherein the small molecule or agonist that activates the FGF signaling pathway is selected from FGF1, FGF2, FGF3, FGF4, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22, and FGF23 or other small molecules that function in a similar capacity, wherein the small molecule or agonist that activates the RA signaling pathway is selected from the group consisting of all-trans retinoic acid, AC 261066 (RAR2 agonist), AC 55649 (selective RAR2 agonist), adapalene (RAR and RAR agonist), AM 580 (retinoic acid analog; RAR agonist), AM 80 (RAR agonist; anticancer), BMS 753 (RAR-selective agonist), BMS 961 (selective RAR agonist), CD 1530 (potent and selective RAR agonist), CD 2314 (selective RAR agonist), CD 437 (RAR-selective agonist), Ch 55 (potent RAR agonist), isotretinoin (endogenous agonist for retinoic acid receptors), tazarotene (receptor-selective retinoid; binds RAR and RAR), and TTNPB (retinoic acid analog; RAR agonist) or other small molecules that function in a similar capacity.
5. The method of claim 1, wherein activating the Wnt signaling pathway occurs through culturing the cells isolated from a human lung or the cells from the ventral-anterior foregut spheroid tissue derived from pluripotent stem cells with one or more molecules configured to activate a Wnt protein, wherein the Wnt protein is selected from the group consisting of Wnt1, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wnt10a, Wnt10b, Wnt11, and Wnt16.
6. The method of claim 1, comprising at least one of the following: wherein the activating one or more signaling pathways within the cells isolated from a human lung or the cells from the ventral-anterior foregut spheroid tissue derived from pluripotent stem cells occurs over a specified temporal period, wherein the activating one or more signaling pathways within the cells isolated from a human lung or the cells from the ventral-anterior foregut spheroid tissue derived from pluripotent stem cells occurs comprises activating two or more signaling pathways.
7. The method of claim 1, wherein the ventral-anterior foregut spheroid tissue is derived from definitive endoderm cells, wherein the definitive endoderm cells are derived from pluripotent stem cells, wherein the pluripotent stem cells are embryonic stem cells and/or induced pluripotent stem cells and/or or cells obtained through somatic cell nuclear transfer.
8. The method of claim 1, wherein the culturing and obtaining steps are conducted in vitro.
9. A composition comprising 3-dimensional lung-like epithelium.
10. The composition of claim 9, wherein the 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity.
11. A method of treating a mammalian subject having a damaged lung tissue with reduced function, comprising: a) culturing cells isolated from a human lung or cells from the ventral-anterior foregut spheroid tissue derived from pluripotent stem cells in vitro, wherein the culturing results in differentiation of the obtained ventral-anterior foregut spheroid tissue into tissue comprising 3-dimensional lung-like epithelium, wherein the culturing comprising activating one or more signaling pathways selected from the FGF signaling pathway, the retinoic acid signaling pathway, and the Wnt signaling pathway; b) obtaining 3-dimensional lung tissue from the cultured tissue comprising 3-dimensional lung-like epithelium; c) engrafting the obtained 3-dimensional lung-like epithelium at the site of injury, wherein engrafted 3-dimensional lung-like epithelium engraft at the site of injury and repopulate at least a portion of the site with the engrafted cells, wherein the repopulated cells supplement the function, thereby treating the subject.
12. The method of claim 11, wherein the damaged lung tissue is associated with, but not limited to, a condition caused by one or more of an injury that results in a loss of epithelial function, a post-lung transplant complication, and/or a genetic disorder.
13. The method of claim 12, wherein the injury that results in loss of epithelial function is bronchiolitis obliterans; wherein the post-lung transplant complication is bronchiolitis obliterans; wherein the genetic disorder is one or more mutations that cause an impairment or a loss of epithelial cell function, wherein the genetic disorder is cystic fibrosis.
14. The method of claim 11, wherein the obtained tissue comprising 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity.
15. The method of claim 11, wherein activating the Wnt signaling pathway comprises culturing the ventral-anterior foregut spheroid tissue with a small molecule or agonist that activates the Wnt signaling pathway, wherein activating the FGF signaling pathway comprises culturing the ventral-anterior foregut spheroid tissue with a small molecule or agonist that activates the FGF signaling pathway, wherein activating the RA signaling pathway comprises culturing the ventral-anterior foregut spheroid tissue with a small molecule or agonist that activates the RA signaling pathway.
16. The method of claim 15, wherein the small molecule or agonist that activates the Wnt signaling pathway is CHIR99021 or other small molecules that function in a similar capacity, wherein the small molecule or agonist that activates the FGF signaling pathway is selected from FGF1, FGF2, FGF3, FGF4, FGF10, FGF11, FGF12, FGF13, FGF14, FGF15, FGF16, FGF17, FGF18, FGF19, FGF20, FGF21, FGF22, and FGF23 or other small molecules that function in a similar capacity, wherein the small molecule or agonist that activates the RA signaling pathway is selected from the group consisting of all-trans retinoic acid, AC 261066 (RAR2 agonist), AC 55649 (selective RAR2 agonist), adapalene (RAR and RAR agonist), AM 580 (retinoic acid analog; RAR agonist), AM 80 (RAR agonist; anticancer), BMS 753 (RAR-selective agonist), BMS 961 (selective RAR agonist), CD 1530 (potent and selective RAR agonist), CD 2314 (selective RAR agonist), CD 437 (RAR-selective agonist), Ch 55 (potent RAR agonist), isotretinoin (endogenous agonist for retinoic acid receptors), tazarotene (receptor-selective retinoid; binds RAR and RAR), and TTNPB (retinoic acid analog; RAR agonist) or other small molecules that function in a similar capacity.
17. The method of claim 11, wherein activating the Wnt signaling pathway occurs through the cells isolated from a human lung or the cells from the ventral-anterior foregut spheroid tissue derived from pluripotent stem cells with one or more molecules configured to activate a Wnt protein, wherein the Wnt protein is selected from the group consisting of Wnt1, Wnt2, Wnt2b, Wnt3, Wnt3a, Wnt4, Wnt5a, Wnt5b, Wnt6, Wnt7a, Wnt7b, Wnt8a, Wnt8b, Wnt9a, Wnt9b, Wnt10a, Wnt10b, Wnt11, and Wnt16.
18. The method of claim 11, comprising at least one of the following: wherein the activating one or more signaling pathways within the ventral-anterior foregut spheroid tissue occurs over a specified temporal period, wherein the activating one or more signaling pathways within the ventral-anterior foregut spheroid tissue occurs comprises activating two or more signaling pathways.
19. The method of claim 11, wherein the ventral-anterior foregut spheroid tissue is derived from definitive endoderm cells, wherein the definitive endoderm cells are derived from pluripotent stem cells, wherein the pluripotent stem cells are embryonic stem cells and/or induced pluripotent stem cells and/or or cells obtained through somatic cell nuclear transfer.
20. The method of claim 11, wherein the culturing and obtaining steps are conducted in vitro.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049] (A, B, C, D, H, I, J) Statistically significant variation between the means of experimental groups within each experiment was determined by an unpaired, one-way analysis of variance in which the mean of each group was compared to the mean of every other group. A significance level of 0.05 was used. Significance is shown on the graph according to the following: P>0.05 ns, P0.05*, P0.01**, P0.001***, P0.0001****.
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058] (A, B) Each data point represents an independent biological replicate and graphs indicate the mean+/the standard error of the mean for each experimental group. An unpaired, one-way analysis of variance was performed for each experiment followed by Tukey's multiple comparison to compare the mean of each group to the mean of every other group within the experiment. A significance level of 0.05 was used. Significance is shown on the graph according to the following: P>0.05 ns, P0.05*, P0.01**, P0.001***, P0.0001****.
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084] (D, F, H, J, L, N, O) The mean+/the standard error of the mean for each group is shown. For each target, a double-sided student's T-test was used to compare the mean of the 3F group to the mean of the FGF7 alone group. P values less than 0.05 were considered significant. P>0.05 ns, P0.05*, P0.01**, P0.001***, P0.0001****.
[0085]
DEFINITIONS
[0086] As used herein, the term pluripotent stem cells (PSCs), also commonly known as PS cells, encompasses any cells that can differentiate into nearly all cells, i.e., cells derived from any of the three germ layers (germinal epithelium), including endoderm (interior stomach lining, gastrointestinal tract, the lungs), mesoderm (muscle, bone, blood, urogenital), and ectoderm (epidermal tissues and nervous system). PSCs can be the descendants of totipotent cells, derived from embryonic stem cells (including embryonic germ cells) or obtained through induction of a non-pluripotent cell, such as an adult somatic cell, by forcing the expression of certain genes.
[0087] As used herein, the term embryonic stem cells (ESCs), also commonly abbreviated as ES cells, refers to cells that are pluripotent and derived from the inner cell mass of the blastocyst, an early-stage embryo. For purpose of the present invention, the term ESCs is used broadly sometimes to encompass the embryonic germ cells as well.
[0088] As used herein, the term induced pluripotent stem cells (iPSCs), also commonly abbreviated as iPS cells, refers to a type of pluripotent stem cells artificially derived from a normally non-pluripotent cell, such as an adult somatic cell, by inducing a forced expression of certain genes.
[0089] As used herein, the term precursor cell encompasses any cells that can be used in methods described herein, through which one or more precursor cells acquire the ability to renew itself or differentiate into one or more specialized cell types. In some embodiments, a precursor cell is pluripotent or has the capacity to becoming pluripotent. In some embodiments, the precursor cells are subjected to the treatment of external factors (e.g., growth factors) to acquire pluripotency. In some embodiments, a precursor cell can be a totipotent (or omnipotent) stem cell; a pluripotent stem cell (induced or non-induced); a multipotent stem cell; an oligopotent stem cells and a unipotent stem cell. In some embodiments, a precursor cell can be from an embryo, an infant, a child, or an adult. In some embodiments, a precursor cell can be a somatic cell subject to treatment such that pluripotency is conferred via genetic manipulation or protein/peptide treatment.
[0090] In developmental biology, cellular differentiation is the process by which a less specialized cell becomes a more specialized cell type. As used herein, the term directed differentiation describes a process through which a less specialized cell becomes a particular specialized target cell type. The particularity of the specialized target cell type can be determined by any applicable methods that can be used to define or alter the destiny of the initial cell. Exemplary methods include but are not limited to genetic manipulation, chemical treatment, protein treatment, and nucleic acid treatment.
[0091] As used herein, the term cellular constituents are individual genes, proteins, mRNA expressing genes, and/or any other variable cellular component or protein activities such as the degree of protein modification (e.g., phosphorylation), for example, that is typically measured in biological experiments (e.g., by microarray or immunohistochemistry) by those skilled in the art. Significant discoveries relating to the complex networks of biochemical processes underlying living systems, common human diseases, and gene discovery and structure determination can now be attributed to the application of cellular constituent abundance data as part of the research process. Cellular constituent abundance data can help to identify biomarkers, discriminate disease subtypes and identify mechanisms of toxicity.
[0092] As used herein, the term organoid is used to mean a 3-dimensional growth of mammalian cells in culture that retains characteristics of the tissue in vivo, e.g. prolonged tissue expansion with proliferation, multilineage differentiation, recapitulation of cellular and tissue ultrastructure, etc.
DETAILED DESCRIPTION OF THE INVENTION
[0093] Experiments conducted during the course of developing embodiments for the present invention aimed to increase the understanding of how multiple growth factor signaling pathways interact to promote maintenance of distal epithelial progenitors in an undifferentiated state. Second, experiments were aimed to elucidate the mechanisms by which distal epithelial progenitor cells of the human fetal lung are maintained and could be expanded and passaged in culture. Third, experiments were aimed to use new information gained from ex vivo culture of mouse and human fetal bud-tip progenitors in a predictive manner, in order to differentiate, de novo, distal epithelial lung progenitor-like cells from hPSCs.
[0094] Using isolated epithelial distal-tip progenitor cells from mouse and human fetal lungs during branching morphogenesis, experiments screened growth factors implicated in lung development individually and in combination for their ability to promote tissue expansion and maintenance of progenitor identity in vitro. The results demonstrated that FGF7 promoted robust growth and expansion of both mouse and human epithelial progenitors, but could not maintain the progenitor population, which underwent differentiation. In the mouse, FGF signaling (FGF7+/FGF10) plus either CHIR-99021 (to stabilize -catenin) or All-trans Retinoic Acid (RA) increased mRNA and protein expression of the distal epithelial progenitor marker, SOX9, and led to growth/expansion and improved epithelial architecture in vitro. Synergistic activity of all 4 factors (FGF7/FGF10/CHIR-99021/RA; 4-factor; 4F conditions) led to the highest mRNA expression of Sox9 in mice, whereas in human fetal lung buds we found that only 3-factors 3F (FGF7, CHIR-99021, RA) were required to maintain growth, allow tissue expansion, and maintain expression of distal epithelial progenitor genes, including SOX9, ID2 and NMYC. Together, these results suggested that FGF, WNT and RA signaling act synergistically to maintain distal progenitor identity in vitro in both mouse and human distal-tip progenitor cells, but that these pathways affected epithelial progenitors in subtly different ways between species. Unexpectedly, such results also revealed that distal epithelial progenitor cells in the human lung express SOX2, which is exclusively expressed in the proximal airway in mice (Hashimoto et al., 2012; Que et al., 2007), identifying an important molecular difference between mouse and human progenitor cells.
[0095] When applied to hPSC-derived foregut spheroid cultures, it was observed that 3F conditions promoted robust epithelial growth into larger organoid structures. hPSC-derived organoids grown in 3F media developed a patterned epithelium, with proximal airway-like domains and distal epithelial bud-like domains that possessed SOX9/SOX2+ cells with a molecular profile similar to the human fetal lung buds. Taken together, these studies provide an improved mechanistic understanding of human lung epithelial progenitor cell regulation, and highlight the importance of using developing tissues to provide a framework for improving differentiation of hPSCs into specific lineages.
[0096] Accordingly, the invention disclosed herein generally relates to methods and systems for growing, expanding and/or obtaining 3-dimensional lung-like epithelium comprising cells having SOX9 protein activity and SOX2+ protein activity. In particular, the invention disclosed herein relates to methods and systems for growing human cells having SOX9 protein activity and SOX2+ protein activity in vitro, and for promoting pluripotent stem cell derived ventral-anterior foregut spheroid tissue into 3-dimensional lung-like epithelium comprising cells having SOX9 protein activity and SOX2+ protein activity.
[0097] In some embodiments, the ventral-anterior foregut spheroid tissue is derived from definitive endoderm cells. In some embodiments, the definitive endoderm cells are derived from pluripotent stem cells. In some embodiments, the pluripotent stem cells are embryonic stem cells and/or induced pluripotent stem cells and/or or cells obtained through somatic cell nuclear transfer.
[0098] In some embodiments, an important step is to obtain stem cells that are pluripotent or can be induced to become pluripotent. In some embodiments, pluripotent stem cells are derived from embryonic stem cells, which are in turn derived from totipotent cells of the early mammalian embryo and are capable of unlimited, undifferentiated proliferation in vitro. Embryonic stem cells are pluripotent stem cells derived from the inner cell mass of the blastocyst, an early-stage embryo. Methods for deriving embryonic stem cells from blastocytes are well known in the art. For example, three cell lines (H1, H13, and H14) have a normal XY karyotype, and two cell lines (H7 and H9) have a normal XX karyotype.
[0099] Additional stem cells that can be used in embodiments in accordance with the present invention include but are not limited to those provided by or described in the database hosted by the National Stem Cell Bank (NSCB), Human Embryonic Stem Cell Research Center at the University of California, San Francisco (UCSF); WISC cell Bank at the Wi Cell Research Institute; the University of Wisconsin Stem Cell and Regenerative Medicine Center (UW-SCRMC); Novocell, Inc. (San Diego, Calif.); Cellartis AB (Goteborg, Sweden); ES Cell International Pte Ltd (Singapore); Technion at the Israel Institute of Technology (Haifa, Israel); and the Stem Cell Database hosted by Princeton University and the University of Pennsylvania. Indeed, embryonic stem cells that can be used in embodiments in accordance with the present invention include but are not limited to SA01 (SA001); SA02 (SA002); ES01 (HES-1); ES02 (HES-2); ES03 (HES-3); ES04 (HES-4); ES05 (HES-5); ES06 (HES-6); BG01 (BGN-01); BG02 (BGN-02); BG03 (BGN-03); TE03 (13); TE04 (14); TE06 (16); UC01 (HSF1); UC06 (HSF6); WA01 (H1); WA07 (H7); WA09 (H9); WA13 (H13); WA14 (H14).
[0100] In some embodiments, the stem cells are further modified to incorporate additional properties. Exemplary modified cell lines include but not limited to H1 OCT4-EGFP; H9 Cre-LoxP; H9 hNanog-pGZ; H9 hOct4-pGZ; H9 in GFPhES; and H9 Syn-GFP.
[0101] More details on embryonic stem cells can be found in, for example, Thomson et al., 1998, Science 282 (5391):1145-1147; Andrews et al., 2005, Biochem Soc Trans 33:1526-1530; Martin 1980, Science 209 (4458):768-776; Evans and Kaufman, 1981, Nature 292(5819): 154-156; Klimanskaya et al., 2005, Lancet 365 (9471): 1636-1641).
[0102] Alternative, pluripotent stem cells can be derived from embryonic germ cells (EGCs), which are the cells that give rise to the gametes of organisms that reproduce sexually. EGCs are derived from primordial germ cells found in the gonadal ridge of a late embryo, have many of the properties of embryonic stem cells. The primordial germ cells in an embryo develop into stem cells that in an adult generate the reproductive gametes (sperm or eggs). In mice and humans it is possible to grow embryonic germ cells in tissue culture under appropriate conditions. Both EGCs and ESCs are pluripotent. For purpose of the present invention, the term ESCs is used broadly sometimes to encompass EGCs.
[0103] In some embodiments, iPSCs are derived by transfection of certain stem cell-associated genes into non-pluripotent cells, such as adult fibroblasts. Transfection is typically achieved through viral vectors, such as retroviruses. Transfected genes include the master transcriptional regulators Oct-3/4 (Pouf51) and Sox2, although it is suggested that other genes enhance the efficiency of induction. After 3-4 weeks, small numbers of transfected cells begin to become morphologically and biochemically similar to pluripotent stem cells, and are typically isolated through morphological selection, doubling time, or through a reporter gene and antibiotic selection. As used herein, iPSCs include but are not limited to first generation iPSCs, second generation iPSCs in mice, and human induced pluripotent stem cells. In some embodiments, a retroviral system is used to transform human fibroblasts into pluripotent stem cells using four pivotal genes: Oct3/4, Sox2, Klf4, and c-Myc. In alternative embodiments, a lentiviral system is used to transform somatic cells with OCT4, SOX2, NANOG, and LIN28. Genes whose expression are induced in iPSCs include but are not limited to Oct-3/4 (e.g., Pou5fl); certain members of the Sox gene family (e.g., Sox1, Sox2, Sox3, and Sox15); certain members of the Klf family (e.g., Klf1, Klf2, Klf4, and Klf5), certain members of the Myc family (e.g., C-myc, L-myc, and N-myc), Nanog, and LIN28.
[0104] More details on induced pluripotent stem cells can be found in, for example, Kaji et al., 2009, Nature 458:771-775; Woltjen et al., 2009, Nature 458:766-770; Okita et al., 2008, Science 322(5903):949-953; Stadtfeld et al., 2008, Science 322(5903):945-949; and Zhou et al., 2009, Cell Stem Cell 4(5):381-384.
[0105] In some embodiments, examples of iPS cell lines include but not limited to iPS-DF19-9; iPS-DF19-9; iPS-DF4-3; iPS-DF6-9; iPS(Foreskin); iPS(IMR90); and iPS(IMR90).
[0106] The lungs of mammals including those of humans, have a soft, spongelike texture and are honeycombed with epithelium, having a much larger surface area in total than the outer surface area of the lung itself.
[0107] Breathing is largely driven by the muscular diaphragm at the bottom of the thorax. Contraction of the diaphragm pulls the bottom of the cavity in which the lung is enclosed downward, increasing volume and thus decreasing pressure, causing air to flow into the airways. Air enters through the oral and nasal cavities; it flows through the pharynx, then the larynx and into the trachea, which branches out into the main bronchi and then subsequent divisions. During normal breathing, expiration is passive and no muscles are contracted (the diaphragm relaxes). The rib cage itself is also able to expand and contract to some degree through the use of the intercostal muscles, together with the action of other respiratory and accessory respiratory muscles. As a result, air is transported into or expelled out of the lungs.
[0108] In humans, the trachea divides into two main bronchi that enter the roots of the lungs. The bronchi continue to divide within the lung, and after multiple divisions, give rise to bronchioles. The bronchial tree continues branching until it reaches the level of terminal bronchioles, which lead to alveolar sacs. Alveolar sacs, are made up of clusters of alveoli, like individual grapes within a bunch. The individual alveoli are tightly wrapped in blood vessels and it is here that gas exchange actually occurs. Deoxygenated blood from the heart is pumped through the pulmonary artery to the lungs, where oxygen diffuses into blood and is exchanged for carbon dioxide in the haemoglobin of the erythrocytes. The oxygen-rich blood returns to the heart via the pulmonary veins to be pumped back into systemic circulation.
[0109] Human lungs are located in two cavities on either side of the heart. Though similar in appearance, the two are not identical. Both are separated into lobes by fissures, with three lobes on the right and two on the left. The lobes are further divided into segments and then into lobules, hexagonal divisions of the lungs that are the smallest subdivision visible to the naked eye. The connective tissue that divides lobules is often blackened in smokers. The medial border of the right lung is nearly vertical, while the left lung contains a cardiac notch. The cardiac notch is a concave impression molded to accommodate the shape of the heart.
[0110] Each lobe is surrounded by a pleural cavity, which consists of two pleurae. The parietal pleura lies against the rib cage, and the visceral pleura lies on the surface of the lungs. In between the pleura is pleural fluid. The pleural cavity helps to lubricate the lungs, as well as providing surface tension to keep the lung surface in contact with the rib cage.
[0111] Lungs are to a certain extent overbuilt and have a tremendous reserve volume as compared to the oxygen exchange requirements when at rest. Such excess capacity is one of the reasons that individuals can smoke for years without having a noticeable decrease in lung function while still or moving slowly; in situations like these only a small portion of the lungs are actually perfused with blood for gas exchange. Destruction of too many alveoli over time leads to the condition emphysema, which is associated with extreme shortness of breath. As oxygen requirements increase due to exercise, a greater volume of the lungs is perfused, allowing the body to match its CO.sub.2/O.sub.2 exchange requirements. Additionally, due to the excess capacity, it is possible for humans to live with only one lung, with the one compensating for the other's loss.
[0112] The environment of the lung is very moist, which makes it hospitable for bacteria. Many respiratory illnesses are the result of bacterial or viral infection of the lungs. Inflammation of the lungs is known as pneumonia; inflammation of the pleura surrounding the lungs is known as pleurisy.
[0113] Vital capacity is the maximum volume of air that a person can exhale after maximum inhalation; it can be measured with a spirometer. In combination with other physiological measurements, the vital capacity can help make a diagnosis of underlying lung disease.
[0114] The lung parenchyma is strictly used to refer solely to alveolar tissue with respiratory bronchioles, alveolar ducts and terminal bronchioles. However, it often includes any form of lung tissue, also including bronchioles, bronchi, blood vessels and lung interstitium.
[0115] Following gastrulation (embryonic day E7.5 in mice), the definitive endoderm undergoes complex morphogenetic movements that ultimately lead to the formation of the primitive gut tube. The foregut represents the most anterior (cranial) region of this tube, while the midgut and hindgut are located at progressively more posterior regions, towards the caudal end of the embryo (see, e.g., Wells, et al., Annu. Rev. Cell Dev. Biol. 15, 393-410). Transcription factor genes such as Foxa1, Foxa2, Gata4 and Gata6, which are expressed early in the endoderm, are crucial for the survival, differentiation and morphogenesis of the foregut (see, e.g., Kuo, et al., Genes Dev. 11, 1048-1060; Morrisey, et al., Genes Dev. 12, 3579-3590; Ang, et al., Cell 78, 561-574; Wan, et al., J. Biol. Chem. 280, 13809-13816). By E8.0-9.5, the local expression of transcription factors along the anteroposterior (AP) axis of the gut endoderm marks organ-specific domains (or fields). For example, the homeodomain protein gene Nkx2.1 [also known as thyroid transcription factor 1 (Titf1) or T/EBP] is expressed in the thyroid and respiratory fields (see, e.g., Kimura, et al., Genes Dev. 10, 60-69), Hex (hematopoietically expressed homeobox) is expressed in the thyroid and liver fields (see, e.g., Martinez Barbera, et al., Development 127, 2433-2445), and the Pdx1 (pancreas-duodenal-associated homeobox gene) is expressed in the pancreatic and duodenal fields (see, e.g., Offield, et al., Development 122, 983-995). In addition, morphogenetic movements foster dynamic interactions between the endoderm and neighboring structures, such as the heart, notochord or the septum transversum (the mesodermal cells that give rise to the diaphragm). Exposure of the endoderm to diffusible signals from these structures at crucial developmental windows is essential for endodermal cell fate specification (see, e.g., Kumar and Melton, Curr. Opin. Genet. Dev. 13, 401-407; Bort, et al., Development 131, 797-80).
[0116] Fibroblast growth factor 4 (Fgf4), bone morphogenetic protein 2 (Bmp2) and retinoic acid (RA) are among the signals that confer AP identity to the early endoderm. They render the endoderm competent to respond to signals from the adjacent mesoderm or from nearby structures to initiate morphogenesis (see, e.g., Tiso, eta al., Mech. Dev. 118, 29-37; Stafford and Prince, Curr. Biol. 12, 1215-1220; Wells and Melton, Development 127, 1563-1572). In zebrafish, disrupted retinoic acid (RA) signaling during gastrulation results in the loss of liver and pancreatic (posterior) fates, while thyroid and pharynx (anterior) fates remain unaltered. Conversely, excess RA induces hepatic and pancreatic cell fates at more anterior domains (see, e.g., Stafford and Prince; Curr. Biol. 12, 1215-1220). In mice and rats, RA signaling initiates soon after gastrulation (see, e.g., Rossant, et al., Genes Dev. 5, 1333-1344), but does not seem to be as crucial for foregut AP identity as it is in the zebrafish.
[0117] The invention disclosed herein relates to methods and systems for promoting ventral-anterior foregut spheroid tissue into 3-dimensional lung-like epithelium comprising cells having SOX9 protein activity and SOX2+ protein activity.
[0118] In some embodiments, PSCs, such as ESCs and iPSCs, undergo directed differentiation in a step-wise manner first into definitive endoderm (DE), then into ventral-anterior foregut spheroid tissue (e.g., SOX2+ anterior foregut 3D spheroid structures), then into 3-dimensional lung-like epithelium comprising cells having SOX9 protein activity and SOX2+ protein activity.
[0119] As such, in some embodiments, methods are provided for the directed differentiation of pluriopotent cells (e.g., iPSCs or ESCs) into definitive endoderm, and the obtaining of such definitive endoderm. In some embodiments, methods are provided for the directed differentiation of the obtained definitive endoderm into ventral-anterior foregut spheroid tissue, and obtaining of such ventral-anterior foregut spheroid tissue. In some embodiments, methods are provided for the directed differentiation of the obtained ventral-anterior foregut spheroid tissue into 3-dimensional lung-like epithelium comprising cells having SOX9 protein activity and SOX2+ protein activity, and the obtaining of such 3-dimensional lung-like epithelium tissue.
[0120] Such methods are not limited to a particular manner of accomplishing the directed differentiation of PSCs into definitive endoderm. Indeed, any method for producing definitive endoderm from pluripotent cells (e.g., iPSCs or ESCs) is applicable to the methods described herein. In some embodiments, pluripotent cells are derived from a morula. In some embodiments, pluripotent stem cells are stem cells. Stem cells used in these methods can include, but are not limited to, embryonic stem cells. Embryonic stem cells can be derived from the embryonic inner cell mass or from the embryonic gonadal ridges. Embryonic stem cells or germ cells can originate from a variety of animal species including, but not limited to, various mammalian species including humans. In some embodiments, human embryonic stem cells are used to produce definitive endoderm. In some embodiments, human embryonic germ cells are used to produce definitive endoderm. In some embodiments, iPSCs are used to produce definitive endoderm.
[0121] In some embodiments, one or more growth factors are used in the differentiation process from pluripotent stem cells to DE cells. The one or more growth factors used in the differentiation process can include growth factors from the TGF- superfamily. In such embodiments, the one or more growth factors comprise the Nodal/Activin and/or the BMP subgroups of the TGF- superfamily of growth factors. In some embodiments, the one or more growth factors are selected from the group consisting of Nodal, Activin A, Activin B, BMP4, Wnt3a or combinations of any of these growth factors.
[0122] In some embodiments, the embryonic stem cells or germ cells and iPSCs are treated with the one or more growth factors for 6 or more hours; 12 or more hours; 18 or more hours; 24 or more hours; 36 or more hours; 48 or more hours; 60 or more hours; 72 or more hours; 84 or more hours; 96 or more hours; 120 or more hours; 150 or more hours; 180 or more hours; or 240 or more hours.
[0123] In some embodiments, the embryonic stem cells or germ cells and iPSCs are treated with the one or more growth factors at a concentration of 10 ng/ml or higher; 20 ng/ml or higher; 50 ng/ml or higher; 75 ng/ml or higher; 100 ng/ml or higher; 120 ng/ml or higher; 150 ng/ml or higher; 200 ng/ml or higher; 500 ng/ml or higher; 1,000 ng/ml or higher; 1,200 ng/ml or higher; 1,500 ng/ml or higher; 2,000 ng/ml or higher; 5,000 ng/ml or higher; 7,000 ng/ml or higher; 10,000 ng/ml or higher; or 15,000 ng/ml or higher. In some embodiments, concentration of the growth factor is maintained at a constant level throughout the treatment. In other embodiments, concentration of the growth factor is varied during the course of the treatment. In some embodiments, the growth factor is suspended in media that include fetal bovine serine (FBS) with varying HyClone concentrations. One of skill in the art would understand that the regimen described herein is applicable to any known growth factors, alone or in combination. When two or more growth factors are used, the concentration of each growth factor may be varied independently.
[0124] In some embodiments, populations of cells enriched in definitive endoderm cells are used. In some embodiments, the definitive endoderm cells are isolated or substantially purified. In some embodiments, the isolated or substantially purified definitive endoderm cells express the SOX2+ marker.
[0125] Methods for enriching a cell population with definitive endoderm are also contemplated. In some embodiments, definitive endoderm cells can be isolated or substantially purified from a mixed cell population by contacting the cells with a reagent that binds to a molecule that is present on the surface of definitive endoderm cells but which is not present on the surface of other cells in the mixed cell population, and then isolating the cells bound to the reagent.
[0126] Additional methods for obtaining or creating DE cells that can be used in the present invention include but are not limited to those described in U.S. Pat. No. 7,510,876; U.S. Pat. No. 7,326,572; Kubol et al., 2004, Development 131:1651-1662; D'Amour et al., 2005, Nature Biotechnology 23:1534-1541; and Ang et al., 1993, Development 119:1301-1315.
[0127] In some embodiments, directed differentiation toward ventral-anterior foregut spheroid tissue, 3-dimensional lung tissue, and lung organoid tissue is achieved by selectively activating or inhibiting certain signaling pathways in the iPSCs and/or DE cells. In some embodiments, the activated and/or inhibited signaling pathways are those active in lung development, including but not limited to the BMP signaling pathway, the TGF signaling pathway, the Wnt signaling pathway, the FGF signaling pathway, and the Hedgehog signaling pathway in a step-wise manner.
[0128] In some embodiments, directed differentiation of definitive endoderm into 3-dimensional lung-like epithelium tissue is accomplished first through directed differentiation of definitive endoderm into ventral-anterior foregut spheroid tissue, then directed differentiation of the ventral-anterior foregut spheroid tissue into 3-dimensional lung-like epithelium tissue.
[0129] Such techniques are not limited to a particular manner of inducing formation of ventral-anterior foregut spheroid tissue from definitive endoderm. In some embodiments, inducing formation of ventral-anterior foregut spheroid tissue from definitive endoderm is accomplished through selectively activating the Wnt signaling pathway and the FGF signaling pathway, and inhibiting the BMP signaling pathway, and the TGF signaling pathway in the DE cells. In some embodiments, activating and/or inhibiting one or more signaling pathways within the definitive endoderm cells comprises culturing the definitive endoderm cells with a Wnt signaling pathway agonist, a FGF signaling pathway agonist, a BMP signaling pathway inhibitor, and a TGF signaling pathway inhibitor. In some embodiments, activating and/or inhibiting one or more signaling pathways within the definitive endoderm cells comprises culturing the definitive endoderm cells with CHIR99021, FGF4, Noggin, and SB431542.
[0130] Such techniques are not limited to a particular manner of inducing formation of 3-dimensional lung-like epithelium from the ventral-anterior foregut spheroid tissue. In some embodiments, inducing formation of 3-dimensional lung-like epithelium from the ventral-anterior foregut spheroid tissue occurs through activating the FGF signaling pathway, the retinoic acid signaling pathway, and the Wnt signaling pathway within the ventral-anterior foregut spheroid tissue. In some embodiments, the obtained tissue comprising 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity.
[0131] In some embodiments, selective activation of the Wnt signaling pathway is accomplished with a Wnt agonist (W).
[0132] The Wnt signalling pathway is defined by a series of events that occur when a Wnt protein binds to a cell-surface receptor of a Frizzled receptor family member. This results in the activation of Dishevelled family proteins which inhibit a complex of proteins that includes axin, GSK-3, and the protein APC to degrade intracellular -catenin. The resulting enriched nuclear -catenin enhances transcription by TCF/LEF family transcription factors.
[0133] A Wnt agonist (e.g., a small molecule or agonist that activates the Wnt signaling pathway) is defined as an agent that activates TCF/LEF-mediated transcription in a cell. Wnt agonists are therefore selected from true Wnt agonists that bind and activate a Frizzled receptor family member including any and all of the Wnt family proteins, an inhibitor of intracellular -catenin degradation, and activators of TCF/LEF. Said Wnt agonist is added to the iPSCs and/or DE cells for purposes of directed differentiation of such cells toward lung organoids in an amount effective to stimulate a Wnt activity in a cell by at least 10%, more preferred at least 20%, more preferred at least 30%, more preferred at least 50%, more preferred at least 70%, more preferred at least 90%, more preferred at least 100%, relative to a level of said Wnt activity in the absence of said molecule, as assessed in the same cell type. As is known to a skilled person, a Wnt activity can be determined by measuring the transcriptional activity of Wnt, for example by pTOPFLASH and pFOPFLASH Tcfluciferase reporter constructs (see, e.g., Korinek et al., 1997. Science 275:1784-1787).
[0134] A Wnt agonist may comprise a secreted glycoprotein including Wnt-1/Int-1; Wnt-2/Irp (Int-1-related Protein); Wnt-2b/13; Wnt-3/Int-4; Wnt-3a (R&D systems); Wnt-4; Wnt-5a; Wnt-5b; Wnt-6 (Kirikoshi H et al. 2001. Biochem Biophys Res Com 283: 798-805); Wnt-7a (R&D systems); Wnt-7b; Wnt-8a/8d; Wnt-8b; Wnt-9a/14; Wnt-9b/14b/15; Wnt-10a; Wnt-10b/12; Wnt-11; and Wnt-16. An overview of human Wnt proteins is provided in THE WNT FAMILY OF SECRETED PROTEINS, R&D Systems Catalog, 2004.
[0135] Further Wnt agonists include the R-spondin family of secreted proteins, which is implicated in the activation and regulation of Wnt signaling pathway and which is comprised of 4 members (R-spondin 1 (NU206, Nuvelo, San Carlos, Calif.), R-spondin 2 ((R&D systems), R-spondin 3, and R-spondin-4); and Norrin (also called Norrie Disease Protein or NDP) (R&D systems), which is a secreted regulatory protein that functions like a Wnt protein in that it binds with high affinity to the Frizzled-4 receptor and induces activation of the Wnt signaling pathway (Kestutis Planutis et al. (2007) BMC Cell Biol. 8: 12).
[0136] Compounds that mimic the activity of R-spondin may be used as Wnt agonists of the invention. It has recently been found that R-spondin interacts with Lgr5. Thus, Lgr5 agonists such as agonistic anti-Lgr5 antibodies are examples of Wnt agonists that may be used in the invention.
[0137] A small-molecule agonist of the Wnt signaling pathway, an aminopyrimidine derivative, was identified and is also expressly included as a Wnt agonist (Liu et al. (2005) Angew Chem Int Ed Engl. 44, 1987-90).
[0138] Known GSK-inhibitors comprise small-interfering RNAs (siRNA; Cell Signaling), lithium (Sigma), kenpaullone (Biomol International; Leost, M. et al. (2000) Eur. J. Biochem. 267, 5983-5994), 6-Bromoindirubin-30-acetoxime (Meijer, L. et al. (2003) Chem. Biol. 10, 1255-1266), SB 216763 and SB 415286 (Sigma-Aldrich), and FRAT-family members and FRAT-derived peptides that prevent interaction of GSK-3 with axin. An overview is provided by Meijer et al., (2004) Trends in Pharmacological Sciences 25, 471-480. Methods and assays for determining a level of GSK-3 inhibition are known to a skilled person and comprise, for example, the methods and assay as described in Liao et al 2004, Endocrinology, 145(6): 2941-9.
[0139] In some embodiments the Wnt agonist is a Gsk3 inhibitor. In some embodiments, the Gsk3 inhibitor is selected from the group consisting of CHIR 99021, CHIR 98014, BIO-acetoxime, BIO, LiCl, SB 216763, SB 415286, AR A014418, 1-Azakenpaullone, and Bis-7-indolylmaleimide. In some embodiments the Gsk3 inhibitor is CHIR 99021 or CHIR 98014 at a concentration of at least about 4 M to about 10 M i. In some embodiments the Gsk3 inhibitor comprises an RNAi targeted against Gsk3.
[0140] In some embodiments, the Wnt agonist added to the iPSCs and/or DE cells for purposes of directed differentiation of such cells toward lung organoids is CHIR 99021. In some embodiments, CHIR 99021 is preferably added to the iPSCs and/or DE cells for purposes of directed differentiation of such cells toward lung organoids at a concentration of at least 200.
[0141] In some embodiments, selective activation of the FGF signaling pathway is accomplished with a FGF agonist (F) (e.g., a small molecule or agonist that activates the FGF signaling pathway).
[0142] In some embodiments, the FGF agonist added to the iPSCs and/or DE cells for purposes of directed differentiation of such cells toward lung organoids is able to bind to FGFR2 or FGFR4. An FGF able to bind to FGFR2 (FGF receptor) or FGFR4 is preferably FGF4, FGF7 or FGF10, most preferably FGF10.
[0143] FGF10 is a protein that belongs to the fibroblast growth factor (FGF) family of proteins. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. FGFs stimulate cells by interacting with cell surface tyrosine kinase receptors (FGFR). Four closely related receptors (FGFR1-FGFR4) have been identified. FGFR1-FGFR3 genes have been shown to encode multiple isoforms, and these isoforms can be critical in determining ligand specificity. Most FGFs bind more than one receptor (Ornitz J Biol. Chem. 1998 Feb. 27; 273 (9):5349-57). However, FGF10 and FGF7 are unique among FGFs in that they interact only with a specific isoform of FGFR2, designated FGFR2b which is expressed exclusively by epithelial cells (Igarashi, J Biol. Chem. 1998 273(21):13230-5). FGF10 is a preferred FGF able to bind to FGFR2 or FGFR4.
[0144] Preferred concentrations for FGF10 are 20, 50, 100, 500 ng/ml, not higher than 500 ng/ml. FGF (e.g., FGF10) is preferably added to the iPSCs and/or DE cells for purposes of directed differentiation of such cells toward lung organoids when required.
[0145] Such methods are not limited to a particular manner of activating the RA signaling pathway. In some embodiments, activating the RA signaling pathway comprises culturing the ventral-anterior foregut spheroid tissue with a small molecule or agonist that activates the RA signaling pathway. In some embodiments, the small molecule or agonist that activates the RA signaling pathway is all-trans retinoic acid. In some embodiments, the small molecule or agonist that activates the RA signaling pathway is AC 261066 (RAR2 agonist), AC 55649 (selective RAR2 agonist), adapalene (RAR and RAR agonist), AM 580 (retinoic acid analog; RAR agonist), AM 80 (RAR agonist; anticancer), BMS 753 (RAR-selective agonist), BMS 961 (selective RAR agonist), CD 1530 (potent and selective RAR agonist), CD 2314 (selective RAR agonist), CD 437 (RAR-selective agonist), Ch 55 (potent RAR agonist), isotretinoin (endogenous agonist for retinoic acid receptors), tazarotene (receptor-selective retinoid; binds RAR and RAR), and TTNPB (retinoic acid analog; RAR agonist).
[0146] In some embodiments, 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity produced in vitro from the described methods can be used to screen drugs for lung tissue uptake and mechanisms of transport. For example, this can be done in a high throughput manner to screen for the most readily absorbed drugs, and can augment Phase 1 clinical trials that are done to study drug lung tissue uptake and lung tissue toxicity. This includes pericellular and intracellular transport mechanisms of small molecules, peptides, metabolites, salts.
[0147] In some embodiments, 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity produced in vitro from the described methods can be used to identify the molecular basis of normal human lung development.
[0148] In some embodiments, 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity produced in vitro from the described methods can be used to identify the molecular basis of congenital defects affecting human lung development.
[0149] In some embodiments, 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity produced in vitro from the described methods can be used to correct lung related congenital defects caused by genetic mutations. In particular, mutation affecting human lung development can be corrected using iPSC technology and genetically normal 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity produced in vitro from the described methods. In some embodiments, 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity produced in vitro from the described methods can be used to generate replacement tissue.
[0150] In some embodiments, 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity produced in vitro from the described methods can be used to generate replacement lung tissue for lung related disorders.
[0151] In some embodiments, a diagnostic kit or package is developed to include 3-dimensional lung-like epithelium comprises cells having SOX9 protein activity and SOX2+ protein activity produced in vitro from the described methods and based on one or more of the aforementioned utilities.
EXAMPLES
[0152] The following examples are illustrative, but not limiting, of the compounds, compositions, and methods of the present invention. Other suitable modifications and adaptations of the variety of conditions and parameters normally encountered in clinical therapy and which are obvious to those skilled in the art are within the spirit and scope of the invention.
Example I
[0153] This example demonstrates isolation and in vitro culture of murine distal lung bud epithelium.
[0154] During branching morphogenesis, the distal epithelial bud tips are comprised of progenitor cells that remain in the progenitor state until the branching program is complete (Chang et al., 2013) and will give rise to all the mature cell types of the lung epithelium (Rawlins et al., 2009). However, the mechanisms maintaining distal progenitors in an undifferentiated state remain unclear. This population of progenitor cells is known to express several transcription factors, including Sox9, Nmyc and Id2 (Chang et al., 2013; Moens et al., 1992; Okubo et al., 2005; Perl et al., 2005; Rawlins et al., 2009; Rockich et al., 2013). In order to study this population of cells, epithelial buds were mechanically isolated from lungs of embryonic day (E) 13.5 Sox9-eGFP mice and cultured in a Matrigel droplet (
Example II
[0155] This example demonstrates FGF7 promotes growth and expansion of distal epithelial lung buds.
[0156] Experiments were conducted to identify culture conditions that could support the growth and expansion of distal epithelial buds in culture. Signaling events were identified from the literature essential for normal mouse lung epithelial development, including FGF signaling (FGF7 and 10) (Bellusci et al., 1997b; Cardoso et al., 1997; Min et al., 1998; Nyeng et al., 2008; Sekine et al., 1999; Volckaert et al., 2013); Wnt signaling (Elluru and Whitsett, 2004; Goss et al., 2009; Harris-Johnson et al., 2009; Kadzik et al., 2014; Mucenski et al., 2005; 2003; Shu et al., 2005); BMP signaling (Weaver et al., 2000; 1999) and RA signaling (Chen et al., 2010; Desai et al., 2006; 2004; Malpel et al., 2000). Many of these signaling events have previously been used for in vitro differentiation of hPSC-derived lung tissue (Firth et al., 2014; Ghaedi et al., 2013; Gilpin et al., 2014b; Gotoh et al., 2014; Huang et al., 2013; Konishi et al., 2015; Mou et al., 2012; Wong et al., 2012). A low-throughput screen was performed to identify factors that could promote growth of distal bud tips in culture. The screen included FGF7, FGF10, BMP4, All Trans Retinoic Acid (hereafter referred to as RA) and CHIR-99021, which inhibits GSK3 and stabilizes -catenin (CAT) leading to activation of CAT-dependent signaling (
[0157] Initial experimental conditions used FGF7 concentrations based on previous literature (long/mL;
Example III
[0158] This example demonstrates FGF7 promotes growth of Sox9+progenitors followed by cellular differentiation over time in culture.
[0159] In order to determine if FGF7 was promoting expansion of Sox9+ distal progenitors cells, experiments performed a lineage trace utilizing Sox9-Cre.sup.ER; Rosa26.sup.Tomato mice. Tamoxifen was given to timed pregnant dams at E12.5, and epithelial lung buds were isolated 24 hours later, at E13.5 (
Example IV
[0160] This example demonstrates that FGF7, CHIR-99021 and RA act synergistically to maintain the distal progenitor identity in mouse lung buds in vitro.
[0161] Given that FGF7 promoted robust expansion of distal buds in vitro, but was also permissive for differentiation, experiments were conducted to identify additional growth factors that interacted with FGF signaling to maintain the undifferentiated SOX9+ distal progenitor cell state in vitro. To do this, experiments were conducted that returned to the strategy of using 5F media, and removed one additional growth factor at a time to examine the effect on growth, and expression of Sox9 and Sox2 as markers of distal progenitor and proximal airway cells, respectively. Removing any single factor (FGF10, CHIR-99021, RA or BMP4) from 5F culture media did not affect the ability of isolated buds to expand (
[0162] Experiments next screened combinations of the remaining factors to determine a minimal set that promoted tissue expansion while maintaining the identity of distal epithelial progenitor cells. All conditions included FGF7 (10 ng/mL) due to its ability to potently support proliferation and tissue expansion (
[0163] To determine if SOX9+ cells maintained in culture were multipotent and retained the ability to differentiate, experiments were conducted that expanded isolated buds in 4F media for 5 days and then removed FGF10, CHIR-99021 and RA (retaining FGF7 only) for 4 days to determine if SOX9 protein/mRNA expression was reduced and if cells could differentiate (
Example V
[0164] This example demonstrates In vitro growth, expansion and maintenance of human fetal distal epithelial lung progenitors.
[0165] Given that almost nothing is known about the functional regulation of human fetal distal lung epithelial progenitor cells, experiments were conducted to determine if conditions that maintained mouse distal epithelial progenitors also supported human fetal distal lung progenitor growth and expansion in vitro. Distal epithelial lung buds were enzymatically and mechanically isolated from the lungs of 3 different biological samples at 12 weeks of gestation (84-87 days; n=3) and cultured in a Matrigel droplet (
[0166] Such analysis demonstrated that 3F and 4F media functioned in a similar manner in human fetal buds, and suggested that the addition of FGF10 to the media did not have a significant effect on bud growth or differentiation. Experiments were conducted to further examine the effect of FGF10 on human fetal lung buds in culture by exposing them to high concentrations of FGF10 (500 ng/mL). It was observed that high concentrations of FGF10 induced only modest growth when compared to control conditions (basal media) (
Example VI
[0167] This example demonstrates that 3F media induces a distal lung bud progenitor-like population of cells in hPSC-derived lung organoids.
[0168] Given the robustness by which 3F media supported mouse and human lung bud progenitor growth and identity, experiments sought to determine whether these culture conditions could promote a distal epithelial lung progenitor-like population from hPSCs. NKX2.1+ ventral foregut spheroids were generated as previously described (Dye et al., 2016a; 2015), and were cultured in a droplet of Matrigel and overlaid with media containing 3F (FGF7, CHIR-99021, RA). Spheroids were considered to be day 0 on the day they were placed in Matrigel. Organoids (called Human Lung Organoids; HLOs) grown in 3F media exhibited robust and stereotyped growth patterns and survived in culture for over 16 weeks (
[0169] HLOs cultured in 3F media exhibited robust Nkx2.1 protein expression, a lung epithelial marker, in all cells (
[0170] In addition to the cystic epithelial phenotype noted above, it was also observed organoids that possessed a dense phenotype (
Example VII
[0171] This example demonstrates 3F HLOs maintain regions of SOX9+/SOX2+ distal progenitor-like cells for over 115 days in culture and exhibit proximal-distal patterning.
[0172] After 40 days in culture, 3F HLOs display clear proximal-distal patterning that mimics what is seen in the developing human lung. Small buds at the periphery of the HLOs stain positive for SOX2 and SOX9 (
Example VIII
[0173] This example demonstrates interior regions of 3F HLOs contain secretory cells.
[0174] Interior regions of the HLOs showed protein staining for SCGB1A1, a marker of club cells, and MUCSAC, a marker of goblet cells, two prominent secretory cell types of the human proximal airway (
Example IX
[0175] This example demonstrates that removal of CHIR-99021 and RA promotes differentiation within HLOs.
[0176] Based on results in the mouse showing that FGF7 was permissive for differentiation (
[0177] HLOs treated with FGF7 also exhibited an increase in many mature cell types as observed both by protein staining and QRT-PCR analysis. Most strikingly, FGF7-only HLOs exhibited a large increase in the number of MUCSAC positive cells, a dramatic increase the amount of mucous within the HLO lumens (
[0178] In addition to an increase expression of multiple proximal airway cell markers, HLOs grown in FGF7-only exhibited an increase in both protein and mRNA expression of the AECII marker SFTPC (
Example X
[0179] This example describes the materials and methods for Examples I-IX.
Mouse Models:
[0180] All animal research was approved by the University of Michigan Committee on Use and Care of Animals. Lungs from Sox9-eGFP (MGI ID:3844824), Sox9CreER; Rosa.sup.Tomato/Tomato (MGI ID:5009223 and 3809523)(Kopp et al., 2011), or wild type lungs from CD1 embryos (Charles River) were dissected at embryonic day (E) 13.5, and buds were isolated as described below and as previously described (del Moral and Warburton, 2010).
Human Fetal Lung Tissue:
[0181] All research utilizing human fetal tissue was approved by the University of Michigan institutional review board. Normal human fetal lungs were obtained from the University of Washington Laboratory of Developmental Biology, and epithelial lung buds were dissected as described below. All experiments were repeated using tissues from 3 individual lungs; 84 day post fertilization of unknown gender, 87 day post fertilization male, and 87 day post fertilization of unknown gender. All tissues were shipped in Belzer's solution at 4 degrees Celsius and were processed and in culture within 24 hours of isolation.
Cell Lines and Culture Conditions:
Mouse and Human Primary Cultures:
[0182] Isolated mouse buds were cultured in 4-6 l droplets of matrigel, covered with media, and kept at 37 degrees Celsius with 5% Carbon Dioxide. Isolated human fetal lung buds were cultured in 25-50 l droplets of matrigel, covered with media, and kept at 37 degrees Celsius with 5% Carbon Dioxide.
Generation and Culture of hPSC-Derived Lung Organoids:
[0183] The University of Michigan Human Pluripotent Stem Cell Research Oversight (hPSCRO) Committee approved all experiments using human embryonic stem cell (hESC) lines. hESC line UM63-1 (NIH registry #0277) was obtained from the University of Michigan and hESC line H9 (NIH registry #0062) was obtained from the WiCell Research Institute. ES cell lines were routinely karyotyped to ensure normal karyotype and ensure the sex of each line (H9-XX, UM63-1-XX). Cells are monitored for mycoplasma infection monthly using the MycoAlert Mycoplasma Detection Kit (Lonza). Stem cells were maintained on hESC-qualified Matrigel (Corning Cat#354277) using mTesR1 medium (Stem Cell Technologies). hESCs were maintained and passaged as previously described (Spence et al., 2011) and ventral foregut spheroids were generated as previously described (Dye et al., 2016a; 2015). Following differentiation, free-floating foregut spheroids were collected from differentiated stem cell cultures and plated in a matrigel droplet on a 24-well tissue culture grade plate.
Isolation and Culture of Mouse Lung Epithelial Buds
[0184] Mouse buds were dissected from E13.5 embryos. For experiments using Sox9CreER; Rosa.sup.Tomato/Tomato mice, 50 ug/g of tamoxifen was dissolved in corn oil and given by oral gavage on E12.5, 24 hours prior to dissection. Briefly, in sterile environment, whole lungs were placed in 100% dispase (Corning Cat#354235) on ice for 30 minutes. Lungs were then transferred using a 25 uL wiretrol tool (Drummond Scientific Cat#S5-000-2050) to 100% FBS (Corning Cat#35-010-CV) on ice for 15 minutes, and then transferred to a solution of Dulbecco's Modified Eagle Medium: Nutrient Mixture F12 (DMEM/F12, ThermoFisher SKU#12634-010) with 10% FBS and 1 Pennicillin-Streptomycin (ThermoFisher Cat#15140122) on ice. To dissect buds, a single lung or lung lobe was transferred by wiretrol within a droplet of media to a 100 mm sterile petri dish. Under a dissecting microscope, the mesenchyme was carefully removed and epithelial bud tips were torn away from the bronchial tree using tungsten needles (Point Technologies, Inc.). Care was taken to remove the trachea and any connective tissue from dissected lungs. Isolated bud tips were picked up using a p20 pipette and added to an eppendorf tube with cold Matrigel (Corning Ref#354248) on ice. The buds were picked up in a p20 pipette with 4-6 uL of Matrigel and plated on a 24-well tissue culture well (ThermoFisher Cat#142475). The plate was moved to a tissue culture incubator and incubated for 5 minutes at 37 degrees Celsius and 5% CO2 to allow the Matrigel droplet to solidify. 500 uL of media was then added to the dish in a laminar flow hood. Media was changed every 2-3 days.
Isolation and Culture of Human Fetal Lung Epithelial Buds
[0185] Distal regions of 12 week fetal lungs were cut into 2 mm sections and incubated with dispase, 100% FBS and then 10% FBS as described above, and moved to a sterile petri dish. Mesenchyme was removed by repeated pipetting of distal lung pieces after dispase treatment. Buds were washed with DMEM until mesenchymal cells were no longer visible in the media. Buds were then moved to a 1.5 mL eppendorf tube containing 200 uL of Matrigel, mixed using a p200 pipette, and plated in 20 uL droplets in a 24 well tissue culture plate. Plates were placed at 37 degrees Celsius with 5% CO2 for 20 minutes while droplets solidified. 500 uL of media was added to each well containing a droplet. Media was changed every 2-3 days.
EdU Quantification by Flow Cytometry
[0186] Epithelial lung buds were dissected from e13.5 CD1 mice and plated in a matrigel droplet as described above. 3-4 individual buds from one mouse were placed in each droplet and were pooled to serve as a single biological replicate. Three droplets (corresponding to 3 independent biological samples) were assigned to each experimental group, receiving either 1, 10, 50 or 100 ng/mL of FGF7 for 7 days. Media was changed every 2-3 days. Cells were incubated with EdU for 1 hour and stained with the Click-It EdU Alexa Fluor 488 system (ThermoFisher Cat# C10337) according to the manufacturer's instructions. As a control, wells that received 10 ng/mL of FGF7 for 7 days were taken through the EdU steps but were not stained were used to set the gates. For analysis, lung buds were broken into a single cell suspension. 1 mL of accutase (Sigma Cat# A6964) was added to a 15 mL conical tube containing pooled epithelial buds and cells were incubated at 37 degrees Celsius with frequent visual inspection until clumps of cells were no longer visible. 3 mL of basal media (see below) was added to each tube, and cells were centrifuged at 300 g for 5 minutes at 4 degrees Celsius. The supernatant was then withdrawn, and cells were resuspended with 1 mL sterile PBS, filtered through a 70 uM strainer to remove any cell clumps and transferred to a cell sorting tube. Flow cytometric analysis was performed on a BD FACSARIA III cell sorter (BD biosciences).
Culture Media, Growth Factors and Small Molecules
Low-Serum Basal Media
[0187] All mouse bud, human fetal bud, and hPSC-derived human lung organoids were grown in low-serum basal media (basal media) with added growth factors. Basal media consisted of Dulbecco's Modified Eagle Medium: Nutrient Mixture F12 (DMEM/F12, ThermoFisher SKU#12634-010) supplemented with 1 N2 supplement (ThermoFisher Catalog#17502048) and 1 B27 supplement (ThermoFisher Catalog#17504044), along with 2 mM Glutamax (ThermoFisher Catalog#35050061), 1 Pennicillin-Streptomycin (ThermoFisher Cat#15140122) and 0.05% Bovine Serum Albumin (BSA; Sigma product# A9647). BSA was weighed and dissolved in DMEM F/12 media before being passed through a SteriFlip 0.22 uM filter (Millipore Item# EW-29969-24) and being added to basal media. Media was stored at 4 degrees Celsius for up to 1 month. On the day of use, basal media was aliquoted and 50 ug/mL Ascorbic acid and 0.4 uM Monothioglycerol was added. Once ascorbic acid and monothioglycerol had been added, media was used within one week.
Growth Factors and Small Molecules
[0188] Recombinant Human Fibroblast Growth Factor 7 (FGF7) was obtained from R&D systems (R&D #251-KG/CF) and used at a concentration of 10 ng/mL unless otherwise noted. Recombinant Human Fibroblast Growth Factor 10 (FGF10) was obtained either from R&D systems (R&D #345-FG) or generated in house (see below), and used at a concentration of 10 ng/mL (low) or 500 ng/mL (high) unless otherwise noted. Recombinant Human Bone Morphogenic Protein 4 (BMP4) was purchased from R&D systems (R&D Catalog #314-BP) and used at a concentration of 10 ng/mL. All-trans Retinoic Acid (RA) was obtained from Stemgent (Stemgent Catalog#04-0021) and used at a concentration of 50 nM. CHIR-99021, a GSK3 inhibitor that stabilizes -CATENIN, was obtained from STEM CELL technologies (STEM CELL Technologies Catalog#72054) and used at a concentration of 3 uM. Y27632, a ROCK inhibitor (APExBIO Cat# A3008) was used at a concentration of 10 uM.
Generation and Isolation of Human Recombinant FGF10
[0189] Recombinant human FGF10 was produced in-house. The recombinant human FGF10 (rhFGF10) expression plasmid pET21d-FGF10 in E. coli strain BL21trxB(DE3) was a gift from James A. Bassuk at the University of Washington School of Medicine (Bagai et al., 2002). E. coli strain was grown in standard LB media with peptone derived from meat, carbenicillin and glucose. rhFGF10 expression was induced by addition of isopropyl-1-thio--D-galactopyranoside (IPTG). rhFGF10 was purified by using a HiTrap-Heparin HP column (GE Healthcare, 17040601) with step gradients of 0.5M to 2M LiCl. From a 200 ml culture, 3 mg of at least 98% pure rFGF-10 (evaluated by SDS-PAGE stained with Coomassie Blue R-250) was purified. rFGF10 was compared to commercially purchased human FGF10 (R&D Systems) to test/validate activity based on the ability to phosphorylate ERK1/2 in an A549 alveolar epithelial cell line (ATCC Cat#CCL-185) as assessed by western blot analysis.
RNA Extraction and Quantitative RT-PCR Analysis
[0190] RNA was extracted using the MagMAX-96 Total RNA Isolation System (Life Technologies). RNA quality and concentration was determined on a Nanodrop 2000 spectrophotometer (Thermo Scientific). 100 ng of RNA was used to generate a cDNA library using the SuperScript VILO cDNA master mix kit (Invitrogen) according to manufacturer's instructions. qRT-PCR analysis was conducted using Quantitect SYBR Green Master Mix (Qiagen) on a Step One Plus Real-Time PCR system (Life Technologies). Expression was calculated as a change relative to GAPDH expression using arbitrary units, which were calculated by the following equation: [2(GAPDH CtGene Ct)]10,000. A Ct value of 40 or greater was considered not detectable. A list of primer sequences used can be found in Table 1.
TABLE-US-00001 TABLE1 qRT-PCRprimersequences Gene SEQ SEQ Species Target ForwardPrimerSequence IDNO: ReversePrimerSequence IDNO: Mouse aqp5 TAGAAGATGGCTCGGAGCAG 1 CTGGGACCTGTGAGTGGTG 2 Mouse foxj1 TGTTCAAGGACAGGTTGTGG 3 GATCACTCTGTCGGCCATCT 4 Mouse gapdh TGTCAGCAATGCATCCTGCA 5 CCGTTCAGCTCTGGGATGAC 6 Mouse id2 AGAAAAGAAAAAGTCCCCAAATG 7 GTCCTTGCAGGCATCTGAAT 8 Mouse nmyc AGCACCTCCGGAGAGGATA 9 TCTCTACGGTGACCACATCG 10 Mouse p63 AGCTTCTTCAGTTCGGTGGA 11 CCTCCAACACAGATTACCCG 12 Mouse Scgb1a1 ACTTGAAGAAATCCTGGGCA 13 CAAAGCCTCCAACCTCTACC 14 Mouse sftp-b ACAGCCAGCACACCCTTG 15 TTCTCTGAGCAACAGCTCCC 16 Mouse sox2 AAAGCGTTAATTTGGATGGG 17 ACAAGAGAATTGGGAGGGGT 18 Mouse sox9 TCCACGAAGGGTCTCTTCTC 19 AGGAAGCTGGCAGACCAGTA 20 Human Foxj1 CAACTTCTGCTACTTCCGCC 21 CGAGGCACTTTGATGAAGC 22 Human gapdh AATGAAGGGGTCATTGATGG 23 AAGGTGAAGGTCGGAGTCAA 24 Human hopx GCCTTTCCGAGGAGGAGAC 25 TCTGTGACGGATCTGCACTC 26 Human id2 GACAGCAAAGCACTGTGTGG 27 TCAGCACTTAAAAGATTCCGTG 28 Human muc5ac* GCACCAACGACAGGAAGGATGAG 29 CACGTTCCAGAGCCGGACAT 30 Human nkx2.1 CTCATGTTCATGCCGCTC 31 GACACCATGAGGAACAGCG 32 Human nmyc CACAGTGACCACGTCGATTT 33 CACAAGGCCCTCAGTACCTC 34 Human p63 CCACAGTACACGAACCTGGG 35 CCGTTCTGAATCTGCTGGTCC 36 Human scgb1a1 ATGAAACTCGCTGTCACCCT 37 GTTTCGATGACACGCTGAAA 38 Human sftp-b CAGCACTTTAAAGGACGGTGT 39 GGGTGTGTGGGACCATGT 40 Human sox2 GCTTAGCCTCGTCGATGAAC 41 AACCCCAAGATGCACAACTC 42 Human sox9 GTACCCGCACTTGCACAAC 43 ATTCCACTTTGCGTTCAAGG 44 Human sp-c AGCAAAGAGGTCCTGATGGA 45 CGATAAGAAGGCGTTTCAGG 46 Note: All primer sequences were obtained from primerdepot.nci.nih.gov (human) or mouseprimerdepot.nci.nih.gov (mouse) unless otherwise noted. All annealing temperatures are near 60 C. *MUC5AC Huang, SX et al. Efficient generation of lung and airway epithelial cells from human pluripotent stem cells. Nature Biotechnol. 1-11 (2013). doi: 10.1038/nbt.2754
Tissue Preparation, Immunohistochemistry and Imaging
Paraffin Sectioning and Staining
[0191] Mouse bud, human bud, and HLO tissue was fixed in 4% Paraformaldehyde (Sigma) for 2 hours and rinsed in PBS overnight. Tissue was dehydrated in an alcohol series, with 30 minutes each in 25%, 50%, 75% Methanol:PBS/0.05% Tween-20, followed by 100% Methanol, and then 100% Ethanol. Tissue was processed into paraffin using an automated tissue processor (Leica ASP300). Paraffin blocks were sectioned 5-7 uM thick, and immunohistochemical staining was performed as previously described (Spence et al., 2009). A list of antibodies, antibody information and concentrations used can be found in Table 2. PAS Alcian blue staining was performed using the Newcomer supply Alcian Blue/PAS Stain kit (Newcomer Supply, Inc.) according to manufacturer's instructions.
TABLE-US-00002 TABLE 2 Antibody information Dilution Dilution (Whole Primary Antibody Source Catalog # Used for Species (Sections) mount) Clone Goat anti-CC10 (SCGB1A1) Santa Cruz sc-9770 Mouse, Human 1:200 C-20 Biotechnology Goat anti-SOX2 Santa Cruz Sc-17320 Mouse, Human 1:200 1:100 polyclonal Biotechnology Mouse anti-Acetylated Sigma-Aldrich T7451 Mouse, Human 1:1000 6-11B-1 Tubulin (ACTTUB) Mouse anti-E-Cadherin BD Transduction 610181 Mouse, Human 1:500 36/E- (ECAD) Labratories Cadherin Mouse anti-Surfactant Protein Seven Hills Wmab-1B9 Mouse, Human 1:250 monoclonal B (SP-B) Bioreagents Rabbit anti-Aquaporin 5 Abcam Ab78486 Mouse 1:500 polyclonal (Aqp5) Rabbit anti-Clara Cell Seven Hills Wrab-3950 Mouse, Human 1:250 polyclonal Secretory Protein (CCSP; Bioreagents SCGB1A1) Rabbit anti-HOPX Santa Cruz Sc-30216 Human 1:250 polyclonal Biotechnology Rabbit anti-NKX2.1 Abcam ab76013 Human 1:200 EP1584Y Rabbit anti-PDPN Santa Cruz Sc-134482 Human 1:500 polyclonal Biotechnology Rabbit anti-Pro-Surfactant Seven Hills Wrab-9337 Human, Mouse 1:500 polyclonal protein C (Pro-SPC) Bioreagents Rabbit anti-P63 Santa Cruz sc-8344 Mouse, Human 1:200 H-129 Biotechnology Rabbit anti-SOX9 Millipore AB5535 Mouse, Human 1:500 1:250 polyclonal Rat anti-Ki67 Biolegend 652402 Mouse 1:100 16A8 *Biotin-Mouse anti MUC5AC Abcam ab79082 Human 1:500 Monoclonal Secondary Antibody Source Catalog # Dilution Donkey anti-goat 488 Jackson Immuno 705-545-147 1:500 Donkey anti-goat 647 Jackson Immuno 705-605-147 1:500 Donkey anti-goat Cy3 Jackson Immuno 705-165-147 1:500 Donkey anti-mouse 488 Jackson Immuno 715-545-150 1:500 Donkey anti-mouse 647 Jackson Immuno 415-605-350 1:500 Donkey anti-mouse Cy3 Jackson Immuno 715-165-150 1:500 Donkey anti-rabbit 488 Jackson Immuno 711-545-152 1:500 Donkey anti-rabbit 647 Jackson Immuno 711-605-152 1:500 Donkey anti-rabbit Cy3 Jackson Immuno 711-165-102 1:500 Donkey anti-goat 488 Jackson Immuno 705-545-147 1:500 Donkey anti-goat 647 Jackson Immuno 705-605-147 1:500 Donkey anti-goat Cy3 Jackson Immuno 705-165-147 1:500 Donkey anti-mouse 488 Jackson Immuno 715-545-150 1:500 Donkey anti-mouse 647 Jackson Immuno 415-605-850 1:500 Donkey anti-mouse Cy3 Jackson Immuno 715-165-150 1:500 Donkey anti-rabbit 488 Jackson Immuno 711-545-152 1:500 Donkey anti-rabbit 647 Jackson Immuno 711-605-152 1:500 Donkey anti-rabbit Cy3 Jackson Immuno 711-165-102 1:500 Streptavidin 488 Jackson Immuno 016-540-084 1:500
Whole Mount Staining
[0192] For whole mount staining tissue was placed in a 1.5 mL eppendorf tube and fixed in 4% paraformaldehyde (Sigma) for 30 minutes. Tissue was then washed with PBS/0.05% Tween-20 (Sigma) for 5 hours, followed by a 2.5-hour incubation with blocking serum (PBS-Tween-20 plus 5% normal donkey serum). Primary antibodies were added to blocking serum and tissue was incubated for at least 24 hours at 4 degrees Celcius. Tissue was then washed for 5 hours with several changes of fresh PBS-Tween-20. Secondary antibodies were added to fresh blocking solution and tissue was incubated for 12-24 hours, followed by 5 hours of PBS-Tween-20 washes. Tissue was then dehydrated to 100% methanol and carefully moved to the center of a single-well EISCO concave microscope slide (ThermoFisher Cat#S99368) using a glass transfer pipette. 5-7 drops of Murray's clear (2 parts Benzyl alcohol, 1 part Benzyl benzoate [Sigma]) were added to the center of the slide, and slides were coverslipped and sealed with clear nail polish.
Imaging and Image Processing
[0193] Images of fluorescently stained slides were taken on a Nikon A-1 confocal microscope. When comparing groups within a single experiment, exposure times and laser power were kept consistent across all images. All Z-stack imaging was done on a Nikon A-1 confocal microscope and Z-stacks were 3-D rendered using Imaris software. Brightness and contrast adjustments were carried out using Adobe Photoshop Creative Suite 6 and adjustments were made uniformly among all images.
[0194] Brightfield images of live cultures were taken using an Olympus S216 dissecting microscope. Image brightness and contrast was enhanced equally for all images within a single experiment using Adobe Photoshop. Images were cropped where noted in figure legends to remove blank space surrounding buds or cultures. Brightfield images of Alcian Blue stains were taken using an Olympus DP72 inverted microscope.
Quantification and Statistical Analysis
[0195] All plots and statistical analysis were done using Prism 6 Software (GraphPad Software, Inc.). For statistical analysis of qRT-PCR results, at least 3 biological replicates for each experimental group were analyzed and plotted with the standard error of the mean. If only two groups were being compared, a two-sided student's T-test was performed. In assessing the effect of length of culture with FGF7 on gene expression in mouse buds (
Example XI
[0196] This example demonstrates that iPSC-derived lung organoids can engraft into a mouse lung (see,
[0197] Having now fully described the invention, it will be understood by those of skill in the art that the same can be performed within a wide and equivalent range of conditions, formulations, and other parameters without affecting the scope of the invention or any embodiment thereof. All patents, patent applications and publications cited herein are fully incorporated by reference herein in their entirety.
INCORPORATION BY REFERENCE
[0198] The entire disclosure of each of the patent documents and scientific articles referred to herein is incorporated by reference for all purposes.
[0199] Complete citations for the references cited within the application are provided within the following reference list. Indeed, each of the following references are herein incorporated by reference in their entireties: [0200] Abler, L. L., Mansour, S. L., Sun, X., 2009. Conditional gene inactivation reveals roles for Fgf10 and Fgfr2 in establishing a normal pattern of epithelial branching in the mouse lung. Dev. Dyn. 238, 1999-2013. doi:10.1002/dvdy.22032 [0201] Bagai, S., Rubio, E., Cheng, J.-F., Sweet, R., Thomas, R., Fuchs, E., Grady, R., Mitchell, M., Bassuk, J. A., 2002. Fibroblast growth factor-10 is a mitogen for urothelial cells. J. Biol. Chem. 277, 23828-23837. doi:10.1074/jbc.M201658200 [0202] Bellusci, S., Furuta, Y., Rush, M. G., Henderson, R., Winnier, G., Hogan, B. L., 1997a. Involvement of Sonic hedgehog (Shh) in mouse embryonic lung growth and morphogenesis. Development 124, 53-63. [0203] Bellusci, S., Grindley, J., Emoto, H., Itoh, N., Hogan, B. L., 1997b. Fibroblast growth factor 10 (FGF10) and branching morphogenesis in the embryonic mouse lung. Development 124, 4867-4878. [0204] Bellusci, S., Henderson, R., Winnier, G., Oikawa, T., Hogan, B. L., 1996. Evidence from normal expression and targeted misexpression that bone morphogenetic protein (Bmp-4) plays a role in mouse embryonic lung morphogenesis. Development 122, 1693-1702. [0205] Branchfield, K., Li, R., Lungova, V., Verheyden, J. M., McCulley, D., Sun, X., 2015. A three-dimensional study of alveologenesis in mouse lung. Developmental Biology. doi:10.1016/j.ydbio.2015.11.017 [0206] Cardoso, W. V., Itoh, A., Nogawa, H., Mason, I., Brody, J. S., 1997. FGF-1 and FGF-7 induce distinct patterns of growth and differentiation in embryonic lung epithelium. Dev. Dyn. 208, 398-405. doi:10.1002/(SICI)1097-0177(199703)208:3<398::AID-AJA10>3.0.CO; 2-X [0207] Chang, D. R., Martinez Alanis, D., Miller, R. K., Ji, H., Akiyama, H., McCrea, P. D., Chen, J., 2013. Lung epithelial branching program antagonizes alveolar differentiation. Proceedings of the National Academy of Sciences. doi:10.1073/pnas.1311760110 [0208] Chen, F., Cao, Y., Qian, J., Shao, F., Niederreither, K., Cardoso, W. V., 2010. A retinoic acid-dependent network in the foregut controls formation of the mouse lung primordium. J. Clin. Invest. 120, 2040-2048. doi:10.1172/JCI40253 [0209] Cornett, B., Snowball, J., Varisco, B. M., Lang, R., Whitsett, J., Sinner, D., 2013. Wntless is required for peripheral lung differentiation and pulmonary vascular development. Developmental Biology 379, 38-52. doi:10.1016/j.ydbio.2013.03.010 [0210] D'Amour, K. A., Agulnick, A. D., Eliazer, S., Kelly, O. G., Kroon, E., Baetge, E. E., 2005. Efficient differentiation of human embryonic stem cells to definitive endoderm. Nat Biotechnol 23, 1534-1541. doi:10.1038/nbt1163 [0211] del Moral, P.-M., Warburton, D., 2010. Explant culture of mouse embryonic whole lung, isolated epithelium, or mesenchyme under chemically defined conditions as a system to evaluate the molecular mechanism of branching morphogenesis and cellular differentiation. Methods Mol. Biol. 633, 71-79. doi:10.1007/978-1-59745-019-5_5 [0212] Desai, T. J., Chen, F., Lu, J., Qian, J., Niederreither, K., Done, P., Chambon, P., Cardoso, W. V., 2006. Distinct roles for retinoic acid receptors alpha and beta in early lung morphogenesis. Developmental Biology 291, 12-24. doi:10.1016/j.ydbio.2005.10.045 [0213] Desai, T. J., Malpel, S., Flentke, G. R., Smith, S. M., Cardoso, W. V., 2004. Retinoic acid selectively regulates Fgf10 expression and maintains cell identity in the prospective lung field of the developing foregut. Developmental Biology 273, 402-415. doi:10.1016/j.ydbio.2004.04.039 [0214] Domyan, E. T., Ferretti, E., Throckmorton, K., Mishina, Y., Nicolis, S. K., Sun, X., 2011. Signaling through BMP receptors promotes respiratory identity in the foregut via repression of Sox2. Development 138, 971-981. doi:10.1242/dev.053694 [0215] Domyan, E. T., Sun, X., 2010. Patterning and plasticity in development of the respiratory lineage. Dev. Dyn. 240, 477-485. doi:10.1002/dvdy.22504 [0216] Dye, B. R., Dedhia, P. H., Miller, A. J., Nagy, M. S., White, E. S., Shea, L. D., Spence, J. R., Rossant, J., 2016a. A bioengineered niche promotes in vivo engraftment and maturation of pluripotent stem cell derived human lung organoids. Elife 5, e19732. doi:10.7554/eLife.19732 [0217] Dye, B. R., Hill, D. R., Ferguson, M. A., Tsai, Y.-H., Nagy, M. S., Dyal, R., Wells, J. M., Mayhew, C. N., Nattiv, R., Klein, O. D., White, E. S., Deutsch, G. H., Spence, J. R., 2015. In vitro generation of human pluripotent stem cell derived lung organoids. Elife 4. doi:10.7554/eLife.05098 [0218] Dye, B. R., Miller, A. J., Spence, J. R., 2016b. How to Grow a Lung: Applying Principles of Developmental Biology to Generate Lung Lineages from Human Pluripotent Stem Cells. Curr Pathobiol Rep 1-11. doi:10.1007/s40139-016-0102-x [0219] Elluru, R. G., Whitsett, J. A., 2004. Potential role of Sox9 in patterning tracheal cartilage ring formation in an embryonic mouse model. Arch. Otolaryngol. Head Neck Surg. 130, 732-736. doi:10.1001/archoto1.130.6.732 [0220] Firth, A. L., Dargitz, C. T., Qualls, S. J., Menon, T., Wright, R., Singer, O., Gage, F. H., Khanna, A., Verma, I. M., 2014. Generation of multiciliated cells in functional airway epithelia from human induced pluripotent stem cells. Proceedings of the National Academy of Sciences 111, E1723-30. doi:10.1073/pnas.1403470111 [0221] Ghaedi, M., Calle, E. A., Mendez, J. J., Gard, A. L., Balestrini, J., Booth, A., Bove, P. F., Gui, L., White, E. S., Niklason, L. E., 2013. Human iPS cell-derived alveolar epithelium repopulates lung extracellular matrix. J. Clin. Invest. 123, 4950-4962. doi:10.1172/JCI68793 [0222] Gilpin, S. E., Ren, X., Okamoto, T., Guyette, J. P., Mou, H., Rajagopal, J., Mathisen, D. J., Vacanti, J. P., Ott, H. C., 2014a. Enhanced lung epithelial specification of human induced pluripotent stem cells on decellularized lung matrix. Ann. Thorac. Surg. 98, 1721-9-discussion 1729. doi:10.1016/j.athoracsur.2014.05.080 [0223] Gilpin, S. E., Ren, X., Okamoto, T., Guyette, J. P., Mou, H., Rajagopal, J., Mathisen, D. J., Vacanti, J. P., Ott, H. C., 2014b. Enhanced Lung Epithelial Specification of Human Induced Pluripotent Stem Cells on Decellularized Lung Matrix. Ann. Thorac. Surg. 98, 1721-1729. [0224] Goss, A. M., Tian, Y., Tsukiyama, T., Cohen, E. D., Zhou, D., Lu, M. M., Yamaguchi, T. P., Morrisey, E. E., 2009. Wnt2/2b and β-Catenin Signaling Are Necessary and Sufficient to Specify Lung Progenitors in the Foregut. Developmental Cell 17, 290-298. doi:10.1016/j.devce1.2009.06.005 [0225] Gotoh, S., Ito, I., Nagasaki, T., Yamamoto, Y., Konishi, S., Korogi, Y., Matsumoto, H., Muro, S., Hirai, T., Funato, M., Mae, S.-I., Toyoda, T., Sato-Otsubo, A., Ogawa, S., Osafune, K., Mishima, M., 2014. Generation of alveolar epithelial spheroids via isolated progenitor cells from human pluripotent stem cells. Stem Cell Reports 3, 394-403. doi:10.1016/j.stemcr.2014.07.005 [0226] Green, M. D., Chen, A., Nostro, M.-C., d'Souza, S. L., Schaniel, C., Lemischka, I. R., Gouon-Evans, V., Keller, G., Snoeck, H.-W., 2011. Generation of anterior foregut endoderm from human embryonic and induced pluripotent stem cells. Nat Biotechnol 1-7. doi:10.1038/nbt.1788 [0227] Harris-Johnson, K. S., Domyan, E. T., Vezina, C. M., Sun, X., 2009. beta-Catenin promotes respiratory progenitor identity in mouse foregut. Proceedings of the National Academy of Sciences 106, 16287-16292. doi:10.1073/pnas.0902274106 [0228] Hashimoto, S., Chen, H., Que, J., Brockway, B. L., Drake, J. A., Snyder, J. C., Randell, S. H., Stripp, B. R., 2012. -Catenin-SOX2 signaling regulates the fate of developing airway epithelium. Journal of Cell Science 125, 932-942. doi:10.1242/jcs.092734 [0229] Herriges, J. C., Verheyden, J. M., Zhang, Z., Sui, P., Zhang, Y., Anderson, M. J., Swing, D. A., Zhang, Y., Lewandoski, M., Sun, X., 2015. FGF-Regulated ETV Transcription Factors Control FGF-SHH Feedback Loop in Lung Branching. Developmental Cell 35, 322-332. doi:10.1016/j.devce1.2015.10.006 [0230] Hines, E. A., Sun, X., 2014. Tissue crosstalk in lung development. J Cell Biochem 115, 1469-1477. doi:10.1002/jcb.24811 [0231] Huang, S. X. L., Islam, M. N., O'Neill, J., Hu, Z., Yang, Y.-G., Chen, Y.-W., Mumau, M., Green, M. D., Vunjak-Novakovic, G., Bhattacharya, J., Snoeck, H.-W., 2013. efficient generation of lung and airway epithelial cells from human pluripotent stem cells. Nat Biotechnol 1-11. doi:10.1038/nbt.2754 [0232] Kaarteenaho, R., Lappi-Blanco, E., Lehtonen, S., 2010. Epithelial N-cadherin and nuclear -catenin are up-regulated during early development of human lung. BMC Dev Biol 10, 113. doi:10.1186/1471-213X-10-113 [0233] Kadzik, R. S., Cohen, E. D., Morley, M. P., Stewart, K. M., Lu, M. M., Morrisey, E. E., 2014. Wnt ligand/Frizzled 2 receptor signaling regulates tube shape and branch-point formation in the lung through control of epithelial cell shape. Proceedings of the National Academy of Sciences 111, 12444-12449. doi:10.1073/pnas.1406639111 [0234] Kim, C. F. B., Jackson, E. L., Woolfenden, A. E., Lawrence, S., Babar, I., Vogel, S., Crowley, D., Bronson, R. T., Jacks, T., 2005. Identification of bronchioalveolar stem cells in normal lung and lung cancer. Cell 121, 823-835. doi:10.1016/j.ce11.2005.03.032 [0235] Kim, H. Y., Nelson, C. M., 2012. Extracellular matrix and cytoskeletal dynamics during branching morphogenesis. Organogenesis 8, 56-64. doi:10.4161/org.19813 [0236] Konishi, S., Gotoh, S., Tateishi, K., Yamamoto, Y., Korogi, Y., Nagasaki, T., Matsumoto, H., Muro, S., Hirai, T., Ito, I., Tsukita, S., Mishima, M., 2015. Directed Induction of Functional Multi-ciliated Cells in Proximal Airway Epithelial Spheroids from Human Pluripotent Stem Cells. Stem Cell Reports 0. doi:10.1016/j.stemcr.2015.11.010 [0237] Kopp, J. L., Dubois, C. L., Schaffer, A. E., Hao, E., Shih, H. P., Seymour, P. A., Ma, J., Sander, M., 2011. Sox9+ ductal cells are multipotent progenitors throughout development but do not produce new endocrine cells in the normal or injured adult pancreas. Development 138, 653-665. doi:10.1242/dev.056499 [0238] Lange, A. W., Sridharan, A., Xu, Y., Stripp, B. R., Perl, A.-K., Whitsett, J. A., 2015. Hippo/Yap signaling controls epithelial progenitor cell proliferation and differentiation in the embryonic and adult lung. Journal of Molecular Cell Biology 7, 35-47. doi:10.1093/jmcb/mju046 [0239] Lee, J.-H., Bhang, D. H., Beede, A., Huang, T. L., Stripp, B. R., Bloch, K. D., Wagers, A. J., Tseng, Y.-H., Ryeom, S., Kim, C. F., 2014. Lung Stem Cell Differentiation in Mice Directed by Endothelial Cells via a BMP4-NFATc1-Thrombospondin-1 Axis. Cell 156, 440-455. doi:10.1016/j.ce11.2013.12.039 [0240] Longmire, T. A., Ikonomou, L., Hawkins, F., Christodoulou, C., Cao, Y., Jean, J. C., Kwok, L. W., Mou, H., Rajagopal, J., Shen, S. S., Dowton, A. A., Serra, M., Weiss, D. J., Green, M. D., Snoeck, H.-W., Ramirez, M. I., Kotton, D. N., 2012. Efficient derivation of purified lung and thyroid progenitors from embryonic stem cells. Cell Stem Cell 10, 398-411. doi:10.1016/j.stem.2012.01.019 [0241] Lu, B. C., Cebrian, C., Chi, X., Kuure, S., Kuo, R., Bates, C. M., Arber, S., Hassell, J., MacNeil, L., Hoshi, M., Jain, S., Asai, N., Takahashi, M., Schmidt-Ott, K. M., Barasch, J., D'Agati, V., Costantini, F., 2009. Etv4 and Etv5 are required downstream of GDNF and Ret for kidney branching morphogenesis. Nat Genet 41, 1295-1302. doi:10.1038/ng.476 [0242] Mahoney, J. E., Mori, M., Szymaniak, A. D., Varelas, X., Cardoso, W. V., 2014. The Hippo Pathway Effector Yap Controls Patterning and Differentiation of Airway Epithelial Progenitors. Dev. Cell 1-14. doi:10.1016/j.devce1.2014.06.003 [0243] Makarenkova, H. P., Hoffman, M. P., Beenken, A., Eliseenkova, A. V., Meech, R., Tsau, C., Patel, V. N., Lang, R. A., Mohammadi, M., 2009. Differential interactions of FGFs with heparan sulfate control gradient formation and branching morphogenesis. Sci Signal 2, ra55-ra55. doi:10.1126/scisignal.2000304 [0244] Malpel, S., Mendelsohn, C., Cardoso, W. V., 2000. Regulation of retinoic acid signaling during lung morphogenesis. Development 127, 3057-3067. Metzger, R. J., Klein, O. D., Martin, G. R., Krasnow, M. A., 2008. The branching programme of mouse lung development. Nature 453, 745-750. doi:10.1038/nature07005 [0245] Min, H., Danilenko, D. M., Scully, S. A., Bolon, B., Ring, B. D., Tarpley, J. E., DeRose, M., Simonet, W. S., 1998. Fgf-10 is required for both limb and lung development and exhibits striking functional similarity to Drosophila branchless. Genes & Development 12, 3156-3161. [0246] Moens, C. B., Auerbach, A. B., Conlon, R. A., Joyner, A. L., Rossant, J., 1992. A targeted mutation reveals a role for N-myc in branching morphogenesis in the embryonic mouse lung. Genes Dev. 6, 691-704. doi:10.1101/gad.6.5.691 [0247] Morrisey, E. E., Cardoso, W. V., Lane, R. H., Rabinovitch, M., Abman, S. H., Ai, X., Albertine, K. H., Bland, R. D., Chapman, H. A., Checkley, W., Epstein, J. A., Kintner, C. R., Kumar, M., Minoo, P., Mariani, T. J., McDonald, D. M., Mukouyama, Y.-S., Prince, L. S., Reese, J., Rossant, J., Shi, W., Sun, X., Werb, Z., Whitsett, J. A., Gail, D., Blaisdell, C. J., Lin, Q. S., 2013. Molecular determinants of lung development. Ann Am Thorac Soc 10, S12-6. doi:10.1513/AnnalsATS.201207-036OT [0248] Morrisey, E. E., Hogan, B. L. M., 2010. Preparing for the First Breath: Genetic and Cellular Mechanisms in Lung Development. Developmental Cell 18, 8-23. doi:10.1016/j.devce1.2009.12.010 [0249] Motoyama, J., Liu, J., Mo, R., Ding, Q., Post, M., Hui, C. C., 1998. Essential function of Gli2 and Gli3 in the formation of lung, trachea and oesophagus. Nat Genet 20, 54-57. doi:10.1038/1711 [0250] Mou, H., Zhao, R., Sherwood, R., Ahfeldt, T., Lapey, A., Wain, J., Sicilian, L., Izvolsky, K., Musunuru, K., Cowan, C., Rajagopal, J., 2012. Generation of Multipotent Lung and Airway Progenitors from Mouse ESCs and Patient-Specific Cystic Fibrosis iPSCs. Cell Stem Cell 10, 385-397. doi:10.1016/j.stem.2012.01.018 [0251] Mucenski, M. L., Nation, J. M., Thitoff, A. R., Besnard, V., Xu, Y., Wert, S. E., Harada, N., Taketo, M. M., Stahlman, M. T., Whitsett, J. A., 2005. -Catenin regulates differentiation of respiratory epithelial cells in vivo. [0252] Mucenski, M. L., Wert, S. E., Nation, J. M., Loudy, D. E., Huelsken, J., Birchmeier, W., Morrisey, E. E., Whitsett, J. A., 2003. beta-Catenin is required for specification of proximal/distal cell fate during lung morphogenesis. J. Biol. Chem. 278, 40231-40238. doi:10.1074/jbc.M305892200 [0253] Nyeng, P., Norgaard, G. A., Kobberup, S., Jensen, J., 2008. FGF10 maintains distal lung bud epithelium and excessive signaling leads to progenitor state arrest, distalization, and goblet cell metaplasia. BMC Dev Biol 8, 2. doi:10.1186/1471-213X-8-2 [0254] Okubo, T., Knoepfler, P. S., Eisenman, R. N., Hogan, B. L. M., 2005. Nmyc plays an essential role during lung development as a dosage-sensitive regulator of progenitor cell proliferation and differentiation. Development 132, 1363-1374. doi:10.1242/dev.01678 [0255] Ornitz, D. M., Xu, J., Colvin, J. S., McEwen, D. G., MacArthur, C. A., Coulier, F., Gao, G., Goldfarb, M., 1996. Receptor specificity of the fibroblast growth factor family. J. Biol. Chem. 271, 15292-15297. doi:10.1074/jbc.271.25.15292 [0256] Ornitz, D. M., Yin, Y., 2012. Signaling Networks Regulating Development of the Lower Respiratory Tract. Cold Spring Harb Perspect Biol 4, a008318-a008318. doi:10.1101/cshperspect.a008318 [0257] Perl, A.-K. T., Kist, R., Shan, Z., Scherer, G., Whitsett, J. A., 2005. Normal lung development and function after Sox9 inactivation in the respiratory epithelium. genesis 41, 23-32. doi:10.1002/gene.20093 [0258] Que, J., Okubo, T., Goldenring, J. R., Nam, K. T., Kurotani, R., Morrisey, E. E., Taranova, O., Pevny, L. H., Hogan, B. L. M., 2007. Multiple dose-dependent roles for Sox2 in the patterning and differentiation of anterior foregut endoderm. Development 134, 2521-2531. doi:10.1242/dev.003855 [0259] Rawlins, E. L., 2010. The building blocks of mammalian lung development. Dev. Dyn. 240, 463-476. doi:10.1002/dvdy.22482 [0260] Rawlins, E. L., Clark, C. P., Xue, Y., Hogan, B. L. M., 2009. The Id2+ distal tip lung epithelium contains individual multipotent embryonic progenitor cells. Development 136, 3741-3745. doi:10.1242/dev.037317 [0261] Rock, J. R., Hogan, B. L. M., 2011. Epithelial Progenitor Cells in Lung Development, Maintenance, Repair, and Disease. Annu. Rev. Cell Dev. Biol. 27, 493-512. doi:10.1146/annurev-cellbio-100109-104040 [0262] Rockich, B. E., Hrycaj, S. M., Shih, H.-P., Nagy, M. S., Ferguson, M. A. H., Kopp, J. L., Sander, M., Wellik, D. M., Spence, J. R., 2013. Sox9 plays multiple roles in the lung epithelium during branching morphogenesis. Proceedings of the National Academy of Sciences. doi:10.1073/pnas.1311847110 [0263] Sekine, K., Ohuchi, H., Fujiwara, M., Yamasaki, M., Yoshizawa, T., Sato, T., Yagishita, N., Matsui, D., Koga, Y., Itoh, N., Kato, S., 1999. Fgf10 is essential for limb and lung formation. Nat Genet 21, 138-141. doi:10.1038/5096 [0264] Shu, W., Guttentag, S., Wang, Z., Andl, T., Ballard, P., Lu, M. M., Piccolo, S., Birchmeier, W., Whitsett, J. A., Millar, S. E., Morrisey, E. E., 2005. Wnt/beta-catenin signaling acts upstream of N-myc, BMP4, and FGF signaling to regulate proximal-distal patterning in the lung. Dev Biol 283, 226-239. [0265] Spence, J. R., Lange, A. W., Lin, S.-C. J., Kaestner, K. H., Lowy, A. M., Kim, I., Whitsett, J. A., Wells, J. M., 2009. Sox17 Regulates Organ Lineage Segregation of Ventral Foregut Progenitor Cells. Developmental Cell 17, 62-74. doi:10.1016/j.devce1.2009.05.012 [0266] Spence, J. R., Mayhew, C. N., Rankin, S. A., Kuhar, M. F., Vallance, J. E., Tolle, K., Hoskins, E. E., Kalinichenko, V. V., Wells, S. I., Zorn, A. M., Shroyer, N. F., Wells, J. M., 2011. Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro. Nature 470, 105-109. doi:10.1038/nature09691 [0267] Tichelaar, J. W., Lu, W., Whitsett, J. A., 2000. Conditional expression of fibroblast growth factor-7 in the developing and mature lung. Journal of Biological Chemistry. doi:10.1074/jbc.275.16.11858 [0268] Varner, V. D., Nelson, C. M., 2014. Cellular and physical mechanisms of branching morphogenesis. Development 141, 2750-2759. doi:10.1242/dev.104794 [0269] Volckaert, T., Campbell, A., Dill, E., Li, C., Minoo, P., De Langhe, S., 2013. Localized Fgf10 expression is not required for lung branching morphogenesis but prevents differentiation of epithelial progenitors. Development 140, 3731-3742. doi:10.1242/dev.096560 [0270] Weaver, M., Dunn, N. R., Hogan, B. L., 2000. Bmp4 and Fgf10 play opposing roles during lung bud morphogenesis. Development 127, 2695-2704. Weaver, M., Yingling, J. M., Dunn, N. R., Bellusci, S., Hogan, B. L., 1999. Bmp signaling regulates proximal-distal differentiation of endoderm in mouse lung development. Development 126, 4005-4015. [0271] White, A. C., Xu, J., Yin, Y., Smith, C., Schmid, G., Ornitz, D. M., 2006. FGF9 and SHH signaling coordinate lung growth and development through regulation of distinct mesenchymal domains. Development 133, 1507-1517. doi:10.1242/dev.02313 [0272] Wong, A. P., Bear, C. E., Chin, S., Pasceri, P., Thompson, T. O., Huan, L.-J., Ratjen, F., Ellis, J., Rossant, J., 2012. Directed differentiation of human pluripotent stem cells into mature airway epithelia expressing functional CFTR protein. Nat Biotechnol. doi:10.1038/nbt.2328 [0273] Yin, Y., Wang, F., Ornitz, D. M., 2011. Mesothelial- and epithelial-derived FGF9 have distinct functions in the regulation of lung development. Development 138, 3169-3177. doi:10.1242/dev.065110 [0274] Yin, Y., White, A. C., Huh, S.-H., Hilton, M. J., Kanazawa, H., Long, F., Ornitz, D. M., 2008. An FGF-WNT gene regulatory network controls lung mesenchyme development. Developmental Biology 319, 426-436. doi:10.1016/j.ydbio.2008.04.009 [0275] Zhang, M., Wang, H., Teng, H., Shi, J., Zhang, Y., 2010. Expression of SHH signaling pathway components in the developing human lung. Histochem. Cell Biol. 134, 327-335. doi:10.1007/s00418-010-0738-2 [0276] Zhang, X., Ibrahimi, O. A., Olsen, S. K., Umemori, H., Mohammadi, M., Ornitz, D. M., 2006. Receptor specificity of the fibroblast growth factor family. The complete mammalian FGF family. J. Biol. Chem. 281, 15694-15700. doi:10.1074/jbc.M601252200 [0277] Zhang, Y., Yokoyama, S., Herriges, J. C., Zhang, Z., Young, R. E., Verheyden, J. M., Sun, X., 2016. E3 ubiquitin ligase RFWD2 controls lung branching through protein-level regulation of ETV transcription factors. Proceedings of the National Academy of Sciences 201603310. doi:10.1073/pnas.1603310113 [0278] Zhao, R., Fallon, T. R., Saladi, S. V., Pardo-Saganta, A., Villoria, J., Mou, H., Vinarsky, V., Gonzalez-Celeiro, M., Nunna, N., Hariri, L. P., Camargo, F., Ellisen, L. W., Rajagopal, J., 2014. Yap tunes airway epithelial size and architecture by regulating the identity, maintenance, and self-renewal of stem cells. Developmental Cell 30, 151-165. doi:10.1016/j.devce1.2014.06.004.
EQUIVALENTS
[0279] The invention may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. The foregoing embodiments are therefore to be considered in all respects illustrative rather than limiting the invention described herein. Scope of the invention is thus indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.